WO2010081204A2

WO2010081204A2 - Activators of the autophagic pathway

Info

Publication number: WO2010081204A2
Application number: PCT/BE2010/000002
Authority: WO
Inventors: Joris Winderickx; Tobias Eisenberg; Guido Kroemer; Frank Madeo; Nadege Minois; Patrick Rockenfeller
Original assignee: Katholieke Universiteit Leuven
Priority date: 2009-01-14
Filing date: 2010-01-14
Publication date: 2010-07-22
Also published as: WO2010081204A3

Abstract

A polyamine compound of the group consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1, 4 -butanediamine N- (3 -aminopropyl) -monohydrochloride or derivatives thereof or combinations thereof which are effective to activate the cellularautophagic pathway for use in a treatment to increase the survivability, lifespan or the life expectancy of an invertebrate animal/poikilotherm invertebrate animal, or to increase the average lifespan of a population of such invertebrate animals.

Description

Activators of the autophagic pathway

Background and Summary BACKGROUND OF THE INVENTION

A. Field of the Invention

The present invention relates generally to polyamine compounds for use in a treatment to activate or reinstate a normal autophagic pathway and furthermore the present invention relates to induction of deacetylation or induction or maintaining of a condition of hypoacetylation of histone H3. Suitable polyamine compounds to activate the autophagic pathway and to induce histone H3 hypoacetylation are the polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof. Moreover the present invention concerns a combined effect of inducing deacetylation of histone H3 in cells and activating the autophagic pathway to protect a cell, tissue or organism of an autophagy disruption disorder or of intracellular protein deposition or protein aggregation. Various protein deposition diseases could finally result in organ failure.

B. Description of the Related Art

Present invention concerns compositions for use in autophagy disruption or weakening disorder such as incapacity of the innate and adaptive immunity mechanism to remove intracellular parasites and autophagy related intracellular protein aggregation disorders. Thus, there is a strong need in the art to prevent or treat infection of cells, tissues and organisms by bacterial, parasitic and viral microorganisms and to treat protein aggregation disorders.

The treatment is carried out by polyamine compounds for instance the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1 ,4-butanediamine

N-(3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof in treatment of an autophagy depletion disorder. Spermidine or N-(3- aminopropyl)tetramethylenediamine is present in virtually all bodily fluids (semen, blood, saliva, tears and milk). It was subsequently also found in many foods of both animal origin (e.g. meat, fish (e.g. fermented anchovies), eggs, milk and cheese) and plant origin (e.g. fruit and vegetables (e.g. fermented soy)). It is of particularly high concentration in human milk (on average about 600 micrograms in milk over 24 hours), where it plays an important role for the newborn. Specifically, in the newborn, the mucosae of the digestive tract are not fully formed and spermidine, taken up with the milk, promotes the growth of the epithelium of the gastric and intestinal mucosa. Various cholesteryl spermine or cholesteryl spermidine compounds including cholesteryl spermine carbamates and combinations thereof are taught e.g. in US Patents 5,837,533; 6,127,170; 6,379,965; 5,650,096; and 5,783,565; and US 2006/0084617, published 20- Apr- 2006. Such polyamines may be manufactured by conventional techniques, e.g. solid state polypeptide production followed by amidation and reduction. It is particularly preferred to use naturally occurring polyamines, e.g. putrescine (H₂N(CH₂)4NH₂), cadaverine (H₂N(CH₂)5NH₂), spermidine (H₂N(CH₂)3NH(CH₂)4NH₂), and spermine (H₂N(CH₂)3NH(CH)₄ NH(CH₂)3NH₂), more particularly putrescine, spermidine or spermine, and especially spermine. It had already been demonstrated that these compounds putrescine, spermidine or spermine (Kobayashi, M. et al Biological & Pharmaceutical Bulletin, 26 (3): 285-288 MAR 2003) are readily taken up from the intestine and distributed over body tissue if administered orally (US7276538 B2).

C. Background of the Invention

Autophagy is an ancient cytoplasmic homeostasis pathway, conserved from yeast to humans, whereby cytoplasm portions get sequestered by membrane for delivery to lysosomes, leading to removal of damaged or surplus organelles and turnover of stable, long-lived macromolecules. By the autophagy process cells digest portions of their interiors to recycle nutrients, remodel and dispose of unwanted cytoplasmic constituents. Autophagy is a central player in the immunological control of bacterial, parasitic and viral infections. Recently it has become clear that autophagy also functions as a tumor suppression mechanism by preventing cell death and inflammation and by protecting the genome from damage and genetic instability. How autophagy protects the genome is not yet clear but may be related to its roles in sustaining metabolism or in the clearance of damaged proteins and organelles and the mitigation of oxidative stress. We now surprisingly found that autophagy can be activated in cells, tissues and living organisms by polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof.

Histone H3 is one of the five main histone proteins involved in the structure of chromatin in eukaryotic cells. Histone H3 is subjectable for acetylation at several different lysine positions in the histone tail by a family of enzymes known as histone acetyltransferases (HATs). Modification of histone H3 is known to influence cellular processes. It was also surprisingly found by present invention that polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3- aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof can induce or maintain a condition of hypoacetylation of histone H3. More particularly was it demonstrated that treatment of cells, tissues or living organisms with polyamine compounds of present invention triggers epigenetic deacetylation of histone H3. hi contrast, depletion of endogenous polyamines in cells, tissues or organisms leads to hyperacetylation. Moreover it has been demonstrated by present invention that abovementioned polyamine compounds or the combinations thereof are inhibitors of the activity of histone acetyltransferase (HAT), the enzyme responsible for histone H3 lysine acetylation. Histone deacetylase (HDAC) inhibitors, in contrast, induce or maintain a level of histone hyperacetylation and are known disruptors of autophagy.

Present invention thus concerns a novel class of compounds to protect a cell, tissue or organism from an autophagy disruption disorder.

Several documents are cited throughout the text of this specification. Each of the documents herein (including any manufacturer's specifications, instructions etc.) is hereby incorporated by reference; however, there is no admission that any document cited is indeed prior art of the present invention. SUMMARY OF THE INVENTION

In accordance with the purpose of the invention, as embodied and broadly described herein, the invention is broadly drawn to a novel class of compounds to protect a cell, tissue or organism from an autophagy disruption disorder and to increase the lifespan or life expectancy of an organism.

In one aspect of the invention, the novel class of compounds induces deacetylation or can maintain a condition of hypoacetylation of histone H3.

The present invention is concerned with compositions for use in the medical art.

It also relates to essentially pure polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3- aminopropyi)-monohydrochloride or derivatives thereof and/or pharmaceutically acceptable salts or esters thereof and/or mixtures thereof for treatment of a autophagy deficiency disorder or to the use of these polyamine autophagy activators for the manufacture of a medicament or a dosage form to treat autophagy deficiencies disorders, effects that have been experimentally observed and have been described in the examples and figures of this application.

As used herein, a "polyamine compound of present invention" is a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof. Therefore, it should be clear that if reference is made herein to "a polyamine compound of present invention", or to "spermidine, spermine, or a polyamine compound of present invention", refers to a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof. Spermine, i.e. N,N'-bis(3-aminopropyl)butane-l,4-diatnine, or spermidine, i.e. (N-(3- aminopropyl)tetramethylenediamine), are polyamine compound of present invention.

The present invention solves the problems of the related art by providing a novel class of autophagy activators, and by demonstrating that also polyamine compounds exert autophagy against activity or to induce increased autophagy activating activity in adipose tissues and that have been demonstrated to induce autophagy system biological effects in a subject treated with such polyamine autophagy activators, effects that have been experimentally observed and have been described in the examples and figures of this application. These polyamine autophagy activator agents can be putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)-monohydrochloride or other derivatives and pharmaceutically acceptable salts or esters thereof and/or mixtures thereof which are useful for treating autophagy related disorders. In accordance with the purpose of the invention, as embodied and broadly described herein, the invention is broadly drawn to polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)- monohydrochloride or other derivatives and pharmaceutically acceptable salts or esters thereof.

The invention relates to spermidine, spermine, or a polyamine compound of present invention for use in a treatment of autophagy activation to restore adipocyte differentiation, to lower FFA, triglycerides and/or cholesterol in plasma or blood circulation or to treat hypercholesterolemia and/or dyslipidemia, and to lower glucose and increase glucose intolerance and/or to lower insulin and improve insulin signaling and/or treat insulin resistance and diabetes, effects that have been observed experimentally and described in the examples and figures of this application. These polyamine autophagy activators may also be used to manufacture a medicament or a dosage form to treat hypercholesterolemia and/or dyslipidemia.

The invention relates to spermidine, spermine, or a polyamine compound of present invention for use in a treatment of autophagy activation to prevent the occurrence or to retard the progress of age-related macular degeneration (AMD). These polyamine autophagy activators may also be used to manufacture a medicament or a dosage form to prevent the occurrence or to retard the progress of age-related macular degeneration (AMD).

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use as a functional ingredient or a pharmaceutical in a treatment of a subject in need thereof to increase autophagy activity to prevent and/or to suppress arteriosclerosis and/or atherosclerosis or to increase autophagy activity to treat arteriosclerosis and/or atherosclerosis.

Moreover the invention relates to spermidine, spermine, or a polyamine compound of present invention for use in a treatment of arteriosclerosis and/or a disorder of atherosclerosis or to the use of these polyamine autophagy activators to manufacture a medicament or a dosage form to treat a disorder of arteriosclerosis and/or atherosclerosis. To date, no single therapeutic approach has proven universally effective in preventing a disorder of arteriosclerosis and/or atherosclerosis. Furthermore, the polyamine autophagy activators of present invention can be used to manufacture a medicament or a dosage form to increase autophagy activity to improve endothelial dysfunction or to increase myocardial perfusion. The invention thus also concerns polyamine autophagy activators for use in a treatment of to improve endothelial dysfunction or to increase myocardial perfusion.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to increase autophagy activity to prevent and/or to suppress the macrophage infiltration in cardiovascular plaques and the formation of atherosclerotic plaques. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to prevent and/or to suppress the macrophage infiltration in cardiovascular plaques and the formation of atherosclerotic plaques.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to increase autophagy activity to prevent and/or to suppress the accumulation of oxidized LDL in cardiovascular plaques and the formation of atherosclerotic plaques. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to prevent and/or to suppress the macrophage infiltration in cardiovascular plaques and the formation of atherosclerotic plaques.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to treat arteriosclerosis and/or atherosclerosis by inhibiting glucose intolerance and/or insulin resistance, and/or diabetes, and/or hypercholesterolemia (to lower total and LDL cholesterol) and/or dyslipidemia (to lower FFA and triglycerides); and/or to improve endothelial dysfunction and to increase myocardial perfusion; and/or infiltration of monocytes/macrophages in the vessel wall and/or adipose tissues, and/or accumulation of oxidized LDL in the vessel wall and/or adipose tissues, and their use to manufacture a medicament or a dosage form to treat such disorders, It thus also concerns the use of said polyamine compounds for the preparation of a medicament or a dosage form and the uses of same in a therapy to treat arteriosclerosis and/or atherosclerosis by inhibiting glucose intolerance and/or insulin resistance, and/or diabetes, and/or hypercholesterolemia (to lower total and LDL cholesterol) and/or dyslipidemia (to lower FFA and triglycerides); and/or to improve endothelial dysfunction and to increase myocardial perfusion; and/or infiltration of monocytes/macrophages in the vessel wall and/or adipose tissues, and/or accumulation of oxidized LDL in the vessel wall and/or adipose tissues, and their use to manufacture a medicament or a dosage form to treat such disorders.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of activating or reinstating a normal autophagic pathway for preventing or improving an autophagy disruption or weakening disorder of the group of impaired innate immune system, impaired adaptive immune system, myopathy caused by a intracellular aggregates, cell poising by a cytoxitic, fibrosis, pancreatic beta cell functional disorder, loss of pancreatic islet mass, inflammatory bowel disease (IBD), lymphopenia, lordokyphosis, disturbed insulin signaling, disturbed metabolic homeostasis of mammalian subject or a patient in need thereof. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to prevent and/or to suppress an autophagy disruption or weakening disorder of the group of impaired innate immune system, impaired adaptive immune system, myopathy caused by a intracellular aggregates, cell poising by a cytotoxic, fibrosis, pancreatic beta cell functional disorder, loss of pancreatic islet mass, inflammatory bowel disease (IBD), lymphopenia, lordokyphosis, disturbed insulin signaling, disturbed metabolic homeostasis in a mammalian subject or a patient in need thereof.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of metabolic defects selected from the group consisting of (1) non-insulin dependent Type 2 diabetes mellitus (NIDDM), (2) hyperglycemia, (3) low glucose tolerance, (4) insulin resistance, (6) a lipid disorder, (7) dyslipidemia, (8) hyperlipidemia, (9) hypertriglyceridemia, (10) hypercholesterolemia, (11) low HDL levels, (12) high LDL levels or (13) atherosclerosis. It also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to treat metabolic defects selected from the group consisting of (1) non-insulin dependent Type 2 diabetes mellitus (NIDDM), (2) hyperglycemia, (3) low glucose tolerance, (4) insulin resistance, (6) a lipid disorder, (7) dyslipidemia, (8) hyperlipidemia, (9) hypertriglyceridemia, (10) hypercholesterolemia, (11) low HDL levels, (12) high LDL levels or (13) atherosclerosis.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of metabolic defects selected from the group consisting of arteriosclerosis, dyslipemia or hypercholesterolemia in a subject in need thereof. It also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to treat metabolic defects selected from the group consisting of arteriosclerosis, dyslipemia or hypercholesterolemia in a subject in need thereof.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of inflammatory bowel disease (IBD) whereby the IBD is a idiopathic IBD, ulcerative colitis or Crohn's disease. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to prevent and/or to suppress inflammatory bowel disease (IBD) whereby the IBD is a idiopathic IBD, ulcerative colitis or Crohn's disease.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to activate the innate defense system against cell invasive organisms. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to activate the innate defense system against cell invasive organisms.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to activate the innate defense system against cell invasive organisms whereby the cell invasive organism are of the group of the yeasts, bacteria or virusses. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to activate the innate defense system against cell invasive organisms whereby the cell invasive organism are of the group of the yeasts, bacteria or virusses.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to activate the innate defense system against cell invasive organisms whereby the cell invasive organism is hepatitis C virus. It thus also concerns the use of essentially pure polyamine spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to activate the innate defense system against cell invasive organisms whereby the cell invasive organism is hepatitis C virus.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of tuberculosis. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to treat tuberculosis.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to maintain the architecture and function of pancreatic beta cells and to protects beta cells in a diabetic subject. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to maintain the architecture and function of pancreatic beta cells and to protect beta cells in a diabetic subject.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to activate the innate defense system against cell invasive organisms whereby the cell invasive organism Burkholderia pseudomallei. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to activate the innate defense system against cell invasive organisms whereby the cell invasive organism Burkholderia pseudomallei.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to activate the innate defense system against cell invasive organisms whereby the cell invasive organism Salmonella typhimurium. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to activate the innate defense system against cell invasive organisms whereby the cell invasive organism Salmonella typhimurium.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to inhibit the HCV RNA replication. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to inhibit the HCV RNA replication.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of metabolic syndrome treatment. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to suppress or prevent metabolic syndrome. The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of lymphocytopenia, or lymphopenia. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to suppress or prevent lymphocytopenia, or lymphopenia.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to activate the innate defense system against cell invading organisms. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to suppress or prevent to activate the innate defense system against cell invading organisms.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to activate the innate defense system against pathogenic yeasts, bacteria or virusses. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to suppress or prevent cell invasion by pathogenic yeasts, bacteria or virusses.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment against hepatitis C virus. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to suppress or prevent cell invasion by hepatitis C virus.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment against Burkholderia pseudomallei. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to suppress or prevent cell invasion by Burkholderia pseudomallei. The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment against Salmonella typhimurium. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to suppress or prevent cell invasion by Salmonella typhimurium.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to inhibit the HCV RNA replication. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to suppress or prevent HCV RNA replication.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment against septic shock. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to suppress or prevent septic shock.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to induce deacetylation or can maintain a condition of hypoacetylation of histone H3. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to induce deacetylation or can maintain a condition of hypoacetylation of histone H3.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to activate or reinstate a normal autophagic pathway. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to activate or reinstate a normal autophagic pathway.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to protect a cell, tissue or organism from an autophagy disruption disorder. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to protect a cell, tissue or organism from an autophagy disruption disorder.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to decrease toxic intracellular aggregates. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to decrease toxic intracellular aggregates.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to increase the capacity of the innate and adaptive immunity mechanism to remove intracellular parasites or cell invading organisms, such as yeasts, bacteria, or viruses. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to increase the capacity of the innate and adaptive immunity mechanism to remove intracellular parasites or cell invading organisms, such as yeasts, bacteria, or viruses.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to protect against or to treat a myopathy caused by a intracellular aggregates or a protein aggregation disorders. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to protect against or to treat a myopathy caused by a intracellular aggregates or a protein aggregation disorders.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to prevent or decrease cell poising for instance as a side effect of chemotherapy or cellular autophagy that can not cope with the damages caused by cytotoxity. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to prevent or decrease cell poising for instance as a side effect of chemotherapy or cellular autophagy that can not cope with the damages caused by cytotoxity. The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to decrease protein deposition due to gene mutation and protein misfolding. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to decrease protein deposition due to gene mutation and protein misfolding.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to treat or prevent fibrosis on organs. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to treat or prevent fibrosis on organs.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to treat or prevent a fibrosis disorder of the group consisting of such as pulmonary fibrosis, interstitial pneumonia, chronic hepatitis, hepatic cirrhosis, chronic renal failure and renal glomerulosclerosis. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to treat or prevent a fibrosis disorder of the group consisting of such as pulmonary fibrosis, interstitial pneumonia, chronic hepatitis, hepatic cirrhosis, chronic renal failure and renal glomerulosclerosis.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to normalize the function in pancreatic beta cells. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to normalize the function in pancreatic beta cells.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to prevent reduction in islet mass or the decrease in the number of β cells. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to prevent reduction in islet mass or the decrease in the number of β cells. The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to reduce the severity of an inflammatory bowel disease (IBD). It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to reduce the severity of an IBD.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to prevent protein aggregation in recombinant protein producing cells. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to prevent protein aggregation in recombinant protein producing cells.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to increase the antigen internalizing and presenting capacity of macrophages and immature dendritic cells. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to increase the antigen internalizing and presenting capacity of macrophages and immature dendritic cells.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to improve insulin signaling and maintain metabolic homeostasis. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to improve insulin signaling and maintain metabolic homeostasis.

The invention furthermore spermidine, spermine, or a polyamine compound of present invention for use in a treatment to increase the survivability, lifespan or the life expectancy of a non human animal or to increase the average lifespan of a population of such non human animals. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to increase the survivability, lifespan or the life expectancy of a non human animal or to increase the average lifespan of a population of such non human animals. The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to improve adipocyte differentiation and adipogenesis. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to improve adipocyte differentiation and adipogenesis.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to prevent, suppress and/or treat vascular and myocardial stiffness and/or enhance, promote, improve and/or restore vascular and myocardial flexibility and/or elasticity. The polyamine compounds of the present invention can be used to manufacture a medicament or a dosage form to prevent, suppress or treat systemic sclerosis. Systemic sclerosis (SSc) is a systemic connective tissue disease.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to exert anti-ageing effects in the endothelial walls of the blood vessels of the vascular system. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention to exert anti-ageing effects in the endothelial walls of the blood vessels of the vascular system.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to reduce, retard, lower or suppress a coagulation disorders or to reduce thrombogenicity to protect against a thrombosis wherein the thrombosis is of the group consisting of thrombotic cerebral infarction, coronary heart disease, angina pectoris, vasculitis, stroke, peripheral vascular thrombosis or to reduce, retard, lower or suppress a coagulation disorders to increase myocardial perfusion all of which depend on lowered plaque stability.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to exert anti-inflammatory effects and to treat, prevent, suppress and/or restore excessive inflammation in body tissues, in particular in the endothelial walls of the blood vessels of the vascular system. The polyamine compounds of the present invention can be used to manufacture a medicament or a dosage form to prevent, suppress or treat inflammatory diseases such as inflammatory bowel diseases, rheumatoid arthritis, or systemic lupus erythematosus.

Furthermore the present invention concerns spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament to increase the activity of autophagy to treat autophagy deficiencies disorders.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament to treat, prevent, suppress, reduce or decrease a vascular disease, cardiovascular or cerebrovascular diseases of the group consisting of arteriosclerosis and/or atherosclerosis and underlying cause of heart attacks, endothelial dysfunction, macrophage infiltration in vessel wall, formation of atherosclerotic plaques, thrombosis, dysfunction of myocardial perfusion e.g. thrombotic cerebral infarction, coronary heart disease, angina pectoris, vasculitis, stroke, peripheral vascular disease, internalisation lipoproteins and transform into lipid-loaded foam cells in early vascular lesions, infiltration of macrophages in plaques, plaque formation and maturation, thrombogenicity, plaque volume, the oxidized LDL content in the plaques, arterial sclerosis and hepatopathy.

Furthermore the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of the lipid homeostasis of the group consisting of induction the formation of less atherogenic LDL, lowering free fatty acids, triglycerides and/or cholesterol in plasma or blood circulation, inducing autophagy in adipose tissue. The present invention also concerns the use of such polyamine compounds for the manufacture of a medicament to include normalisation or improvement of the lipid homeostasis of the group consisting of induction the formation of less atherogenic LDL, lowering free fatty acids, triglycerides and/or cholesterol in plasma or blood circulation, inducing autophagy in adipose tissue.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of autophagy deficiencies disorders or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to treat autophagy deficiencies disorders.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of a vascular disease, cardiovascular or cerebrovascular diseases of the group consisting of arteriosclerosis and/or atherosclerosis and underlying cause of heart attacks, endothelial dysfunction, macrophage infiltration in vessel wall, formation of atherosclerotic plaques, thrombosis, dysfunction of myocardial perfusion e.g. thrombotic cerebral infarction, coronary heart disease, angina pectoris, vasculitis, stroke, peripheral vascular disease, internalisation lipoproteins and transform into lipid-loaded foam cells in early vascular lesions, infiltration of macrophages in plaques, plaque formation and maturation, thrombogenicity, plaque volume, the oxidized LDL content in the plaques, arterial sclerosis and hepatopathy or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to treat, prevent, suppress, reduce or decrease a vascular disease, cardiovascular or cerebrovascular diseases of the group consisting of arteriosclerosis and/or atherosclerosis and underlying cause of heart attacks, endothelial dysfunction, macrophage infiltration in vessel wall, formation of atherosclerotic plaques, thrombosis, dysfunction of myocardial perfusion e.g. thrombotic cerebral infarction, coronary heart disease, angina pectoris, vasculitis, stroke, peripheral vascular disease, internalisation lipoproteins and transform into lipid-loaded foam cells in early vascular lesions, infiltration of macrophages in plaques, plaque formation and maturation, thrombogenicity, plaque volume, the oxidized LDL content in the plaques, arterial sclerosis and hepatopathy.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of normalisation or improvement of the lipid homeostasis of the group consisting of induction the formation of less atherogenic LDL, lowering FFA, triglycerides and/or cholesterol hi plasma or blood circulation, inducing increased autophagy in adipose tissue or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to include normalisation or improvement of the lipid homeostasis of the group consisting of induction the formation of less atherogenic LDL, lowering FFA, triglycerides and/or cholesterol in plasma or blood circulation, inducing increased autophagy in adipose tissue. Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of hypercholesterolemia and/or dyslipidemia, to lower total cholesterol, triglycerides & FFA, to lower plasma triglycerides, FFA and cholesterol to modulate the whole-body sterol homeostasis, including fatty acid, triglyceride, and lipoprotein metabolism and reverse cholesterol transport or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to treat hypercholesterolemia and/or dyslipidemia, to lower total cholesterol, triglycerides & FFA, to lower plasma triglycerides, FFA and cholesterol to modulate the whole-body sterol homeostasis, including fatty acid, triglyceride, and lipoprotein metabolism and reverse cholesterol transport.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of hypercholesterolemia or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to treat hypercholesterolemia.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of dyslipidemia or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to treat dyslipidemia.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to treat cholesterol disorders.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention as hypolipidemic agents for use in a treatment of or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to reduce circulating triglycerides or liver triglyceride deposition.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to induce weight loss or to decrease, retard or reduce increase in adipose tissue formation. Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to improve lipid metabolism and insulin signaling associated with decreased tissue deposition of oxidized LDL.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to treat atherosclerotic cardiovascular disease (CVD).

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to treat age-related macular degeneration (AMD).

Furthermore, the present invention spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to treat Alzheimer disease (AD).

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such polyamine autophagy activators for the manufacture of a medicament or a dosage form to increase β-oxidation of fatty acids such as oleate or palmitate and to decrease fatty acid incorporation into triglycerides.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such polyamine autophagy activators for the manufacture of a medicament to induce weight loss or to decrease, retard or reduce increase hi adipose tissue formation.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such autophagy inducing polyamine compounds for the manufacture of a medicament to improve lipid metabolism and insulin signaling associated with decreased tissue deposition of oxidized LDL.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such autophagy inducing polyamine compounds for the manufacture of a medicament to treat atherosclerotic cardiovascular disease (CVD).

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such autophagy inducing polyamines for the manufacture of a medicament to treat age-related macular degeneration (AMD).

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such autophagy inducers for the manufacture of a medicament to treat Alzheimer disease (AD).

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such autophagy inducers for the manufacture of a medicament to increase β-oxidation of fatty acids such as oleate or palmitate and to decrease fatty acid incorporation into triglycerides and to decrease lipid accumulation in tissues, for instance in adipose tissue.

Furthermore, the present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of or the use of such autophagy inducing polyamines for the manufacture of a medicament to decrease intracellular lipids through increasing mitochondrial fatty acid oxidation and to decreases PKC activity (protein kinase C- θ (PKC-Θ) and protein kinase C-β (PKC-β)) in cells or tissues for instance myocytes of a subject.

Furthermore, the present invention relates to spermidine, spermine, or a polyamine compound of present invention for use in a treatment of activating or reinstating a normal autophagic pathway to sustain cellular anabolic needs under a starvation conditions or during times of nutrient or energy deprivation in an animal in need thereof. The present invention also relates to the use of spermidine, spermine, or a polyamine compound of present invention for use in a treatment of activating or reinstating a normal autophagic pathway to sustain cellular anabolic needs under starvation conditions or during times of nutrient or energy deprivation in an animal in need thereof.

Furthermore, the present invention relates to spermidine, spermine, or a polyamine compound of present invention for the preparation of a dosage form to increase the lifespan or the life expectancy of a non human animal. The present invention also relates to the use of spermidine, spermine, or a polyamine compound of present invention for the preparation of a dosage form to increase the lifespan or the life expectancy of a non human animal.

In a preferred embodiment, the non human animal is a poikilotherm organism such as an invertebrate. The poikilotherm organism is an invertebrate organism. The invertebrate organism can be a microinvertebrate, a zooplankton, or an arthropod such as an insect, an arachnid or a crustacean. In a particular embodiment, the invertebrate poikilotherm organism is a crustacean of the group consisting of a crab, lobster, crayfish, shrimp, krill, barnacle, crab, and bivalve mollusk. In a preferred embodiment, invertebrate poikilotherm organism is an aquatic organism, e;g. a crustacean of the group consisting of a crab, lobster, crayfish, shrimp, krill, barnacle, crab, and bivalve mollusk.

In a particular embodiment, the poikilotherm organism is a vertebrate organism. Vertebrate poikilotherm organism is in particular an aquatic organism, such as a fish, which can be a cartilaginous fish or a bony fish, of the group consisting of salmon, trout, carp, bass, bream, turbot, sole, milkfish, grey mullet, grouper, flounder, sea bass, cod, haddock, Japanese flounder and eel.

Present invention concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of activating or reinstating a normal autophagic pathway to sustain cellular anabolic needs under a starvation conditions or during times of nutrient or energy deprivation in a human in need thereof. Present invention also concerns the use of spermidine, spermine, or a polyamine compound of present invention for use in a treatment of activating or reinstating a normal autophagic pathway to sustain cellular anabolic needs under starvation conditions or during times of nutrient or energy deprivation in a human in need thereof. Nutrient or energy deprivation can e.g. occur during fasting or dieting or as a result of malnourishment. In a preferred embodiment, the nutrient or energy deprivation is caused by infection with a cell invasive organism of the group of yeasts, bacteria or virusses.

Furthermore, the present invention relates to a composition comprising spermidine, spermine, or a polyamine compound of present invention for use in a treatment to increase the survivability, lifespan or the life expectancy of a poikilotherm animal or to increase the average lifespan of a population of such poikilotherm animal, comprising: an amount of a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, 1,4-butanediamine N-(3-aminopropyl)- monohydrochloride or derivatives thereof or combinations thereof that is effective to activate the cellular autophagic pathway. Present invention thus also relates to the use of the composition for increasing the survivability, lifespan or the life expectancy of a poikilotherm animal or to increase the average lifespan of a population of such poikilotherm animal. In one embodiment, the composition is an oral composition. Yet, in another embodiment the composition is a pharmaceutical composition or a nutraceutical composition.

Furthermore, the present invention relates to a composition comprising spermidine, spermine, or a polyamine compound of present invention for use in a treatment to increase the survivability of metamorphosing juvenile organism, comprising: an amount of a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, 1,4-butanediamine N-(3-aminopropyl)-rnonohydrochloride or derivatives thereof or combinations thereof that is effective to activate the cellular autophagic pathway. Present invention thus also relates to the use of the composition to increase the average lifespan of a population of such metamorphosing juvenile organism.

In one embodiment, the composition is an oral composition. Yet, in another embodiment the composition is a pharmaceutical composition or a nutraceutical composition.

Furthermore, the present invention relates to a composition comprising spermidine, spermine, or a polyamine compound of present invention for use in a treatment to extend a healthy lifespan of a mammalian animal or to extend the average healthy lifespan of a population of such mammalian animals, comprising: an amount of a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, 1,4- butanediamine N-(3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof that is effective to activate the cellular autophagic pathway. Present invention thus also relates to the use of the composition in a treatment to extend a healthy lifespan of a mammalian animal or to extend the average healthy lifespan of a population of such mammalian animals.

Furthermore, the present invention relates to a composition comprising spermidine, spermine, or a polyamine compound of present invention for use in a treatment to extend a healthy lifespan of a human or to extend the average healthy lifespan of a population of such humans, comprising: an amount of a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, 1,4-butanediamine N-(3- aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof that is effective to activate the cellular autophagic pathway. Present invention thus also relates to the use of the composition in a treatment to extend a healthy lifespan of a human or to extend the average healthy lifespan of a population of such humans.

Furthermore, the present invention relates to a composition comprising spermidine, spermine, or a polyamine compound of present invention for use in a treatment to increase the survivability of a fasting human, comprising: an amount of a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, 1,4- butanediamine N-(3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof that is effective to activate the cellular autophagic pathway.

The invention furthermore concerns the following methods.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to induce deacetylation or to maintain a condition of hypoacetylation of histone H3. A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to activate or reinstate a normal autophagic pathway.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to protect a cell, tissue or organism from an autophagy disruption disorder.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to decrease toxic intracellular aggregates.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to increase the capacity of the innate and adaptive immunity mechanism to remove intracellular parasites.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to protect against or to treat a myopathy caused by a intracellular aggregates or a protein aggregation disorders.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to prevent or decrease cell poising for instance as a side effect of chemotherapy or cellular autophagy that can not cope with the damages caused by cytotoxity.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to decrease protein deposition due to gene mutation and protein misfolding.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to treat or prevent fibrosis on organs.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to treat or prevent a fibrosis disorder of the group consisting of such as pulmonary fibrosis, interstitial pneumonia, chronic hepatitis, hepatic cirrhosis, chronic renal failure and renal glomerulosclerosis.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to normalize the function in pancreatic beta cells. A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to prevent reduction in islet mass or the decrease in the number of β cells.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to reduce the severity of an inflammatory bowel disease (IBD).

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to prevent protein aggregation in recombinant protein producing cells.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to increase the antigen internalizing and presenting capacity of macrophages and immature dendritic cells.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to improve insulin signaling and maintain metabolic homeostasis.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to increase the survivability, lifespan or the life expectancy of a non human animal or to increase the average lifespan of a population of such non human animals. .

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to improve adipocyte differentiation and adipogenesis.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject for the reduction of the incidence of the development of cardiovascular disease such as arteriosclerosis or atherosclerosis in a subject at risk of developing such atherosclerotic cardiovascular disease for instance to such a subject who is selected from the group consisting of those subjects which have been diagnosed with an overproduction of large, triglyceride-rich very low density lipoproteins (VLDL) or with an increased concentration of atherogenic plasma lipoproteins or with increased concentration of factors that promote the increase of atherogenic lipoproteins in plasma and/or have a blood variable profile that is related to the diagnosis of such atherosclerotic cardiovascular disease. The invention further relates to spermidine, spermine, or a polyamine compound of present invention for use in such treatment or it concerns the use of said spermidine, spermine, or a polyamine compound of present invention to manufacture a medicament or a dosage form for such treatment.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject for the reduction of the incidence of the development of age-related macular degeneration in a subject at risk of developing such age-related macular degeneration for instance to a subject who is selected from the group consisting of those subjects which have been diagnosed with an overproduction of large, triglyceride-rich very low density lipoproteins (VLDL) or an overexpression of very-low-density-lipoprotein receptor (VLDLR) and/or have a blood variable profile that is related to the diagnosis of such age-related macular degeneration. The invention further relates to spermidine, spermine, or a polyamine compound of present invention for use in such treatment or it concerns the use of said spermidine, spermine, or a polyamine compound of present invention to manufacture a medicament for such treatment.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to said subject in an amount effective to inhibit or treat said condition of Alzheimer disease of the subject. The invention further relates to spermidine, spermine, or a polyamine compound of present invention for use in such treatment or it concerns the use of said spermidine, spermine, or a polyamine compound of present invention to manufacture a medicament for such treatment.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject for the reduction of the incidence of the development of age-related macular degeneration in a subject at risk of developing such age-related macular degeneration for instance to a subject who is selected from the group consisting of those subjects which have been diagnosed with an overproduction of large, triglyceride-rich very low density lipoproteins (VLDL) or an overexpression of very-low-density-lipoprotein receptor (VLDLR) and/or have a blood variable profile that is related to the diagnosis of such age-related macular degeneration. The invention further relates to spermidine, spermine, or a polyamine compound of present invention for use in such treatment or it concerns the use of said spermidine, spermine, or a polyamine compound of present invention to manufacture a medicament or a dosage form for such treatment. A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject for the reduction of the incidence of the development of Alzheimer disease in a subject at risk of developing such Alzheimer disease for instance to such a subject who is selected from the group consisting of those subjects which have been diagnosed with an overproduction of large, triglyceride-rich very low density lipoproteins (VLDL) or an overexpression of very-low-density-lipoprotein receptor (VLDLR) and/or have a blood variable profile that is related to the diagnosis of such Alzheimer disease. The invention further relates to spermidine, spermine, or a polyamine compound of present invention for use in such treatment or it concerns the use of said spermidine, spermine, or a polyamine compound of present invention to manufacture a medicament or a dosage form for such treatment.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject for the reduction of the incidence of the development of coronary heart diseases in a subject at risk of developing such coronary heart diseases for instance for such subject which selected from the group consisting of those subjects which have been diagnosed with an overproduction of large, triglyceride-rich very low density lipoproteins (VLDL) or an overexpression of very-low-density-lipoprotein receptor (VLDLR) and/or have a blood variable profile that is related to the diagnosis of such coronary heart diseases. The invention further relates to spermidine, spermine, or a polyamine compound of present invention to manufacture a medicament or a dosage form for such treatment.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to inhibit or treat a atherosclerotic cardiovascular disease such as arteriolosclerosis and/or atherosclerosis, comprising the step of: administering spermidine, spermine, or a polyamine compound of present invention to said subject in an amount effective to inhibit or treat said atherosclerotic cardiovascular disease of the subject. The invention further relates to spermidine, spermine, or a polyamine compound of present invention for use in such treatment or it concerns the use of said spermidine, spermine, or a polyamine compound of present invention to manufacture a medicament or a dosage form for such treatment. A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to inhibit or treat a condition of age-related macular degeneration comprising the step of: administering spermidine, spermine, or a polyamine compound of present invention to said subject in an amount effective to inhibit or treat said condition of age-related macular degeneration of the subject. The invention further relates to spermidine, spermine, or a polyamine compound of present invention for use in such treatment or it concerns the use of said spermidine, spermine, or a polyamine compound of present invention to manufacture a medicament or a dosage form for such treatment.

A method of delivering spermidine, spermine, or a polyamine compound of present invention to a subject to inhibit or treat a condition of Alzheimer disease comprising the step of: administering spermidine, spermine, or a polyamine compound of present invention to said subject in an amount effective to inhibit or treat said condition of Alzheimer disease of the subject. The invention further relates to spermidine, spermine, or a polyamine compound of present invention for use in such treatment or it concerns the use of said spermidine, spermine, or a polyamine compound of present invention to manufacture a medicament or a dosage form for such treatment.

Furthermore, the invention concerns a method of rearing a metamorphotic juvenile organism, the method comprising feeding the metamorphotic juvenile organism during at least part of the larval and/or post-larval stage with a diet for instance a prey organisms or an inert diet, the diet having a content of a polyamine compounds of the groups consisting of putrescine, spermine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)- monohydrochloride or derivatives thereof or combinations thereof in the range that is effective to activate the cellular autophagic pathway.

Thus, autophagy modulators of present invention, such as those described herein, can be used in the prophylaxis and/or therapeutic treatment of a variety of different disease and conditions, such as weight disorders (e.g. obesity, overweight condition, bulimia, and anorexia nervosa), lipid disorders (e. g. hyperlipidemia, dyslipidemia including associated diabetic dyslipidemia and mixed dyslipidemia, hypoalphalipoproteinemia, hypertriglyceridemia, hypercholesterolemia, and low HDL (high density lipoprotein)). In particular the autophagy modulators of present invention, such as those described herein, can be used in the prophylaxis and/or therapeutic treatment of cardiovascular disease of the group consisting of hypertension, coronary heart disease, heart failure, congestive heart failure, atherosclerosis, arteriosclerosis, stroke, cerebrovascular disease, myocardial infarction and peripheral vascular disease.

In particular the autophagy modulators of present invention, such as those described herein, can be used in the prophylaxis and/or therapeutic treatment of neurodegenerative disorders of the group consisting of Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, spinal cord injury, and inflammatory demyelinating disease, including acute disseminated encephalomyelitis and Guillain-Barre syndrome) and coagulation disorders (e.g. thrombosis).

Each year, approximately 60,000 Americans join the 1.5 million Americans currently afflicted by Parkinson's Disease (PD). This disorder is thought to originate in the part of the brain called the substantia nigra. As affected nerve cells in this portion of the brain die, their production of dopamine likewise vanishes. Without dopamine, smooth and coordinated muscle movement is lost. The autophagy inducers of present invention can protect cellular viability in the substantia nigra while simultaneously attenuating microglial activation Autophagy, protects human neuroblastoma SH-SY5Y cells against MPP+ induced cytotoxicity via inhibition of mitochondrial dysfunction and ROS production spermidine will ameliorate the MPP+ induced loss of neuronal cell viability and oxidative stress, rescued MPP+-induced changes in nuclear morphology.

The compounds of the present invention lower plasma FFA, triglycerides, glucose, insulin, lower total cholesterol (TC) and decrease low density lipoprotein (LDL), which have a beneficial effect on the protection of coronary heart disease and atherosclerosis.

The invention also relates to processes for the preparation of the same, and to the use thereof in the preparation of pharmaceutical compositions for the therapeutic treatment of warmblooded animals, including humans. The invention applies to human and veterinary applications. Macrophages are cells within the tissues that originate from specific white blood cells called monocytes. Monocytes and macrophages are phagocytes, acting in non-specific defense or innate immunity, as well as specific defense or cell-mediated immunity of vertebrate animals. Their role is to phagocytise (engulf and then digest) cellular debris and pathogens either as stationary or mobile cells, and to stimulate lymphocytes and other immune cells to respond to the pathogen. Oxidized LDL is the result of oxidative modification of LDL in the circulation and/or the adiopose tissue and/or the vessel wall, by cellular and/or a-cellular mechanisms, which do or do not involve enzymes of which the activity is dependent or independent of metal ions. The uptake of oxidized LDL by macrophages results in the generation of foam cells, a primary event in the development of atherosclerosis.

As used herein, a "subject" includes mammals, e.g., humans, companion animals (e.g., dogs, cats, birds and the like), farm animals (e.g., cows, sheep, pigs, horses, fowl and the like) and laboratory animals (e.g., rats, mice, guinea pigs and the like). In a preferred embodiment of the disclosed methods, the subject is human.

Dyslipemia is a metabolic dysfunction of lipids typically diagnosed by high triglyceride levels and/or low levels of HDL cholesterol, and/or the occurrence of small dense LDL which are prone to oxidation and thus can be associated with high levels of circulating oxidized LDL.

The following terms are similar, yet distinct, in both spelling and meaning, and can be easily confused: arteriosclerosis, arteriolosclerosis and atherosclerosis.

Arteriosclerosis also called hardening of the arteries chronic disease is characterized by abnormal thickening and hardening of the walls of arteries, with a resulting loss of elasticity. The major form of arteriosclerosis is atherosclerosis, in which plaques of consisting of macrophages, fatty deposits in foam cells, or atheromas, form on the inner walls of the arteries. These fatty acids are largely due to the uptake of oxidized LDL by macrophages. Arteriosclerosis is a general term describing any hardening (and loss of elasticity) of medium or large arteries (in Greek, "Arterio" meaning artery and "sclerosis" meaning hardening); arteriolosclerosis is arteriosclerosis mainly affecting the arterioles (small arteries); atherosclerosis is a hardening of an artery specifically due to an atheromatous plaque.

Therefore, atherosclerosis is a form of arteriosclerosis. Arteriosclerosis ("hardening of the artery") results from a deposition of tough, rigid collagen inside the vessel wall and around the atheroma. This increases the stiffness, decreases the elasticity of the artery wall. Arteriolosclerosis (hardening of small arteries, the arterioles) is the result of collagen deposition, but also muscle wall thickening and deposition of protein ("hyaline"). Calcification, sometimes even ossification (formation of complete bone tissue) occurs within the deepest and oldest layers of the sclerosed vessel wall.

Atherosclerosis causes two main problems. First, the atheromatous plaques, though long compensated for by artery enlargement, eventually lead to plaque ruptures and stenosis (narrowing) of the artery and, therefore, an insufficient blood supply to the organ it feeds. If the compensating artery enlargement process is excessive, a net aneurysm results. Atherosclerosis chronic disease is caused by the deposition of fats, cholesterol, calcium, and other substances in the innermost layer (endothelium) of the large and medium-sized arteries. Atherosclerosis is a disease affecting the arterial blood vessel. It is commonly referred to as a "hardening" or "furring" of the arteries. It is caused by the formation of multiple plaques within the arteries.

These complications are chronic, slowly progressing and cumulative. Most commonly, soft plaque suddenly ruptures cause the formation of a thrombus that will rapidly slow or stop blood flow, e.g. 5 minutes, leading to death of the tissues fed by the artery. This catastrophic event is called an infarction. For instance, the also called vulnerable plaque is such atheromatous plaque, which is particularly prone to produce sudden major problems, such as a heart attack or stroke. One of the most common recognized scenarios is called coronary thrombosis of a coronary artery causing myocardial infarction (a heart attack). Another common scenario in very advanced disease is claudication from insufficient blood supply to the legs, typically due to a combination of both stenosis and aneurismal segments narrowed with clots. Since atherosclerosis is a body wide process, similar events also occur in the arteries to the brain, intestines, kidneys, legs, etc.

Pathologically, the atheromatous plaque is divided into three distinct components: the nodular accumulation of a soft, flaky, yellowish material at the centre of large plaques composed of macrophages nearest the lumen of the artery; sometimes with underlying areas of cholesterol crystals; and possibly also calcification at the outer base of older/more advanced lesions. Hypercholesterolemia is an excess of cholesterol in the blood.

Thrombogenicity refers to the tendency of a material in contact with the blood to produce a thrombus, or clot. It not only refers to fixed thrombi but also to emboli i.e. thrombi which have become detached and travel through the bloodstream. Thrombogenicity can also encompass events such as the activation of immune pathways and the complement system. All materials are considered to be thrombogenic with the exception of the endothelial cells which line the vasculature. Certain medical implants appear non-thrombogenic due to high flow rates of blood past the implant, but in reality, all are thrombogenic to a degree. A thrombogenic implant will eventually be covered by a fibrous cap, the thickness of this capsule can be considered one measure of thrombogenicity, and if extreme can lead to the failure of the implant.

The term "pharmaceutically acceptable" is used adjectivally herein to mean that the compounds are appropriate for use in a pharmaceutical product.

As used herein, the phrase "pharmaceutically acceptable salts" or "nutraceutically acceptable salts" refers to salts prepared from pharmaceutically acceptable, preferably nontoxic, acids and bases, including inorganic and organic acids and bases, including but not limited to, sulfuric, citric, maleic, acetic, oxalic, hydrochloride, hydro bromide, hydro iodide, nitrate, sulfate, bisulfite, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, fornate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and pamoate (i.e., l,l'-methylene-bis-(2-hydroxy-3-naphthoate)) salts. Pharmaceutically acceptable salts include those formed with free amino groups such as, but not limited to, those derived from hydrochloric, phosphoric, acetic, oxalic, and tartaric acids. Pharmaceutically acceptable salts also include those formed with free carboxyl groups such as, but not limited to, those derived from sodium, potassium, ammonium, sodium lithium, calcium, magnesium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, and procaine.

As used herein, the term "carrier" refers to a diluent, adjuvant, excipient, or vehicle. Such carriers can be sterile liquids, such as saline solutions in water, or oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. A saline solution is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.

As used herein, the tern "mineral" refers to a substance, preferably a natural substance that contains calcium, magnesium or phosphorus. Illustrative nutrients and minerals include beef bone, fish bone, calcium phosphate, egg shells, sea shells, oyster shells, calcium carbonate, calcium chloride, calcium lactate, calcium gluconate and calcium citrate.

As used herein, the term "biological sample" is broadly defined to include any cell, tissue, organ or multicellular organism. A biological sample can be derived, for example, from cells or tissue cultures in vitro. Alternatively, a biological sample can be derived from a living organism or from a population of single cell organisms. Preferably, the biological sample is live tissue. More preferably, the biological sample is live bone or adipose tissue.

A "patient" in the meaning of this application, can be a human, but can also be an animal such as a mammalian or any multicellular living organism (animal) such as a poikilotherm animal for instance a teleaost or an invertebrate for instance a crustacean or an insect.

The term "treatment" refers to any process, action, application, therapy, or the like, wherein a mammal, including a human being, is subject to medical aid with the object of improving the mammal's condition, directly or indirectly.

The term "a compound that increases the expression" refers here to gene expression and thus to the increase of gene transcription and/or translation of a gene transcript (mRNA). Preferably said increase is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or even higher. The term "a compound that increases the activity" refers hereto.

The polyamine autophagy inducers inhibit the formation of fibrosis. Fibrosis is the formation or development of excess fibrous connective tissue in an organ or tissue as a reparative or reactive process. Types of fibrosis are cystic fibrosis of the pancreas and lungs, endomyocardial fibrosis, idiopathic pulmonary fibrosis of the lung, mediastinal fibrosis, myleofibrosis , retroperitoneal fibrosis, progressive massive fibrosis and nephrogenic systemic fibrosis. Another embodiment of present invention is the use of one of the polyamine compounds selected of present invention to manufacture a medicament.

In a preferred embodiment the autophagy enhancing polyamines, their hydrochloride or any pharmaceutically acceptable salt or derivatives there of may be administered orally in a regime of 10 to 2000 mg/patient/day, more preferably 100 to 1500 mg/patient/day, and yet more preferably 150 to 1000 mg/patient/day and most preferably 250 to 750 mg/patient/day. A possible daily dose can for instance be 5 to 15 mg/kg body weight. The active compound may be delivered as a solid medicine in pill or tablet form and alternatively as liquid, semisolid. The parenteral administration form may be an isotonic injection solution. The daily dose can be 100 μg to 50 mg kg body weight, preferably 250 μg / kg body weight to 30 mg / kg body weight, more preferably 500 μg to 25 mg/kg body weight and most preferably 1 to 15 mg/kg body weight.

The present invention demonstrates that a cellular contact with a direct action on cellular level of the polyamine autophagy inducers improves adipocyte differentiation (differentiation of pre-adipocytes to adipocytes). The adipocytes play a critical role in energy balance. Adipose tissue growth involves an increase in adipocyte size and the formation of new adipocytes from precursor cells. When preadipocytes differentiate, it is known that committed preadipocytes undergo growth arrest and subsequent terminal differentiation into adipocytes. Such is accompanied by a dramatic increase in expression of adipocyte genes including adipocyte fatty acid binding protein and lipid-metabolizing enzymes. The present invention thus provides a new class of compounds for the therapy or for use in a treatment of the pathophysiological mechanisms underlying excess of adipose tissue which is for instance for an obesity therapy. Moreover, this demonstrates that the compounds of present invention can be used in a treatment to prevent or reduce excessive body weight gam or to improve glucose tolerance.

A particular embodiment of present invention is the use of the autophagy enhancing polyamines of present invention as mentioned further above in this application for the inhibition of fibrosis. Fibrosis is a disease characterized by the excessive accumulation of a connective tissue component, and one which is a noticeable component in fibrosis is collagen. Moreover the present invention also concerns the use of the autophagy enhancing polyamines of present invention for the manufacture of a medicament or dosage form for the treatment of fibrosis or the use of the autophagy enhancing polyamines of present invention for use in a treatment of inhibition of fibrosis. In practicing such methods of treating or inhibiting fibrosis, preferably the tissue fibrosis affects a tissue selected from the group consisting of liver, skin epidermis, skin endodermis, muscle, tendon, cartilage, cardiac tissue, pancreatic tissue, lung tissue, uterine tissue, neural tissue, testis, ovary, adrenal gland, artery, vein, colon, small intestine, biliary tract and gut; most preferably, liver tissue (including tissue infected with schistosoma). Pulmonary fibrosis is a group of disorders characterized by accumulation of scar tissue in the lung interstitium, resulting in loss of alveolar function, destruction of normal lung architecture, and respiratory distress. Some types of fibrosis respond to corticosteroids, but for many there are no effective treatments. Prognosis varies but can be poor. For example, patients with idiopathic pulmonary fibrosis (IPF) have a median survival of only 2.9 years. In certain embodiments, the fibrosis results from the healing of a wound (including a surgical incision). Accumulation of collagen occurs in a variety of viscera, for example, brings about pulmonary fibrosis in lung and liver fibrosis in liver. Also in skin, for example, the accumulation of collagen brings about disorders such as cutis keloid formation. In many cases, the net accumulation of collagen in fibrosis is the result of disproportion between factors which bring about decomposition and production of collagen. The compounds of present invention can be administered to a subject to shift the balance from fibrotic tissue generation to generation of functional tissue. In a particular embodiment of present invention the autophagy enhancing polyamines of present invention are for use in a treatment to suppress hepatic stellate cell production of collagen after injury or to manufacture a medicament for such treatment.

Another particular embodiment of present invention is a treatment to suppress or to prevent the development of a disorder of the group consisting of progressive fibrosing steatohepatitis pathologicallies, human metabolic steatohepatitis, established steatohepatitis and liver fibrosis. The compounds of present invention can be used to reduce or suppress fibrosis in liver, kidney, and cardiac tissue or to counter act the fibrotic activities of TGF-β. They can be used to oppose the profibrotic effect of TGF-β, which induces differentiation of fibroblasts to myofibroblasts, a critical effector cell in fibrosis. Moreover the compounds of present invention can be used to inhibit the fibrotic response for instance the production of collagen by hepatic stellate cells in liver, kidney or cardiac of a subject who encountered a fibrosis disorder. An efficient therapy is the use of the compounds of present invention to effectively inhibit lung fibrosis.

Yet another particular embodiment can be also the use of the compounds of present invention to support stem cell therapy in tissue repair.

"Medicated" for this application means that it contains a medicinal substance for instance a functional ingredient. A medicated feed for instance is a feed containing a medicines or a functional ingredient for the purpose of treating or controlling disease or disorders in animals or reduce the risk of, to prevent, to treat or to manage a number of health disorders. A medicated food for instance is a food containing a medicines or a functional ingredient for the purpose of treating or controlling disease or disorders in human or reduce the risk of, to prevent, to treat or to manage a number of health disorders. The medicament of the dosage form of present invention can be comprised in a medicated feed or a medicated food.

"Functional ingredients" offer potential health benefits beyond basic nutrition when incorporated into foods, beverages, and other orally ingested products. Such ingredients have been shown to help reduce the risk of or manage a number of health concerns, including cancer, heart and cardiovascular disease, gastrointestinal health, menopausal symptoms, osteoporosis, and vision. Since 1993, the United States Food and Drug Administration (FDA) has approved numerous health claims for the labeling of food products with information related to the health benefits of functional food (U.S. Food and Drug Administration, A Food Labeling Guide (2000)). Although not yet approved by the FDA for the purposes of labeling, numerous other functional foods are believed to provide health benefits beyond those listed above, such as reduced inflammation. Functional ingredients generally are classified into categories such as carotenoids, dietary fiber, fatty acids, flavonoids, isothiocyanates, phenols, plant sterols and stands (phytosterols and phytostanols); polyols; prebiotics/probiotics; phytoestrogens; soy protein; sulfides/thiols; amino acids; proteins; vitamins; and minerals. Functional ingredients also may be classified based on their health benefits, such as cardiovascular, cholesterol reducing, and anti-inflammatory.

Each of the claims set out a particular embodiment of the invention. Some embodiments of the invention are set forth in claim format directly below: 1) A polyamine compound of the group consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, 1,4-butanediamine N-(3-aminopropyl)- monohydrochloride or derivatives thereof or combinations thereof for use in a treatment to increase the survivability, lifespan or the life expectancy of a poikilotherm organism or to increase the average lifespan of a population of such poikilotherm organisms.

2) The compound of claim 1, whereby the dose of treatment is in the low dose range of 10 mM to 1 μM, preferably of 1 mM to 10 μM.

3) A polyamine compound as claimed in claim 1 or 2, whereby the poikilotherm organism is an invertebrate poikilotherm organism.

4) A polyamine compound as claimed in claim 3, whereby the invertebrate organism is a microinvertebrate.

5) A polyamine compound as claimed in claim 3, whereby the invertebrate organism is an arthropod.

6) A polyamine compound as claimed in claim 5, whereby the arthropod is an arthropod of the group consisting of an insect, an arachnid and a crustacean.

7) A polyamine compound as claimed in claim 6, whereby the invertebrate poikilotherm organism is a crustacean of the group consisting of a crab, a lobster, a crayfish, a shrimp, krill and a barnacle.

8) A polyamine compound as claimed in claim 3, whereby the invertebrate poikilotherm organism is a a bivalve mollusk.

9) A polyamine compound as claimed in any one of the previous claims 1 to 2, whereby the poikilotherm organism is a vertebrate poikilotherm organism.

1O)A polyamine compound as claimed in claim 9, whereby the vertebrate poikilotherm organism is a vertebrate poikilotherm aquatic organism. H)A polyamine compound as claimed in claim 10, whereby the vertebrate poikilotherm aquatic organism is a cartilaginous fish or a bony fishes. 12) A polyamine compound as claimed in claim 10, whereby the vertebrate poikilotherm aquatic organism is a fish of the group consisting of a salmon, a trout, a carp, a bass, a bream, a turbot, a sole, a milkfϊsh, a grey mullet, a grouper, a flounder, a sea bass, a cod, a haddock, a Japanese flounder and an eel. 13) A polyamine compound as claimed in any of the previous claims, whereby polyamine compound is spermidine or a pharmaceutically or nutraceutically acceptable salt of such a polyamine compound.

14) A polyamine compound as claimed in any of the previous claims, whereby polyamine compound is spermine or a pharmaceutically or nutraceutically acceptable salt of such a polyamine compound.

15) A composition comprising the polyamine compound of claims 1 to 14 for use in a treatment to increase the survivability, lifespan or the life expectancy of a poikilotherm animal or to increase the average lifespan of a population of such poikilotherm animal, comprising: an amount of a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, 1,4-butanediamine N-(3- aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof that is effective to activate the cellular autophagic pathway.

16) The composition of claim 15 wherein the composition is an oral composition.

17) The composition of claim 15 wherein the composition is a pharmaceutical composition.

18) The composition of claim 15 wherein the composition is a nutraceutical composition.

19) The composition of claim 15 wherein the composition is a non living compostion.

2O)A composition comprising the polyamine compound of claims 1 to 15 for use in a treatment to increase the survivability of metamorphosing juvenile organism, comprising: an amount of a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, 1,4-butanediamine N-(3-aminopropyl)- monohydrochloride or derivatives thereof or combinations thereof that is effective to activate the cellular autophagic pathway.

21) The composition of claims 20 wherein the composition is an oral composition.

22) The composition of claims 20 wherein the composition is a pharmaceutical composition.

23) The composition of claims 20 wherein the composition is a nutraceutical composition.

24) Use of a polyamine compound of any of claims 1 to 14 to increase the survivability, lifespan or the life expectancy of a poikilotherm organism or to increase the average lifespan of a population of such poikilotherm organism. 25) Use of a composition of any of claims 15 to 19 for increasing the survivability, lifespan or the life expectancy of a poikilotherm animal or to increase the average lifespan of a population of such poikilotherm animal.

26) Use of a composition of any of claims 20 to 23 for increasing the survivability, lifespan or the life expectancy of a metamorphosing juvenile organism or to increase the average lifespan of a population of such metamorphosing juvenile organism.

Nutrient or energy deprivation can e.g. occur during fasting or dieting or as a result of malnourishment.

Other embodiments of present invention are set forth in claim format directly below:

1) A polyamine compound of the group consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochioride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1 ,4-butanediamine N-(3-aminopropyl)- monohydrochloride or derivatives thereof or pharmaceutically acceptable salts thereof or combinations thereof for use in a treatment to extend a healthy lifespan of a mammalian animal or to extend the average healthy lifespan of a population of said mammalian animal.

2) The polyamine compound as claimed in claim 1, whereby said mammalian animal is a human.

3) The polyamine compound as claimed in claim 1, whereby said mammalian animal is a fasting animal or is subjected to nutrient deficiency, to nutrient or energy deprivation or to malnourishment.

4) The polyamine compound as claimed in claim 3, whereby said fasting animal is a fasting human or a human subjected to nutrient deficiency.

5) Use of a polyamine compound of any of claims 1 to 4 in a treatment to extend a healthy lifespan of a mammalian animal or to extend the average healthy lifespan of a population of said mammalian animal.

6) Use of a polyamine compound as claimed in claim 5, whereby said mammalian animal is a human.

7) Use of a polyamine compound as claimed in claim 5, whereby said mammalian animal is a fasting animal or an animal subjected to nutrient deficiency, to nutrient or energy deprivation or to malnourishment. 8) Use of a polyamine compound as claimed in claim 7, whereby said fasting animal is a fasting human or a human subjected to nutrient deficiency, to nutrient or energy deprivation or to malnourishment.

9) A composition for use in a treatment to extend a healthy lifespan of a mammalian animal or to extend the average healthy lifespan of a population of said mammalian animal, comprising: an amount of a polyamine compound of the group consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, and 1 ,4-butanediamine N-(3 - aminopropyl)-monohydrochloride or derivatives thereof or pharmaceutically acceptable salts thereof or combinations thereof that is effective to activate the cellular autophagic pathway.

10) The composition as claimed in claim 9, whereby said mammalian animal is a human.

11) The composition as claimed in claim 9, whereby said mammalian animal is a fasting animal or an animal subjected to nutrient deficiency, to nutrient or energy deprivation or to malnourishment.

12) The composition as claimed in claim 11, whereby said fasting animal is a fasting human.

13) The composition as claimed in any of claims 9 to 12 wherein the composition is an oral or a pharmaceutical or a nutraceutical composition.

14) Use of a composition as claimed in any of claims 9 to 13 in a treatment to extend a healthy lifespan of a mammalian animal or to extend the average healthy lifespan of a population of said mammalian animal.

15) Use of a polyamine compound as claimed in claim 14, whereby said mammalian animal is a human.

16) Use of a polyamine compound as claimed in claim 14, whereby said mammalian animal is a fasting animal or an annual or is subjected to nutrient deficiency, to nutrient or energy deprivation or to malnourishment.

17) Use of a polyamine compound as claimed in claim 16, whereby said fasting animal is a fasting human or an animal or is subjected to nutrient deficiency, to nutrient or energy deprivation or to malnourishment.

Detailed Description

DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION Reference throughout this specification to "one embodiment" or "an embodiment" means that a particular element, feature or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular compound, composition or method may be combined in any suitable manner, as would be apparent to one of ordinary skill in the art from this disclosure, in one or more embodiments.

Similarly it should be appreciated that in the description of exemplary embodiments of the invention, various features of the invention are sometimes grouped together in a single embodiment, figure, or description thereof for the purpose of streamlining the disclosure and aiding in the understanding of one or more of the various inventive aspects. This method of disclosure, however, is not to be interpreted as reflecting an intention that the claimed invention requires more features than are expressly recited in each claim. Rather, as the following claims reflect, inventive aspects lie in less than all features of a single foregoing disclosed embodiment. Thus, the claims following the detailed description are hereby expressly incorporated into this detailed description, with each claim standing on its own as a separate embodiment of this invention.

In the description provided herein, numerous specific details are set forth. However, it is understood that embodiments of the invention may be practised without these specific details. In other instances, well-known methods, structures and techniques have not been shown in detail in order not to obscure an understanding of this description.

The invention will now be described by a detailed description of several embodiments of the invention. It is clear that other embodiments of the invention can be configured according to the knowledge of persons skilled in the art without departing from the true spirit or technical teaching of the invention, the invention being limited only by the terms of the appended claims.

For the purpose of teaching of the invention, preferred embodiments of the compounds, uses and methods of the invention are described below. It will be appreciated by the person skilled in the art that other alternative and equivalent embodiments of the invention can be conceived and reduced to practice without departing form the true spirit of the invention, the scope of the invention being limited only by the appended claims.

As used herein, a "polyamine compound of present invention" is a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof. Therefore, it should be clear that if reference is made herein to "a polyamine compound of present invention", or to "spermidine, spermine, or a polyamine compound of present invention", refers to a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof.

Spermine, i.e. N,N'-bis(3-aminopropyl)butane-l,4-diamine, or spermidine, i.e. (N-(3- aminopropyl)tetramethylenediamine), are polyamine compound of present invention.

In a specific embodiment, the polyamine of present invention is spermine or spermidine.

By present invention it has been clearly demonstrated that polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof can induce deacetylation or can maintain a condition of hypoacetylation of histone H3 and can be used in a treatment to activate or reinstate a normal autophagic pathway. Autophagy as used in this application comprises macroautophagy (bulk degradation of cytoplasmic components including proteins and whole organelles), a major lysosomal catabolic pathway and microautophagy (a morphologically distinct form of autophagy often seen in yeast). Macroautophagy ("autophagy") is the major, lysosomal mechanism by which cells degrade protein, in addition to the multi-enzyme proteasome system. Unlike the proteasome, however, autophagy can also eliminate damaged or redundant organelles. Autophagy is a cellular homeostasis pathway used to sustain cellular anabolic needs during times of nutrient or energy deprivation. Autophagosomes sequester cytoplasmic constituents, including macromolecules such as long-lived proteins. Upon fusion of autophagosomes with lysosomes, the engulfed cargo is degraded. The proteolysis of long-lived proteins by macroautophagy is a Standard, specific measure of autophagic degradation and represents an end-point assay for the pathway. The polyamine compounds of present invention thus cause an effect opposite to the histone deacetylase (HDAC) inhibitors or to feeding the cells with synthetic lipids or interleukin-13, which have been reported to inhibit macroautophagy (Zeng, X., Overmeyer, J. H., and Maltese, W. A. (2006) J. Cell. Sci. 119, 259-270.). Such interleukin 13 -dependent inhibition of macroautophagy can moreover be reversed by Sphingolipids for instance ceramide or sphingosine 1 -phosphate (SlP) (Scarlatti F et al. J Biol Chem. 2004 Apr 30;279(18):18384-91. Epub 2004 Feb and Lavieu G et al. Methods MoI Biol. 2008;445:159- 73).

The autophagic pathways serve a salutary function by facilitating removal of aggregates too large for efficient proteasome-mediated clearance, hi the absence of basal levels of autophagic activity in a tissue, abnormal aggregates of intracellular proteins develop. Pharmacological induction of autophagy is sufficient to facilitate clearance of the aggregates and reduce improve this aggregation disorders. For instance pharmacological induction of autophagy can reduce polyglutamine-induced cytotoxicity in animal models of Huntington's disease (Fortun J, et al. J Neurosci. 2003 ;23: 10672-10680 and Komatsu M, et al; Nature. 2006; 441:880- 884). The invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to protect a cell, tissue or organism from an autophagy disruption disorder. An autophagy disruption or weakening disorder can be caused by excess intracellular aggregates or can cause toxic intracellular aggregates.

In the absence of basal levels of autophagic activity in a tissue, abnormal aggregates of intracellular proteins develop. Treatment with the polyamines of present invention is sufficient to facilitate clearance of the aggregates and reduce improve this aggregation disorders. As aged organisms suffer of polyamine depletion, there is a large need in the art for polyamine treatment. It has for instance also been experimentally proved by this invention that aged cell are unable to or have a decreased capability to synthesize polyamines and it has been demonstrated that there is a clear polyamine depletion effect on aging. Also intracellular spermidine depletion has been experimentally confirmed. Moreover we have demonstrated that this can be restored by supplementation with spermidine or putrescine, the obligate precursor of spermidine. It also has been demonstrated by present invention that spermidine fed to a living organism is taken up and metabolized their cells and that putrescine is readily present in the cells and tissues of such organism. Moreover it has been demonstrated that such polyamines enhance the autophagic pathway. Taken together, the data of present application demonstrate that stimulating autophagic activity by delivery polyamine compounds such as putrescine, spermine and spermidine (N-(3-aminopropyl)tetramethylenediamine), cholesteryl spermine or other derivatives and the combinations thereof to a an organism can be used to treat, prevent or inhibit a cellular protein aggregation disorder and in particular in an organism that normally can not cope with such intracellular protein aggregates for instance due to a intracellular polyamine decline for instance as an ageing effect.

Typically disorders that can be cured by restoring or enhancing autophagy are summarized hereunder.

Present invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to protect a cell, tissue or organism from an autophagy disruption disorder. An autophagy disruption or weakening disorder can be an immune disorder and in particularly an incapacity of the innate and adaptive immunity mechanism to remove intracellular parasites.

Autophagy is an evolutionarily ancient pathway for survival during different forms of cellular stress, including infection with viruses and other intracellular pathogens. Moreover, autophagic degradation is a major effector of innate and adaptive immunity mechanism for direct elimination of intracellular microbes and other aspects of immune defense system. Pharmacological inhibition of lysosomal function for instance by chloroquine is known to suppress the immune system. The process of autophagy may degrade intracellular pathogens, deliver endogenous antigens to MHC-class-II-loading compartments, direct viral nucleic acids to Toll-like receptors and regulate T-cell homeostasis. Autophagy is an important host mechanism for the removal of intracellular bacteria and protozoans, in keeping with its primary function as a cytoplasmic clean-up process (Levine, B. Cell 120, 159-162 (2005)). Initiation of autophagy results in eliminating certain intracellular pathogens, such as Mycobacterium tuberculosis, that block normal phagolysosome biogenesis. Gutierrez et al. showed that the mycobacterial-imposed block in phagolysosomal maturation can be overcome by activating cellular autophagy. Nearly simultaneously, other studies determined that autophagy can capture intracellular bacteria that lyse the phagosome and escape into the cytosol such as Shigella spp. (Gutierrez, M. G. et al. Cell 119, 753-766 (2004)) or extracellular bacteria that manage to invade the host cytoplasm, such as Group A Streptococcus (Nakagawa, I. et al. Autophagy defends cells against invading group A Streptococcus. Science 306, 1037-1040 (2004)). Other studies have confirmed these initial findings and extended the list of intracellular bacteria and parasites targeted by autophagy to include Listeria monocytogenes, Salmonella enterica, Francisella tularensis and Toxoplasma gondii (Andrade, R. M., et al J. Clin. Invest. 116, 2366-2377 (2006), Ling, Y. M. et al. J. Exp. Med. 203, 2063-2071 (2006)). Autophagy has a clear role in the elimination of parasites (Singh, S. Bet al; Cell. Microbiol. 5, 455^68 (2003), Py, B. F., et al. Autophagy 3, 117-125 (2007) and Birmingham, C. L., et al. J. Biol. Chem. 281, 11374-11383 (2006)). Autophagy as an antiviral pathway and an antimicrobial pathway (Nakagawa, IchiroEnsho to Men'eki (2008), 16(4), 381-387). It is known that autophagy has an integral role of autophagy in innate and adaptive antiviral immunity, selective pressure likely promoted the emergence of escape mechanisms by pathogenic viruses. Autophagy may protect against viral infection through degrading, of viral components (xenophagy), by promoting the survival or death of infected cells, through delivery of Toll-like receptor (TLR) ligands to endosomes to activate innate immunity, or by feeding antigens to MHC class II compartments to activate adaptive immunity Viral evasion of autophagy. (Orvedahl, Anthony; Levine, Beth. Autophagy (2008), 4(3), 280-285.). The polyamine compounds of the group consisting of putrescine, spermine and spermidine (N-(3-aminopropyl)tetramethylenediamine) and derivatives thereof, including various cholesteryl spermine compounds or combinations thereof can be used for protecting cells against invasive pathogens. The autophagic pathway is a component of the innate defense system against invading bacteria such as B. pseudomallei. For instance, when autophagy is pharmacologically induced using rapamycin, bacteria are actively sequestered in autophagosomes, ultimately decreasing their survival (Autophagy Volume: 4 Issue: 6 Pages: 744-753 Published: AUG 16 2008). Present invention concerns polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof for use in a treatment of a subject, for instance a mammalian subject, and preferably a human patient against intracellular micro-organisms (yeasts, bacteria or virusses).

Present invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to protect a cell, tissue or organism from an autophagy disruption disorder. An autophagy disruption or weakening disorder can be a myopathy in particular a myopathy caused by an intracellular aggregates or a protein aggregation disorders.

Myopathies are common non-infectious disorders in farm raised and farm fed poikilothem animals such as larval and juvenile fish (Partridge and Creeper, 2004 GJ J. Fish Dis. 27 (2004), pp. 523-530: Lewis, D.H., J.E. Marks and R.R. Stickney, 1985. J.Fish.Diseases, 8:563-565).

It is known that blunting autophagy in vivo dramatically hastens heart failure progression with a 3 -fold increase in interstitial fibrosis, greater accumulation of polyubiquitinated proteins, larger and more extensive intracellular aggregates, accelerated ventricular dysfunction, and early mortality (Paul Tannous et al. PNAS July 15, 2008 vol. 105 no. 28 9745-9750). Moreover overload or pharmacologically induced protein aggregation are sufficient to induce robust cardiomyocyte autophagy, which then functions to attenuate the accumulation of protein aggregates and aggresome formation (Paul Tannous et al. PNAS July 15, 2008 vol. 105 no. 28 9745-9750).

Reports of cytosolic vacuoles in the muscle cells of patients with altered muscular function are numerous. Impaired autophagy in a myopathy (Y. Tanaka et al., Nature 406 (2000), pp. 902-906. and P. Saftig et al., Disease model: LAMP-2 enlightens Danon disease. Trends MoI. Med. 7 (2001), pp. 37-39. and Buj-Bello et al., Proc. Natl. Acad. Sci. U. S. A. 99 (2002), pp. 15060-15065.) is at the basis of these muscular disorders that are diagnosable by increased cytosolic vacuoles in the muscle cells as compared to a normal condition. For instance pharmacological inhibition of lysosomal function is known to be a major cause of myopathy, as in chloroquine myopathy (Shintani and Klionsky, 2004 Science 306 (2004), pp. 990- 995). The polyamine compounds such as putrescine, spermine and spermidine (N-(3- aminopropyl) tetramethylenediamine), cholesteryl spermine or derivatives thereof or combinations thereof of present invention can be used for inhibiting fibrosis in various organs or preventing and/or treating diseases of impaired autophagy related myopathy. Since autophagic pathways facilitate removal of aggregates too large for efficient proteasome- mediated clearance, thus acting in a salutary fashion, the polyamine compounds such as putrescine, spermine and spermidine (N-(3-aminopropyl)tetramethylenediamine), cholesteryl spermine or other derivatives and the combinations thereof to activate the autophagic pathway, can be for use in a treatment to diminish the damage of a cardiac failure.

Present invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to protect a cell, tissue or organism from an autophagy disruption disorder. An autophagy disruption or weakening disorder can be due to cell poising for instance as a side effect of chemotherapy or cellular autophagy that can not cope with the damages caused by cytotoxity.

The polyamine compositions of present invention and their use in a treatment are particular suitable for reversing intracellar protein aggregates following cell fibrillary degeneration by cause of poisoning or a chemotherapy (e.g. aluminum poisoning). Such posing protein aggregation effect can be particularly important in organisms which by ageing have intracellular polyamine depletion. Such chemically induced depositions can be prevented or diminished by a therapy with the polyamine compounds such as putrescine, spermine and spermidine (N-(3-aminopropyl)tetramethylenediamine), cholesteryl spermine or other derivatives and the combinations thereof of present invention, particular in those patients that suffer of intracellular polyamine depletion. The increasing evidence connecting cancer and autophagy makes the manipulation of autophagy a very attractive prospect for the treatment of cancer. Moreover numerous inhibitors of histone deacetylases are under development to block tumor cell differentiation, apoptosis, or growth arrest such as the histone deacetylase inhibitors :4SC 201 of Nycomed (Phase-I Solid tumours), Belinostat of TopoTarget (Phase-II for Acute myeloid leukaemia, Bladder cancer, Colorectal cancer, Cutaneous T cell lymphoma, Liver cancer, Mesothelioma, Myelodysplasia syndromes, Non-Hodgkin's lymphoma, Ovarian cancer, Peripheral T-cell lymphoma, Sarcoma, Solid tumours, Thymoma), Chidamide of Chipscreen Biosciences (Phase-I Cancer), CHR 3996of Chroma Therapeutics (Phase-I Cancer), CT 200 of Celleron Therapeutics (Phase-I - Cancer), CUDC 101 of Curis (Phase-I Cancer), Entinostat of Bayer Yakuhin, Nihon Schering, University of Tokyo (Phase-I/IICancer Leukaemia, Non-small cell lung), ITF 2357 of Italfarmaco (Phase-II Cancer, Haematological Disorders, Musculoskeletal Disorders, Rheumatic Disease Arthritis, Hodgkin's disease, Multiple myeloma, Myelofibrosis, Polycythaemia vera, Thrombocytosis), JNJ 26481585 of Johnson & Johnson Pharmaceutical Research & Development LLC (Phase-I Cancer ,Haematological malignancies, Solid tumours), MGCD 0103 of MethylGene (Phase-II Cancer Acute myeloid leukaemia, B cell lymphoma, Chronic lymphocytic leukaemia, Hodgkin's disease, Myelodysplastic syndromes, Non-Hodgkin's lymphoma, Solid tumours) and MGCD 290 of MethylGene(Phase-I Mycoses). The autophagy inhibitor hydroxychloroquine has been combined with other cytotoxic compounds such in the Phase I/II clinical trial, NCT00765765 which started august 2008 with a combination of Ixabepilone with Hydroxychloroquine for the Treatment of Patients With Metastatic Breast Cancer of the Cancer Institute of New Jersey and National Cancer Institute (NCI). However these autophagy inhibitors block aggregate clearance healthy tissues. Moreover the various proteasome inhibitors, which are used as chemotherapeutic in cancer therapy, are known to induce intracellular protein aggregation in cancer and normal tissue. Autophagy protects the cell against cytotoxicity of the DNA-damaging compounds. (Elliott, Althea; Reiners, John J., Jr. Toxicology and Applied Pharmacology (2008), 232(2), 169-179). The polyamine compounds of the group consisting of putrescine, spermine and spermidine (N-(3- aminopropyl)tetramethylenediamine) and derivatives thereof, including various cholesteryl spermine compounds or combinations thereof can be used in to protect a mammalian organism under treatment with drugs or bioactive compounds that can induce DNA-damage. The polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1 ,4-butanediamine N-(3-aminopropyl)- monohydrochloride or derivatives thereof or combinations thereof of present invention can be used in a treatment of to protect such healthy tissues. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

Present invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to protect a cell, tissue or organism from an autophagy disruption disorder. An autophagy disruption or weakening disorder can be due to gene mutation and protein misfolding

The polyamine compositions of present invention and their use in a treatment are particular suitable for the many diseases inherited mutations that lead to the production of incorrectly folded or processed proteins, which proteins aggregation are known to be accelerated by reactive oxygen species (ROS). Moreover evidence indicates that the protein aggregates might affect mitochondria, leading to higher levels of ROS production. This scenario leads to a positive-feedback loop that is fuelled by the levels of ROS Toren Finkel Nature Reviews Molecular Cell Biology 6, 971-976 (December 2005). Huntington's disease, amyotrophic lateral sclerosis, parkinsonism, and Alzheimer disease, are for instance typical disorders that result into the deposition of proteins within intracellular aggregates. The polyamine compositions of present invention induces autophagy, and thereby, enhances the clearance of autophagy substrates, like for instance mutant huntingtin and alpha-synucleins or like the toxic protein of Huntington's disease. Present invention provides polyamine compositions in particular such compositions comprising polyamine compounds such as putrescine, spermine and spermidine (N-(3-aminopropyl)tetramethylenediamine), cholesteryl spermine or other derivatives and the combinations thereof for use in a treatment to slow down or to prevent gene mutation inherent incorrect protein folding or processing and consequent proteins aggregation.

Present invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to protect a cell, tissue or organism from an autophagy disruption disorder. Fibrosis and hepatectomy will weaken autophagy in cells and tissues and thus cause an autophagy disruption or weakening disorder Fibrosis and hepatectomy will weaken autophagy in cells and tissues. For instance cystic fibrosis is a typical autophagic disease. Present invention concerns the use of the polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)- monohydrochloride or derivatives thereof or combinations thereof of present invention for inhibiting fibrosis in various organs or preventing and/or treating diseases caused by fibrosis in organs, such as pulmonary fibrosis, interstitial pneumonia, chronic hepatitis, hepatic cirrhosis, chronic renal failure, renal glomerulosclerosis.

Present invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to protect a cell, tissue or organism from an autophagy disruption disorder. An autophagy disruption or weakening disorder can lead to atherosclerosis and will enhance ischemic/reperfusion-induced myocardial apoptosis.

Autophagy safeguards plaque cells against cellular distress, in particular oxidative injury, by degrading the damaged intracellular material. In this way, autophagy is antiapoptotic and contributes to cellular recovery in an adverse environment. (Martinet W, De Meyer GR. Curr Atheroscler Rep. 2008 Jun; 10(3):216-23 and Verheye S, et al. and J Am Coll Cardiol. 2007 Feb 13; 49(6):706-15. Epub 2007 Jan 26) Autophagy may not only attenuate the formation of atherosclerosis associated with hypercholesterolemia, but may also protect the heart from subsequent ischemic/reperfusion-induced myocardial apoptosis.

Present invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to protect a cell, tissue or organism from an autophagy disruption disorder. An autophagy disruption or weakening disorder can lead to a disturbed function in pancreatic beta cells or in reduction in islet mass due predominantly to a decrease in the number of β cells.

Autophagy acts as a defense to cellular damage incurred during diabetes. Autophagy is important in islet homeostasis and compensatory increase of beta cell mass in response to high-fat diet. Autophagy maintenance normal islet architecture in pancreas and normal function in pancreatic beta cells. The results also identified a unique role for inductive autophagy as an adaptive response of b cells in the presence of insulin resistance induced by high-fat diet (Arakawa, Masayuki; et al. Cell Metabolism (2008), 8(4), 325-332). The polyamine compounds of the group consisting of putrescine, spermine and spermidine (N-(3- aminopropyl)tetramethylenediamine) and derivatives thereof, including various cholesteryl spermine compounds or combinations thereof can be used for the induction of autophagy in pancreatic β cells. These compounds can be provided to diabetes patients to protect the pancreatic β cells and to maintain there functional status. The polyamine compounds of the group consisting of putrescine, spermine and spermidine (N-(3- aminopropyl)tetramethylenediamine) and derivatives thereof, including various cholesteryl spermine compounds or combinations thereof protect a mammalian organism against or can be used in a treatment of hypoglycemia and/or hyperinsulinemia and/or a reduction in islet mass due predominantly to a decrease in the number of β cells.

Present invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to protect a cell, tissue or organism from an autophagy disruption disorder. An autophagy disruption or weakening disorder can result into inflammatory bowel disease (IBD).

Autophagy is essential for cellular homeostasis, providing a mechanism of response among all cell types to limit the harmful effects of diverse exogenous and endogenous stresses. It has a role in intestinal physiology, acute stages of inflammatory injury and the resolution phase of IBD. In intestinal epithelial cells/Paneth cells and antigen-presenting cells, muramyl dipeptide (MDP) found in bacterial proteoglycans is recognized by the leucine rich repeats (LRR) domains of NOD2 and leads to the activation of NF- B. In Paneth cells, NOD2-mediated NF- B activation leads to the induction of defensins. Mutations in NOD2 attenuate selective - defensin production and protect epithelial cells from bacterial infection. In antigen-presenting cells, NOD2 signaling is modulated by TLR signaling inputs and, via interaction with procaspase 1, regulates pro-inflammatory cytokine production (Nature 448, 427-434 (26 July 2007)). The autophagy pathway plays a part in protecting mammalian cells against various bacterial pathogens and the cytotoxic effect of bacterial toxins. A constellation of findings, particularly in the last year, suggest a more focused orientation of that model on intracellular responses to low-level invasive bacteria. These include recent findings implicating alterations in autophagy and phagosomal function. Following low-level stimuli or pathogen infection, autophagy represents a primary attempt to re-establish homeostasis The relevance to IBD is highlighted by the recent discovery that a synonymous SNP in the auto- phagocytic gene ATG 16Ll is associated with increased risk for Crohn's disease (Nature Genetics 39, 596 - 604 (2007) and Nature Genetics 39, 207 - 211 (2006) (Fig. 3b). ATGl 6Ll is broadly expressed in the intestinal epithelium, APCs, CD4/8 T cells, Bl cells and memory B cells. Preliminary data have implicated ATG 16Ll in host responses to intracellular bacteria Nature Genetics 39; 207 - 211 (2006). Recent studies have also implicated a second autophagy gene, IRGM in Crohn's disease risk. Short interfering (si)RNA studies have demonstrated that IRGM is required for mycobacterial immunity and may have an analogous role in the granulomatous response often observed in Crohn's disease. Nature Genetics 39, 596 - 604 (2007) ATGl 6Ll is expressed in intestinal epithelial cell lines and that functional knockdown of this gene abrogates autophagy of Salmonella typhimurium. Together, these findings suggest that autophagy and host cell responses to intracellular microbes are involved in the pathogenesis of Crohn's disease. The innate immunity plays a major role in IBD pathogenesis. The basic mechanism of autophagy begins with the formation of a phagophore which is a double-membrane vesicle that expands and eventually surrounds a portion of the cytoplasm to become an autophagosome. Later this vesicle expands through fusion with a lysosome to become an autolysosome. Inside the autolysosome hydrolases degrade the trapped material which is then exported back into the cytosol (W. Martinet, G.R.Y. et al; Biotechnol Lett 27 (2005), pp. 1157-1163). This autophagic mechanism is important to cellular function as it aids in cell protection from pathogens and cell maintenance by degrading long-lived proteins and organelles.

Disease association of rs2241880 in the autophagy-related 16-like 1 gene (ATG16L1) was replicated in these samples (P = 4.0 10-8) and confirmed in a UK case-control sample (P = 0.0004). By haplotype and regression analysis, we found that marker rs2241880, a coding SNP (T300A), carries virtually all the disease risk exerted by the ATG16L1 locus. The

ATG 16Ll gene encodes a protein in the autophagosome pathway that processes intracellular bacteria. We found a statistically significant interaction with respect to Crohn's disease risk between rs2241880 and the established CARDl 5 susceptibility variants (P = 0.039). Together with the lack of association between rs2241880 and ulcerative colitis (P > 0.4), these data suggest that the underlying biological process may be specific to Crohn's disease. Nature Genetics 39, 207 - 211 (2006) Sequence variants in the autophagy gene IRGM and multiple other replicating loci contribute to Crohn's disease susceptibility this study confirms all four new Crohn's disease loci that achieved genome-wide significance in the WTCCC scan5 and confirms the recently reported 5pl3 gene desert9, as well as implicating four other new risk loci. These data, combined with the association in the WTCCC scan5 and the North American study 12 of an intergenic region on chromosome 10q21, underline the value of genome- wide scanning. Taken together, the genetic evidence regarding IRGM, ATG 16Ll (converging on autophagy pathways), CARD 15 and IL23R strongly implicates defects in the early immune response, particularly innate immune pathways and the handling of intracellular bacteria, in the pathogenesis of Crohn's disease. Whether the latter is restricted to a single pathogen (or, more likely, to a class of subpathogenic bacteria relying on defective host innate immunity for survival) awaits further investigation. Nature Genetics 39, 830 - 832 (2007). The polyamine compounds of the group consisting of putrescine, spermine and spermidine (N-(3- aminopropyl)tetramethylenediamine) and derivatives thereof, including various cholesteryl spermine compounds or combinations thereof can be used to treat a mammalian organism affected by an IBD. polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-arninopropyl)- monohydrochloride or derivatives thereof or combinations thereof can be used in a treatment of an IBD such as Crohn's disease or Colitis.

Present invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to protect a cell, tissue or organism from autophagy disruption or weakening or of protein aggregation due to non coping of the natural autophagy process. Protein aggregation is a common issue encountered during manufacture of biotherapeutics. The production of recombinant biomolecules: Aggregation of proteins into insoluble intracellular complexes and inclusion bodies due to misfolded proteins is a common problem in bioengineering for instance in fermentation and recombinant protein production processes Protein aggregates can be either structured (e.g. amyloid;) or amorphous whereby in case, they tend to be insoluble and metabolically stable under physiological conditions resulting in decreased yields of recombinant production. Moreover, accumulating can result into toxic intracellular aggregates. It has been known by the man skilled in the art that yields in recombinant protein production are affected by protein aggregation and further unknown factors. Autophagy enhancement can be used to prevent protein aggregation. Present invention provides polyamine compounds such as putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)- monohydrochloride or derivatives thereof or combinations thereof to activate the autophagic pathway of recombinant producing cells to improve the removal of damaged organelles and proteins and to provide turnover of nutrients in order to increase the -recombinant protein productivity or to increase secreted recombinant protein levels in fermentation supernatant.

Present invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to enhance autophagy in a cell, tissue or organism Autophagy is a common mechanism in innate and adaptive immune response of macrophages and immature dendritic cells for processing and presenting internalizing antigens.

Macrophages and immature dendritic cells are phagocytic cells that internalize particulate antigens (AGs) such as microbes and latex beads conjugated to Ag. The phagocytic antigen processing cells are involved in innate and adaptive immune response to microbials such as bacteria. Macrophages rapidly transfer pathogens from lipid raft vacuoles to autophagosomes. For instance macrophages activate autophagy as an immediate response to Legionella pneumophila infection (Amal O. Amer et al. Autophagy. 2005 April; 1(1): 53-58.). Moreover macrophages exploit autophagy to capture pathogens within the lipid raft pathway for antigen presentation. Antigen presenting cells (APCs) such as dendritic cells (DCs) and macrophages (M0s) have been used for ex vivo expansion and for taking up, processing and presenting protein antigens for instance in a vaccine strategy in cancer. The present invention clearly demonstrate that polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3- aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof these compounds can be used to activate the preserved mechanism of cellular autophagy and antigen presentation by antigen presenting cells.

Present invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to induce hypoacetylation of histone H3 or to prevent acetylation of proteins required for autophagy in order to improve insulin signaling and maintain metabolic homeostasis.

According to the present invention, it has now been surprisingly found that polyamine compounds such as spermidine are activators of the autophagic pathway. Spermidine leads to hypoacetylation of histone H3 and strongly induces autophagy in yeast, flies, and in mammalian cells, for instance by preventing acetylation of proteins required for autophagy. Autophagy is the process of sequestering portions of cellular interior (cytosol and intracellular organelles) into a membranous organelle (autophagosome). The autophagic machinery is highly conserved among organisms and the basic role of autophagy as a nutritional process has survived in organisms ranging from yeast to man. Autophagy is a catabolic process ubiquitous in eukaryotic cells that involves bulk degradation of cytoplasm in the vacuole/lysosome lumen. This degradative mechanism has been shown to be essential for adaptation of the cell to internal and external stress factors, and participates in other physiological processes including type II programmed cell death, MHC class II presentation of cytoplasmic antigens, innate immunity, development, or cellular differentiation. Conversely, malfunction of autophagy is involved in a broad range of pathologies such as cardiovascular, neurodegenerative and muscular diseases (Beth Levine and Daniel J. Klionsky Developmental Cell, Vol. 6, 463-477, April, 2004 and T. Shintani and D.J. Klionsky, Science 5 (2004), pp. 990-995). In human, autophagy has been implicated in many health and disease states, including cancers, neurodegeneration, aging, immunity and tissue homeostasis. As highly evolutionary conserved cellular homeostatic mechanism, autophagy is a cell regulatory mechanism that controls cytoplasmic biomass, organelle abundance, and distribution and that removes potentially harmful protein aggregates, eliminates intracellular pathogens such as bacteria, protozoans and viruses and that process self or foreign proteins for antigen presentation (Levine, B. (2007) Nature 446:745-747; Shintani, T., and Klionsky, D. J. (2004) Science 306:990-995; Levine, B., and Klionsky, D. J. (2004) Dev. Cell. 6:463-477; Rubinsztein, D. C. (2006) Nature 443:780-786; Schmid, D., et al (2006) J. MoI. Med.: 1-9; Martinez- Vicente, M., and Cuervo, A. M. (2007) Lancet Neurol. 6:352-361; Deretic, V. (2005) Trends Immunol. 26:523-528; Mizushima, N., and Klionsky, D. J. (2007) Annu. Rev. Nutr. 27:19-40; Yoshimori, T. (2007) Cell 128:833-836 and Kamada, Y., Sekito, T., and Ohsumi, Y. 2004 Curr. Top. Microbiol. Immunol. 279:73-84°. Schizosaccharomyces pombe Hst4 Functions in DNA Damage Response by Regulating Histone H3 K56 Acetylation (Eukaryot Cell. 2008 May; 7(5): 800-813). Histone hypoacetylation results in tighter packaging. Histone hypoacetylation is known to promotes resistance to DNA damage and to suppresses genomic instability and telomere dysfunction, to induces DNA repair and to improve insulin signaling and metabolic homeostasis and to protect against abnormalities that include profound lymphopenia, loss of subcutaneous fat, lordokyphosis, and severe metabolic defects. Furthermore, studies on Zmpste24-null progeroid mice, which are a reliable model of human Hutchinson-Gilford progeria, have revealed that the observed autophagic increase is associated with a series of metabolic alterations resembling those occurring under calorie restriction (Autophagy Volume: 4 Issue: 6 Pages: 807-809 Published: AUG 16 2008).

Present invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to enhance autophagy. Enhancing autophagy can be used to induce an increased lifespan of invertebrates.

Autophagy and in particular macroautophagy, is a fundamental mechanism essential for cell survival in all eukaryotic organisms. The term macroautophagy comprises two processes: (1) formation of autophagosomes and the transport of vesicles containing cargo and (2) lysosomal degradation of the cargo after fusion of the autophagosomes with endo/lysosomes (also called amphisomes or autolysosomes. Macroautophagy (herein referred to as autophagy) contributes to the control of life and death throughout the animal. Mice deficient in the Atg5 or Atg7 autophagy genes do not survive the early neonatal starvation period (Komatsu et al., 2005 J. Cell Biol. 169 (2005), pp. 425^434). Promoting autophagy increases longevity in fruit flies. We now surprisingly found that autophagy can be activated in cells, tissues and living organisms by polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)- monohydrochloride or derivatives thereof or combinations thereof. But moreover present invention demonstrates that these polyamine compounds when taken up by or fed to invertebrates induce an increased lifespan.

Present invention concerns a novel class of compounds, a composition comprising a member of this class of compounds, and a method of treatment by a member of this class of compounds to enhance autophagy. Autophagy is a cellular membrane trafficking process that leads to the lysosomal degradation of cytoplasmic components. The differentiation of a mature adipocyte requires is also a highly coordinated and massive cellular remodeling processes. There is a clear function of autophagy in adipocyte differentiation. Organisms that are deficient in autophagy exhibit a defect in differentiation into adipocytes (W.C. Yeh, et al. Prc Natl Acad Sci 92 (1995), pp. 11086-11090 and Rebecca Baerga, Thesis August 29, 2008)

The present invention clearly demonstrate that polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof these compounds can be used to activate the preserved mechanism of adipocyte autophagy and to improve adipocyte differentiation and adipogenesis.

Suitable dosages of such above described autophagy inducing polyamines to treat, prevent or reduce the disorders of present inventions such as arteriosclerosis, dyslipemia or hypercholesterolemia are in the range of 100 μg to 500 mg/kg body weight, more preferably in the range of 250 μg to 100 mg / kg body weight, yet more preferably 500 μg g to 50 mg per kg body weight, and most preferably 1 mg to 25 mg / kg body weight.

The invention further relates to these compounds for use in such treatment or it concerns the use of these compounds to manufacture a medicament for the above-mentioned treatments.

Present invention concerns polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3- aminopropyl)-monohydrochloride or other derivatives and pharmaceutically acceptable salts or esters thereof and/or mixtures thereof for the preparation of a dosage form to increase the lifespan or the life expectancy of a non human animal.

Present invention concerns the use of polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)-monohydrochloride or other derivatives and pharmaceutically acceptable salts or esters thereof and/or mixtures thereof for the preparation of a dosage form to increase the lifespan or the life expectancy of a non human animal.

In a preferred embodiment, the non human animal is a poikilotherm organism. In a particular embodiment, the poikilotherm organism is an invertebrate organism. The invertebrate organism can be a microinvertebrate or a zooplankton. The invertebrate organism can also be an arthropod, e.g. an insect, an arachnid or a crustacean.

In a particular embodiment, the invertebrate poikilotherm organism is an aquatic organism, e.g. a crustacean of the group consisting of a crab, lobster, crayfish, shrimp, krill and a barnacle.

In a particular embodiment, the invertebrate poikilotherm organism is an aquatic organism, e.g. a crustacean of the group consisting of a shrimp, lobster, crayfish, crab and bivalve mollusk.

"Crustacean" refers to any arthropod animal belonging to the subphylum Crustacea.

The compounds, compositions and methods described herein can be practiced on crustaceans at various stages of commercial aquaculture production. The different stages of commercial aquaculture production are know to those of skill in the art and include, for example, broodstock phase, reproductive phase, spawning phase, hatchery phase, settlement phase, larval phase, postlarval phase, juvenile growout phase, adult growout phase, harvest phase, and finishing phase.

The compounds, compositions and methods described herein can be practiced on crustaceans that are imported, exported, transshipped or otherwise transported e;g. to serve as bird and fish feed.

The present invention provides a dissolvable pellet, biscuit or the like, adapted to supply spermidine, spermine, or a polyamine compound of present invention or to otherwise treat an aqueous environment, said pellet, biscuit or the like comprising: said spermidine, spermine, or a polyamine compound of present invention, chemical substance, medicament or other primary ingredient(s). Said primary ingredient comprises e.g. an aquaculture food source.

In one embodiment, the poikilotherm organism is a vertebrate organism. In a particular embodiment, the vertebrate poikilotherm organism is an aquatic organism, such as a fish, which can be a cartilaginous fish or a bony fish, of the group consisting of salmon, trout, carp, bass, bream, turbot, sole, milkfish, grey mullet, grouper, flounder, sea bass, cod, haddock, Japanese flounder and eel.

In one embodiment, the polyamine compound is spermidine or a pharmaceutically acceptable salt of such a compound. Yet in another embodiment, the polyamine compound is spermine or a pharmaceutically acceptable salt of such a compound.

The invention furthermore concerns the use of a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)-monohydrochloride or other derivatives or a pharmaceutically acceptable salt of such a compound or the combinations thereof to increase the lifespan of invertebrates.

The invention furthermore concerns the use of a polyamine compound of present invention for use in a treatment to increase the survivability, lifespan or the life expectancy of a non human animal or to increase the average lifespan of a population of such non human animal.

The invention furthermore concerns a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, 1,4-butanediamine N- (3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof for use in a treatment to extend a healthy lifespan of a mammalian animal or to extend the average healthy lifespan of a population of such mammalian animals.

In a preferred embodiment, the mammalian animal is a fasting animal.

In a preferred embodiment, the mammalian animal is a human, e.g. a fasting human.

The invention furthermore concerns a composition capable of extending a healthy lifespan of a mammalian animal or to extend the average healthy lifespan of a population of such mammalian animals, comprising: an amount of a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, 1,4- butanediamine N-(3-aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof that is effective to activate the cellular autophagic pathway. In a preferred embodiment, composition contains spermine or spermidine. In one embodiment, the composition is an oral composition.

In one embodiment, the composition is a pharmaceutical composition. Yet hi another embodiment, the composition is a nutraceutical composition.

The term "healthy" means not obviously ill, with physical and mental functions corresponding to those of the average animal of the same sex in the same age-group. A subject that is suffering from neurodegeneration-associated disease, ageing of the skin, stroke, ischemia, IBD (inflammatory bowel disease), Crohn's disease, artherosclerosis, diseases associated with loss of pancreatic islet mass (diabetis mellitus, hyper glycemia), or hyper lipidemia, is not considered a "healthy" subject.

The term "mammal" as used herein includes both humans and non-humans.

Present invention concerns polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3- aminopropyl)-monohydrochloride or other derivatives or a pharmaceutically acceptable salt of such a compound or the combinations thereof for use in a treatment of activating or reinstating a normal autophagic pathway to sustain cellular anabolic needs under a starvation conditions or during times of nutrient or energy deprivation in a animal in need thereof. The present invention also concerns the use of a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)-monohydrochloride or other derivatives or a pharmaceutically acceptable salt of such a compound or the combinations thereof for use in a treatment of activating or reinstating a normal autophagic pathway to sustain cellular anabolic needs under starvation conditions or during times of nutrient or energy deprivation in a animal in need thereof. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

In one embodiment, the animal is under starvation or observes times of nutrient or energy deprivation. This can e.g. occur during fasting or dieting or as a result of malnourishment.

In a particular embodiment, the animal is a fasting animal. The fasting animal can be a fasting mammal, such as a fasting human.

In a preferred embodiment, the nutrient or energy deprivation is caused by infection with a cell invasive organism of the group of yeasts, bacteria or virusses.

In another embodiment, the polyamine compound is used to induce a positive nitrogen balance and lean body mass in an animal in need thereof.

Furthermore the invention concerns a method of rearing a metamorphotic juvenile organism, the method comprising feeding the metamorphotic juvenile organism during at least part of the larval and/or post-larval stage with a diet for instance a prey organisms or an inert diet, the diet having a content of a polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1 ,4-butanediamine N-(3- aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof in the range that is effective to activate the cellular autophagic pathway.

In one embodiment, the method comprising feeding the metamorphotic juvenile organism during at least part of the larval and/or post-larval stage with a diet for instance a prey organisms or an inert diet, the diet having a content of a polyamine compounds in the range of 3 - 2000 mg per kg feed composition on a dry weight basis.

In a particular embodiment, the polyamine compound is administered orally in a regime of 100 μg to 50 mg per kg body weight biomass of organisms per day.

In a particular embodiment, the prey organisms are cultivated and are selected from the group consisting of a crustacean species, rotifera species and brachiopoda species. The crustacean species can e.g. be an Artemia species. The prey organisms are Rotifera species or a Brachiopoda species. The Rotifera species includes Brachionus plicatilis, Brachionus rotundiformis, and/or Brachionus rubens.

Drawing Description

BRIEF DESCRIPTION OF THE DRAWINGS

The present invention will become more fully understood from the detailed description given herein below and the accompanying drawings which are given by way of illustration only, and thus are not limitative of the present invention.

Figure 1 is a graphic display showing that spermidine leads to hypoacetylation of histone H3 and strongly induces autophagy in flies and mammalian cell culture. (A) Relative acetylation (normalized to respective controls, dashed line) of indicated histone H3 lysine residues determined by quantification of immunoblot analysis using site specific antibodies. Data represent means of two independent analyses. For calculation details and representative blots (D. Balasundaram, C. W. Tabor, H. Tabor, Proc Natl Acad Sci USA 8S, 5872-5876 (1991)). (B) Relative acetylation of indicated histone H3 lysine residues of Δspel cells (open bars) compared to wild type cells (closed bars) chronologically aged to day 3 (Lyslδ and Lys56) or day 12 (Lys9+14). Data represent means of two independent analyses. (C) Relative inhibition of histone acetyltransferase activity (HAT-activity) by spermidine determined by an in vitro HAT-activity assay of yeast nuclear extracts of wild type cells. Data represent means ± SEM of three independent experiments. *p = 0.024. (D) Chronological aging of wild type and Aiki3Asas3 with (open symbols) or without (closed symbols) addition of 4 mM spermidine. Data represent means ± SEM (n = 4). (E) Relative acetylation of histone H3 lysine 9+14 residues determined by quantification of immunoblot analysis performed at day 20 of the experiment shown in (E). Data represent means ± SEM (n = 3). *p < 0.05, ***p < 0.001. (F) LysoTracker Red staining of vacuoles indicative of autophagy in oesophagus-tissue from flies fed with 1 mM spermidine for two days compared to controls (without spermidine). Nuclei were visualized by Hoechst staining (blue color). Representative pictures are show. Scale bars represent 10 μm. (G) Fluorescence microscopy of Hoechst-counterstained HeLa cells transiently transfected with LC3-GFP subjected to 100 μM spermidine for 6 h. Representative pictures are shown.

Figure 2 is a graphic display showing autophagy induced by spermidine in flies and in mammalian cell culture. (A) Quantification of autophagic vesicles per nucleus in LysoTracker Red stained muscle tissue of female flies fed with 1 mM spermidine or with 10% glucose (starved) for 48 hours compared to normal food (controls). Data represent means ± SEM of at least 20 flies for each group. **p < 0.01. (B) HeLa cells transiently transfected with LC3-GFP were subjected to spermidine (100 μM) for 6 h and the percentage of adherent cells exhibiting a clear LC3-GFP relocalization into cytoplasmic vacuoles was determined using micrographs of Hoechst 33342-counterstained cells. Data represents means ± S.D. of three independent experiments. (C, D) Immunoblot analyses of accumulating LC3-II protein as well as p53 and GAPDH protein levels evaluated in dose (0.1 - 100 μM) and time (1 - 6 h) responses in HeLa cells subjected to spermidine.

Figure 3 is a graphic display showing that application of spermidine extends life span of yeast, flies, and human immune cells and inhibits oxidative stress in aging mice. (A) Survival determined by clonogenicity during chronological aging of wild type yeast (BY4741) with (o) and without (■) addition of 4 mM spermidine at day 1. Data represent means ± SEM (n = 5). (B) Survival determined by AnnexinV / 7-AAD staining (unstained cells were considered as viable) of isolated human immune cells (PBMC) cultured for 6 and 12 days with PHA in the absence (black bar) or presence (white bars) of various spermidine concentrations (as indicated). Data represent means + SEM of 3 independent experiments (each done on PBMC from different donors). *p < 0.05 and **p < 0.01. (C and D) Survival determined by the number of living individuals of Drosophila melanogaster during aging of (C) female flies under normal conditions and (D) male flies under stressful conditions (addition of preservatives propionic acid and phosphoric acid) with and without (■) supplementation of food with various concentration of spermidine (as indicated). Representative aging experiments of at least 50 flies per sample are shown. (E) Replicative life span analysis of BY4741 wild type yeast after separation into old (fraction V) and young (fraction II) cells by emulation centrifugation. The remaining life span with or without 1 mM spermidine on 2 % glucose full media is shown. (F) Free thiol group concentration (indicative of oxidative stress level) in blood serum of aging mice with or without (control) supplementation of drinking water with 0.3 and 3 mM spermidine for 200 days. Data represent means ± SEM (n = 3). **p < 0.01. (G) Intracellular spermidine of mouse liver cells, obtained from the same mice used for RSH measurements presented in (F). Data represent means ± SEM (n = 3).

Figure 4 is a graphic display showing that spermidine treatment of yeast results in strong resistance against heat shock and peroxide treatment. Survival of pre-aged wild type cells stressed for 4 h with hydrogen peroxide (3 mM H₂O₂) or heat shock (42 °C) compared to unstressed cells. Cells were chronologically aged until day 24 with or without addition of 4 mM spermidine. Data represent means ± SEM (n = 4). *p < 0.05 and ***p < 0.001.

Figure 5 is a graphic display showing that spermidine inhibits necrotic cell death of PBMC. Quantification (FACS analysis) of phosphatidylserine externalization (FITC channel) and loss of membrane integrity indicative of necrosis (PerCP channel) using AnnexinV/7-ADD costaining of 12 day old human PBMCs. Unstained cells were considered as viable. Dot Plots with 30,000 cells evaluated of a representative experiment are shown. Numbers indicate the percentage of cells located in the respective gate.

Figure 6 is a graphic display showing that histone H3 acetylation is regulated by intracellular polyamines in part mediated through Iki3p and Sas3p. (A) Immunoblot of whole cell extracts of wild type cells chronologically aged to designated time points with (+) or without (-) spermidine application. Blots were probed with antibodies against total histone H3 or H3 acetylation sites at the indicated lysine residues. (B) Relative acetylation of histone H3 lysine 9+14 of Δspel cells compared to wild type cells chronologically aged to day 5 with (open bars) or without (closed bars) adjustment of pH_ex to 6. Data represent means ± SEM of three independent experiments. **p < 0.01. (C) Quantification (FACS analysis) of phosphatidylserine externalization and loss of membrane integrity using AnnexinV/PI costaining performed at day 20 of the chronological aging experiment shown in (Fig. 2D). For each staining 30,000 cells were evaluated. ***p < 0.001. (D) Immunoblot of whole cell extracts of wild type and ΔiM3Δsas3 cells with (+) or without (-) spermidine application obtained at day 20 of the aging experiment shown in (Fig. 2D). Blots were probed with antibodies against total histone H3 or H3 acetylation sites at lysine 9+14 (Lys9+14). Figure 7 is a graphic display showing that polyamine depletion shortens yeast chronological life span evoking markers of oxidative stress and necrosis. (A) Intracellular spermidine of five day old Aspel cells compared to wild type. Data represent means ± SEM (n = 3). ***p < 0.001. (B) Chronological aging of wild type (■) and polyamine depleted Aspel (Δ) yeast cells. Data represent mean ± SEM (n = 6). Cells were tested for cell death markers at day 3 (C-E). (C) Fluorescence microscopy of DHE stained wild type and Aspel cells indicating ROS accumulation. Scale bars represent 10 μm. (D) Quantification (fluorescence reader) of ROS accumulation using DHE staining of wild type and Aspel cells. Data represent means ± SEM (n =4). ***p < 0.001. (E) Quantification (FACS analysis) of phosphatidylserine externalization and loss of membrane integrity using Annexin V/PI costaining and of DNA- fragmentation using TUNEL staining of chronologically aging wild type and Δspel cells at day 3. Data represent means ± SEM (n = 3). **p < 0.01.

Figure 8 is a graphic display showing life span extension upon external alkalinization strictly depends on endogenous polyamines. (A) Chronological aging of wild type (closed symbols) and Aspel (open symbols) with (A) and without (■) adjustment of extracellular pH to 6. Data represent means ± SEM (n = 3). (B) Intracellular pH determined by staining with the pH- dependent fluorescent dye SNARF-4F of wild type and Aspel cells with and without adjustment of extracellular pH to 6 during chronological aging. Data represent means + SEM (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001.

Figure 9 is a graphic display showing that spermidine application suppresses necrotic cell death. (A) Fluorescence microscopy of DHE staining and Annexin V (green)/PI (red) costaining of wild type cells at day 18 of the chronological aging experiment shown in Fig. 5B. Scale bars represent 10 μm. (B and C) Quantification of DHE staining (B) and Annexin V/PI costaining (C) by FACS analysis performed at indicated time points of the chronological aging experiment shown in Fig. 5B. Data represent means ± SEM (n = 3). ***p < 0.001. (D) Fluorescence microscopy of chronologically aged wild type cells (day 3 and 14) expressing an EGFP-tagged version of the yeast HMGBl homolog (Nhp6 A-EGFP) with or without (control) addition of 4 mM spermidine. Scale bars represent 5 μm. (E) Electron microscopy of young log-phase cells (day 0) and of 20 day old wild type cells aged with or without (control) 4 mM spermidine. Representative cells are shown.

Figure 10 is a graphic display showing necrotic disintegration of subcellular structures during aging is inhibited by spermidine. Overview pictures of electron microscopy of 20 day old wild type cells aged with or without (control) treatment of 4 mM spermidine and of healthy young cells. Higher resolution images of representative cells are shown in Figure 3E.

Figure 11 is a graphic display showing life span extension by spermidine treatment is not due to regrowth of better adapted mutants. (A) Budding index of wild type cells at indicated time points during chronological aging with (o) or without (■) application of 4 mM spermidine, similar to the aging experiment as shown in Figure IA. Data represent means ± SEM (n = 3) with at least 500-1000 cells evaluated for each replicate. **p < 0.01. (B) Mutation rate per 10⁶ living cells determined by canavanine resistance of wild type cells at indicated time points during chronological aging with (open bars) or without (closed bars) application of 4 mM spermidine, similar to the aging experiment as shown in Fig. IA. Data represent means ± SEM (n = 5). *p < 0.05.

Figure 12 is a graphic display showing that spermidine application temporarily protects from excessive ROS accumulation and loss of survival in sod2 mutant cells during aging. (A) Survival during chronological aging of wild type (WT) and Δsod2 yeast with (open symbols) or without (closed symbols) application of 4 mM spermidine. Data represent means ± SEM (n = 4). (B) Quantification (fluorescence reader) of ROS accumulation using DHE staining of cells obtained from the aging experiment shown in (A). Data represent means ± SEM (n = 4).

Figure 13 is a graphic display showing autophagy induced by spermidine in flies and in mammalian cell culture. (A) Quantification of autophagic vesicles per nucleus in LysoTracker Red stained muscle tissue of female flies fed with supplementation of 1 mM spermidine or with 10% glucose (starved) for 48 hours compared to normal food (control). Data represent means ± SEM of at least 20 flies for each group. **p < 0.01. (B) HeLa cells transiently transfected with LC3-GFP were subjected to spermidine (100 μM) for 6 h and the percentage of adherent cells exhibiting a clear LC3-GFP relocalization into cytoplasmic vacuoles was determined using micrographs of Hoechst 33342-counterstained cells. Data represents means ± S.D. of three independent experiments. (C, D) Immunoblot analyses of accumulating LC3-II protein (indicative of autophagy) as well as p53 and GAPDH protein levels evaluated in dose (0.1 - 100 μM) and time (1 — 6 h) responses in HeLa cells subjected to spermidine.

Figure 14 is a graphic display showing that deletion of the polyamine acetyltransferase PAAl shortens chronological life span and enhances oxidative stress. (A) Survival during chronological aging of wild type and bφaal yeast cells. Data represent means ± SEM (n = 4). (B) Quantification (fluorescence reader) of ROS accumulation using DHE staining of cells obtained from the aging experiment shown in (A). Relative fluorescence units have been normalized to wild type at dayl. Data represent means ± SEM (n = 4). ***p < 0.001.

Figure 15 is a graphic display showing that spermidine treatment causes remodelling of chronologically aging cells into a low metabolic, quiescence-like state. (A) Sucrose gradient centrifugation of 22 day old wild type yeast chronologically aged with or without (control) treatment of 4 mM spermidine. A representative photograph is shown, picturing upper, middle, and lower (quiescent) cells. (B) Quantification of upper, middle, and lower fraction of cells after sucrose gradient centrifugation representatively shown in (A). Data represent means ± SEM of three independent experiments. **p< 0.01, ***p < 0.001. (C) Oxygen consumption of wild type cells treated with or without (control) 4 mM spermidine during chronological aging. Oxygen consumption has been determined using 0₂-electrode measurements and normalized to living cells (see Methods section). Data represent means ± SEM (n = 3). *p< 0.05, ***p < 0.001.

Figure 16 displays the survivorship of the crustacean inventerbrate, Daphnia magna exposed to Spermidine, Spermidine + temperature stress and Spermidine + Cd stress animals treated for 10 days with different SPD doses at culture temperature (20°C) were transferred to stress conditions (high temperature 28°C or sublethal Cd concentrations).

Examples on materials and methods Blood Samples, Preparation, and Culture of Peripheral Blood Mononuclear Cells (PBMC)

Sixty ml of peripheral full blood were obtained from healthy young (<35 years) persons, registered at the Institute for Biomedical Aging Research as blood donors. Informed written consent was obtained and the study was approved by the local ethical committee. PBMC were purified from heparinized blood by Ficoll Paque density gradient centrifugation (Pharmacia, Uppsala, Sweden). PBMC were cultured for 12 days in RPMI 1640 (Life Technologies, New York, USA) supplemented with 10% fetal calf serum (Sigma- Aldrich, Austria), 1% penicillin- streptomycin (Gibco, Invitrogen Corporation, UK) and phytohemagglutinin (PHA) (1 μg/ml, Sigma, Vienna, Austria) using 24 well-plates (BD, Franklin Lakes, NJ, USA) for 12 days. PBMC were kept at a density of 10⁶ cells per well at 37 °C, 5% CO₂. Spermidine (Sigma, Austria) was added after 1 and 7 days of culture (0 nM, 0.2 nM, 2 nM, 20 nM, and 2 μM). Survival of cells was measured after 6 and 12 days.

Immunofluorescence Staining of PBMC

Cells were washed (1500 rpm, 10 min, RT) with phosphate buffered saline (PBS) and resuspended in 50 μl PBS / 10⁶ cells. Necrosis staining of cells was performed by adding the DNA intercalator 7-Aminoactinomycin D (7-AAD), which is visible in the Phycoerythrin (PE) channel, at a concentration of 0.5 μl/ 50 μl PBS and incubated for 30 minutes at 4 °C. Cells were then washed with PBS and resuspended in 100 μl Annexin binding buffer (10 mM HEPES, 140 mM NaCl, 2.5 mM CaCl_2, pH 7.4). 5 μl of the Fluoresceinisothiocyanate (FITC) labeled Annexin V (BD Pharmingen, San Jose, CA, USA) were added and samples were incubated for 15 min at RT, in the dark. Finally, 400μl of Annexin binding buffer were added, samples were kept on ice and measured at the FACS immediately. Cells which were negative for both staining were considered as viable (P. Fabrizio et al, J Cell Biol 166, 1055-1067 (2004)).

Cell Culture Conditions, Plasmid Transfection, and Autophagy Measurements

HeLa cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal calf serum (FCS), 1 mM pyruvate and 10 mM Hepes at 37°C under 5% CO2. For plasmid transfection cells were cultured in six-well plates and transfected at 80% confluence. Transient transfections with LC3-GFP plasmid was performed with Lipofectamine 2000 reagent (Invitrogen) and cells were used 24 h after transfection. For fluorescence microscopy HeLa cells transfected with LC3-GFP were fixed with paraformaldehyde (4%, w/v) and nuclei were labeled with 10 mg/ml Hoechst 33342 (Molecular Probes-Invitrogen). Fluorescence microscopy was analyzed with a Leica IRE2 equipped with a DC300F camera. For western blot analysis cells were washed with cold PBS at 4°C and lysed as previously described (A. Criollo et al, Cell Death Differ 14, 1029-1039 (2007)). Fifty μg of protein were loaded on a 10% SDS-PAGE precasted gels (Invitrogen) and transferred to Immobilon membrane (Millipore). The membrane was incubated for 1 h in TBS-Tween 20 (0.05%) containing 5% non-fat milk. Primary antibodies including anti-LC3 I/II (Cell Signaling) or anti-p53 (DO-I; SantaCruz) were incubated overnight at 4°C and revealed with the appropriate horseradish peroxidase-labeled secondary antibodies (Southern Biotechnologies Associates) plus the SuperSignal West Pico chemoluminiscent substrate (Pierce). Anti- GAPDH (Chemicon CA) antibody was used to control equal loading.

Drosophila Life Span Experiments

Flies from an isogenized w strain were used in all the experiments. They were kept in a 25 °C, 70% humidity, 12 h light/ 12 h dark incubator. Spermidine (S4139, Sigma, Austria) was prepared as a 1 M stock solution in sterile distilled water, aliquoted in single use portions and stored at -20 °C. New stock solution was prepared once a month. Spermidine was mixed to liquid food medium (2.2% sugar beet syrup, 8% malt extract, 1.8% yeast, 1.2% nipagine). In a preliminary experiment, we tested that the flies ate normally when fed with spermidine supplemented food to exclude a dietary restriction effect on life span. Food colorant was added to normal food and food mixed with 10 μM, 100 μM, 1 mM and 10 mM spermidine. The intensity of the color in the flies' abdomens was checked regularly for 24 hours. We could not detect any difference between the control group and the groups fed spermidine at all concentrations. Where indicated, the preservatives propionic acid (0.84%) and phosphoric acid (0.05%) were added to the food.

Newly enclosed flies were collected for a total of 60 flies in each group. Both males and females were studied. Data presented are from experiments with female flies, the effects on male flies were smaller but significant (data not shown). Twenty flies of the same sex were put in an empty vial closed with a foam plug in which a cut was made to insert a filter paper soaked with 400 μl of food. The filters were replaced by new ones and dead flies were counted every weekday. Over the weekend, 1.2 ml of food was given to the flies. Comparison of survivorship data was performed using log rank and Wilcoxon survival tests and corrected for multiple comparisons against the control group. Each sex and replicate was analyzed separately.

The lines for the generation of the Atg7 homozygous and heterozygous flies were kindly provided by Dr. T. Neufeld (University of Minnesota, USA; (G. Juhasz, B. Erdi, M. Sass, T. P. Neufeld, Genes Dev 21, 3061-3066 (2007).)). The homozygote mutants, Atg7^dl4/Atg7^d77 are homozygous mutant for Atg7, heterozygous for Sec6 and CG5335. The flies of the genotype CG5335^d30/Atg7^d14 (heterozygous for Atg7, Sec6 and CG5335) were used as controls. For life span experiments of Atg7 mutants, an yw control (obtained from The Bloomington Stock Center, Indiana, USA) was included as the closest genetic background for the Atg7 lines. Similar results were obtained as compared to CG5335 /Atgr¹⁴ flies (data not shown). The w line was also included to control for the replicability of the results (similar results as replicates shown in Fig. 3 C were observed; data not shown).

Autophagy Measurements in Drosophila Tissue

W¹¹¹ females were kept for 48 hours on normal food (control), food supplemented with 1 mM spermidine (spermidine) or on a 10% glucose solution (starved). Muscles from the thorax and sections of the esophagus were dissected in PBS and then transferred for two minutes in a PBS solution containing the fluorescent dyes Hoechst 4432 (dilution 1:1000) and LysoTracker Red DND-99 (Invitrogen, Ref L7528) diluted 1:10000. After staining, the tissues were transferred on a microscope slide (SuperFrost UltrάPlus Menzel-Glaser Nr. J4800AMNZ), covered with a cover slip and immediately imaged with a fluorescence microscope Zeiss axioplan 2 imaging / Coolsnap HQ. At least 20 flies were imaged for each group. On each picture from the muscles, the number of autophagic vesicles recognized by the LysoTracker dye and the nuclei were manually counted. The ratio of vesicles to nuclei was calculated for each picture and analyzed with a Kruskal-Wallis test corrected with a Bonferroni post-hoc tests.

Experimental Animals and Determination of Thiol Groups in Mice Serum

Male and female C57BL/6 mice were purchased from the Institut fur Labortierkunde und - genetik, Himberg, Austria. All animals were used at an age between 12 and 16 weeks. All mice were kept and treated according to institutional guidelines and Austrian law and the experiments were approved by the responsible governmental commission. For each group, one male and two female mice were housed singly and fed ad libitum with regular food (pellets) and spermidine was supplemented to drinking water in concentrations of 0.3 and 3 mM for 200 days. Controls were given pure drinking water. Drinking water was replaced every 2-3 days and spermidine freshly added from 1 M aqueous stock (spermidine/HCl pH 7.4), which was kept at -20°C for no longer than one month. Food and body weight, calculated on a weekly basis, remained unaffected by supplementation of spermidine (data not shown), indicating that not calorie restriction could account for the observed effects. At the end of the experiment, the animals were anesthetized by ether inhalation, and exsanguinated by heart puncture. Peripheral blood was allowed to clot for 20 min, and serum was obtained by centrifugation at 200 g for 10 min. The spleens and livers (shock frozen in liquid nitrogen and stored at -80 °C upon further use) were immediately excised. Serum was used for determination of free thiol groups by Ellmans' reaction ( G. L. Ellman, Arch Biochem Biophys 82, 70-77 (1959) and C. K. Riener, G Kada, H. J. Gruber, Anal Bioanal Chem 373, 266-276 (2002).) as described previously (E. Schraml et al, Exp Gerontol 42, 1072-1078 (2007).). Spleen weight, which was similar in all groups, indicated that all mice were of similar general health (data not shown).

Extraction of Polyamines for LC/MS/MS Measurements

For acid extraction of polyamines from yeast cells (D. Balasundaram, C. W. Tabor, H. Tabor, Proc Natl Acad Sci U S A SS, 5872-5876 (1991)) culture equivalents of 20 OD₆₀₀ were washed three times with ddH₂O, resuspended in 400 μl ice-cold 5% TCA, and incubated on ice for one hour with vortexing every 15 min. Supernatants were neutralized with 100 μl of 2 M K₂FIPO₄ and stored at -80 °C upon polyamine measurements using LC/MS/MS. Extraction of polyamines from mice liver tissue and from flies was performed according to the freeze/ thaw- method described by Minocha et al. (R. Minocha, W. C. Shortle, S. L. Long, S. C. Minocha, J Plant Growth Regul 13, 187-193 (1994).) with slight modifications. Briefly, about 50-75 mg of mice liver tissue or 15-20 mg of whole flies were semi-homogenized using Fisherbrand Disposable Pestle System (Fisher scientific) and polyamines extracted with 400 μl 5% TCA by three repeated freeze-thaw cycles. After extraction 100 μl of 2 M ammonium formiate were added to supernatants and stored at -80 °C upon polyamine measurements using LC/MS/MS.

Polyamine Measurements using LC/MS/MS

Polyamines were determined according to the method described previously by Gianotti et al. (V. Gianotti et al., J Chromatogr A 1185, 296-300 (2008).). All experiments were carried out on an Ultimate 3000 System (Dionex, LCPackings) coupled to a Quantum TSQ Ultra AM (ThermoFinnigan) using an APCI ion source. The system was controlled by Xcalibur Software 1.4. The stationary phase was a Sequent ZIC-HILIC column (150 x 2.1 mm, 3μm, 100 A). The elution solvent A was 50 mM ammonium formiate in ultra pure water and solvent B was acetonitrile. Separation was performed with 15% acetonitrile for 2 min. Thereafter, the acetonitrile content was linearly decreased to 5% over 2 min. After 1 min, acetonitrile content was increased to 15% for column equilibration. Flow rate was set to 300 μl/min.

Polyamines were detected in MRM mode using following transitions: spermidine (m/z 146 -> 72, CE 34 eV), putrescine (m/z 89 -> 72, CE 28 eV), bis(hexamethylene)-triamine as internal standard (m/z 216 -> 100, CE 36 eV). Calibration standards were prepared by spiking extraction buffer with specific concentrations of spermidine, putrescine and internal standard. 20 μl of each sample were injected.

Yeast Strains and Molecular Biology

Experiments were carried out in BY4741 (MATa his3Δl leu2Δ0 metl5Δ0 ura3Δ0) and respective null mutants, obtained from Euroscarf. The double mutant Δiki3Δsas3 was generated according to Gueldener et al. (Gueldener et al. Nucleic Acids Res. 2002 Mar 15;30(6):e23) by using gene-specific URA3-knockout cassette, amplified by PCR with pUG72 as template (E. Lovaas, G. Carlin, Free Radic Biol Med 11, 455-461 (1991).). Primers are listed in Table 2. The double mutant phenotype was confirmed using a strain generated by mating and sporulation of the respective single mutants (BY4742 Δiki3 MATα and BY4741 Δsas3 MATa). AU spel double mutant strains were obtained through mating and sporulation of BY4741 Δspel with the respective BY4742 (Matα) single mutant strains. Single and double mutant strains were verified for correct gene deletion by PCR with primers listed in Table 2 and further checked for consistent auxotrophies. Notably, at least three different clones of each generated mutant were tested for the survival plating during aging to rule out clonogenic variation. Strains were grown at 28 °C on SC medium containing 0.17% yeast nitrogen base (Difco), 0.5% (NHU)₂SO₄ and 30 mg/1 of all amino acids (except 80 mg/1 histidine and 200 mg/1 leucine), 30 mg/1 adenine, and 320 mg/1 uracil with 2% glucose (SCD). To demonstrate the complete requirement of polyamines for life span extension upon media alkalinization, experiments were carried out in polyamine-free SCD, obtained by sterile filtering and special treatment of glass ware as described (V. D. Longo, E. B. Gralla, J. S. Valentine, J Biol Chem 271, 12275-12280 (1996).). To construct NHP6A-ΕGFP in pUG35- Ura (giving rise to a C-terminally tagged chimeric fusion protein under control of the met25- Promotor) the insert was amplified by PCR using genomic DNA from BY4741 as template and cloned into pUG35 using the EcoRI restriction site. The EGFP-ATG8 construct in pUG36-Ura (N-terminally tagged fusion protein) was similarly generated, using EcoRI and CIaI restriction sites. Primers are listed in Table 2.

Yeast Survival Plating and Test for Cell Death Markers

For chronological aging experiments, cultures were inoculated from fresh overnight cultures to OD_60O of 0.1 (~1-10⁶ cells/ml) with culture volume being 10% of flask volume and aliquots were taken out to perform survival plating at indicated time points (B. Liu, A. Sutton, R. Sternglanz, J Biol Chem 280, 16659-16664 (2005).). Survival at day 1 of wild type control cultures was set to 100% and other samples calculated accordingly. If not otherwise indicated, representative aging experiments are shown with at least three independent samples (as indicated) aged at the same time, which have been repeated at least twice with similar outcome. In case of experiments with Δspel (Fig. 2 A-E), all strains were inoculated to 5-10 cells/ml. Upon deletion of both IKI3 and SAS3 we observed slight aggregation of cells possibly due to a defect in late budding events. Therefore, for calculation of survival rates in experiments using Δiki3Δsas3, cell numbers of each sample were determined after two pulse of sonication on ice with Sonifier 250 from Benson (Duty Cycle: 35; Output Control: 2.5). Tests for apoptotic (TUNEL and Annexin V staining) and necrotic (PI staining) markers as well as markers for oxidative stress (DFIE staining) were performed as described (B. Dod, A. Kervabon, J. Parello, Eur J Biochem 121, 401-405 (1982)). For quantifications using flow cytometry (BD F ACS Aria), 30,000 cells were evaluated and analyzed with BD FACSDiva software. Spermidine (S4139, Sigma, Austria) and putrescine (P5780, Sigma, Austria; 1 mM final concentration) were added to stationary cultures at day 1 of the aging experiments (24 h after inoculation). 1 M aqueous stock solution of spermidine was stored in one use aliquots at -20 °C for no longer than 1 month. For adjustment of extracellular pH (pH_eX) to 6 (+ 0.5), the required amount of sodium hydroxide was added 30 h after inoculation. The pH_ex was maintained at approximately 6 (± 0.5) throughout the aging.

As a further marker for necrosis, nuclear release of the yeast HMGBl homolog (NhpβAp) was monitored by epifluorescence microscopy of ectopically expressed chimeric fusion protein Nhp6Ap-EGFP. Therefore, yeast strains transformed with p\JG35/NHP6A were grown on SCD lacking uracil and aged until indicated time points. Cells were washed once with PBS and directly applied to epifluorescence microscopy with the use of small-band EGFP filter (Zeiss) on a Zeiss Axioskop microscope in order to monitor intracellular localization of Nhp6A-EGFP. Expression during aging was verified by immunoblotting (data not shown). Notably, release of Nhp6 A-EGFP to the extracellular space, which has been reported for mammalian HMGBl (M. T. Lotze, K. J. Tracey, Nat Rev Immunol 5, 331-342 (2005)), could not be detected in yeast after 10Ox concentration of culture media (data not shown).

Yeast Replicative Life Span Determination

For replicative life span analysis of BY4741 synthetic complete glucose medium (SC- glucose) containing 2% (w/v) D-glucose, 0.17% yeast nitrogen base (Difco), 0.5% (NHt)₂SO₄, and 10 ml complete dropout was used. Complete dropout contains: 0.2% Arg, 0.1% His, 0.6% lie, 0.6% Leu, 0.4% Lys, 0.1% Met, 0.6% Phe, 0.5% Thr, 0.4% Trp, 0.1% Ade, 0.4% Ura, 0.5% Tyr. Agar plates were made by adding 2% (w/v) agar to the media. Where necessary, spermidine from a freshly prepared aqueous stock solution (0.2 M, pH 7.0) was added to a final concentration of 1 mM. Pre-tests showed that this concentration does not influence growth properties of fraction V cells (data not shown). Preparation of senescent yeast cells (fraction V) by elutriation was performed as described in Laun et al. (P. Laun et ah, MoI Microbiol 39, 1166-1173 (2001).). To determine the remaining life span of fraction II and fraction V cells, cohorts of 80 randomly chosen cells per fraction were taken directly after elutriation and, for each cell, the number of remaining cell cycles was determined by micromanipulation. Cells that never budded were excluded from analysis. Statistical analysis was performed as described in Laun et al. (P. Laun et al, MoI Microbiol 39, 1166-1173 (2001).).

Electron Microscopy

Yeast cells were aged to day 20 or logarithmically grown (day 0), transformed into spheroblasts and fixed in 2% glutaraldehyde (Sigma, Austria) for 1 hour. Spheroblastation was performed using zymolyase (20 U/ml), lyticase (100 U/ml), and glucoronidase/arylsulfatase (7 μl/ml) (Roche, Austria) in 20 mM potassium phosphate buffer (pH 7.4) with 1.2 M sorbitol for 70 minutes at 28 °C. Glutaraldehyde fixation was done in 20 mM potassium phosphate buffer (pH 7.4) with addition of 0.4 M potassium chloride for osmotic stabilisation of spheroblasts. Fixed cells were postfixed in osmium tetroxide and prepared for electron microscopy as described (B. Fahrenkrog, E. C. Hurt, U. Aebi, N. Pante, J Cell Biol 143, 577-588 (1998)). Thin sections were cut on a Reichert Ultracut microtome (Reichert-Jung Optische Werke, Vienna, Austria) using a diamond knife (Diatome, Biel, Switzerland). The sections were collected on parlodion coated copper grids and stained with 6% uranyl acetate for 1 hour followed by 2% lead citrate for 2 minutes. Electron micrographs were recorded with a Hitachi H-7000 transmission electron microscope (Hitachi Ltd., Tokyo, Japan) operated at an acceleration voltage of 100 kV.

Immunoblotting and Quantification of Histone Acetylation

Trichloroacetic acid whole-cell extracts were prepared according to the method described by Kao et al. (L. Howe et al, Genes Dev 15, 3144-3154 (2001).). Proteins were separated on 15% SDS-PAGE for Western blot analysis on PVDF membrane (Millipore) as described (F. Madeo et al, MoI Cell 9, 911-917 (2002).) using CAPS buffer (10 mM 3-(Cyclohexylamino)- 1-propanesulfonic acid, 10% methanol) for transfer of proteins. Blots were probed with the rabbit polyclonal antibody against histone H3 (abl791, Abeam) (1:5,000), which served as a loading control for total histone H3, as well as the following histone H3 modification antibodies (Upstate Biotechnology): K56ac (1:6,000) (J. Recht et al, Proc Natl Acad Sci US A 103, 6988-6993 (2006).); K18ac (1:10,000); and K9+14ac (1:10,000). Peroxidase- conjugated affinity-purified secondary antibody was obtained from Sigma. For quantification of relative acetylation blots were scanned using a densitometer (Molecular Dynamics, Model P.D. 300) and quantified with ImageQuant Version 5.1 (Molecular Dynamics). Band densities of acetylation specific blots were normalized to the respective densities of total histone H3 blots in order to obtain specific acetylation rates for each sample. Acetylation rates of wild type control cultures were normalised to 1 and the relative acetylation of each sample was calculated accordingly.

Yeast Intracellular pH Measurement

Intracellular pH (pHi) of aging yeast cells was assessed by FACS analysis of cells stained with the pH-dependent fluorescent dye SNARF-4F (Invitrogen, Austria), following the method described by Valli et al. (M. Valli et ah, Appl Environ Microbiol 71, 1515-1521 (2005)) with slight modifications. The dye is applied as its acetomethyl ester (SNARF-4F- AM) and needs to be activated by intracellular esterases. In order to ensure sufficient activation in aging cells the incubation time for dye loading was increased to 30 minutes.

Spontaneous Mutation Frequency and Budding Index

Spontaneous mutation frequency was determined based on the appearance of mutants able to form colonies on agar plates containing 60 mg/1 L-canavanine sulfate according to Fabrizio et al. (P. Fabrizio et al, JCeIl Biol 166, 1055-1067 (2004).). Mutation rates were calculated per 10⁶ living (colony forming on YEPD) cells. Budding index was assessed by counting the percentage of budded cells after 10 seconds of sonication on ice using Sonifier 250 from Benson (Duty Cycle: 35; Output Control: 2.5) in micrographs of no more than 40 cells. For each sample, at least 500 cells were evaluated.

Oxygen consumption

Oxygen consumption was directly determined in 1.7 ml of chronologically aged yeast cultures transferred to a recording chamber by measuring the decline of oxygen concentration under anaerobic conditions using an oxygen electrode. Slopes were calculated over 15 min within the linear decrease of oxygen (minute 2 - 17) and normalized to living cells as determined by plating on YEPD agar plates.

Fractionation of "upper" and "lower" (quiescence) cells Cells were cultured in SCD media as described in section on "Yeast Strains and Molecular Biology". Percoll density gradient centrifugation was performed according to Allen et al. (C. Allen et al, J Cell Biol 174, 89-100 (2006)). Cell counts for each fraction were determined using a CASY cell counter (Innovatis).

Yeast Nuclear Extract Preparation

Yeast nuclei were isolated from 200 ml BY4741 wild type culture (grown for 24 h in SCD to stationary phase) as described previously (S. Buttner et al, MoI Cell 25, 233-246 (2007)). Nuclear extract was prepared using nuclear extraction buffer from Bio Vision's Nuclear/ Cytosol Fractionation Kit (Bio Vision, K266-25) without DTT addition, according to the manufacturer's protocol. Incubation time was doubled to 80 min with vortexing every 8 minutes. Protein concentration was determined via Bradford, giving yields of approximately 1 mg/ml protein. Yeast nuclear extract was immediately subjected to HAT activity assays.

HAT Activity Assay

For HAT-activity determination the commercially available HAT Activity Colorimetric Assay KIT from Bio Vision (Bio Vision K332-100) was employed. HAT assays were performed according to the manufacturer's protocol. In brief, assays were performed with each 15 μg of yeast nuclear extract or nuclear extract of HeLa-cells (Bio Vision K332- 100-4), respectively. Spermidine was added at a final concentration of 100 mM 15 minutes after assay initiation. Development of tetrazolium dye was measured by absorption at 440 nm using a GeniosPro plate reader (Tecan). Background readings were done with samples without NADH generating enzyme, giving the nuclear extracts unspecific background activity and eliminate any possible negative effects of spermidine addition on the assay itself. For calculation of relative HAT activity linear regression over 100 minutes within the suggested assay time (minute 95 to 195) was performed to determine the slope of dye development. Regression coefficients of R² > 0.99 were obtained. Calculated slopes of spermidine treated samples were compared to slopes of untreated samples which were set to a relative activity of 100%.

Yeast RNA Isolation and Affymetrix Array Analyses Total RNA extraction from chronologically aged yeast cells (with or without spermidine application) by glass bead disruption were performed using RNeasy MiniKit (Qiagen) according to the manufacturers' instructions. 10⁸ cells were used after shock freezing in liquid nitrogen and storage at -80 °C upon preparation. RNA of two independent aging experiments at day 3 and 10 of the aging experiment (biological replicates) was applied to Affymetrix Array Analyses.

Syntheses of cDNA and hybridization experiments were outsourced to the Microarray Facility Tuebingen, Germany, an authorized Affymetrix Service Provider. Hybridization was done onto high-density oligonucleotide arrays Yeast Genome 2.0 (Affymetrix). Both, experimental and data analysis workflow were fully compliant with the MIAME 2.0 Standard. Annotation Data for the Yeast Genome 2.0 Array were supplied by Affymetrix Inc. Raw data were normalized with GCRMA (Z. Wu, R. A. Irizarry, R. Gentleman, F. Martinez-Murillo, F. Spencer, Journal of the American Statistical Association 99, 909-918 (2004)) using CarmaWeb (J. Rainer, F. Sanchez-Cabo, G. Stacker, A. Sturn, Z. Trajanoski, Nucleic Acids Res 34, W498-503 (2006).). P-values were calculated with a paired T-Test comparing untreated (controls) with treated (spermidine supplemented) samples at the respective tune points using TM4 MeV software (A. I. Saeed et al, Biotechniques 34, 374-378 (2003).).

Yeast Autophagy Measurements

Autophagy was monitored either by vacuolar localization of Atg8p using fluorescence microscopy of cells expressing an EGFP-Atg8 fusion protein (T. Kirisako et al, J Cell Biol 147, 435-446 (1999).) or by alkaline phosphatase (ALP) activity according to Kissova et al. (I. Kissova. M. Deffieu, S. Manon, N. Camougrand, J Biol Chem 279, 39068-39074 (2004).) using BY4741 wild type strain transformed with and selected for stable insertion of pTN9 HindIII fragment (confirmed by PCR). In order to correct for intrinsic (background) ALP activity, BY4741 (without pTN9) have been simultaneously processed and ALP activity subtracted. For generation of EGFP-^t TG8 constructs see section on Molecular Biology.

Study of the effect of spermidine in Daphnia magna

Daphnia magna were used in a full lifespan testing of the effects of different concentrations of spermidine. Since the test compound was suspected to act on the prolongation of the life span, the main endpoint targeted by this study was the longevity. Experimental phase 1: The Daphnia brood was kept at low metabolic rate in the laboratory, these animals are not suited for direct use when starting experiments. Therefor standard operating protocols have been followed which recommend the use of offsprings from mothers produced in good conditions. For this, 64 brood grand mothers (F-2)) were raised in optimal conditions with excess algae feed (1 mg C/ liter.Daphnia) to produce suitable offspring for the trial. On 16^th march hundred and forty F-I neonates freshly born (24 h aged) were transferred to 70 vessels (2 Daphnia per vessel) and are being raised until sexual maturity. Their offspring (FO) will be used for the tests starting next week.

Experimental phase 2: The a nimals were treated in a standard culture water (ADaM medium) that has been oxygenated for 24 h before use. The temperature was fixed at 19° C and an artificial murnination is used with a 16-hour light and 8-hour dark cycle. Freshly harvested unicellular green alga (Scenedesmus obliquus) were used to feed the Daphnia. Spermidine is uptaken during water filtration for food by the test animals.

Testing : In total seventy glass bottles were used. Five Daphnias (FO) were placed in each bottle containing 100 ml of test water with 6 different concentrations of spermidine (0.1-1-10- lOOμM- ImM -IM) and control (no spermidine). This range of spermidine concentration had been chosen to correspond to the ranges so far tested in different studies on flowers, fruits, algae, worms, fruit flies (Drosophila), human and rodent cells. The effect of the test compound on the longevity of Daphnia was tested at low food "near chronic starvation stress" condition (0.05 mg C/liter.Daphnia) and at high food "optimal" condition (0.5 mg C/liter.Daphnia). Each test condition was 5 times replicated and comprises 25 animals. Chronic food stress is expected to shorten life.

Daily care : Daphnias were checked every day in the morning. In case new-born neonates were observed they were counted and immediately removed from the vessels to not eat the food for experimental animals and to avoid crowding in the vessels. Dead individuals, if any, were also counted and removed. The concentrations of the test compound were renewed every morning (100% renewal) using stock solutions prepared in advance at the start of the experiment. Daphnia were fed once a day with an appropriate concentration of alga. Endpoints measured : In the course of the trial

^■ Growth: size at different ages, growth rate.

^■ Reproduction: age at 1^st maturity, intervals between clutches and number of babies per clutch. Daphnia reproduce parthenogenetically usually when conditions are favorable. Juvenile animals are nurtured in the brood pouch inside the carapace. The newly hatched Daphnia must molt several times before they are fully grown into an adult usually after about two weeks. The folly mature females are able to produce a new brood of young about every ten days under ideal conditions.

^■ Survivorship was recorded in the course of the trial. Mortality should not be confounded with natural senescence.

At the end of the trial

^■ Longevity (natural or spermidine inhibited senescence).

Observation

Since the spermidine was thought to prolongate the life span, the experiment was stopped when a clear-cut significant difference was observed between spermidine treated and non-treated groups. This observation was expected to happen when animals get old at the end of their lifespan, following the onset of the natural senescence depending on the treatment conditions.

This was expected around an age between 40 and 60 days.

Statistical Analyses

Except for Drosophila experiments (see section on Drosophila life span experiments and autophagy measurements) and for replicative aging (see section on replicative life span of yeast), statistical analyses were performed using Students T-Test (one-tailed, unpaired).

Examples on Results

Histone H3 acetylation is regulated by intracellular polyamines in part mediated through Iki3p and Sas3p, as shown in Figure 6 with: (A) Immunoblot of whole cell extracts of wild type cells chronologically aged to designated time points with (+) or without (-) spermidine application. Blots were probed with antibodies against total histone H3 or H3 acetylation sites at the indicated lysine residues; (B) Relative acetylation of histone H3 lysine 9+14 of Δspel cells compared to wild type cells chronologically aged to day 5 with (open bars) or without (closed bars) adjustment of pH_eχ to 6. Data represent means ± SEM of three independent experiments. **p < 0.01; (C) Quantification (FACS analysis) of phosphatidylserine externalization and loss of membrane integrity using AnnexinV/PI co- staining performed at day 20 of the chronological aging experiment shown in (Fig. 4D). For each staining 30,000 cells were evaluated. ***p < 0.001; (D) Immunoblot of whole cell extracts of wild type and Δih3Δsas3 cells with (+) or without (-) spermidine application obtained at day 20 of the aging experiment shown in (Fig. 4D). Blots were probed with antibodies against total histone H3 or H3 acetylation sites at lysine 9+14 (Lys9+14).

Exogenous supply of spermidine to chronologically aging (BY4741 wild type) cells (at day 1) caused a drastic increase in yeast life span by a factor of up to 4 times, as determined in clonogenic assays that monitored the frequency of viable cells (Fig. IB). Similar results were obtained using the wild type strain DBY746 (data not shown). Supplementation of spermidine led to a stable increase in the intracellular spermidine level in aging cells that otherwise would exhibit a decrease in spermidine levels (Fig. 3 A, C).

While chronological aging serves as a model for aging of post-mitotic tissues, replicative aging of yeast models the life span of dividing cells in higher eukaryotes. Both aging systems are interrelated, since replicatively old cells die early during chronological aging (C. Allen et al, J Cell Biol 174, 89-100 (2006)). We therefore analyzed the differential effect of spermidine on replicatively young and old cells obtained by elutriation (P. Laun et al, MoI Microbiol 39, 1166-1173 (2001)). The remaining replicative life span of old cells was significantly increased by spermidine (Fig. 3D, fraction V cells, p < 0.02) while no apparent effect was observable on the remaining life span of replicatively young cells (fraction II cells, Fig. 3D). These aged yeast cells treated with spermidine did not only exhibit an increased life span, but also a strong resistance against stress inflicted by heat shock or H₂O₂ treatment (Fig. 4). Present invention also demonstrates that orally delivered spermidine is actively taken up and can be used to increase the intracellular levels of bioactive spermidine .Ordinary food (full media) of the fruit fly Drosophila melanogaster with spermidine. Low doses of spermidine increased the mean life span of flies up to 30% (Fig. 3E, p = 0.0002 for 1 mM; for mean life spans and replicates see Fig. 3). Measurement of endogenous polyamines confirmed that intracellular spermidine levels were stably increased by spermidine supplementation of -20% compared to controls. Of note, putrescine (a poryamine interconvertable with, spermidine) was not detectable in control samples but clearly present in spermidine fed flies (~ 100 nmol/g) indicating that spermidine was indeed taken up and metabolized by the flies cells (data not shown).

We next asked whether polyamines also enhanced the lifespan of human peripheral blood mononuclear cells (PBMC), and monitored survival by means of co-staining with Annexin V/7-AAD (unstained cells were regarded as viable) After 12 days, only 15% of the cells survived in PBMC control cultures, whereas up to 50% of the cells survived after addition of 20 nM spermidine (Fig. 3B). Unexpectedly, the rescuing effect was not due to inhibition of apoptotic cell death, as the percentage of apoptotic cells (positive for Annexin V but negative for 7-AAD) remained unaltered. Instead, cell death associated with membrane rupture indicative of necrosis (as evident by dual 7-AAD and Annexin V staining) was markedly reduced (Fig. 5).

One of the most widely accepted theories of aging is the free radical theory that explains aging by accumulating oxidative stress (D. Harman, J Gerontol 11, 298-300 (1956)). Consistently, in rodents the level of oxidative stress and protein damage increases with age, observable in the serum by a decline of free thiol groups (E. Schraml et ah, Exp Gerontol 42, 1072-1078 (2007)). Feeding mice with 3 mM spermidine (supplemented to drinking water) for 200 days increased the serum level of free thiol groups by ~30%, indicative of reduced age-related oxidative stress (Fig. 3F). Notably, such an increase of free thiol groups is comparable to the natural decline that has been observed during the course of aging (between young and old rodents) (E. Schraml et al, Exp Gerontol 42, 1072-1078 (2007)). Again, intracellular spermidine levels were significantly increased by exogenous spermidine supplementation as determined in liver cells (Fig. 3G).

Next, we investigated the effect of poryamine depletion on aging, using a yeast strain deleted in SPEl (Δspel) and hence unable to synthesize polyamines. Polyamine depletion, as confirmed by measurement of intracellular spermidine (Fig. 7A), caused a drastic drop in yeast chronological life span (Fig. 7B), which can be restored by supplementation with spermidine or putrescine, the obligate precursor of spermidine (data not shown). Consistent with the free radical theory of aging (D. Harman, J Gerontol 11, 298-300 (1956).), we observed an enhanced accumulation of oxygen radicals upon disruption of SPEl, as measured by dihydroethidium (DHE) staining (Fig. 7C, 7D). An enhancement of radicals upon SPE2 deletion has also been shown in growing cells (M. K. Chattopadhyay, C. W. Tabor, H. Tabor, Yeast 23, 751-761 (2006)). Since oxidative stress can cause apoptosis in yeast (F. Madeo et al, J Cell Biol 145, 757-767 (1999)) we determined apoptotic markers of wild type and polyamine depleted Aspel cells. Surprisingly, the frequency of apoptotic events (that is cells that exhibit DNA-fragmentation detectable by TUNEL or phosphatidylserine externalization detectable with Amiexin V) was not affected by SPEl deletion (Fig. 7E). Instead, we observed an increase in necrotic, PI positive cells in Aspel cultures as compared to wild type controls (Fig. 7E). Accordingly, deletion of apoptotic effector molecules (including the yeast caspase, Ycalp; apoptosis-inducing factor, Aiflp; endonuclease G, Nuclp; or the serine protease HtrA2/OMI, Nmalllp) in the background of Aspel did not prevent the aging-associated death accelerated by polyamine depletion (data not shown). We therefore conclude that depletion of intracellular polyamines can precipitate premature chronological aging via non-apoptotic, possibly necrotic death of yeast cells. Very few studies have addressed the mechanisms of necrotic cell death in a systematic fashion. Using C. elegans as a model, it has been demonstrated that acidification of the cytosol is required for necrotic cell death, whereas alkalinization has a cytoprotective effect (M. Artal-Sanz, C. Samara, P. Syntichaki, N. Tavernarakis, J Cell Biol 173, 231-239 (2006), P. Syntichaki, C. Samara, N. Tavernarakis, Curr Biol 15, 1249-1254 (2005)). In yeast, adjustment of the extracellular pH from normally 3.5 to 6.5 not only extends chronological life span (P. Fabrizio et al, J Cell Biol 166, 1055-1067 (2004)) but also stabilizes the intracellular pH in a polyamine dependent manner (Fig. 12B), corroborating the assumption that cytosolic acidification limits cellular life span. Since addition of 4 mM spermidine to chronologically aging yeast increases the extracellular pH to 6 (± 0.5), we asked, if indeed intracellular polyamines (e.g. spermidine) were responsible for life span extension under these conditions. Making use of polyamine depleted cells (Aspel), we demonstrate that the protective effect of external alkalinization on longevity, and thus of spermidine application, is strictly dependent on intracellular polyamines (Fig. 12A).

Consistent with an anti-necrotic effect of alkalinization in C. elegans, spermidine treatment procures a drastic reversion of age-associated necrosis in yeast. Determination of cell death markers revealed that markers of necrosis and oxidative stress (DHE positivity) were drastically diminished upon spermidine treatment (Fig. 9C). In contrast, externalization of phosphatidylserine, an early apoptotic marker (Annexin V⁺ PI^" cells), remained largely unaltered. Instead, loss of membrane integrity due to primary necrosis (PI positivity) and late apoptosis resulting in secondary necrosis (Annexin V⁺ PI⁺) was reduced from 50% to less tihan 10% in spermidine-treated cultures as late as after 18 days of aging (Fig. 9C). We therefore conclude that death associated with chronological aging of yeast is mainly mediated by spermidine-inhibitable necrosis-like cell death. Consistently, electron microscopy of old cells (day 20) showed necrotic disintegration of subcellular structures and plasma membrane ruptures, while the ultrastructure of spermidine-treated samples of the same age resembled that of young cells (Fig. 9E; overview in Fig. 10). Nuclear release of the high mobility group box 1 protein (HMGBl), a chromatin bound non-histone protein, is a defining feature of necrosis in mammalian cells (P. Scaffidi, T. Misteli, M. E. Bianchi, Nature 418, 191-195 (2002)). Fluorescence microscopy detected a nucleo-cytosolic translocation of the yeast HMGBl homolog NhpόAp (which was rendered visible with an EGFP tag) after 14 days of aging (Fig. 9D). Again, this necrotic feature was prevented by application of spermidine (Fig. 9D). Thus, spermidine treatment protects against aging by inhibition of necrosis. As the extended life span of spermidine-treated cultures was neither associated with an increased mutation frequency nor a higher budding index (Fig. 11), we speculated that epigenetic modifications rather than genetic changes (such as the regrowth of death-resistant mutants) were responsible for the positive impact of spermidine on longevity. We could also exclude that a simple direct anti-oxidant effect of polyamines (E. Lovaas, G. Carlin, Free Radic Biol Med 11, 455-461 (1991)) could account for the observed life span extension. Global histone deacetylation, a key event of epigenetic chromatin modification, is associated with prolonged life span and healthy aging in a wide range of organisms (V. D. Longo, B. K. Kennedy, Cell 126, 257-268 (2006), A. A. Sauve, C. Wolberger, V. L. Schramm, J. D. Boeke, Annu Rev Biochem 75, 435-465 (2006).). Since (de)acetylation of lysyl residues of histone H3 is critical for yeast longevity, at least during replicative aging (S. Imai, C. M. Armstrong, M. Kaeberlein, L. Guarente, Nature 403, 795-800 (2000)), we analyzed the effects of spermidine on the level of histone acetylation by means of a panel of specific antibodies that detect H3 acetylation at 4 different lysyl residues. The improved life span of aging wild type cells treated with spermidine correlated with hypoacetylation of histone H3 at all monitored acetylation sites (Fig. IA, Fig. 12). Conversely, premature death of aging SPEi-deleted cells was accompanied by hyperacetylation of histone H3 (Fig. IB). These results hint to an obligatory role for polyamines in the regulation of histone acetylation during aging. In line with the strict requirement of polyamines for life span extension upon extracellular alkalinization, we observed hypoacetylation of the chromatin only in wild type, but not in SPEl knockout cells upon alkalinization of the culture medium (Fig. 12B). These results suggest that global deacetylation and polyamines are connected to the extension of chronological life span in yeast.

As the role of the Sir2p deacetylase is well established in replicative aging (V. D. Longo, B. K. Kennedy, Cell 126, 257-268 (2006), S. J. Lin, P. A. Defossez, L. Guarente, Science 289, 2126-2128 (2000)), we tested its potential involvement in polyamine-promoted longevity during chronological aging. However, deletion of SIR2 did not abrogate the ability of spermidine to extend the chronological life span (data not shown, Table 1). Thus, the observed hypoacetylation during chronological life span extension is not due to the sole induction of Sir2p activity. Similarly, single deletion of all other known yeast sirtuins (HSTl, HST2, HST3, HST4) did not affect longevity upon spermidine application (Table 1). This result is compatible with previous findings suggesting that chronological life span extension by calorie restriction is not mediated by Sir2p activity (P. Fabrizio et ah, Cell 123, 655-667 (2005)) nor by any of the other yeast sirtuins (D. L. Smith, Jr., J. M. McClure, M. Matecic, J. S. Smith, Aging Cell 6, 649-662 (2007).).

Theoretically, spermidine treatment could lead to hypoacetylation either via activation of histone deacetylases or via inhibition of histone acetyltransferases (HATs). Therefore, we determined the effects on aging of the disruption of 28 genes involved in histone (de)acetylation in the presence or absence of spermidine. The anti-aging (pro-survival) effect of spermidine was partially abrogated in two of these strains, namely Aiki3 and Asas3 (data not shown, Table 1). Interestingly, the histone acetyl transferase Sas3p preferentially acetylates histone H3 at lysine 14 (L. Howe et ah, Genes Dev 15, 3144-3154 (2001)), one of the acetylation sites that is profoundly influenced by the availability of intracellular polyamines (see above). Deletion of IKI3, an essential subunit of the histone acetylating elongator complex, has been reported to reduce histone H3 acetylation at lysine 14 as well (G. S. Winkler, A. Kristjuhan, H. Erdjument-Bromage, P. Tempst, J. Q. Svejstrup, Proc Natl Acad Sd U S A 99, 3517-3522 (2002)). Consequently, we generated the double mutant Aiki3Asas3 in an attempt to diminish these overlapping HAT-activities converging on lysine 14 of histone H3.

Chronologically aged Δiki3Asas3 cells responded significantly less to the anti-aging effect of spermidine than wild type cells (Fig. ID, p = 0.002 for day 20). At day 20, spermidine treatment increased survival of wild type cells by 5-fold compared to only 1.3-fold for Aiki3Asas3 cells, suggesting that Iki3p and Sas3p are, at least to some extent, required for the life span prolonging effects of spermidine. Moreover, the untreated double mutant showed an improved survival during chronological aging as compared to wild type controls (Fig. ID, p < 0.001 for day 20), indicating that histone acetylation activity is responsible for age- induced cell death. Accordingly, histone H3 acetylation was significantly reduced upon deletion of IKI3 and SAS3, and spermidine application barely reduced the level of acetylation in this mutant (Fig. IE). Evaluation of cell death markers revealed that increased survival of Aiki3A$a$3 cells is clearly due to the inhibition of necrotic death (PI staining) while apoptotic markers (Annexin V) remained constant (Fig. 2C). The combined knockout of IKI3 and SAS3 did increase the life span of yeast cells, yet failed to mimic the life span prolongation of spermidine in quantitative terms, presumably because epigenetic aging processes are likewise regulated by more than just two proteins that modify the level of histone H3 acetylation on one lysyl residue. An in vitro assay for HAT-activity revealed that spermidine efficiently inhibited general HAT activity in extracts of isolated yeast and mammalian nuclei (Fig. 1C, data not shown). These results suggest that spermidine-mediated anti-aging effects are achieved via direct inhibition of HAT-activity.

Autophagy is believed to be essential for healthy aging and longevity, and the autophagy- regulatory Tor-pathway constitutes one of three highly conserved signaling pathways controlling aging of various organisms (R. W. Powers, 3rd, M. Kaeberlein, S. D. Caldwell, B. K. Kennedy, S. Fields, Genes Dev 20, 174-184 (2006)). Spermidine induced signs of autophagy in flies (Fig. IH) and in cultured human cells (Fig. IG). Staining of lysosomes by LysoTracker Red in esophagus-tissue obtained from flies fed with 1 mM spermidine for 48 h exhibited a strong increase in the number of lysosomes indicative of autophagy, which even exceeded that of starved flies (Fig. IF, Fig. 13A for quantification). HeLa cells treated with 100 μM spermidine for 6 h showed a clear relocalization of LC3-GFP (the mammalian orthologue of Atg8p) into cytoplasmic puncta with a frequency of 40% (Fig. IG and fig. 13B). rmmunoblot detection of accumulating LC3-II, the pahnitoylated form of LC3, confirmed induction of autophagy by spermidine (fig. 13 C, D). Finally, deletion of ATG7-dependent autophagy completely abrogated spermidine-induced life span extension in flies (Fig. IG).

Altogether, our results demonstrate that epigenetic regulation of necrotic death determines the chronological life span of yeast and that this epigenetic regulation is mediated by proteins involved in histone acetylation (such as Iki3p and Sas3p), which in turn are inhibited by spermidine. Additionally, histone (de)acetylation (and subsequent regulation of cell death) might also be regulated by polyamines depending on their acetylation state thereby directly modifying chromatin accessibility (B. Liu, A. Sutton, R. Sternglanz, J Biol Chem 280, 16659- 16664 (2005)). Consistently, we observed that deletion of PAAl, the sole known polyamine acetyl transferase (B. Liu, A. Sutton, R. Sternglanz, J Biol Chem 280, 16659-16664 (2005)), effectively shortens yeast chronological life span accompanied by enhanced ROS levels (Fig. 14).

We showed that spermidine strongly induces autophagy in, flies and cultured human cells. Autophagy constitutes the major lysosomal degradation pathway recycling damaged and potentially harmful cellular material (such as damaged mitochondria). Of note, autophagy counteracts cell death and prolongs life span in various ageing models (L. Galluzzi et al, Curr MoI Med 8, 78-91 (2008)). Therefore, inhibition of necrotic cell death by autophagy could facilitate the long-term survival of spermidine-treated cells.

It is generally accepted that hypoacetylation is a key event of gene silencing (L. Guarente, Genes Dev 14, 1021-1026 (2000)). Silencing might be concomitantly linked to lower metabolic rates causing less ROS (i.e. superoxide) and longevity (L. Guarente, Genes Dev 14, 1021-1026 (2000)). This could be of high importance, especially in old cells, which suffer from damaged and inefficient mitochondria and therefore generate high ROS levels when respiration is active. In support of this hypothesis, we demonstrate that spermidine-treated cells, which showed largely hypoacetylated histones, reduced their oxygen consumption (Fig. 15, day 20). Intriguingly, these cells resemble the status of quiescence as we demonstrated by sucrose-gradient separation of upper (non-quiescent) and lower (quiescent) cells (Fig. 15B). Quiescent cells are unbudded cells, exhibiting low ROS, reduced markers of apoptosis and necrosis, and low metabolic rates (C. Allen et al., JCeIl Biol 174, 89-100 (2006).). Interestingly, TOR depletion or rapamycin treatment, which also induces autophagy, similarly causes cells to enter a quiescent (GO-like) state (E. Jacinto, M. N. Hall, Nat Rev MoI Cell Biol 4, 111 -126 (2003)). Thus, autophagic processes as well as hypoacetylation-induced silencing might cooperate to promote longevity of non-growing cells by promoting a low- metabolic quiescent state.

Aging-associated necrotic death can be inhibited by simple spermidine application to yeast, flies, and human immune cells or by genetic modification of the HAT machinery in yeast, arguing in favor of programmed rather than accidental necrotic death. Necrotic cell death culminates in the leakage of intracellular compounds and consequent local inflammation, which in turn is suspected to be a driving force of aging ("inflammaging"). Recently, Franceschi et al. proposed that chronic inflammation may be one of the driving forces of human aging, causing immunosenescence (C. Franceschi et al, Mech Ageing Dev 128, 92- 105 (2007)). In support of this theory, we showed that spermidine potently inhibits necrotic death during aging of human PBMCs and protects mice from oxidative stress. Thus, programmed necrotic processes might be of cardinal importance to understand the mechanisms of organismal aging in general.

Interestingly, polyamine concentrations decline during aging of various organisms, including humans (G. Scalabrino, M. E. Ferioli, Mech Ageing Dev 26, 149-164 (1984).) and plants (R. Kaur-Sawhney, L. M. Shih, H. E. Flores, A. W. Galston, Plant Physiol 69, 405-410 (1982)), and external application of spermidine inhibits oat leaf senescence (A. Airman, R. Kaur- Sawhney, A. W. Galston, Plant Physiol 60, 570-574 (1977)). Moreover, anti-oxidant as well as anti-inflammatory activities of polyamines have been described in human cells (E. Lovaas, G. Carlin, Free Radio Biol Med 11, 455-461 (1991)).

Thus, our findings may have implications ranging from basic aging processes to human aging research.

Table 1. Effects on chronological aging of single disruption of genes involved in histone (de)acetylation.

The effects on chronological aging of 28 single deletion strains of genes involved in histone acetylation (bold italic characters) or deacetylation (italic characters) are presented. AU strains were aged with and without application of 4 niM spermidine and survival was determined by clonogenicity. Deletion strains were assigned to one of five categories, depending on the effects on survival during aging and the ability of spermidine to improve this survival.

Table 1

Survival during Pro-survival effect of chronological aging spermidine application Single deletion of.. (compared to WT) (compared to WT) mcreased during early _reduced

SAS3, IKI3, ELP3 aging (day 5 to 15) increased during early aging (due to fast death of control cultures), ,-,,-,»„ r,_{rm WΠ A I} strongly reduced

BUT diminished or absent at later time points (day 15 to 25) slightly reduced during early not affected AHCl aging (day 5 tol5) slightly increased not affected HDAl slightly reduced not affected SPTlO, RXT2, SDS3, SAP30

HATl, HPA2, HPA3, YNGl, HDA3, HOSl, not affected not affected HOS2, HOS3, HOS4, RPD3, PHO23, SIR2, HSTl, HST2, SET3, SIF2

The pro-survival effect of spermidine in the ELP3 deleted strain was only reduced until day 10 of aging.

Table 2. Primers used for gene disruption and cloning.

Sequences of control primers kan-B (used for verification of IKI3 and SPEl deletion) and Ura-C (used for verification of SAS3 deletion) were according to Gueldener et al. (Gueldener et al. Nucleic Acids Res. 2002 Mar 15;30(6):e23).

Table 2

Primer for... Sequence

₅ '-TTCCTTCTTCATTAATTAGTCTCCGTATAATTTGC AGATAC AGCTGAAGCTTCGTACGC-3 ' loxP-ϋhj3-loxP cassette [SEQ ID NO l] (SAS3 deletion using pUG72) S'-ACATGTATATGCTTATATCCAATATATACCCATCGCCGCGCATAGGCCACTAGTGGATCT G-3' [SEQ ID NO 2]

5'-AGGCCAATTGAACAAGAAAT-S' (SAS3) [SEQ ID NO 3]

Deletion control primers 5'-GTACTAGTAGAGTTCAAGACA-S' QKIS) ) [SEQ ID NO 4] (forward) 5'-AATTTTAATCTGCGCCGTGC-S' (SPEl) ) [SEQ IDNO 5]

Deletion control primers 5'-GGATGTATGGGCTAAATG-S' (kan-B) ) [SEQ IDNO 6] (reverse) 5'-TTGGCTAATCATGACCCC-S' (Ura-C) ) [SEQ IDNO 7] S'-ATCTGAATTCATGGTCACCCCAAGAGAACθ' ) [SEQ IDNO 8] pUG35-Ura/iVHP&4

S'-ATCTGAATTCAGCCAAAGTGGCGTTATATAAC-S' ) [SEQ IDNO 9]

S'-ATCTGAATTCATGAAGTCTACATTTAAGTCTGAATATCC-S' ) [SEQ IDNO 10] pUG36-Ura/Λrσs

₅'-ATCT ATCGATCTACCTGCCAAATGTATTTTCTCC -3' ) [SEQ ID NO 11]

The polyamine compounds such as putrescine, spermine and spermidine (N-(3- arninopropyl)tetramethylenediamine), cholesteryl spermine or derivatives thereof or combinations thereof of present invention can be used for producing a human neural cell by providing such to a pluripotent human cell and culturing the pluripotent human cell and culturing such cell line in a medium with the compound of present invention to produce the human neural cell. Moreover the invention concerns the induction of differentiation of human embryonic stem cells by administration of the autophagy inducing compounds polyamine compounds such as putrescine, spermine and spermidine (N-(3-aminopropyl) tetramethylenediamine), cholesteryl spermine or other derivatives and the combinations thereof of present invention. Such method as described above is particular suitable for pluripotent human cells which are a differentiating pluripotent human cells. These methods can comprise the intermediate step of forming an embryoid body comprising the pluripotent human cell prior to culturing a cell from the embryoid body with the polyamine compounds such as putrescine, spermine and spermidine (N-(3 arrώiopropyl)tetramemylenediamine), cholesteryl spermine or derivatives thereof or combinations thereof of present invention. Furthermore such method can further involve forming the embryoid body by culturing the pluripotent human cell with an essentially serum free medium, for instance a MEDII conditioned medium. In a particular embodiment of present invention the medium for or with the pluripotent mammalian cell comprises from 0.1 μM to 1000 μM of spermidine, preferably 1 μM to 100 μM of spermidine, yet more preferably from 5 μM to 50 μM of spermidine. The method is suitable for a pluripotent human cell which is selected from the group consisting of a human embryonic stem cell, a human inner cell mass (ICM)/epiblast cell, a human primitive ectoderm cell, and a human primordial germ cell. In a particular embodiment of present invention the pluripotent human cell is a human embryonic stem cell or the human pluripotent cell is a multipotent cell or the multipotent cell is a neural precursor cell. A particular embodiment of present invention is a differentiation enhancing culture medium comprising a polyamine compounds such as putrescine, spermine and spermidine (N-(3- aminopropyl)tetramethylenediamine), cholesteryl spermine or derivatives thereof or combinations thereof for culturing and differentiation enhancing of pluripotent human cell, which can be a human embryonic stem cell for instance a multipotent cell or a multipotent cell which is a neural precursor cell. In a specific embodiment, the polyamine of present invention is spermine or spermidine. The present invention is concerned with compositions for use in the medical art and generally to polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3-aminopropyl)- monohydrochloride or derivatives thereof or combinations thereof with histone H3 hypoacetylation and autophagy stimulating activities. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

It also relates to essentially pure polyamine compounds of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate and 1,4-butanediamine N-(3- aminopropyl)-monohydrochloride or other derivatives and pharmaceutically acceptable salts or esters thereof or the combinations thereof for treatment of an autophagy deficiency disorder or to the use of these polyamine for the manufacture of a medicament and/or induce histone 3 hypoacetylation or inhibit histone 3 acetylation and to treat autophagy deficiency-related disorders. It has been found that such polyamine compounds have a autophagy enhancing or autophagy reinstating activity. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention relates to spermidine, spermine, or a polyamine compound of present invention for use in a treatment of autophagy activation to improve adipocyte differentiation and adipogenesis, to lower free fatty acids (FFA), triglycerides and/or cholesterol, glucose and insulin in plasma or blood circulation or to treat hypercholesterolemia and/or dyslipidemia and/or glucose intolerance and/or insulin resistance and diabetes, effects that have been observed experimentally and described in the examples and figures of this application. These polyamine autophagy enhancers may also be used to manufacture a medicament to treat hypercholesterolemia and/or dyslipidemia. hi a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of a subject in need thereof to increase autophagy activity to prevent and/or to suppress the formation of atherosclerotic plaques or to increase autophagy activity to treat arteriosclerosis and/or atherosclerosis. Arteriosclerosis refers to thickening of the intima as a result of ageing in absence of other risk factors. Atherosclerosis also refers to shaping of the plaque. The effects that have experimentally been observed and have been described in the examples and figures of this application. The intima is the inner lining of the blood vessel formed by the endothelial cells and a small amount of connective tissue, hi a specific embodiment, the polyamine of present invention is spermine or spermidine.

Moreover the invention relates to spermidine, spermine, or a polyamine compound of present invention for use in a treatment of arteriosclerosis or a disorder of atherosclerosis or to the use of spermidine, spermine, or a polyamine compound of present invention with histone H3 hypoacetylation and autophagy stimulating activities to manufacture a medicament to treat a disorder of arteriosclerosis or a disorder of atherosclerosis. To date, no single therapeutic approach has proven universally effective in preventing a disorder of arteriosclerosis or a disorder of atherosclerosis. Furthermore, the polyamine autophagy enhancers of present invention can be used to manufacture a medicament to increase autophagy activity to improve endothelial dysfunction, to reduce thrombogenicity or to increase myocardial perfusion. The invention thus also concerns polyamine autophagy enhancers for use in a treatment to improve endothelial dysfunction or to increase myocardial perfusion. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention with histone H3 hypoacetylation and autophagy stimulating activities for use in a treatment of subject in need thereof to increase autophagy activity to prevent and/or to suppress the macrophage infiltration in cardiovascular plaques and the formation of atherosclerotic plaques, effects that have been observed experimentally and described in the examples and figures of this application. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention with histone H3 hypoacetylation and autophagy stimulating activities for the manufacture of a medicament or dosage form to prevent and/or to suppress the macrophage infiltration in cardiovascular plaques and the formation of atherosclerotic plaques. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention relates to spermidine, spermine, or a polyamine compound of present invention with histone H3 hypoacetylation and autophagy stimulating activities to prevent the occurrence or to retard the progress of age-related macular degeneration (AMD) or Alzheimer disease (AD). These polyamine autophagy activators may also be used to manufacture a medicament to prevent the occurrence or to retard the progress of age-related macular degeneration (AMD) or Alzheimer disease (AD). In a specific embodiment, the polyamine of present invention is spermine or spermidine.

Moreover the invention relates to spermidine, spermine, or a polyamine compound of present invention with histone H3 hypoacetylation and autophagy stimulating activities and pharmaceutically acceptable salts or esters thereof for use in a treatment of arteriosclerosis or a disorder of atherosclerosis or to the use of these polyamine autophagy activators to manufacture a medicament to treat a disorder of arteriosclerosis or a disorder of atherosclerosis. To date, no single therapeutic approach has proven universally effective in preventing a disorder of arteriosclerosis or a disorder of atherosclerosis. Furthermore, the polyamine autophagy activators of present invention can be used to manufacture a medicament or a dosage form to increase autophagy activity to improve endothelial dysfunction, to reduce thrombogenicity or to increase myocardial perfusion. The invention thus also concerns polyamine autophagy activators for use in a treatment to improve endothelial dysfunction or to increase myocardial perfusion. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to prevent and/or to suppress the macrophage infiltration in cardiovascular plaques and the formation of atherosclerotic plaques, effects that have been observed experimentally and described in the examples and figures of this application. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to prevent and/or to suppress the macrophage infiltration in cardiovascular plaques and the formation of atherosclerotic plaques. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to decrease oxidative stress, for example to prevent and/or to suppress the accumulation of oxidized LDL in the blood and/or cardiovascular plaques and the formation of atherosclerotic plaques, effects that have been observed experimentally and described in the examples and figures of this application. It thus also concerns the use of essentially pure spermidine, spermine, or a polyamine compound of present invention for the manufacture of a medicament or a dosage form to prevent and/or to suppress the macrophage infiltration in cardiovascular plaques and the formation of atherosclerotic plaques. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

Moreover the invention relates to spermidine, spermine, or a polyamine compound of present invention for use in a treatment of arteriosclerosis and/or a disorder of atherosclerosis or to the use of these polyamine autophagy activators to manufacture a medicament to treat a disorder of arteriosclerosis and/or atherosclerosis. To date, no single therapeutic approach has proven universally effective in preventing a disorder of arteriosclerosis and/or atherosclerosis. Furthermore, the polyamine autophagy activators of present invention can be used to manufacture a medicament to improve endothelial dysfunction or to increase myocardial perfusion. The invention thus also concerns polyamine autophagy activators for use in a treatment of to improve endothelial dysfunction or to increase myocardial perfusion, m a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of subject in need thereof to prevent and/or to suppress the macrophage infiltration in cardiovascular plaques and the formation of atherosclerotic plaques, effects that have been observed experimentally and described in the examples and figures of this application. It thus also concerns the use of essentially pure spermidine, spermine, or apolyamine compound of present invention for the manufacture of a medicament to prevent and/or to suppress the macrophage infiltration in cardiovascular plaques and the formation of atherosclerotic plaques. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of activating or reinstating a normal autophagic pathway for preventing or improving an autophagy disruption or weakening disorder of the group of impaired innate immune system, impaired adaptive immune system, myopathy caused by a intracellular aggregates, cell poising by a cytotoxic, fibrosis, pancreatic beta cell functional disorder, loss of pancreatic islet mass, inflammatory bowel disease (IBD), lymphopenia, lordokyphosis, disturbed insulin signaling, disturbed metabolic homeostasis of a mammalian subject or a patient in need thereof, hi a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of metabolic defects selected from the group consisting of (1) non-insulin dependent Type 2 diabetes mellitus (NIDDM), (2) hyperglycemia, (3) low glucose tolerance, (4) insulin resistance, (6) a lipid disorder, (7) dyslipidemia, (8) hyperlipidemia, (9) hypertriglyceridemia, (10) hypercholesterolemia, (11) low HDL levels, (12) high LDL levels or (13) atherosclerosis. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of metabolic defects selected from the group consisting of arteriosclerosis, dyslipemia or hypercholesterolemia in a subject in need thereof. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of inflammatory bowel disease (IBD) whereby the EBD is a idiopathic IBD, ulcerative colitis or Crohn's disease, hi a specific embodiment, the polyamine of present invention is spermine or spermidine. The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to activate the innate defense system against cell invasive organisms. Li a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to activate the innate defense system against cell invasive organisms whereby the cell invasive organism are of the group of the yeasts, bacteria or virusses. hi a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to activate the innate defense system against cell invasive organisms whereby the cell invasive organism is hepatitis C virus, hi a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of tuberculosis. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to maintain the architecture and function of pancreatic beta cells and that its induction in diabetic mice protects beta cells, hi a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to activate the innate defense system against cell invasive organisms whereby the cell invasive organism Burkholderia pseudomallei. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to activate the innate defense system against cell invasive organisms whereby the cell invasive organism Salmonella typhimurium. hi a specific embodiment, the polyamine of present invention is spermine or spermidine. The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to inhibit the HCV RNA replication. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of lymphocytopenia, or lymphopenia. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for treating, preventing or reducing arteriosclerosis, dyslipemia or hypercholesterolemia in a subject in need thereof. In a specific embodiment, the poryamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to activate the innate defense system against cell invading organisms. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to present cell invasion by yeasts, bacteria or virusses. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use hi a treatment against hepatitis C virus infection. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment against Burkholderia pseudomallei infection. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment against Salmonella typhimurium infection, hi a specific embodiment, the polyamine of present invention is spermine or spermidine. The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment to inhibit the HCV RNA replication. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment against septic shock. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention also relates to processes for the preparation of the same, and to the use thereof in the preparation of pharmaceutical compositions for the therapeutic treatment of living organisms, for instance in invertebrates, vertebrates and preferably warm-blooded animals, including humans. The invention applies to human and veterinary applications, hi a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention to manufacture a medicament or medicated dosage form for use in a treatment of stabilizing or preventing, reducing, lowering, suppressing the formation of sclerotic plaques, the plaque volume, the plaque area in the tissue of a mammalian subject or a patient in need thereof by reducing the oxidized LDL content, the macrophage infiltration, the macrophage accumulation or the transformation of monocytes into foam cells in said in plaques, increasing the stability of plaques by decreasing the macrophage-to-smooth muscle cell ratio or for use in a treatment of preventing, reducing, lowering, retarding or suppressing a disorder of the group of cellular oxidative stress and/or oxidized LDL formation, cell dysfunction, mitochondrial cell dysfunction, tissue dysfunction and tissue degeneration in a mammalian subject or a patient in need thereof or for use in a treatment of inhibiting or reducing of lipid accumulation and of improving adipocyte differentiation (differentiation of pre-adipocytes to adipocytes) or for prevention of adipose increase by a direct action of said compound on cellular level of the compound on adipocytes or for use in a treatment to reduce, retard, lower or suppress a coagulation disorders or to reduce thrombogenicity to protect against a thrombosis wherein tfie thrombosis is of the group consisting of thrombotic cerebral infarction, coronary heart disease, angina pectoris, vasculitis, stroke, peripheral vascular thrombosis or to reduce, retard, lower or suppress a coagulation disorders to increase myocardial perfusion. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns spermidine, spermine, or a polyamine compound of present invention for use in a treatment of stabilizing or preventing, reducing, lowering, suppressing the formation of sclerotic plaques, the plaque volume, the plaque area in the tissue of a mammalian subject or a patient in need thereof by reducing the oxidized LDL content, the macrophage infiltration, the macrophage accumulation or the transformation of monocytes into foam cells in said in plaques or for use in a treatment of preventing, reducing, lowering, retarding or suppressing a disorder of the group of cellular oxidative stress and/or oxidized LDL formation, cell dysfunction, mitochondrial cell dysfunction, tissue dysfunction and tissue degeneration in a mammalian subject or a patient in need thereof or for use in a treatment of inducing adipocyte differentiation (differentiation of pre-adipocytes to adipocytes) or for prevention of adipose increase by a direct action of said compound at cellular level of the compound on adipocytes or for use in a treatment to reduce, retard, lower or suppress a coagulation disorders or to reduce thrombogenicity to protect against a thrombosis wherein the thrombosis is of the group consisting of thrombotic cerebral infarction, coronary heart disease, angina pectoris, vasculitis, stroke, peripheral vascular thrombosis or to reduce, retard, lower or suppress a coagulation disorders to increase myocardial perfusion. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns a composition comprising the polyamines of present invention for use in a treatment of activating or reinstating a normal autophagic pathway for preventing or improving an autophagy disruption or weaking disorder of the group of impaired innate immune system, impaired adaptive immune system, myopathy caused by a intracellular aggregates, cell poisining by a cytoxitic, fibrosis, pancreatic beta cell functional disorder, loss of pancreatic islet mass, inflammatory bowel disease (IBD), mitochondrial dysfunction, lymphopenia, lordokyphosis, disturbed insulin signalling, disturbed metabolic homeostasis, endothelial dysfunction, sclerotization or a hardening of tissue, thickening of the intima of the of the blood vessel as a result of ageing, vascular and myocardial stiffness in mammalian subject or a patient in need thereof. In a specific embodiment, the polyamine of present invention is spermine or spermidine. In one embodiment, the composition has one portion that comprises at least 0,50 mg of the polyamine compound. This polyamine compound is e.g. spermidine or spermine.

The invention furthermore concerns the use of spermidine, spermine, or a polyamine compound of present invention to decrease protein aggregation in recombinant protein producing cells. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns the use of spermidine, spermine, or a polyamine compound of present invention to active the process of presenting internalizing antigens by macrophages or dendritic cells. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns the use of spermidine, spermine, or a polyamine compound of present invention for producing a human neural cell by providing such to a pluripotent human cell and culturing the pluripotent human cell and culturing such cell line in a medium with the compound of present invention to produce the human neural cell, hi a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns an oral composition capable of increasing the survivability, lifespan or the life expectancy of a non human animal or to increase the average lifespan of a population of such non human animal, comprising: an amount of spermidine, spermine, or a polyamine compound of present invention that is effective to activate the cellular autophagic pathway. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The invention furthermore concerns an oral composition capable of increasing the survivability, lifespan or the life expectancy of a poikilotherm animal or to increase the average lifespan of a population of such poikilotherm animal, comprising: an amount of spermidine, spermine, or a polyamine compound of present invention that is effective to activate the cellular autophagic pathway. In a specific embodiment, the polyamine of present invention is spermine or spermidine. The invention furthermore concerns an oral composition capable of increasing the survivability of metamorphosing juvenile organism, comprising: an amount of spermidine, spermine, or a polyamine compound of present invention that is effective to activate the cellular autophagic pathway. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The polyamine autophagy stimulating activity of present invention can be characterized in that the autophagy stimulating polyamine is as active ingredient in an amount between 5 mg and 2.5 gram, preferably 15 mg to 2 gram, more preferably between 25 mg and 1.5 gram, more preferably between 50 mg and 750 mg per serving. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The polyamine autophagy stimulating activity of present invention can be characterized in that the dosage form is selected from the group consisting of the orally ingestible forms of tablets, capsules, caplets, powders, solutions, suspensions and/or syrups, and may also comprise a plurality of granules, beads, powders or pellets. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The polyamine autophagy stimulating activity of present invention can be characterized in that the dosage form is a parenteral delivery forms for instance a total parenteral nutrition solution. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The polyamine autophagy stimulating activity of present invention can be characterized in that the dosage form is a medicated feed or food or is comprised in a medicated feed or food. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

The polyamine autophagy stimulating activity of present invention can be characterized in that the dosage form further comprises at least one sweet taste improving composition selected from the group consisting of a synthetic sweetener, carbohydrates, polyols, amino acids and their corresponding salts, polyamino acids and their corresponding salts, sugar acids and their corresponding salts, organic acids, inorganic acids, organic salts, inorganic salts, bitter compounds, flavorants, astringent compounds, polymers, proteins or protein hydrolysates, surfactants, emulsifiers, flavonoids, alcohols, natural high-potency sweeteners, and combinations thereof.

The polyamine autophagy stimulating activity of present invention can be characterized in that the dosage form is a dosage form which is selected from the group consisting of is selected from the group consisting of the orally ingestible forms of tablets, capsules, caplets, solutions, suspensions and/or syrups, and may also comprise a plurality of granules, beads, powders or pellets.

The polyamine autophagy stimulating activity of present invention can be characterized in that the dosage form is in a parenteral delivery form such as a total parenteral nutrition delivery form.

The polyamines of present invention and in particular spermidine can be used for the following applications:

- The polyamine autophagy stimulating activity of present invention to prevent or reduce sclerotization or a hardening of tissue, whereby the sclerotization or a hardening of tissue is of the group consisting of arterial sclerosis , neuritic sclerosis, systemic sclerosis, amyotrophic lateral sclerosis, hippocampal sclerosis, multiple sclerosis, osteosclerosis or tuberous sclerosis.

- The polyamine autophagy stimulating activity of present invention to reduce thickening of the intima of the of the blood vessel as a result of ageing.

-The polyamine autophagy stimulating activity of present invention to repair of mitochondrial dysfunction or to promote mitochondrial biogenesis. -The polyamine autophagy stimulating activity of present invention to protect against cytotoxicity. -The polyamine autophagy stimulating activity of present invention to protect against adipocyte hypertrophy. -The polyamine autophagy stimulating activity of present invention to protect against the oxidation of LDL or to lower the tissue levels of oxidized LDL in blood or other tissues.

- The polyamine autophagy stimulating activity of present invention to prevent, retard or suppress vascular and myocardial stiffness or to promote vascular and myocardial elasticity/flexibility. -The polyamine autophagy stimulating activity of present invention to prevent, retard or suppress ageing related vascular wall and myocardial stiffness.

- The polyamine autophagy stimulating activity of present invention whereby the treatment affects the disorder by increasing the expression of a autophagy gene or increasing the activity of a autophagy in said cells or tissues.

- The polyamine autophagy stimulating activity of present invention whereby the treatment affects the disorder by increasing the expression of an autophagy gene or the autophagy activity in adipose tissue.

- The polyamine autophagy stimulating activity of present invention whereby the treatment affects the disorder by increasing the expression of a autophagy gene or the autophagy activity in vascular tissue.

- The polyamine autophagy stimulating activity of present invention whereby the treatment affects the disorder by increasing the expression of a autophagy gene or the autophagy activity in monocytes or macrophages.

- The polyamine autophagy stimulating activity of present invention whereby the treatment affects the disorder by increasing the expression of a autophagy gene or the autophagy activity in an endothelial cell, a monocyte, a macrophage, or an adipose cell.

- The polyamine autophagy stimulating activity of present invention whereby the treatment affects the disorder by increasing the expression of a autophagy gene or the autophagy activity in visceral adipose tissue.

- The polyamine autophagy stimulating activity of present invention whereby the treatment affects the disorder by increasing the expression of a autophagy gene or the autophagy activity in adipose and vascular tissue.

- The polyamine autophagy stimulating activity of present invention whereby the disorder is an irritable bowel syndrome.

- The polyamine autophagy stimulating activity of present invention whereby the disorder is rheumatic arthritis.

The polyamine autophagy activators of present invention can be delivered in an oral dosage forms are preferred for those therapeutic agents that are orally active, and include tablets, capsules, caplets, solutions, suspensions and/or syrups, and may also comprise a plurality of granules, beads, powders or pellets that may or may not be encapsulated. Such dosage forms are prepared using conventional methods known to those in the field of pharmaceutical formulation and described in the pertinent texts, e.g., in Remington: The Science and Practice of Pharmacy, 20th Edition, Gennaro, A.R., Ed. (Lippincott, Williams and Wilkins, 2000). Tablets and capsules represent the most convenient oral dosage forms, in which case solid pharmaceutical carriers are employed. It is clear that the dose can vary to the molecular weight and the presence or absence of glycoside groups on the autophagy activators of present invention but daily dose can be in the range of 100 μg to 500 mg/kg body weight, more preferably in the range of 250 μg to 100 mg / kg body weight, yet more preferably 500 μg g to 50 mg per kg body weight, and most preferably 1 mg to 25 mg / kg body weight.

Tablets may be manufactured using standard tablet processing procedures and equipment. One method for forming tablets is by direct compression of a powdered, crystalline or granular composition containing the active agent(s), alone or in combination with one or more carriers, additives, or the like. As an alternative to direct compression, tablets can be prepared using wet-granulation or dry-granulation processes. Tablets may also be molded rather than compressed, starting with a moist or otherwise tractable material; however, compression and granulation techniques are preferred.

In addition to the active agent(s), then, tablets prepared for oral administration using the method of the invention will generally contain other materials such as binders, diluents, lubricants, desintegrants, fillers, stabilisers, surfactants, coloring agents, and the like. Binders are used to impart cohesive qualities to a tablet, and thus ensure that the tablet remains intact after compression. Suitable binder materials include, but are not limited to, starch (including corn starch and pregelatinised starch), gelatin, sugars (including sucrose, glucose, dextrose and lactose), polyethylene glycol, waxes, and natural and synthetic gums, e.g., acacia sodium alginate, polyvinylpyrrolidone, cellulosic polymers (including hydroxypropyl cellulose, hydroxypropyl methylcellulose, methyl cellulose, ethyl cellulose, hydroxyethyl cellulose, and the like), and Veegum. Diluents are typically necessary to increase bulk so that a practical size tablet is ultimately provided.

Suitable diluents include lactose, cellulose, kaolin, mannitol, sodium chloride, dry starch and powdered sugar. Lubricants are used to facilitate tablet manufacture; examples of suitable lubricants include, for example, magnesium stearate and stearic acid. Stearates, if present, preferably represent at no more than approximately 2 wt. % of the drug-containing core.

Disintegrants are used to facilitate disintegration of the tablet, and are generally starches, clays, celluloses, algins, gums or cross linked polymers. Fillers include, for example, materials such as silicon dioxide, titanium dioxide, alumina, talc, kaolin, powdered cellulose and microcrystalline cellulose, as well as soluble materials such as mannitol, urea, sucrose, lactose, dextrose, sodium chloride and sorbitol. Stabilizers are used to inhibit or retard drug decomposition reactions that include, by way of example, oxidative reactions. Surfactants may be anionic, cationic, amphoteric or non-ionic surface active agents.

The dosage form may also be a capsule, in which case the active agent-containing composition may be encapsulated in the form of a liquid or solid (including particulates such as granules, beads, powders or pellets). Suitable capsules may be either hard or soft, and are generally made of gelatin, starch, or a cellulosic material, with gelatin capsules preferred. Two-piece hard gelatin capsules are preferably sealed, such as with gelatin bands or the like. See, for example, Remington: The Science and Practice of Pharmacy, which describes materials and methods for preparing encapsulated pharmaceuticals. If the active agent- containing composition is present within the capsule in liquid form, a liquid carrier is necessary to dissolve the active agent(s). The carrier must be compatible with the capsule material and all components of the pharmaceutical composition, and must be suitable for ingestion.

Solid dosage forms, whether tablets, capsules, caplets, or particulates, may, if desired, be coated so as to provide for delayed release. Dosage forms with delayed release coatings may be manufactured using standard coating procedures and equipment. Such procedures are known to those skilled in the art and described in the pertinent texts, e.g., hi Remington, supra. Generally, after preparation of the solid dosage form, a delayed release coating composition is applied using a coating pan, an airless spray technique, fluidized bed coating equipment, or the like. Delayed release coating compositions comprise a polymeric material, e.g., cellulose butyrate phthalate, cellulose hydrogen phthalate, cellulose propionate phthalate, polyvinyl acetate phthalate, cellulose acetate phthalate, cellulose acetate trimellitate, hydroxypropyl methylcellulose phthalate, hydroxypropyl methylcellulose acetate, dioxypropyl methylcellulose succinate, carboxymethyl ethylcellulose, hydroxypropyl methylcellulose acetate succinate, polymers and copolymers formed from acrylic acid, methacrylic acid, and/or esters thereof.

Sustained release dosage forms provide for drug release over an extended time period, for instance relatively short period up to 1 hour wherein at least 80 % of the compound of present invention will be released, or for instance a medium term release period of 1 to 8 hours wherein up to 80% of the compound of present invention will be released or for instance a long term release period of more than 8 hours wherein up to 80% of the compound of present invention will be released. Generally, as will be appreciated by those of ordinary skill in the art, sustained release dosage forms are formulated by dispersing a drug within a matrix of a gradually bioerodible (hydrolysable) material such as an, insoluble plastic, a hydrophilic polymer, or a fatty compound, or by coating a solid, drug containing dosage form with such a material. Insoluble plastic matrices may be comprised of, for example, polyvinyl chloride or polyethylene. Hydrophilic polymers useful for providing a sustained release coating or matrix cellulosic polymers include, without limitation: cellulosic polymers such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose, methyl cellulose, ethyl cellulose, cellulose acetate, cellulose acetate phthalate, cellulose acetate trimellitate, hydroxypropylmethyl cellulose phthalate, hydroxypropylcellulose phthalate, cellulose hexahydrophthalate, cellulose acetate hexahydrophthalate, and carboxymethylcellulose sodium; acrylic acid polymers and copolymers, preferably formed from acrylic acid, methacrylic acid, acrylic acid alkyl esters, methacrylic acid alkyl esters, and the like, e.g. copolymers of acrylic acid, methacrylic acid, methyl acrylate, ethyl acrylate, methyl methacrylate and/or ethyl methacrylate, with a terpolymer of ethyl acrylate, methyl methacrylate and trimethylammonioethyl methacrylate chloride (sold under the tradename Eudragit RS) preferred; vinyl polymers and copolymers such as polyvinyl pyrrolidone, polyvinyl acetate, polyvinylacetate phthalate, vinylacetate crotonic acid copolymer, and ethylenevinyl acetate copolymers; zein; and shellac, ammoniated shellac, shellac-acetyl alcohol, and shellac n-butyl stearate. Fatty compounds for use as a sustained release matrix material include, but are not limited to, waxes generally (e.g., camauba wax) and glyceryl tristearate.

The transdermal administration of polyamines compound, their hydrochloride or any pharmaceutically acceptable salt or derivatives thereof can be transdermal electromotive administration, the transdermal absorption being accelerated by use of an electrode-drug receptacle attached to the patients. For such topical treatment the pharmaceutical product can be used as liquid, semi-solid or solid medicine. Liquid medicines are solutions, suspensions, emulsions or dispersions of the above-cited active ingredients or combinations of active ingredients as drops, tinctures and sprays. As semi-solid medicines, for example, gels, ointments, creams and foams are used while, for example, powders, toilet powders, granulates, pellets and microcapsules are used as solid medicines.

If the pharmaceutical product containing as active ingredient tetrahydro-pyran-diterpene compound, its hydrochloride or any pharmaceutically acceptable salt or derivatives thereof, is used as a liquid, it is recommended to use as far as possible irritation-free diluting agents, as for example water, monovalent alcohols, especially ethanol, polyvalent alcohols, especially glycerin and/or propanediol, polyglycols, especially polyethylene glycols and/or miglyols, glycerine formal, dimethylisosorbide, natural and synthetic oils and/or esters.

For the production of semi-solid products, as for example gels, ointments, creams and foams, in addition to the above-cited diluting agents basic materials, as for example bentonite, veegum, guar flour and/or cellulose derivatives, especially methylcellulose and/or caboxymethylcellulose, are suitable. The tetrahydro-pyran-diterpene compound hydrochloride, maleate and/or alkali and/or alkaline earth salts may be in the form of a physico-chemical complex with a phospholipid selected from the group consisting of lecithin, cephalin, phosphatidylserine, phosphoinositide, and phosphatidic acid, or mixtures thereof in the form of a cream, an ointment, a pomade, a gel, or an emulsion to the area to be treated. The process of manufacture of such complexes has been described by Bertini Curri in US5,280,020. Furthermore, instead of the above-cited basic materials or in addition to these materials polymers of vinyl alcohol and vinylpyrrolidone, alginates, pectines, polyacrylates, solid and/or liquid polyethylenglycols, paraffins, fatty alcohols, Vaseline and/or waxes, fatty acids and/or fatty acid esters are used. It is possible to use the above-cited active ingredients without filler for the production of solid products, as for example powders, toilet powder, granules, pellets and microcapsules. The pharmaceutical product described here is especially suited for the attention of such of the above-described diseases which are in a much progressed stage so that at first an increased concentration of active ingredients is necessary. With less serious disease conditions or with progressive healing of the disease such embodiments of the solid pharmaceutical product are used which contain fillers, as for example colloidal silicic acid, powdered soapstone, milk sugar, starch powder, sugar, cellulose derivatives, gelatin, metal oxides and/or metal salts, wherein the concentration of the active ingredient or of the combination of active ingredients varies between 0.001% by weight and 50% by weight.

A suitable kind of pharmaceutical form may be a topical deliver form of the above-described active ingredient, which is made by the application of the solid, liquid or semi-solid pharmaceutical product onto a gauze strip, a compress or a plaster so that such a gauze strip, such a compress or such a plaster then is only locally applied onto the spot which is to be treated. The pharmaceutical product can be filled into the known receptacles, as for example bottles, tubes, toilet powder boxes and baby powder boxes as well as seal edge bags, which are possibly provided with metering means, as for example droplet forming means, metering valves or metering chambers.

Generally, the polyamine autophagy enhancers of present invention may be in a food, beverage, pharmaceutical, tobacco, nutraceutical, oral hygienic, or cosmetic, hi a specific embodiment, the polyamine of present invention is spermine or spermidine.

The compounds of present invention for use of the medical or nutraceutical treatment of present invention can also be in an orally ingestible compositions, hi a specific embodiment, the polyamine of present invention is spermine or spermidine.

I ll There are no restrictions on the type of orally ingestible composition or dosage forms encompassed by embodiments of this invention as long as they are safe for human or animal consumption when used in a generally acceptable range. These compositions include food, beverage, pharmaceutical, tobacco, nutraceutical, oral hygienic/cosmetic products, and the like. Non-limiting examples of these products include non-carbonated and carbonated beverages such as colas, ginger ales, root beers, ciders, fruit-flavored soft drinks (e.g., citrus- flavored soft drinks such as lemon-lime or orange), powdered soft drinks (e.g., cola, juice, tea, water, coffee), and the like; fruit juices originating in fruits or vegetables, fruit juices including squeezed juices or the like, fruit juices containing fruit particles, fruit beverages, fruit juice beverages, beverages containing fruit juices, beverages with fruit flavorings, vegetable juices, juices containing vegetables, and mixed juices containing fruits and vegetables; sport drinks, energy drinks, near water and the like drinks (e.g., water with natural or synthetic flavorants); tea type or favorite type beverages such as coffee, cocoa, black tea, green tea, oolong tea and the like; beverages containing milk components such as milk beverages, coffee containing milk components, cafe au lait, milk tea, fruit milk beverages, drinkable yogurt, lactic acid bacteria beverages or the like; dairy products; bakery products; desserts such as yogurt, jellies, drinkable jellies, puddings, Bavarian cream, blancmange, cakes, ready to eat cereals, brownies, mousse and the like, sweetened food products eaten at tea time or following meals; frozen foods; cold confections, e.g. types of ice cream such as ice cream, ice milk, lacto-ice and the like (food products in which sweeteners and various other types of raw materials are added to milk products, and the resulting mixture is agitated and frozen), and ice confections such as sherbets, dessert ices and the like (food products in which various other types of raw materials are added to a sugary liquid, and the resulting mixture is agitated and frozen); ice cream; ready to eat cereals, general confections, e.g., baked confections or steamed confections such as cakes, crackers, biscuits, buns with bean-jam filling and the like; rice cakes and snacks; table top products; general sugar confections such as chewing gum (e.g., including compositions which comprise a substantially water-insoluble, chewable gum base, such as chicle or substitutes thereof, including jetulong, guttakay rubber or certain comestible natural synthetic resins or waxes), hard candy, soft candy, mints, nougat candy, jelly beans and the like; sauces including fruit flavored sauces, chocolate sauces and the like; edible gels; cremes including butter cremes, flour pastes, whipped cream and the like; jams including strawberry jam, marmalade and the like; breads including sweet breads and the like or other starch products; spice; general condiments including seasoned soy sauce used on roasted meats, roast fowl, barbecued meat and the like, as well as tomato catsup, sauces, noodle broth and the like; processed agricultural products, livestock products or seafood; processed meat products such as sausage and the like; retort food products, pickles, preserves boiled in soy sauce, delicacies, side dishes; snacks such as potato chips, cookies, or the like; cereal products; drugs or quasi-drugs that are administered orally or used in the oral cavity (e.g., vitamins, cough syrups, cough drops, chewable medicine tablets, amino acids, bitter-tasting agents, acidulants or the like), wherein the drug may be in solid, liquid, gel, or gas form such as a pill, tablet, spray, capsule, syrup, drop, troche agent, powder, and the like; personal care products such as other oral compositions used in the oral cavity such as mouth freshening agents, gargling agents, mouth rinsing agents, toothpaste, tooth polish, dentifrices, mouth sprays, teeth-whitening agent and the like; dietary supplements; tobacco products including smoke and smokeless tobacco products such as snuff, cigarette, pipe and cigar tobacco, and all forms of tobacco such as shredded filler, leaf, stem, stalk, homogenized leaf cured, reconstituted binders and reconstituted tobacco from tobacco dust, fines or ether sources in sheet, pellet or other forms, tobacco substitutes formulated from non- tobacco materials, dip or chewing tobacco; animal feed; nutraceutical products, which includes any food or part of a food that may provide medicinal or health benefits, including the prevention and treatment of disease (e.g., cardiovascular disease and high cholesterol, diabetes, osteoporosis, inflammation, or autoimmune disorders), non-limiting, examples of nutraceuticals include naturally nutrient-rich or medicinally active food, such as garlic, soybeans, antioxidants, fibers, phytosterols and phytostanols and their esters, glucosamine, chondroitin sulfate, stenol, stanol, ginseng, ginkgo, echinacea, or the like; other nutrients that provide health benefits, such as amino acids, vitamins, minerals, carotenoids, dietary fiber, fatty acids such as omega-3 or omega-6 fatty acids, DHA, EPA, or ALA which can be derived from plant or animal sources (e.g., salmon and other cold-water fish or algae), flavonoids, phenols, polyols, polyphenols (e.g., catechins, proanthocyanidins, procyanidins, anthocyanins, quercetin, resveratrol, isoflavones, curcumin, punicalagin, ellagitannin, citrus flavonoids such as hesperidin and naringin, and chlorogenic acid), prebiotics/probiotics, phytoestrogens, sulfides/thiols, policosanol, saponin, rubisco peptide, appetite suppressants, hydration agents, autoimmune agents, C-reactive protein reducing agents, or anti-inflammatory agents; or any other functional ingredient that is beneficial to the treatment of specific diseases or conditions, such as diabetes, osteoporosis, inflammation, or high cholesterol levels in the blood.

The autophagy activators of present invention may be combined with fatty acids (including long chain polyunsaturated fatty acids), and especially with omega-3 fatty acids and omega-6 fatty acids which are nutrients required in the human diet. Such are found in natural sources such as the oil of certain plants and animals, including fishes, walnuts, lingonberries, hemp, flax, chia, perilla, purslane, and algae. Since essential fatty acids such as omega-3 fatty acids and omega-6 fatty acids are not synthesized by the body, they, and their health benefits, must be obtained through food or dietary supplement. Therefore, omega-3 fatty acids have been used as beneficial functional ingredients for various compositions, including beverages. In addition, long chain omega-3 fatty acids (e.g., docosahexaenoic acid (DHLA) and eicosapentaenoic acid (EPA)) are known to enhance cognitive function and maintain cardiovascular health, among other health benefits (See, e.g., von Schacky, C, "Omega-3 Fatty Acids and Cardiovascular Disease," Current Opinion in Clinical Nutrition and Metabolic Care 7, no. 2 (March 2004): 131-6. and Simopoulos, A.P., "Essential Fatty Acids in Health and Chronic Disease," American Journal of Clinical Nutrition 79, no. 3 (March 2004): 523-4.).

The autophagy activator of present invention may be as functional ingredients in the dosage form in a purity greater than about 50 % autophagy activator by weight on a dry basis, in a purity greater than about 70 % autophagy activator by weight on a dry basis, in a purity greater than about 80 % autophagy activator by weight on a dry basis, in a purity greater than about 90 % autophagy activator by weight on a dry basis, in a purity greater than about 97 % autophagy activator by weight on a dry basis, in a purity greater than about 98 % autophagy activator by weight on a dry basis or in a purity greater than about 99 % autophagy activator by weight on a dry basis.

In accordance with an embodiment of present invention the autophagy activator of present invention for the treatment or prevention of the disorder of present invention may be in a dosage form as a confection. Such confection may be in the form of any food that is typically perceived to be rich in sugar or is typically sweet. According to particular embodiments of the present invention, the confections may be bakery products such as pastries; desserts such as yogurt, jellies, drinkable jellies, puddings, Bavarian cream, blancmange, cakes, brownies, mousse and the like, sweetened food products eaten at tea time or following meals; frozen foods; cold confections, e. g. types of ice cream such as ice cream, ice milk, lacto-ice and the like (food products in which sweeteners and various other types of raw materials are added to milk products, and the resulting mixture is agitated and frozen), and ice confections such as sherbets, dessert ices and the like (food products in which various other types of raw materials are added to a sugary liquid, and the resulting mixture is agitated and frozen); ready to eat cereals, general confections, e. g., baked confections or steamed confections such as crackers, biscuits, buns with bean-jam filling, halvah, alfajor, and the like; rice cakes and snacks; table top products; general sugar confections such as chewing gum (e.g. including compositions which comprise a substantially water- insoluble, chewable gum base, such as chicle or substitutes thereof, including jetulong, guttakay rubber or certain comestible natural synthetic resins or waxes), hard candy, soft candy, mints, nougat candy, jelly beans, fudge, toffee, taffy, Swiss milk tablet, licorice candy, chocolates, gelatin candies, marshmallow, marzipan, divinity, cotton candy, and the like; sauces including fruit flavored sauces, chocolate sauces and the like; edible gels; cremes including butter cremes, flour pastes, whipped cream and the like; jams including strawberry jam, marmalade and the like; and breads including sweet breads and the like or other starch products, and combinations thereof. And such confection may comprise additional functional or non functional sweeteners such as synthetic high-potency sweetener selected from the group consisting of sucralose, acesulfame potassium and other salts, aspartame, alitame, saccharin, neohesperidin dihydrochalcone, cyclamate, neotame, N- [N- [3 -(3 -hy droxy-4-methoxyphenyl) propyl] -L-α-aspartyl] -L- phenylalanine 1 -methyl ester, N-[N^"-[3-(3-hydroxy-4-methoxyphenyl)-3-methylbutyl]-L-α- aspartyl]-L-phenylalanine 1-methyl ester, N- [N- [3 -(3 -methoxy-4-hydroxyphenyl)propyl] -L-α- aspartyl] -L-phenylalanine 1 -methyl ester, salts thereof, and combinations thereof or as mogroside IV, mogroside V, Luo Han Guo sweetener, siamenoside, monatin and its salts (monatin SS, RR, RS, SR), curculin, glycyrrhizic acid and its salts, thaumatin, monellin, mabinlin, brazzein, hernandulcin, phyllodulcin, glycyphyllin, phloridzin, trilobatin, baiyunoside, osladin, polypodoside A, pterocaryoside A, pterocaryoside B, mukurozioside, phlomisoside I, periandrin I, abrusoside A, cyclocarioside I, and combinations thereof. In a specific embodiment, the polyamine of present invention is spermine or spermidine.

As referred to herein, "confection" can mean a sweet, a lollie, a confectionery, or similar term. As referred to herein, "base composition" means any composition which can be a food item and provides a matrix for carrying the natural and/or synthetic high-potency sweetener and perhaps other flavors.

Suitable base compositions for embodiments of this invention may include flour, yeast, water, salt, butter, eggs, milk, milk powder, liquor, gelatin, nuts, chocolate, citric acid, tartaric acid, fumaric acid, natural flavors, artificial flavors, colorings, polyols, sorbitol, isomalt, maltitol, lactitol, malic acid, magnesium stearate, lecithin, hydrogenated glucose syrup, glycerine, natural or synthetic gum, starch, and the like, and combinations thereof. Such components generally are recognized as safe (GRAS) and/or are U.S. Food and Drug Administration (FDA)-approved. According to particular embodiments of the invention, the base composition is present in the confection in an amount ranging from about 0.1 to about 99 weight percent of the confection. Generally, the base composition is present in the confection in an amount, in combination with the at least one natural and/or synthetic high-potency sweetener and the at least one sweet taste improving composition, to provide a food product.

The base composition of the confection may optionally include other artificial or natural sweeteners, bulk sweeteners, or combinations thereof. BuUc sweeteners include both caloric and non-caloric compounds. In a particular embodiment, the sweet taste improving composition functions as the bulk sweetener. Non-limiting examples of bulk sweeteners include sucrose, dextrose, maltose, dextrin, dried invert sugar, fructose, high fructose corn syrup, levulose, galactose, corn syrup solids, tagatose, polyols (e.g., sorbitol, mannitol, xylitol, lactitol, erythritol, and maltitol), hydrogenated starch hydrolysates, isomalt, trehalose, and mixtures thereof. Generally, the amount of bulk sweetener present in the confection ranges widely depending on the particular embodiment of the confection and the desired degree of sweetness. Those of ordinary skill in the art will readily ascertain the appropriate amount of bulk sweetener. In a particular embodiment, a confection comprises at least one natural and/or synthetic high-potency sweetener in combination with at least one sweet taste improving composition and a base composition. Generally, the amount of natural and/or synthetic high-potency sweetener present in the confection ranges widely depending on the particular embodiment of the confection and the desired degree of sweetness. Those of ordinary skill in the art will readily ascertain the appropriate amount of sweetener. In a particular embodiment, the at least one natural and/or synthetic high-potency sweetener is present in the confection in an amount in the range of about 30 ppm to about 6000 ppm of the confection. In another embodiment, the at least one natural and/or synthetic high- potency sweetener is present in the confection in an amount in the range of about 50 ppm to about 3000 ppm of the confection. In embodiments where the confection comprises hard candy, the at least one natural or synthetic high-potency sweetener is present in an amount in the range of about 150 ppm to about 2250 ppm of the hard candy.

In accordance with an embodiment of present invention the autophagy activator of present invention may in a dosage form with synthetic sweetener sweetened compositions. In accordance with desirable embodiments of this invention, synthetic sweetener sweetened compositions such as those described hereinabove comprise a sweetenable orally ingestible composition, at least one synthetic sweetener, and at least one sweet taste improving composition selected from the group consisting of carbohydrates, polyols, amino acids, other sweet taste improving additives, and combinations thereof. For example, according to a particular embodiment of this invention, a synthetic sweetener sweetened beverage comprises an orally ingestible beverage composition, such as an aqueous beverage composition or the like, and a synthetic sweetener composition with a more sugar-like temporal profile and/or flavor profile, as disclosed herein. In addition, according to a particular embodiment of this invention, a synthetic sweetener sweetened food comprises an orally ingestible food composition and a synthetic sweetener composition with a more sugar-like temporal profile and/or flavor profile, as disclosed herein. In addition, according to a particular embodiment of this invention, a synthetic sweetener sweetened pharmaceutical comprises a pharmaceutically active composition and/or pharmaceutically acceptable salts thereof, and a synthetic sweetener composition with a more sugar-like temporal profile and/or flavor profile, as disclosed herein. Alternatively, in addition, according to a particular embodiment of this invention, a synthetic sweetener sweetened pharmaceutical comprises a pharmaceutically active composition and/or pharmaceutically acceptable salts thereof and a coating comprising an orally ingestible composition and a synthetic sweetener composition with a more sugar- like temporal profile and/or flavor profile, as disclosed herein. In addition, according to a particular embodiment of this invention, a synthetic sweetener sweetened tobacco product comprises a tobacco and a synthetic sweetener composition with a more sugar-like temporal profile and/or flavor profile, as disclosed herein. In addition, according to a particular embodiment of this invention, a synthetic sweetener sweetened nutraceutical product comprises an orally ingestible nutraceutical composition and a synthetic sweetener composition with a more sugar-like temporal profile and/or flavor profile, as disclosed herein. In addition, according to a particular embodiment of this invention, a synthetic sweetener sweetened oral hygienic product comprises an orally ingestible oral hygienic composition and a synthetic sweetener composition with a more sugar-like temporal profile and/or flavor profile, as disclosed herein. In addition, according to a particular embodiment of this invention, a synthetic sweetener sweetened cosmetic product comprises an orally ingestible cosmetic composition and a synthetic sweetener composition with a more sugar-like temporal profile and/or flavor profile, as disclosed herein.

Furthermore the compounds of present invention may further be incorporated in or combined with a sweet taste improving composition.

As used herein, the phrase "sweet taste improving composition" includes any composition which imparts a more sugar-like temporal profile, sugar-like flavor profile, or both to a synthetic sweetener. Examples of sweet taste improving compositions include, but are not limited to, carbohydrates, polyols, amino acids, and other sweet taste improving taste additives imparting such sugar-like characteristics.

The term "carbohydrate" generally refers to aldehyde or ketone compounds substituted with multiple hydroxyl groups, of the general formula (CH2O)n, wherein n is 3-30, as well as their oligomers and polymers. The carbohydrates of the present invention can, in addition, be substituted or deoxygenated at one or more positions. Carbohydrates as used herein encompass unmodified carbohydrates, carbohydrate derivatives, substituted carbohydrates, and modified carbohydrates. As used herein the phrases "carbohydrate derivatives", "substituted carbohydrate", and "modified carbohydrates" are synonymous. Modified carbohydrate means any carbohydrate wherein at least one atom has been added, removed, substituted, or combinations thereof. Thus, carbohydrate derivatives or substituted carbohydrates include substituted and unsubstituted monosaccharides, disaccharides, oligosaccharides, and polysaccharides. The carbohydrate derivatives or substituted carbohydrates optionally can be deoxygenated at any corresponding C-position, and/or substituted with one or more moieties such as hydrogen, halogen, haloalkyl, carboxyl, acyl, acyloxy, amino, amido, carboxyl derivatives, alkylamino, dialkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfo, mercapto, imino, sulfonyl, sulfenyl, sulfinyl, sulfamoyl, carboalkoxy, carboxamido, phosphonyl, phosphinyl, phosphoryl, phosphino, thioester, thioether, oximino, hydrazino, carbamyl, phosphor phosphonato, or any other viable functional group provided the carbohydrate derivative or substituted carbohydrate functions to improve the sweet taste of a synthetic sweetener.

Non-limiting examples of carbohydrates in embodiments of this invention include tagatose, trehalose, galactose, rhamnose, cyclodextrin (e.g., α-cyclodextrin, β-cyclodextrin, and γ- cyclodextrin), maltodextrin (including resistant maltodextrins such as Fibersol-2®), dextran, sucrose, glucose, ribulose, fructose, threose, arabinose, xylose, lyxose, allose, altrose, mannose, idose, lactose, maltose, invert sugar, isotrehalose, neotrehalose, palatinose or isomaltulose, erythrose, deoxyribose, gulose, idose, talose, erythrulose, xylulose, psicose, turanose, cellobiose, amylopectin, glucosamine, mannosamine, fucose, glucuronic acid, gluconic acid, glucono-lactone, abequose, galactosamine, beet oligosaccharides, isomalto- oligosaccharides (isomaltose, isomaltotriose, panose and the like), xylo-oligosaccharides (xylotriose, xylobiose and the like), gentio-origoscaccharides (gentiobiose, gentiotriose, gentiotetraose and the like), sorbose, nigero-oligosaccharides, palatinose oligosaccharides, fucose, fructooligosaccharides (kestose, nystose and the like), maltotetraol, maltotriol, malto- oligosaccharides (maltotriose, maltotetraose, maltopentaose, maltohexaose, maltoheptaose and the like), lactulose, melibiose, raffinose, rhamnose. ribose, isomerized liquid sugars such as high fructose corn/starch syrup (e.g., HFCS55, HFCS42, or HFCS90), coupling sugars, soybean oligosaccharides, and glucose syrup. Additionally, the carbohydrates as used herein may be in either the D-or L-configuration. The term "alkyl", as used herein, unless otherwise specified, refers to a saturated straight, branched, or cyclic, primary, secondary, or tertiary hydrocarbon, typically of Cl to C18, and specifically includes methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, pentyl, cyclopentyl, isopentyl, neopentyl, hexyl, isohexyl, cyclohexyl, cyclohexylmethyl, 3- methylpentyl, 2,2-dimethylbutyl, 2,3-dirnethylbutyl, and 3,3-dimethylbutyl. The alkyl group optionally can be substituted with one or more moieties selected from the group consisting of hydroxyl, carboxy, carboxamido, carboalkoxy, acyl, amino, alkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfo, sulfate, phospho, phosphato, or phosphonato.

The term "alkenyl", as referred to herein, and unless otherwise specified, refers to a straight, branched, or cyclic hydrocarbon of C2 to ClO with at least one double bond. The alkenyl groups optionally can be substituted in the same manner as described above for the alkyl groups and also optionally can be substituted with a substituted or unsubstituted alkyl group.

The term "alkynyl", as referred to herein, and unless otherwise specified, refers to a C2 to ClO straight or branched hydrocarbon with at least one triple bond. The alkynyl groups optionally can be substituted in the same manner as described above for the alkyl groups and also optionally can be substituted with a substituted or unsubstituted alkyl group.

The term "aryl", as used herein, and unless otherwise specified, refers to phenyl, biphenyl, or naphthyl, and preferably phenyl. The aryl group optionally can be substituted with one or more moieties selected from the group consisting of hydroxyl, acyl, amino, halo, carboxy, carboxamido, carboalkoxy, alkylamino, alkoxy, aryloxy, nitro, cyano, sulfo, sulfato, phospho, phosphate, or phosphonato.

The term "heteroaryl" or "heteroaromatic", as used herein, refers to an aromatic or unsaturated cyclic moiety that includes at least one sulfur, oxygen, nitrogen, or phosphorus in the aromatic ring. Non-limiting examples are furyl, pyridyl, pyrimidyl, thienyl, isothiazolyl, imidazolyl, tetrazolyl, pyrazinyl, benzofuranyl, benzothiophenyl, quinolyl, isoquinolyl, benzothienyl, isobenzofuryl, pyrazolyl, indolyl, isoindolyl, benzimidazolyl, purinyl, carbazolyl, oxazolyl, thiazolyl, isothiazolyl, 1,2,4-thiadiazolyl, isooxazolyl, pyrrolyl, quinazolinyl, pyridazinyl, pyrazinyl, cinnolinyl, phthalazinyl, quinoxalinyl, xanthinyl, hypoxanthinyl, and pteridinyl. The heteroaryl or heteroaromatic group optionally can be substituted with one or more moieties selected from the group consisting of hydroxyl, acyl, amino, halo, alkylamino, alkoxy, aryloxy, nitro, cyano, sulfo, sulfato, phospho, phosphate, or phosphonato.

The term "heterocyclic" refers to a saturated nonaromatic cyclic group which may be substituted, and wherein there is at least one heteroatom, such as oxygen, sulfur, nitrogen, or phosphorus in the ring. The heterocyclic group optionally can be substituted in the same manner as described above for the heteroaryl group.

The term "aralkyl", as used herein, and unless otherwise specified, refers to an aryl group as defined above linked to the molecule through an alkyl group as defined above. The term alkaryl, as used herein, and unless otherwise specified, refers to an alkyl group as defined above linked to the molecule through an aryl group as defined above. The aralkyl or alkaryl group optionally can be substituted with one or more moieties selected from the group consisting of hydroxyl, carboxy, carboxamido, carboalkoxy, acyl, amino, halo, alkylamino, alkoxy, aryloxy, nitro, cyano, sulfo, sulfato, phospho, phosphate, or phosphonato.

The term "halo", as used herein, specifically includes chloro, bromo, iodo, and fluoro.

The term "alkoxy", as used herein, and unless otherwise specified, refers to a moiety of the structure~O-alkyl, wherein alkyl is as defined above.

The term "acyl", as used herein, refers to a group of the formula C(O)R', wherein R is an alkyl, aryl, alkaryl or aralkyl group, or substituted alkyl, aryl, aralkyl or alkaryl, wherein these groups are as defined above.

The term "polyol", as used herein, refers to a molecule that contains more than one hydroxyl group. A polyol may be a diol, triol, or a tetraol which contains 2, 3, and 4 hydroxyl groups respectively. A polyol also may contain more than four hydroxyl groups, such as a pentaol, hexaol, heptaol, or the like, which contain, 5, 6, or 7 hydroxyl groups, respectively. Additionally, a polyol also may be a sugar alcohol, polyhydric alcohol, or polyalcohol which is a reduced form of carbohydrate, wherein the carbonyl group (aldehyde or ketone, reducing sugar) has been reduced to a primary or secondary hydroxyl group.

Non-limiting examples of polyols in embodiments of this invention include erythritol, maltitol, mannitol, sorbitol, lactitol, xylitol, isomalt, propylene glycol, glycerol (glycerine), threitol, galactitol, palatinose, reduced isomalto-oligosaccharides, reduced xylo- oligosaccharides, reduced gentio-oligosaccharides, reduced maltose syrup, reduced glucose syrup, and sugar alcohols or any other carbohydrates capable of being reduced which do not adversely affect the taste of the synthetic sweetener or the orally ingestible composition.

As used herein, the phrase "sweet taste improving additive" means any material that imparts a more sugar-like temporal profile or sugar-like flavor profile or both to a synthetic sweetener. Suitable sweet taste improving additives useful in embodiments of this invention include amino acids and their salts, polyamino acids and their salts, peptides, sugar acids and their salts, nucleotides and their salts, organic acids, inorganic acids, organic salts including organic acid salts and organic base salts, inorganic acid salts (e.g., sodium chloride, potassium chloride, magnesium chloride), bitter compounds, flavorants and flavoring ingredients, astringent compounds, polymers, proteins or protein hydrolysates, surfactants, emulsifϊers, flavonoids, alcohols, and natural high-potency sweeteners.

Suitable sweet taste improving amino acid additives for use in embodiments of this invention include, but are not limited to, aspartic acid, arginine, glycine, glutamic acid, proline, threonine, theanine, cysteine, cystine, alanine, valine, tyrosine, leucine, isoleucine, asparagine, serine, lysine, histidine, ornithine, methionine, carnitine, aminobutyric acid (alpha-, beta-, or gamma-isomers), glutamine, hydroxyproline, taurine, norvaline, sarcosine, and their salt forms such as sodium or potassium salts or acid salts. The sweet taste improving amino acid additives also may be in the D-or L-configuration and in the mono-, di-, or tri-form of the same or different amino acids. Additionally, the amino acids may be α-, β-, γ-, δ-, and ε- isomers if appropriate. Combinations of the foregoing amino acids and their corresponding salts (e.g., sodium, potassium, calcium, magnesium salts or other alkali or alkaline earth metal salts thereof, or acid salts) also are suitable sweet taste improving additives in embodiments of this invention. The amino acids may be natural or synthetic. The amino acids also may be modified. Modified amino acids refers to any amino acid wherein at least one atom has been added, removed, substituted, or combinations thereof (e.g., N-alkyl amino acid, N-acyl amino acid, or N-methyl amino acid). Non-limiting examples of modified amino acids include amino acid derivatives such as trimethyl glycine, N-methyl-glycine, and N-methyl-alanine. As used herein, modified amino acids encompass both modified and unmodified amino acids. As used herein, amino acids also encompass both peptides and polypeptides (e.g., dipeptides, tripeptides, tetrapeptides, and pentapeptides) such as glutathione and L-alanyl-L-glutamine. Suitable sweet taste improving polyamino acid additives include poly-L-aspartic acid, poly-L- lysine (e.g., poly-L-α-lysine or poly-L-ε-lysine), poly-L-ornithine (e.g., poly-L-α-ornithine or poly-L-ε-ornithine), poly-L-arginine, other polymeric forms of amino acids, and salt forms thereof (e.g., calcium, potassium, sodium, or magnesium salts such as L-glutamic acid mono sodium salt). The sweet taste improving polyamino acid additives also may be in the D-or L- configuration. Additionally, the polyamino acids may be α-, β-, γ-, δ-, and ε-isomers if appropriate. Combinations of the foregoing polyamino acids and their corresponding salts (e.g., sodium, potassium, calcium, magnesium salts or other alkali or alkaline earth metal salts thereof or acid salts) also are suitable sweet taste improving additives in embodiments of this invention. The polyamino acids described herein also may comprise co-polymers of different amino acids. The polyamino acids may be natural or synthetic. The polyamino acids also may be modified, such that at least one atom has been added, removed, substituted, or combinations thereof (e.g., N-alkyl polyamino acid or N-acyl polyamino acid). As used herein, polyamino acids encompass both modified and unmodified polyamino acids. In accordance with particular embodiments of this invention, modified polyamino acids include, but are not limited to polyamino acids of various molecular weights (MW), such as poly-L-α- lysine with a MW of 1,500, MW of 6,000, MW of 25,200, MW of 63,000, MW of 83,000, or MW of 300,000.

Suitable sweet taste improving sugar acid additives for use in embodiments of this invention include but are not limited to aldonic, uronic, aldaric, alginic, gluconic, glucuronic, glucaric, galactaric, galacturonic, and their salts (e.g., sodium, potassium, calcium, magnesium salts or other physiologically acceptable salts), and combinations thereof. Suitable sweet taste improving nucleotide additives for use in embodiments of this invention include but are not limited to inosine monophosphate ("IMP"), guanosine monophosphate ("GMP"), adenosine monophosphate ("AMP"), cytosine monophosphate (CMP), uracil monophosphate (UMP), inosine diphosphate, guanosine diphosphate, adenosine diphosphate, cytosine diphosphate, uracil diphosphate, inosine triphosphate, guanosine triphosphate, adenosine triphosphate, cytosine triphosphate, uracil triphosphate, and their alkali or alkaline earth metal salts, and combinations thereof. The nucleotides described herein also may comprise nucleotide-related additives, such as nucleosides or nucleic acid bases (e.g., guanine, cytosine, adenine, mymine, uracil).

Suitable sweet taste improving organic acid additives include any compound which comprises a~COOH moiety. Suitable sweet taste improving organic acid additives for use in embodiments of this invention include but are not limited to C2-C30 carboxylic acids, substituted hydroxyl C2-C30 carboxylic acids, benzoic acid, substituted benzoic acids (e.g., 2,4-dihydroxybenzoic acid), substituted cinnamic acids, hydroxyacids, substituted hydroxybenzoic acids, substituted cyclohexyl carboxylic acids, tannic acid, lactic acid, tartaric acid, citric acid, gluconic acid, glucoheptonic acids, adipic acid, hydroxycitric acid, malic acid, fruitaric acid (a blend of malic, fumaric, and tartaric acids), fumaric acid, maleic acid, succinic acid, chlorogenic acid, salicylic acid, creatine, caffeic acid, bile acids, acetic acid, ascorbic acid, alginic acid, erythorbic acid, polyglutamic acid, glucono delta lactone, and their alkali or alkaline earth metal salt derivatives thereof. In addition, the organic acid additives also may be in either the D-or L-configuration.

Suitable sweet taste improving organic acid additive salts include, but are not limited to, sodium, calcium, potassium, and magnesium salts of all organic acids, such as salts of citric acid, malic acid, tartaric acid, fumaric acid, lactic acid (e.g., sodium lactate), alginic acid (e.g., sodium alginate), ascorbic acid (e.g., sodium ascorbate), benzoic acid (e.g., sodium benzoate or potassium benzoate), and adipic acid. The examples of the sweet taste improving organic acid additives described optionally may be substituted with one or more of the following moiety selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, halo, haloalkyl, carboxyl, acyl, acyloxy, amino, amido, carboxyl derivatives, alkylamino, dialkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfo, thiol, imine, sulfonyl, sulfenyl, sulfinyl, sulfamyl, carboxalkoxy, carboxamido, phosphonyl, phosphinyl, phosphoryl, phosphino, thioester, thioether, anhydride, oximino, hydrazino, carbamyl, phospho, phosphonato, or any other viable functional group provided the substituted organic acid additives function to improve the sweet taste of a synthetic sweetener.

Suitable sweet taste improving inorganic acid additives for use in embodiments of this invention include but are not limited to phosphoric acid, phosphorous acid, polyphosphoric acid, hydrochloric acid, sulfuric acid, carbonic acid, sodium dihydrogen phosphate, and their corresponding alkali or alkaline earth metal salts thereof (e.g., inositol hexaphosphate Mg/Ca).

Suitable sweet taste improving bitter compound additives for use in embodiments of this invention include but are not limited to caffeine, quinine, urea, bitter orange oil, naringin, quassia, and salts thereof.

Suitable sweet taste improving flavorant and flavoring ingredient additives for use in embodiments of this invention include but are not limited to vanillin, vanilla extract, mango extract, cinnamon, citrus, coconut, ginger, viridiflorol, almond, menthol (including menthol without mint), grape skin extract, and grape seed extract. "Flavorant" and "flavoring ingredient" are synonymous and can include natural or synthetic substances or combinations thereof. Flavorants also include any other substance which imparts flavor and may include natural or non-natural (synthetic) substances which are safe for human or animals when used in a generally accepted range. Non-limiting examples of proprietary flavorants include Doehler® Natural Flavoring Sweetness Enhancer K14323 (Doehler®, Darmstadt, Germany), Symrise® Natural Flavor Mask for Sweeteners 161453 and 164126 (Symrise®, Holzminden, Germany), Natural Advantage® Bitterness Blockers 1, 2, 9 and 10 (Natural Advantage®, Freehold, NJ., U.S.A.), and Sucramask® (Creative Research Management, Stockton, Calif., U.S.A.).

Systemic sclerosis (SSc) is a systemic connective tissue disease. Characteristics of SSc include essential vasomotor disturbances; fibrosis; subsequent atrophy of the skin, subcutaneous tissue, muscles, and internal organs (e.g., alimentary tract, lungs, heart, kidney, CNS); and immunologic disturbances accompany these findings.

"Essentially pure" for the meaning of this application is in a purity greater than about 90 % of the concerned compound by weight on a dry basis, more preferably in a purity greater than about 97 % by weight on a dry basis, and more preferably in a purity greater than about 98 % by weight on a dry basis or most preferably in a purity greater than about 99 % by weight on a dry basis.

Suitable sweet taste improving polymer additives for use in embodiments of this invention include, but are not limited to, chitosan, pectin, pectic, pectinic, polyuronic, polygalacturonic acid, starch, food hydrocolloid or crude extracts thereof (e.g., gum acacia Senegal (Fibergum®), gum acacia seyal, carageenan), poly-L-lysine (e.g., poly-L-α-lysine or poly-L- ε-lysine), poly-L-ornithine (e.g., poly-L-α-ornithine or poly-L-α-ornithine), polypropylene glycol, polyethylene glycol, poly(ethylene glycol methyl ether), polyarginine, polyaspartic acid, polyglutamic acid, polyethyleneimine, alginic acid, sodium alginate, propylene glycol alginate, sodium polyethyleneglycolalginate, sodium hexametaphosphate or its salts, and other cationic polymers and anionic polymers.

Suitable sweet taste improving protein or protein hydrolysate additives for use in embodiments of this invention include, but are not limited to, bovine serum albumin (BSA), whey protein (including fractions or concentrates thereof such as 90% instant whey protein isolate, 34% whey protein, 50% hydrolyzed whey protein, and 80% whey protein concentrate), soluble rice protein, soy protein, protein isolates, protein hydrolysates, reaction products of protein hydrolysates, glycoproteins, and/or proteoglycans containing amino acids (e.g., glycine, alanine, serine, threonine, asparagine, glutamine, arginine, valine, isoleucine, leucine, norvaline, methionine, proline, tyrosine, hydroxyproline, and the like), collagen (e.g., gelatin), partially hydrolyzed collagen (e.g., hydrolyzed fish collagen), and collagen hydrolysates (e.g., porcine collagen hydrolysate).

Suitable sweet taste improving surfactant additives for use in embodiments of this invention include but are not limited to polysorbates (e.g., polyoxyethylene sorbitan monooleate (polysorbate 80), polysorbate 20, polysorbate 60), sodium dodecylbenzenesulfonate, dioctyl sulfosuccinate or dioctyl sulfosuccinate sodium, sodium dodecyl sulfate, cetylpyridinium chloride (hexadecylpyridinium chloride), hexadecyltrimethylammonium bromide, sodium cholate, carbamoyl, choline chloride, sodium glycocholate, sodium taurodeoxycholate, lauric arginate, sodium stearoyl lactylate, sodium taurocholate, lecithins, sucrose oleate esters, sucrose stearate esters, sucrose palmitate esters, sucrose laurate esters, and other emulsifiers, and the like.

Suitable sweet taste improving flavonoid additives for use in embodiments of this invention generally are classified as flavonols, flavones, flavanones, flavan-3-ols, isoflavones, or anthocyanidins. Non-limiting examples of flavonoid additives include catechins (e.g., green tea extracts such as Polyphenon® 60, Polyphenon® 30, and Polyphenon® 25 (Mitsui Norin Co., Ltd., Japan), polyphenols, rutins (e.g., enzyme modified rutin Sanmelin® AO (San-fi Gen F.F.I., Inc., Osaka, Japan)), neohesperidin, naringin, neohesperidin dihydrochalcone, and the like.

Suitable sweet taste improving alcohol additives for use in embodiments of this invention include, but are not limited to, ethanol.

Suitable sweet taste improving astringent compound additives include, but are not limited to, tannic acid, europium chloride (EuC13), gadolinium chloride (GdC13), terbium chloride (TbC13), alum, tannic acid, and polyphenols (e.g., tea polyphenol).

Suitable sweet taste improving vitamins include nicotinamide (Vitamin B3) and pyridoxal hydrochloride (Vitamin B6).

Suitable sweet taste improving natural high-potency sweetener additives for use in embodiments of this invention include, but are not limited to, rebaudioside A, rebaudioside B, rebaudioside C, rebaudioside D, rebaudioside E, rebaudioside F, dulcoside A, dulcoside B, rubusoside, stevia, stevioside, mogroside IV, mogroside V, Luo Han Guo sweetener, siamenoside, monatin and its salts (monatin SS, RR, RS, SR), curculin, glycyrrhizic acid and its salts, thaumatin, monellin, mabinlin, brazzein, hernandulcin, phyllodulcin, glycyphyllin, phloridzin, trilobtain, baiyunoside, osladin, polypodoside A, pterocaryoside A₅ pterocaryoside B, mukurozioside, phlomisoside I, periandrin I₃ abrusoside A, and cyclocarioside I. As used herein, the phrase "natural high-potency sweetener" or "NHPS" means any sweetener found in nature which may be in raw, extracted, purified, or any other form, singularly or in combination thereof and characteristically have a sweetness potency greater than sucrose, fructose, or glucose, yet have less calories. NHPS may be further modified. Modified NHPSs includes NHPSs which have been altered naturally or synthetically. For example, a modified NHPS includes, but is not limited to, NHPSs which have been fermented, contacted with enzyme, or derivatized, or the product of any process wherein at least one atom has been added to, removed from, or substituted on the NHPS. In one embodiment, extracts of NHPS may be used in any purity percentage. In another embodiment, when a NHPS is used as a non-extract, the purity of the NHPS may range for example from about 25% to about 100%. hi another example, the purity of the NHPS may range from about 70% to about 100%; from about 80% to about 90%; from about 90% to about 100%; from about 95% to about 100%; from about 96% to about 99%; from about 97% to about 98%; from about 98% to about 99%; and from about 99% to about 100%. Specific embodiments of NHPS compositions hi combination with sweet taste improving compositions are disclosed in U.S. Provisional Application No. 60/739,302, entitled "Natural High-Potency Sweetener Compositions with Improved Temporal Profile and/or Flavor Profile, Methods for Their Formulation, and Uses," filed on Nov. 23, 2005, by DuBois, et al., the disclosure of which is incorporated herein by reference in its entirety.

The sweet taste improving compositions also may be hi salt form which may be obtained using standard procedures well known hi the art. The term "salt" also refers to complexes that retain the desired chemical activity of the sweet taste improving compositions of the present invention and are safe for human or animal consumption in a generally acceptable range. Alkali metal (for example, sodium or potassium) or alkaline earth metal (for example, calcium or magnesium) salts also can be made. Salts also may include combinations of alkali and alkaline earth metals. Non-limiting examples of such salts are (a) acid addition salts formed with inorganic acids and salts formed with organic acids; (b) base addition salts formed with metal cations such as calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium, potassium, and the like, or with a cation formed from ammonia, N,N-dibenzylethylenediamine₅ D-glucosarnine, tetraethylammonium, or ethylenediamine; or (c) combinations of (a) and (b). Thus, any salt forms which may be derived from the sweet taste improving compositions may be used with the embodiments of the present invention as long as the salts of the sweet taste improving additives do not adversely affect the taste of synthetic sweeteners or the orally ingestible compositions or dosage forms which comprises at least one synthetic sweetener. The salt forms of the additives can be added to the synthetic sweetener composition in the same amounts as their acid or base forms.

In particular embodiments, suitable sweet taste improving inorganic salts useful as sweet taste improving additives include sodium chloride, potassium chloride, sodium sulfate, magnesium phosphate, potassium citrate, europium chloride (EuC13), gadolinium chloride (GdC13), terbium chloride (TbC13), magnesium sulfate, alum, magnesium chloride, mono-, di-, tri-basic sodium or potassium salts of phosphoric acid (e.g., inorganic phosphates), salts of hydrochloric acid (e.g., inorganic chlorides), sodium carbonate, sodium bisulfate, and sodium bicarbonate. Furthermore, in particular embodiments, suitable organic salts useful as sweet taste improving additives include, but are not limited to, alginic acid sodium salt (sodium alginate), glucoheptonic acid sodium salt, choline chloride, gluconic acid sodium salt (sodium gluconate), gluconic acid potassium salt potassium gluconate), guanidine HCl, glucosamine HCl, monosodium glutamate (MSG), amiloride HCl, adenosine monophosphate salt, magnesium gluconate, potassium tartrate (monohydrate), and sodium tartrate (dihydrate).

Embodiments of the sweet taste improving compositions of this invention can impart a more sharp and clean sensation to the taste of synthetic sweeteners. Furthermore, embodiments of the sweet taste improving compositions of the present invention have a superior effect in improving the temporal profile and/or flavor profile of synthetic sweeteners while at the same time providing a sweetener composition with a low-caloric or non-caloric content, imparting more sugar-like characteristics.

In yet another embodiment of present invention the compounds of present invention can for use of present invention be combined with or incorporated in a synthetic sweetener composition. A synthetic sweetener composition comprises at least one sweet taste improving composition present in the synthetic sweetener composition in an amount effective for the synthetic sweetener composition to impart an osmolality of at least 10 mOsmoles/L to an aqueous solution of the synthetic sweetener composition wherein the synthetic sweetener is present in the aqueous solution in an amount sufficient to impart a maximum sweetness intensity equivalent to that of a 10% aqueous solution of sucrose by weight. As used herein, "mOsmoles/L" refers to milliosmoles per liter. According to another embodiment, a synthetic sweetener composition comprises at least one sweet taste improving composition in an amount effective for the synthetic sweetener composition to impart an osmolality of 10 to 500 mOsmoles/L, preferably 25 to 500 mOsmoles/L preferably, 100 to 500 mOsmoles/L, more preferably 200 to 500 mOsmoles/L, and still more preferably 300 to 500 mOsmoles/L to an aqueous solution of the synthetic sweetener composition wherein the synthetic sweetener is present in the aqueous solution in an amount sufficient to impart a maximum sweetness intensity equivalent to that of a 10% aqueous solution of sucrose by weight. In particular embodiments, a plurality of sweet taste improving compositions may be combined with a synthetic sweetener and in that case, the osmolality impacted is that of the total combination of the plurality of sweet taste improving compositions.

Osmolality refers to the measure of osmoles of solute per liter of solution, wherein osmole is equal to the number of moles of osmotically active particles in an ideal solution (e.g., a mole of glucose is one osmole), whereas a mole of sodium chloride is two osmoles (one mole of sodium and one mole of chloride). Thus, in order to improve in the quality of taste of synthetic sweeteners, the osmotically active compounds or the compounds which impart osmolality must not introduce significant off taste to the formulation.

In one embodiment, suitable sweet taste improving compositions which improves the temporal profile of the synthetic sweetener or sweetenable composition to be more sugar-like include carbohydrates, polyols, amino acids, other sweet taste improving additives (e.g., sugar acids and their salts, nucleotides, organic acids, inorganic acids, organic salts including organic acid salts and/organic base salts, inorganic salts, bitter compounds, astringent compounds, proteins or protein hydrolysates, surfactants, emulsifiers, flavonoids, alcohols, and natural high-potency sweeteners). In more preferred embodiments, non-limiting examples of suitable compounds which impart osmolality include sweet taste improving carbohydrate additives, sweet taste improving polyol additives, sweet taste improving alcohol additives, sweet taste improving inorganic acid additives, sweet taste improving organic acid additives, sweet taste improving inorganic salt additives, sweet taste improving organic salt additives, sweet taste improving organic base salt additives, sweet taste improving amino acid additives, sweet taste improving amino acid salt additives, sweet taste improving bitter additives, and sweet taste improving astringent additives.

In one embodiment, suitable compounds which impart osmolality include, but are not limited to, sucrose, fructose, glucose, maltose, lactose, mannose, galactose, tagatose, erythritol, glycerol, propylene glycol, ethanol, phosphoric acid (including corresponding sodium, potassium, calcium, and magnesium salts thereof), citric acid, malic acid, tartaric acid, fumaric acid, gluconic acid, adipic acid, glucosamine and glucosamine salt, choline salt, guanidine salt, protein or protein hydrolysate, glycine, alanine, serine, threonine, theanine, caffeine, quinine, urea, naringin. tannic acid, AlNa(SO4)2, A1K(SO4)2 and other forms of alum, and combinations thereof.

In one embodiment, suitable sweet taste improving carbohydrate additives for the present invention have a molecular weight less than or equal to 500 and desirably have a molecular weight from 50 to 500. In particular embodiments, suitable carbohydrates with a molecular weight less than or equal to 500 include, but are not limited to, sucrose, fructose, glucose, maltose, lactose, mannose, galactose, and tagatose. Generally, in accordance with desirable embodiments of this invention, a carbohydrate is present in the synthetic sweetener compositions in an amount from about 1,000 to about 100,000 ppm. (Throughout this specification, the term ppm means parts per million by weight or volume. For example, 500 ppm means 500 mg in a liter.) In accordance with other desirable embodiments of this invention, a carbohydrate is present in the synthetic sweetener sweetened compositions in an amount from about 2,500 to about 10,000 ppm. In another embodiment, suitable sweet taste improving carbohydrate additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, sweet taste improving carbohydrate additives with a molecular weight ranging from about 50 to about 500.

In one embodiment, suitable polyol additives have a molecular weight less than or equal to 500 and desirably have a molecular weight from 76 to 500. In particular embodiments, suitable polyols with a molecular weight less than or equal to 500 include, but are not limited to, erythritol, glycerol, and propylene glycol. Generally, in accordance with desirable embodiments of this invention, a polyol is present in the synthetic sweetener compositions in an amount from about 400 ppm to about 80,000 ppm. hi other embodiments of this invention, a polyol is present in the synthetic sweetener compositions in an amount from about 5,000 to about 40,000 ppm of the composition, more particularly from about 10,000 to about 35,000 ppm of the composition. In accordance with other desirable embodiments of this invention, a polyol is present in the synthetic sweetener sweetened compositions in an amount from about 400 to about 80,000 ppm. In a sub-embodiment, suitable sweet taste improving polyol additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to sweet taste improving polyol additives with a molecular weight ranging from about 76 to about 500.

Generally, in accordance with another embodiment of this invention, a suitable sweet taste improving alcohol is present in the synthetic sweetener compositions in an amount from about 625 to about 10,000 ppm. hi another embodiment, suitable sweet taste improving alcohol additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to sweet taste improving alcohol additives with a molecular weight ranging from about 46 to about 500. A non-limiting example of a sweet taste improving alcohol additive with a molecular weight ranging from about 46 to about 500 includes ethanol.

In one embodiment, suitable sweet taste improving amino acid additives have a molecular weight of less than or equal to 250 and desirably have a molecular weight from 75 to 250. In particular embodiments, suitable amino acids with a molecular weight less than or equal to 250 include, but are not limited to, glycine, alanine, serine, valine, leucine, isoleucine, proline, theanine, and threonine. Preferred amino acids include those which are sweet tasting at high concentrations, but are desirably present in embodiments of this invention at amounts below or above their sweetness taste detection threshold. Even more preferred are mixtures of amino acids at amounts below or above their sweetness taste detection threshold. Generally, in accordance with desirable embodiments of this invention, an amino acid is present in the synthetic sweetener compositions in an amount from about 100 ppm to about 25,000 ppm, more particularly from about 1,000 to about 10,000 ppm, and still more particularly from about 2,500 to about 5,000 ppm. In accordance with other desirable embodiments of this invention, an amino acid is present in the synthetic sweetener sweetened compositions in an amount from about 250 ppm to about 7,500 ppm. In a sub-embodiment, suitable sweet taste improving amino acid additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to sweet taste improving amino acid additives with a molecular weight ranging from about 75 to about 250.

Generally, in accordance with yet another embodiment of this invention, a suitable sweet taste improving amino acid salt additive is present in the synthetic sweetener compositions in an amount from about 25 to about 10,000 ppm more particularly from about 1,000 to about 7,500 ppm, and still more particularly from about 2,500 to about 5,000 ppm. In another embodiment, suitable sweet taste improving amino acid salt additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, sweet taste improving amino acid additives with a molecular weight ranging from about 75 to about 300. Non-limiting examples of sweet taste improving amino acid salt additives with a molecular weight ranging from about 75 to about 300 include salts of glycine, alanine, serine, theanine, and threonine.

Generally, in accordance with still another embodiment of this invention, a suitable sweet taste improving protein or protein hydroyslate additive is present in the synthetic sweetener compositions in an amount from about 200 to about 50,000 ppm. In another embodiment, suitable sweet taste improving protein or protein hydrolysate additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, sweet taste improving protein hydrolysate additives with a molecular weight ranging from about 75 to about 300. Non-limiting examples of sweet taste improving protein or protein hydrolysate additives with a molecular weight ranging from about 75 to about 300 include proteins or protein hydrolysates containing glycine, alanine, serine, and threonine.

Generally, in accordance with another embodiment of this invention, a suitable sweet taste improving inorganic acid additive is present in the synthetic sweetener compositions in an amount from about 25 to about 5,000 ppm. In another embodiment, suitable sweet taste improving inorganic acid additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, phosphoric acid, HCl, and H2SO4 and any other inorganic acid additives which are safe for human or animal consumption when used in a generally acceptable range. In a sub- embodiment, suitable sweet taste improving inorganic acid additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, sweet taste improving inorganic acid additives with a molecular weight range from about 36 to about 98.

Generally, in accordance with still another embodiment of this invention, a suitable sweet taste improving inorganic acid salt additive is present in the synthetic sweetener compositions in an amount from about 25 to about 5,000 ppm. In another embodiment, suitable sweet taste improving inorganic acid salt additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, salts of inorganic acid, for example sodium, potassium, calcium, and magnesium salts of phosphoric acid (e.g., inorganic phosphates), and any other alkali or alkaline earth metal salts of other inorganic acid additives (e.g., sodium bisulfate) which are safe for human or animal consumption when used in a generally acceptable range. In a particular embodiment, suitable sweet taste improving inorganic acid salt additives include magnesium chloride, magnesium sulfate, sodium chloride, or combinations thereof.

In a sub-embodiment, suitable sweet taste improving inorganic acid salt additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, sweet taste improving inorganic acid salt additives with a molecular weight range from about 58 to about 120. Generally, in accordance with still another embodiment of this invention, a suitable sweet taste improving organic acid additive is present in the synthetic sweetener compositions in an amount from about 10 to about 5,000 ppm. In another embodiment, suitable sweet taste improving organic acid additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, creatine, citric acid, malic acid, succinic acid, hydroxycitric acid, tartaric acid, fumaric acid, gluconic acid, glutaric acid, adipic acid, and any other sweet taste improving organic acid additives which are safe for human or animal consumption when used hi a generally acceptable range. In one embodiment, the sweet taste improving organic acid additive comprises a molecular weight range from about 60 to about 208.

Generally, in accordance with still another embodiment of this invention, a suitable sweet taste improving organic acid salt additive is present in the synthetic sweetener compositions in an amount from about 20 to about 10,000 ppm. In another embodiment, suitable sweet taste improving organic acid salt additives for imparting osmolarities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, salts the sweet taste improving organic acid additives such as sodium, potassium, calcium, magnesium, and other alkali or alkaline metal salts of citric acid, malic acid, tartaric acid, fumaric acid, gluconic acid, adipic acid, hydroxycitric acid, succinic acid, glutaric acid, and salts of any other sweet taste improving organic acid additives which are safe for human or animal consumption when used in a generally acceptable range. In one embodiment, the sweet taste improving organic acid salt additive comprises a molecular weight range from about 140 to about 208.

Generally, in accordance with yet another embodiment of this invention, a suitable sweet taste improving organic base salt additive is present in the synthetic sweetener compositions in an amount from about 10 to about 5,000 ppm. m another embodiment, suitable sweet taste improving organic base salt additives for imparting osmolarities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, inorganic and/organic acid salts of organic bases such as glucosamine salts, choline salts, and guanidine salts. Generally, in accordance with yet another embodiment of this invention, a suitable sweet taste improving astringent additive is present in the synthetic sweetener compositions in an amount from about 25 to about 1,000 ppm. In another embodiment, suitable sweet taste improving astringent additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, tannic acid, tea pholyphenols, catechins, aluminium sulfate, AlNa(SO4)2, A1K(SO4)2 and other forms of aluminium.

Generally, in accordance with yet another embodiment of this invention, a suitable sweet taste improving nucleotide additive is present in the synthetic sweetener compositions in an amount from about 5 to about 1,000 ppm. In another embodiment, suitable sweet taste improving nucleotide additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, adenosine monophosphate.

Generally, in accordance with yet another embodiment of this invention, a suitable sweet taste improving polyammo acid additive is present in the synthetic sweetener compositions in an amount from about 30 to about 2,000 ppm. hi another embodiment, suitable sweet taste improving polyamino acid additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, poly-L-lysine (e.g., poly-L-α-lysme or poly-L-ε-lysine), poly-L-ornithine (e.g., poly-L-α-ornithine or poly-ε-ornithine), and poly-L-arginine.

Generally, in accordance with yet another embodiment of this invention, a suitable sweet taste improving polymer additive is present in the synthetic sweetener compositions in an amount from about 30 to about 2,000 ppm. In another embodiment, suitable sweet taste improving polymer additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, chitosan, pectin, hydrocoUoids such as gum acacia Senegal, propylene glycol, polyethylene glycol, and poly(ethylene glycol methyl ether). Generally, in accordance with yet another embodiment of this invention, a suitable sweet taste improving surfactant additive is present in the synthetic sweetener compositions in an amount from about 1 to about 5,000 ppm. In another embodiment, suitable sweet taste improving surfactant additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, polysorbates, choline chloride, sodium taurocholate, lecithins, sucrose oleate esters, sucrose stearate esters, sucrose pahnitate esters, and sucrose laurate esters.

Generally, in accordance with yet another embodiment of this invention, a suitable sweet taste improving flavonoid additive is present in the synthetic sweetener compositions in an amount from about 0.1 to about 1,000 ppm. In another embodiment, suitable sweet taste improving flavonoid additives for imparting osmolalities ranging from about 10 mOsmoles/L to about 500 mOsmoles/L to a sweetenable composition include, but are not limited to, naringin, catechins, rutins, neohesperidin, and neoheperidin dihydrochalcone.

Furthermore the compounds of present invention can for use of present invention be combined with a suitable sweet taste improving composition which is a flavor profile modulator or which improves the flavor profile. The flavor profile imparts sugar-like characteristic to synthetic sweeteners. Any sweet taste improving composition that imparts a sugar-like flavor profile to synthetic sweeteners will be effective by this mechanism, hi particular, any sweet taste improving composition that imparts a more sugar-like osmotic taste will be effective by this mechanism. In one embodiment, suitable sweet taste improving compositions which improves the flavor profile, including the osmotic taste, of the synthetic sweetener or sweetenable composition to be more sugar-like include carbohydrates, polyols, amino acids, and other sweet taste improving additives (e.g., polyamino acids, peptides, sugar acids and their salts, nucleotides, organic acids, inorganic acids, organic salts including organic acid salts and organic base salts, inorganic salts, bitter compounds, flavorants and flavoring ingredients, astringent compounds, proteins or protein hydrolysates, surfactants, emulsifiers, flavonoids, alcohols, and natural high-potency sweeteners).

In a preferred embodiment, non-limiting examples of sweet taste improving compositions enhancing the synthetic sweetener's osmotic taste to be more sugar-like include sweet taste improving carbohydrate additives, sweet taste improving alcohol additives, sweet taste improving polyol additives, sweet taste improving amino acid additives, sweet taste improving amino acid salt additives, sweet taste improving inorganic acid salt additives, sweet taste improving polymer additives, and sweet taste improving protein or protein hydrolysate additives.

In another embodiment, suitable sweet improving amino acid additives for improving the osmotic taste of the synthetic sweeteners to be more sugar-like include, but are not limited to, amino acid additives comprising a molecular weight less than or equal to 250. In one example, suitable sweet taste improving amino acids include, but are not limited to, low molecular weight amino acids such as glycine, leucine, valine, isoleucine, proline, hydroxyproline, alanine, serine, theanine, and threonine.

hi another embodiment, suitable sweet taste improving carbohydrate additives for improving the osmotic taste of the synthetic sweeteners to be more sugar-like include, but are not limited to, sweet taste improving carbohydrate additives with a molecular weight ranging from about 50 to about 500. Non-limiting examples of sweet taste improving carbohydrate additives with a molecular weight ranging from about 50 to about 500 include sucrose, fructose, glucose, maltose, lactose, mannose, galactose, ribose, rhamnose, trehalose, and tagatose.

In another embodiment, suitable sweet taste improving polyol additives for improving the osmotic taste of the synthetic sweeteners to be more sugar-like include, but are not limited to, sweet taste improving polyol additives with a molecular weight ranging from about 76 to about 500. Non-limiting examples of sweet taste improving polyol additives with a molecular weight ranging from about 76 to about 500 include erythritol, glycerol, and propylene glycol, hi a sub-embodiment, other suitable sweet taste improving polyol additives include sugar alcohols.

hi another embodiment, suitable sweet taste improving alcohol additives for improving the osmotic taste of the synthetic sweeteners to be more sugar-like include, but are not limited to, sweet taste improving alcohol additives with a molecular weight ranging from about 46 to about 500. A non-limiting example of sweet taste improving alcohol additive with a molecular weight ranging from about 46 to about 500 includes ethanol.

In another embodiment, suitable sweet taste improving amino acid additives for improving the osmotic taste of the synthetic sweeteners to be more sugar-like include, but are not limited to, sweet taste improving amino acid additives with a molecular weight ranging from about 75 to about 250. Non-limiting examples of sweet taste improving amino acid additives with a molecular weight ranging from about 75 to about 250 include glycine, alanine, serine, leucine, valine, isoleucine, proline, hydroxyproline, glutamine, theanine, and threonine.

In another embodiment, suitable sweet taste improving amino acid salt additives for improving the osmotic taste of the synthetic sweeteners to be more sugar-like include, but are not limited to, sweet taste improving amino acid salt additives with a molecular weight ranging from about 75 to about 300. Non-limiting examples of sweet taste improving amino acid salt additives with a molecular weight ranging from about 75 to about 300 include salts of glycine, alanine, serine, leucine, valine, isoleucine, proline, hydroxyproline, glutamine, theanine, and threonine.

The autophagy activator compounds of present invention for use in present invention can also be incorporated in a composition or dosage form which is a beverage. Such beverage may be of the group of a non-carbonated beverage or a carbonated beverage.

The autophagy activator compounds of present invention for use in present invention can also be incorporated in a composition or dosage form which is a beverage which is of the group of cola, fruit- flavored beverage, citrus- flavored beverage (for instance lemon-lime flavored beverage or a orange-flavored beverage), root beer, fruit juice, fruit- flavored, fruit-containing beverage, vegetable juice or vegetable containing beverage, tea, coffee, beverage comprising a dairy component, sports drink, energy drink, flavored water.

A suitable dosage form for the autophagy activator of present invention is for instance composition comprising water in an amount between 97-99% by volume of the total composition; citric acid in an amount between 0.18 and 0.22% by volume of the total composition; juice concentrate in an amount between 3.0-7.0% by volume of the total composition; ascorbic acid in an amount between 0.046-0.054 g/L by weight of the total composition; natural sweeteners in an amount between 0.65-0.79% by volume of the total composition; Vitamin E in amount between 0.015-0.019 g/L by weight of the total composition; green tea extract in an amount between 0.050-0.062 g/L by weight of the total composition; grape seed extract in an amount between 0.050-0.062 g/L by weight of the total composition; artificial sweeteners in an amount between 0.47-0.58 g/L by weight of the total composition; and carbonation in an amount between 2.5 and 3.0 volumes or more preferably such composition comprising water in an amount of 98% by volume of the total composition; citric acid in an amount of 0.20% by volume of the total composition; juice concentrate in an amount of 5.3% by volume of the total composition; ascorbic acid in an amount 0.05 g/L by weight of the total composition; natural sweeteners in an amount between 0.65-0.79% by volume of the total composition; Vitamin E in amount of 0.017 g/L by weight of the total composition; green tea extract in an amount of 0.056 g/L by weight of the total composition; grape seed extract in an amount of 0.056 g/L by weight of the total composition sucralose in an amount between 0.45-0.55 g/L by weight of the total composition; acesulfame potassium in an amount between 0.020-0.024 g/L by weight of the total composition; and carbonation in an amount of 2.5 volumes.

The autophagy activator agonist compounds of present invention for use in present invention can also be incorporated in a composition or dosage form which is a beverage or a drink such as a fruit juice, beer, lemonade for instance a sparkling fruit juice antioxidant beverage or a sparkling vegetable juice antioxidant beverage.

Preferred ingredients of such sparkling fruit juice antioxidant beverage or such of such sparkling vegetable juice antioxidant beverage suitable for comprising the autophagy activator agonist compounds of present invention are in the ranges in which they may be present according to the invention, the preferred ranges in which they may be present, and the most preferred amount in which they may be present as follows: water (citric acid, ascorbic acid, HFCS-55, (Brix: 77.0), Fruit Juice concentrate(s) or vegetable juice concentrates, FD&Color(s), Potassium, sorbate, sodium benzoate, potassium, citrate, EDTA/ calcium disodium sucralose liquid concentrate, acesulfame potassium, Flavors/flavorings, vitamin E, grape seed extract, green tea extract, carbonation. These can be in ranges of water More Preferred Relative Amount 97-99% v/v SSJ or Most Preferred Relative Amount 98% v/v SSJ), citric acid (More Preferred Relative Amount 0.18-0.22% v/v SSJ or Most Preferred Relative Amount 0.20% v/v SSJ), ascorbic acid, HFCS-55 (Brix: 77.0) (More Preferred Relative Amount 0.65-0.79% v/v SSJ or Most Preferred Relative Amount 0.72% v/v SSJ), Fruit Juice concentrate(s) or vegetable juice concentrates (More Preferred Relative Amount 3.0-7.0% v/v SSJ or Most Preferred Relative Amount 5.3% % v/v SSJ) , FD&Color(s) (More Preferred Relative Amount 0.0364-0.0444 g/L or Most Preferred Relative Amount 0.0404 g/L), Potassium sorbate (More Preferred Relative Amount 0.440-0.538 g/L or Most Preferred Relative Amount 0.489 g/L), sodium benzoate (More Preferred Relative Amount 0.196-0.240 g/L or Most Preferred Relative Amount 0.218 g/L), potassium, citrate (More Preferred Relative Amount 0.18-0.22 g/L or Most Preferred Relative Amount 0.200 g/L), EDTA/ calcium disodium (More Preferred Relative Amount 0.022-0.275 g/L or Most Preferred Relative Amount 0.025 g/L), sucralose liquid concentrate (More Preferred Relative Amount 0.45-0.55 g/L or Most Preferred Relative Amount 0.495 g/L), acesulfame potassium (More Preferred Relative Amount 0.020-0.024 g/L or Most Preferred Relative Amount 0.022 g/L), Flavors/flavorings (More Preferred Relative Amount 0.99-12.1 g/L or Most Preferred Relative Amount 1.1 g/L), vitamin E (More Preferred Relative Amount 0.015-0.019 g/L or Most Preferred Relative Amount 0.017 g/L.), grape seed extract (0.050-0.062 g/L or Most Preferred Relative Amount 0.056 g/L) , green tea extract (More Preferred Relative Amount 0.050-0.062 g/L or Most Preferred Relative Amount 0.056 g/L) , carbonation (More Preferred Relative Amount 2.5-3.0 volumes or Most Preferred Relative Amount 2.5 volumes). The above mentioned lists of juice concentrates, FD&C colors, and flavors/flavorings among the components of the sparkling juice beverages of the invention. The particular juice concentrates, FD&C colors and flavorings may be selected from a large variety of known juices, colors and flavors according to taste and aesthetic factors. The vitamin E listed above is liquid or encapsulated powder form. The artificially sweetened sparkling juice beverage compositions formulated according to the ranges above offer the antioxidant benefits of vitamin C and E as well as green tea and grape seed extracts.

The autophagy activator of present invention may be further combined in a functional composition or dosage form with suitable C-reactive protein reducing substances which include, but are not limited to, phytosterols, 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors (i.e., statins), peroxisome proliferators-activated receptor-α agonists (i.e., fibrates), peroxisome proliferators-activated receptor-α agonists (i.e., glitazones), aspirin, RRR-α-tocopherol, policosanol, leukotriene inhibitors, antihistamines, corticosteroids, 2-aryl- 3-aroylbenzo[b]thiophenes, similar type substances, and combinations thereof. For example, suitable phytosterols for use hi embodiments of the present invention include, but are not limited to, sitosterol, campesterol, stigmasterol, spinosterol, taraxasterol, brassicasterol, demosterol, chalinosterol, poriferasterol, clionasterol, ergosterol, sitostanol, campestanol, stigmastanol, spinostanol, taraxastanol, brassicastanol, desmostanol, chalinostanol, poriferastanol, clionastanol, ergostanol, and similar type substances, and combinations thereof. Suitable phytosterols for embodiments of the present invention may also be derived from, for example, rice bran, corn bran, corn germ, wheat germ oil, corn oil, safflower oil, oat oil, olive oil, cotton seed oil, soybean oil, peanut oil, black tea, green tea, colocsia, kale, broccoli, sesame seeds, shea oils, grapeseed oil, rapeseed oil, linseed oil, canola oil, tall oil, other oils obtained from wood pulp, and similar type sources. As used herein, "phytosterols" refers to plant sterols and plant stanols in their free and esterified forms. In other embodiments, suitable C-reactive protein reducing substances comprise a policosanol selected from the group consisting of 1-tetracosanol, 1-hexacosanol, 1-heptacosanol, 1-octacosanol, 1- triacontanol, 1- dotriacontanol, 1-tetracontanol, any other high molecular weight straight chain primary alcohol selected from 20 to 36 carbon atoms, and similar type materials, and combinations thereof. Within the human body, C-reactive protein is an acute-phase protein produced by the liver. C-reactive protein is considered an acute-phase protein because it is released into the body in response to acute injury, infection, or other inflammatory stimuli. These C-reactive protein has been used as a marker of inflammation. In addition, C-reactive protein has been useful in monitoring the activity of rheumatoid arthritis (i.e., rheumatology) and as a risk marker for cardiovascular disease (e.g., atherogenesis). More recently, it has been suggested that the C-reactive protein is not only a marker for cardiovascular disease, but may also play a role in causing atherogenesis. For example, C-reactive protein may play a role in the expression of different adhesion molecules on endothelial cells and may be able to activate human complement within plaque. Thus, C-reactive protein reducing substances can desirably be used to decrease, block, or inhibit C-reactive protein or its production in the human body. As used herein, "C-reactive protein reducing substance" refers to any substance effective in causing a biological response of a tissue, system, or patient which may include decreasing, modulating, blocking, or inhibiting C-reactive protein, its production, or its detrimental effects.

For its use in a treatment of the health disorders according to present invention the autophagy activator of present invention may be incorporated in an edible gel mix. Such edible gel mix can comprise at least one natural and/or synthetic high-potency sweetener, at least one sweet taste improving composition, and at least one gelling ingredient. In other embodiments, an edible gel composition is provided that comprises at least one natural and/or synthetic high- potency sweetener, at least one sweet taste improving composition, at least one gelling ingredient, and at least one fluid. As used herein the phrase "the at least one natural and/or synthetic high-potency sweetener and at least one sweet taste improving composition" is synonymous with the phrase "the sweetener composition". A gel is a colloidal system in which a network of particles spans the volume of a liquid medium. Although gels mainly are composed of liquids, and thus exhibit densities similar to liquids, gels have the structural coherence of solids due to the network of particles that spans the liquid medium. For this reason, gels generally appear to be solid, jelly-like materials. Gels can be used in a number of applications. For example, gels can be used in foods, paints, and adhesives. Gels that can be eaten are refered to herein as "edible gel compositions." Edible gel compositions typically are eaten as snacks, as desserts, as a part of staple foods, or along with staple foods. Non-limiting examples of edible gel compositions for use in particular embodiments include gel desserts, puddings, jellies, pastes, trifles, aspics, marshmallows, gummy candies, or the like. Edible gel mixes generally are powdered or granular solids to which a fluid may be added to form an edible gel composition. Non-limiting examples of fluids for use in particular embodiments include water, dairy fluids, dairy analogue fluids, juices, alcohol, alcoholic beverages, and combinations thereof. Non-limiting examples of dairy fluids which may be used in particular embodiments include milk, cultured milk, cream, fluid whey, and mixtures thereof. Non- limiting examples of dairy analogue fluids which may be used in particular embodiments include, for example, soy milk and non-dairy coffee whitener. As used herein, the term "gelling ingredient" denotes any material that can form a colloidal system within a liquid medium. Non-limiting examples of gelling ingredients for use in particular embodiments include gelatin, alginate, carageenan, gum, pectin, konjac, agar, food acid, rennet, starch, starch derivatives, and combinations thereof. It is well known to those having ordinary skill in the art that the amount of gelling ingredient used in an edible gel mix or an edible gel composition varies considerably depending on a number of factors, such as the particular gelling ingredient used, the particular fluid base used, and the desired properties of the gel. In a particular embodiment, the gelling ingredient is present in the edible gel mix in an amount from about 0.5% to about 80% by weight of the edible gel mix. hi a particularly desirable embodiment, the gelling ingredient present in the edible gel mix is gelatin. Desirably, the gelatin is present in the edible gel mix in an amount from about 25% to about 80% by weight of the edible gel mix, and more desirably in an amount from about 38% to about 50% by weight of the edible gel mix. hi another embodiment, the gelling ingredient is present in the edible gel composition in an amount from about 0.05% to about 10% by weight of the edible gel composition. In a particularly desirable embodiment, the gelling ingredient present in the edible gel composition is gelatin. Desirably, the gelatin is present hi the edible gel composition in an amount from about 0.8% to about 4% by weight of the edible gel composition, and more desirably in an amount from about 1.2% to about 1.6% by weight of the edible gel composition. Edible gel compositions generally appeal to consumers because of their sweet taste. Because edible gel products found in the marketplace typically are sweetened with sucrose, it is desirable to sweeten edible gels with an alternative sweetener in order provide a low-calorie or non-calorie alternative. Accordingly, in a particular embodiment, the edible gel mix comprises at least one natural and/or synthetic high-potency sweetener in combination with at least one sweet taste improving composition and at least one gelling ingredient. The sweetener composition may be added to the edible gel mix composition in an amount effective to sweeten the edible gel mix. hi other embodiments, an edible gel composition is provided that comprises at least one natural and/or synthetic high- potency sweetener, at least one sweet taste improving composition, at least one gelling ingredient, and at least one fluid. The sweetener composition may be added to the edible gel composition as a coating, as a frosting, as a glaze, or as a matrix blend (i.e. added as an ingredient to the edible gel mix prior to the preparation of the edible gel composition).

In a specific embodiment, the polyamine of present invention is spermine or spermidine. In an embodiment of present invention the autophagy activator of present invention or administered in a orally deliverable dosage form which comprises dietary fibers. Food sources of dietary fiber include, but are not limited to, grains, legumes, fruits, and vegetables. Grains providing dietary fiber include, but are not limited to, oats, rye, barley, wheat,. Legumes providing fiber include, but are not limited to, peas and beans such as soybeans. Fruits and vegetables providing a source of fiber include, but are not limited to, apples, oranges, pears, bananas, berries, tomatoes, green beans, broccoli, cauliflower, carrots, potatoes, celery. Plant foods such as bran, nuts, and seeds (such as flax seeds) are also sources of dietary fiber. Parts of plants providing dietary fiber include, but are not limited to, the stems, roots, leaves, seeds, pulp, and skin. Although dietary fiber generally is derived from plant sources, indigestible animal products such as chitins are also classified as dietary fiber. Chitin is a polysaccharide composed of units of acetylglucosamine joined by β(l-4) linkages, similar to the linkages of cellulose. Sources of dietary fiber often are divided into categories of soluble and insoluble fiber based on their solubility in water. Both soluble and insoluble fibers are found in plant foods to varying degrees depending upon the characteristics of the plant. Although insoluble in water, insoluble fiber has passive hydrophilic properties that help increase bulk, soften stools, and shorten transit time of fecal solids through the intestinal tract. Unlike insoluble fiber, soluble fiber readily dissolves in water. Soluble fiber undergoes active metabolic processing via fermentation in the colon, increasing the colonic microflora and thereby increasing the mass of fecal solids. Fermentation of fibers by colonic bacteria also yields end products with significant health benefits. For example, fermentation of the food masses produces gases and short-chain fatty acids. Acids produced during fermentation include butyric, acetic, propionic, and valeric acids that have various beneficial properties such as stabilizing blood glucose levels by acting on pancreatic insulin release and providing liver control by glycogen breakdown. In addition, fiber fermentation may reduce atherosclerosis by lowering cholesterol synthesis by the liver and reducing blood levels of LDL and triglycerides. The acids produced during fermentation lower colonic pH, thereby protecting the colon lining from cancer polyp formation. The lower colonic pH also increases mineral absorption, improves the barrier properties of the colonic mucosal layer, and inhibits inflammatory and adhesion irritants. Fermentation of fibers also may benefit the immune system by stimulating production of T-helper cells, antibodies, leukocytes, splenocytes, cytokinins and lymphocytes. Dietary fiber has been demonstrated to have assorted health benefits despite not being absorbed by the gastrointestinal tract. Dietary fiber can potentially reduce the incidence of an assortment of chronic diseases, especially those involving the gastrointestinal tract. Consumption of dietary fiber has been demonstrated to alter metabolism of carbohydrates, lipids, and proteins. Medical studies show that diets high in fiber reduce the risk of colon cancer, coronary heart disease, type-2 diabetes, diverticular disease, irritable bowel syndrome, and constipation. High fiber diets also reduce the risk of developing obesity, high blood cholesterol, and inflammatory bowel diseases such as ulcerative colitis and Crohn's disease. Accordingly, it will be desirable to supplement foods and beverages with dietary fiber. It is well known to those of ordinary skill in the art that phytonutrients, plant extracts, and herbal compositions may be used in their natural and/or modified form. Modified phytonutrients, plant extracts, and herbal compositions include phytonutrients, plant extracts, and herbal compositions which have been altered naturally. For example, a modified phytonutrient includes, but is not limited to, phytonutrients which have been fermented, contacted with enzyme, or derivatized or substituted on the phytonutrient. In one embodiment, modified phytonutrients may be used individually or in combination with unmodified phytonutrients. For the sake of brevity, however, in the description of embodiments of this invention, a modified phytonutrient is not described expressly as an alternative to an unmodified phytonutrient, but it should be understood that modified phytonutrients can be substituted for or combined with phytonutrients in any embodiment disclosed herein. The same embodiments will be applicable to plant extracts and other herbal compositions. Plant extracts include extracts from foliage, stems, bark, fruit, seed, and any other plant matter. As used herein, the at least one dietary fiber source may comprise a single dietary fiber source or a plurality of dietary fiber sources as a functional ingredient for the sweetener compositions provided herein. Generally, according to particular embodiments of this invention, the at least one dietary fiber source is present in the sweetener composition or sweetened orally ingestible composition in an amount sufficient to promote health and wellness. In a preferred embodiment, dietary fiber is provided in the dietary fiber composition in an amount from about 0.5 to about 6.0 g per single serving. In a more preferred embodiment, dietary fiber is provided in the dietary fiber composition in an amount from about 2.0 to about 3.0 grams per single serving.

In a specific embodiment, the polyamine of present invention is spermine or spermidine. Suitable polymer additives for the delivering the autophagy activators of present invention in the form of a chewable gum are but not limited to, chitosan, pectin, pectic, pectinic, polyuronic, polygalacturonic acid, starch, food hydrocolloid or crude extracts thereof (e.g., gum acacia Senegal (Fibergum™), gum acacia seyal, carageenan), poly-L-lysine (e.g., poly-L-α-lysine or poly-L-ε-lysine), poly-L-ornithine (e.g., poly-L-α-ornithine or poly-L-ε- ornithine), polyarginine, polypropylene glycol, polyethylene glycol, poly(ethylene glycol methyl ether), polyaspartic acid, polyglutamic acid, polyethyleneimine, alginic acid, sodium alginate, propylene glycol alginate, sodium hexametaphosphate (SHMP) and its salts, and sodium polyethyleneglycolalginate and other cationic and anionic polymers. Suitable sweet taste improving protein or protein hydrolysate additives for use in the embodiments of such chewable gum include, but are not limited to, bovine serum albumin (BSA), whey protein (including fractions or concentrates thereof such as 90% instant whey protein isolate, 34% whey protein, 50% hydrolyzed whey protein, and 80% whey protein concentrate), soluble rice protein, soy protein, protein isolates, protein hydrolysates, reaction products of protein hydrolysates, glycoproteins, and/or proteoglycans containing amino acids (e.g., glycine, alanine, serine, threonine, asparagine, glutamine, arginine, valine, isoleucine, leucine, norvaline, methionine, proline, tyrosine, hydroxyproline, and the like), collagen (e.g., gelatin), partially hydrolyzed collagen (e.g., hydrolyzed fish collagen), and collagen hydrolysates (e.g., porcine collagen hydrolysate). Suitable sweet taste improving surfactant additives for use in embodiments of this invention include, but are not limited to, polysorbates (e.g., polyoxyethylene sorbitan monooleate (polysorbate 80), polysorbate 20, polysorbate 60), sodium dodecylbenzenesulfonate, dioctyl sulfosuccinate or dioctyl sulfosuccinate sodium, sodium dodecyl sulfate, cetylpyridinium chloride (hexadecylpyridinium chloride), hexadecyltrimethylammonium bromide, sodium cholate, carbamoyl, choline chloride, sodium glycocholate, sodium taurodeoxycholate, lauric arginate, sodium stearoyl lactylate, sodium taurocholate, lecithins, sucrose oleate esters, sucrose stearate esters, sucrose palmitate esters, sucrose laurate esters, and other emulsifiers, and the like.

According to particular embodiments of this invention, the sweetener compositions for comprising the autophagy activators of present invention provided herein further may comprise at least one functional ingredient different than the dietary fiber sources described above. According to particular embodiments of this invention, non-limiting examples of such functional ingredients include naturally nutrient- rich or medicinally active food, such as garlic, soybeans, antioxidants, fibers, glucosamine, chondroitin sulfate, ginseng, ginko, Echinacea, or the like; other nutrients that provide health benefits, such as amino acids, vitamins, minerals, carotenoids, fatty acids such as omega-3 or omega-6 fatty acids, DHA, EPA, or ALA which can be derived from plant or animal sources (e.g., salmon and other cold- water fish or algae), flavonoids, phenols, polyols, prebiotics/probiotics, phytosterols and phytostanols and their esters, phytoestrogens, sulfides/thiols, policosanol, saponin, rubisco peptide, appetite suppressants, hydration agents, autoimmune agents, C-reactive protein reducing agents, or anti-inflammatory agents; or any other functional ingredient that is beneficial to the treatment of specific diseases or conditions, such as diabetes, osteoporosis, inflammation, or cholesterol.

Another dosage for comprising the functional autophagy activators of present invention in order to delivery them to the subject to treat or prevent a autophagy related disorder is a baked good. Baked goods, as used herein, include ready to eat and all ready to bake products, flours, and mixes requiring preparation before serving. Non-limiting examples of baked goods include cakes, crackers, cookies, brownies, muffins, rolls, bagels, donuts, strudels, pastries, croissants, biscuits, bread, bread products, and buns. Preferred baked goods in accordance with embodiments of this invention can be classified into three groups: bread-type doughs (e.g., white breads, variety breads, soft buns, hard rolls, bagels, pizza dough, and flour tortillas), sweet doughs (e.g., danishes, croissants, crackers, puff pastry, pie crust, biscuits, and cookies), and batters (e.g., cakes such as sponge, pound, devil's food, cheesecake, and layer cake, donuts or other yeast raised cakes, brownies, and muffins). Doughs generally are characterized as being flour-based, whereas batters are more water-based. Baked goods in accordance with particular embodiments of this invention generally comprise a combination of sweetener, water, and fat. Baked goods made in accordance with many embodiments of this invention also contain flour in order to make a dough or a batter. The term "dough" as used herein is a mixture of flour and other ingredients stiff enough to knead or roll. The term "batter" as used herein consists of flour, liquids such as milk or water, and other ingredients, and is thin enough to pour or drop from a spoon. Desirably, in accordance with particular embodiments of the invention, the flour is present in the baked goods in an amount in the range of about 15 to about 60% on a dry weight basis, more desirably from about 23 to about 48% on a dry weight basis. The type of flour may be selected based on the desired product. Generally, the flour comprises an edible non-toxic flour that is conventionally utilized in baked goods. According to particular embodiments, the flour may be a bleached bake flour, general purpose flour, or unbleached flour. In other particular embodiments, flours also may be used that have been treated in other manners. For example, in particular embodiments flour may be enriched with additional vitamins, minerals, or proteins. Non- limiting examples of flours suitable for use in particular embodiments of the invention include wheat, corn meal, whole grain, fractions of whole grains (wheat, bran, and oatmeal), and combinations thereof. Starches or farinaceous material also may be used as the flour in particular embodiments. Common food starches generally are derived from potato, corn, wheat, barley, oat, tapioca, arrow root, and sago. Modified starches and pregelatinized starches also may be used in particular embodiments of the invention. The type of fat or oil used in particular embodiments of the invention may comprise any edible fat, oil, or combination thereof that is suitable for baking. Non-limiting examples of fats suitable for use in particular embodiments of the invention include vegetable oils, tallow, lard, marine oils, and combinations thereof. According to particular embodiments, the fats may be fractionated, partially hydrogenated, and/or interesterified. In another particular embodiment, the fat desirably comprises reduced, low calorie, or non-digestible fats, fat substitutes, or synthetic fats. In yet another particular embodiment, shortenings, fats, or mixtures of hard and soft fats also may be used, hi particular embodiments, shortenings may be derived principally from triglycerides derived from vegetable sources (e.g., cotton seed oil, soybean oil, peanut oil, linseed oil, sesame oil, palm oil, palm kernel oil, rapeseed oil, safflower oil, coconut oil, corn oil, sunflower seed oil, and mixtures thereof). Synthetic or natural triglycerides of fatty acids having chain lengths from 8 to 24 carbon atoms also may be used in particular embodiments. Desirably, in accordance with particular embodiments of this invention, the fat is present in the baked good in an amount in the range of about 2 to about 35% by weight on a dry basis, more desirably from about 3 to about 29% by weight on a dry basis. Baked goods in accordance with particular embodiments of this invention also comprise water in amounts sufficient to provide the desired consistency, enabling proper forming, machining and cutting of the baked good prior or subsequent to cooking. The total moisture content of the baked good includes any water added directly to the baked good as well as water present in separately added ingredients (e.g., flour, which generally includes about 12 to about 14% by weight moisture). Desirably, in accordance with particular embodiments of this invention, the water is present in the baked good in an amount up to about 25% by weight of the baked good. Baked goods in accordance with particular embodiments of this invention also may comprise a number of additional conventional ingredients such as leavening agents, flavors, colors, milk, milk by-products, egg, egg by-products, cocoa, vanilla or other flavoring, as well as inclusions such as nuts, raisins, cherries, apples, apricots, peaches, other fruits, citrus peel, preservative, coconuts, flavored chips such a chocolate chips, butterscotch chips, and caramel chips, and combinations thereof. In particular embodiments, the baked goods may also comprise emulsifiers, such as lecithin and monoglycerides. In a particular embodiment, the at least one sweet taste improving composition comprises at least one of the additional conventional ingredients described above. According to particular embodiments of this invention, leavening agents may comprise chemical leavening agents or yeast leavening agents. Non-limiting examples of chemical leavening agents suitable for use in particular embodiments of this invention include baking soda (e.g., sodium, potassium, or aluminum bicarbonate), baking acid (e.g., sodium aluminum phosphate, monocalcium phosphate, or dicalcium phosphate), and combinations thereof. In accordance with another particular embodiment of this invention, cocoa may comprise natural or "Dutched" chocolate from which a substantial portion of the fat or cocoa butter has been expressed or removed by solvent extraction, pressing, or other means. In a particular embodiment, it may be necessary to reduce the amount of fat in a baked good comprising chocolate because of the additional fat present in cocoa butter. In particular embodiments, it may be necessary to add larger amounts of chocolate as compared to cocoa in order to provide an equivalent amount of flavoring and coloring. Baked goods generally also comprise caloric sweeteners, such as sucrose, high fructose corn syrup, erythritol, molasses, honey, or brown sugar. In exemplary embodiments of the baked goods provided herein, the sweetener comprises at least one natural and/or synthetic high-potency sweetener and at least one sweet taste improving composition. Accordingly, a baked good in accordance with a particularly desirable embodiment comprises at least one natural and/or synthetic high-potency sweetener in combination with at least one sweet taste improving composition, a fat, water, and optionally flour. In a particular embodiment, the baked good optionally may include other natural and/or synthetic high- potency sweeteners and/or bulk sweeteners. As described hereinabove, the baked goods comprise at least one natural and/or synthetic high-potency sweetener and at least one sweet taste improving composition. The combination of the at least one natural and/or synthetic high-potency sweetener and at least one sweet taste improving composition, as used herein, comprises the "sweetener composition." In addition, the combination of the sweetener composition hi a baked good comprises a "sweetened composition."

Accordingly, in a particular embodiment, the at least one natural and/or synthetic high- potency sweetener in combination with at least one sweet taste improving composition is present hi the edible gel mix in an amount of at least about 0.3% by weight of the edible gel mix. More desirably, the sweetener composition is present hi the edible gel mix hi an amount from about 0.5% to about 30% by weight of the edible gel mix, even more desirably from about 1% to about 10% by weight of the edible gel mix, and yet even more desirably from about 1.8% to about 3.6% by weight of the edible gel mix.

In another particular embodiment the at least one natural and/or synthetic high- potency sweetener in combination with at least one sweet taste improving composition is present hi the edible gel composition hi an amount of at least about 0.006% by weight of the edible gel composition. More desirably, the sweetener composition is present in the edible gel mix in an amount from to about 0.01% to about 1.5% by weight of the edible gel composition, even more desirably from about .025% to about 0.5% by weight of the edible gel composition, and yet even more desirably from about 0.045% to about 0.09% by weight of the edible gel composition.

It is well known to those having ordinary skill in the art that the edible gel mixes and edible gel compositions of this invention may be prepared using other ingredients in addition to the sweetener composition and the gelling agent. Non-limiting examples of other ingredients for use in particular embodiments include a food acid, a salt of a food acid, a buffering system, a bulking agent, a sequestrant, a cross-linking agent, one or more flavors, one or more colors, and combinations thereof. Non-limiting examples of food acids for use in particular embodiments include citric acid, adipic acid, fumaric acid, lactic acid, malic acid, and combinations thereof. Non-limiting examples of salts of food acids for use in particular embodiments include sodium salts of food acids, potassium salts of food acids, and combinations thereof. Non-limiting examples of bulking agents for use in particular embodiments include raftilose, isomalt, sorbitol, polydextrose, maltodextrin, and combinations thereof. Non-limiting examples of sequestrants for use in particular embodiments include calcium disodium ethylene tetra-acetate, glucono delta-lactone, sodium gluconate, potassium gluconate, ethylenediaminetetraacetic acid (EDTA), and combinations thereof. Non-limiting examples of cross-linking agents for use in particular embodiments include calcium ions, magnesium ions, sodium ions, and combinations thereof.

One of ordinary skill in the art, with the teachings of the present invention, may arrive at all the possible combinations of natural and/or synthetic high-potency sweeteners and sweet taste improving compositions in a dosage form of the autophagy agonist of present invention. For example, non-limiting combinations of the natural and/or synthetic high-potency sweetener and sweet taste improving compositions include: 1. at least one natural and/or synthetic high- potency sweetener and at least one carbohydrate; 2. at least one natural and/or synthetic high- potency sweetener and at least one polyol; 3. at least one natural and/or synthetic high- potency sweetener and at least one amino acid; 4. at least one natural and/or synthetic high- potency sweetener and at least one other sweet taste improving additive; 5. at least one natural and/or synthetic high-potency sweetener, at least one carbohydrate, at least one polyol, at least one amino acid, and at least one other sweet taste improving additive; 6. at least one natural and/or synthetic high-potency sweetener, at least one carbohydrate, and at least one polyol; 7. at least one natural and/or synthetic high-potency sweetener, at least one carbohydrate, and at least one amino acid; 8. at least one natural and/or synthetic high-potency sweetener, at least one carbohydrate, and at least one other sweet taste improving additive; 9. at least one natural and/or synthetic high-potency sweetener, at least one polyol, and at least one amino acid; 10. at least one natural and/or synthetic high-potency sweetener, at least one polyol, and at least one other sweet taste improving additive; 11. at least one natural and/or synthetic high- potency sweetener, at least one amino acid, and at least one other sweet taste improving additive; 12. at least one natural and/or synthetic high-potency sweetener, at least one carbohydrate, at least one polyol, and at least one amino acid; 13. at least one natural and/or synthetic high-potency sweetener, at least one carbohydrate, at least one polyol, and at least one other sweet taste improving additive; 14. at least one natural and/or synthetic high- potency sweetener, at least one polyol, at least one amino acid, and at least one other sweet taste improving additive; and 15. at least one natural and/or synthetic high-potency sweetener, at least one carbohydrate, at least one amino acid, and at least one other sweet taste improving additive.

These fifteen major combinations further may be broken down into further combinations in order to improve the overall taste of the natural and/or synthetic high- potency sweetener or the sweetened compositions comprising the natural and/or synthetic high-potency sweetener.

Another functional ingredient that may be combined with the polyamine autophagy activator of present invention is at least one mineral. Minerals, in accordance with the teachings of this invention, comprise inorganic chemical elements required by living organisms. Minerals are comprised of a broad range of compositions (e.g., elements, simple salts, and complex silicates) and also vary broadly in crystalline structure. They may naturally occur in foods and beverages, may be added as a supplement, or may be consumed or administered separately from foods or beverages. Minerals may be categorized as either bulk minerals, which are required in relatively large amounts, or trace minerals, which are required in relatively small amounts. Bulk minerals generally are required in amounts greater than or equal to about 100 mg per day and trace minerals are those that are required in amounts less than about 100 mg per day.

In particular embodiments of this invention, the at least one mineral comprises bulk minerals, trace minerals, or combinations thereof. Non-limiting examples of bulk minerals include calcium, chlorine, magnesium, phosphorous, potassium, sodium, and sulfur. Non-limiting examples of trace minerals include chromium, cobalt, copper, fluorine, iron, manganese, molybdenum, selenium, zinc, and iodine. Although iodine generally is classified as a trace mineral, it is required in larger quantities than other trace minerals and often is categorized as a bulk mineral, in other particular embodiments of this invention, the at least one mineral may comprise other trace minerals that are believed to be necessary for human nutrition, non- limiting examples of which include bismuth, boron, lithium, nickel, rubidium, silicon, strontium, tellurium, tin, titanium, tungsten, and vanadium. The minerals embodied herein may be in any form known to those of ordinary skill in the art. For example, in a particular embodiment the minerals may be in their ionic form, having either a positive or negative charge. In another particular embodiment the minerals may be in their molecular form. For example, sulfur and phosphorous often are found naturally as sulfates, sulfides, and phosphates. Appropriate intake of dietary minerals is necessary to maintain health. Sodium, potassium, and chlorine largely regulate the fluid balance in the body. Sodium also is involved in the absorption of other nutrients, such as glucose and amino acids. In addition, sodium and potassium act as cofactors for some enzymes. Other minerals, such as calcium, magnesium, and phosphorous, are essential for the proper development of the skeletal system and serve important structural functions in the body. These minerals also are important for maintaining connective tissue and cell membranes. Mineral deficiencies contribute to a number of health problems. For example, a sodium or potassium deficiency may cause abnormal nerve activity, cardiac arrhythmias or even cardiac arrest. Deficiencies of iodine, which is used by the body in synthesis of thyroid hormones, may lead to goiter and, in pregnant females, can lead to serious birth defects such as cretinism. Iron is an essential component of hemoglobin, and dietary iron deficiencies can cause anemia, resulting in tiredness and shortness of breath. Calcium deficiencies, which most often are caused by a deficiency in vitamin D, can lead to poor bone structure and osteoporosis. Manganese and zinc deficiencies can result in rashes on the skin of the upper torso, face, groin, hands, and feet. Although mineral deficiencies can cause serious health problems, excessive mineral intake may also lead to illness. For example, potassium or magnesium toxicity in the body can lead to cardiac arrest. Generally, kidneys that function normally can regulate mineral concentrations within the body and excrete excess amounts of minerals; however, in some cases the body is unable to regulate mineral concentrations properly. This can occur if kidney function is abnormal or if mineral intake is highly excessive. In addition, excess mineral intake of one mineral can influence the absorption and metabolism of other minerals. For example, the presence of a large amount of zinc in the diet decreases the absorption of iron and copper and can lead to harmful deficiencies. Because of the importance of obtaining an appropriate intake of minerals, people generally should eat a well-balanced diet. However, for many people, available food supply or dietary patterns can cause mineral imbalances or mineral deficiencies, falling short of the Recommended Dietary Allowances (RDAs) promulgated by the Food and Nutrition Board of the National Academy of Sciences. Accordingly, dietary mineral supplements and mineral fortification of foods and beverages are desirable and generally recommended by the Food and Nutrition Board. RDAs for males and females of commonly recognized dietary minerals are provided in the table below along with maximum safe levels of daily nutrient intake; however, this table should not be construed as limiting the scope of the invention. Mineral intake beyond the upper limits provided by the Food and Nutrition Board may be appropriate if prescribed by a physician. Note also that the RDAs in the table below are provided for adult males and adult females. Generally, lower dietary allowances are appropriate for infants and for children under the age of 18.

Due to their activity, the polyamine autophagy activators and polyamine autophagy activators are advantageously useful in human and veterinary medicine. As described above, the compounds of the invention are useful for treating or preventing arteriosclerosis, dyslipemia or hypercholesterolemia in a patient.

When administered to a patient, a polyamine autophagy activator is preferably administered as a component of a composition that optionally comprises a pharmaceutically acceptable carrier or vehicle. In a preferred embodiment, these compositions are administered orally.

Compositions for oral administration might require an enteric coating to protect the composition(s) from degradation within the gastrointestinal tract. In another example, the composition(s) can be administered in a liposomal formulation to shield the polyamine autophagy activator disclosed herein from degradative enzymes, facilitate the molecule's transport in the circulatory system, and affect delivery of the molecule across cell membranes to intracellular sites.

Polyamine autophagy activator intended for oral administration can be coated with or admixed with a material (e.g., glyceryl monostearate or glyceryl distearate) that delays disintegration or affects absorption of the polyamine autophagy activator in the gastrointestinal tract. Thus, for example, the sustained release of a polyamine autophagy activator can be achieved over many hours and, if necessary, the polyamine autophagy activator can be protected from being degraded within the gastrointestinal tract. Taking advantage of the various pH and enzymatic conditions along the gastrointestinal tract, pharmaceutical compositions for oral administration can be formulated to facilitate release of a polyamine autophagy activator at a particular gastrointestinal location. Selectively permeable membranes surrounding an osmotically active driving compound are also suitable for orally administered compositions. Fluid from the environment surrounding the capsule is imbibed by the driving compound, which swells to displace the polyamine autophagy activator through an aperture, can provide an essentially zero order delivery profile instead of the spiked profiles of immediate release formulations. A time delay material such as, but not limited to, glycerol monostearate or glycerol stearate can also be used.

Suitable pharmaceutical carriers also include starch, glucose, lactose, sucrose, gelatin, saline, gum acacia, talc, keratin, urea, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, and ethanol. If desired, the carrier, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. In addition, auxiliary, stabilizing, thickening, lubricating, and coloring agents may be used. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.

A pharmaceutical composition comprising a polyamine autophagy activator can be administered via one or more routes such as, but not limited to, oral, intravenous infusion, subcutaneous injection, intramuscular, topical, depo injection, implantation, time-release mode, and intracavitary. The pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intramuscular, intraperitoneal, intracapsular, intraspinal, intrasternal, intratumor, intranasal, epidural, intra-arterial, intraocular, intraorbital, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical-particularly to the ears, nose, eyes, or skin), transmucosal (e.g., oral) nasal, rectal, intracerebral, intravaginal, sublingual, submucosal, and transdermal administration.

Administration can be via any route known to be effective by a physician of ordinary skill. Parenteral administration, i.e., not through the alimentary canal, can be performed by subcutaneous, intramuscular, intra-peritoneal, intratumoral, intradermal, intracapsular, intra- adipose, or intravenous injection of a dosage form into the body by means of a sterile syringe, optionally a pen-like syringe, or some other mechanical device such as an infusion pump. A further option is a composition that can be a powder or a liquid for the administration in the form of a nasal or pulmonary spray. As a still further option, the administration can be transdermally, e.g., from a patch. Compositions suitable for oral, buccal, rectal, or vaginal administration can also be provided.

In one embodiment, a pharmaceutical composition of the invention is delivered by a controlled-release system. For example, the pharmaceutical composition can be administered using intravenous infusion, an implantable osmotic pump, a transdermal patch, liposomes, or other modes of administration, hi one embodiment, a pump can be used (See e.g., Langer, 1990, Science 249:1527-33; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507; Saudek et al., 1989, N. Engl. J. Med. 321:574). In another embodiment, the compound can be delivered in a vesicle, in particular a liposome (See e.g., Langer, 1990, Science 249:1527-33; Treat et al., 1989, in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353- 65; Lopez-Berestein, ibid., pp. 317-27; International Patent Publication No. WO 91/04014; U.S. Pat. No. 4,704,355). In another embodiment, polymeric materials can be used (See e.g., Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Press: Boca Raton, FIa., 1974; Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley: New York (1984); Ranger and Peppas, 1953, J. Macromol. Sci. Rev. Macromol. Chem. 23:61; Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989, J. Neurosurg. 71:105).

hi yet another embodiment, a controlled release system can be placed in proximity of the target. For example, a micropump can deliver controlled doses directly into bone or adipose tissue, thereby requiring only a fraction of the systemic dose (See e.g., Goodson, 1984, in Medical Applications of Controlled Release, vol. 2, pp. 115-138). hi another example, a pharmaceutical composition of the invention can be formulated with a hydrogel (See, e.g., U.S. Pat. Nos. 5,702,717; 6,117,949; 6,201,072).

hi one embodiment, it may be desirable to administer the pharmaceutical composition of the invention locally, i.e., to the area in need of treatment. Local administration can be achieved, for example, by local infusion during surgery, topical application (e.g., in conjunction with a wound dressing after surgery), injection, catheter, suppository, or implant. An implant can be of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.

In certain embodiments, it may be desirable to introduce the polyamine autophagy activator into the central nervous system by any suitable route, including intraventricular, intrathecal, and epidural injection. Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.

Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent, or via perfusion in a fluorocarbon or synthetic pulmonary surfactant.

In one embodiment, the invention provides for the treatment of a patient using implanted cells that have been regenerated or stimulated to proliferate in vitro or in vivo prior to reimplantation or transplantation into a recipient. Conditioning of the cells ex vivo can be achieved simply by growing the cells or tissue to be transplanted in a medium that has been supplemented with a growth-promoting amount of the combinations and is otherwise appropriate for culturing of those cells. The cells can, after an appropriate conditioning period, then be implanted either directly into the patient or can be encapsulated using established cell encapsulation technology, and then implanted.

The skilled artisan can appreciate the specific advantages and disadvantages to be considered in choosing a mode of administration. Multiple modes of administration are encompassed by the invention. For example, a polyamine autophagy activator of the invention can be administered by subcutaneous injection, whereas another therapeutic agent can be administered by intravenous infusion. Moreover, administration of one or more species of polyamine autophagy activators, with or without other therapeutic agents, can occur simultaneously (i.e., co-administration) or sequentially. In another embodiment, the periods of administration of a polyamine autophagy activator, with or without other therapeutic agents can overlap. For example a polyamine autophagy activator can be administered for 7 days and another therapeutic agent can be introduced beginning on the fifth day of polyamine autophagy activator treatment. Treatment with the other therapeutic agent can continue beyond the 7-day polyamine autophagy activator treatment.

A pharmaceutical composition of a polyamine autophagy activator can be administered before, during, and/or after the administration of one or more therapeutic agents. In one embodiment, polyamine autophagy activator can first be administered to stimulate the expression of insulin, which increases sensitivity to subsequent challenge with a therapeutic agent. In another embodiment, polyamine autophagy activator can be administered after administration of a therapeutic agent. In yet another embodiment, there can be a period of overlap between the administration of the polyamine autophagy activator and the administration of one or more therapeutic agents.

A pharmaceutical composition of the invention can be administered in the morning, afternoon, evening, or diurnally. In one embodiment, the pharmaceutical composition is administered at particular phases of the circadian rhythm. In a specific embodiment, the pharmaceutical composition is administered in the morning. In another specific embodiment, the pharmaceutical composition is administered at an artificially induced circadian state.

The present compositions can take the form of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained-release formulations, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use. Li one embodiment, the pharmaceutically acceptable vehicle is a capsule (See e.g., U.S. Pat. No. 5,698,155). Other examples of suitable pharmaceutical carriers are described in Remington 's Pharmaceutical Sciences, Alfonso R. Gennaro ed., Mack Publishing Co. Easton, Pa., 19th ed., 1995, pp. 1447 to 1676, incorporated herein by reference.

In a specific embodiment, the present compositions contain spermine or spermidine.

Accordingly, the pharmaceutical compositions herein described can be in the form of oral tablets, capsules, elixirs, syrups and the like.

For instance, for oral administration in the form of a tablet or capsule, the active drug component can be combined with an oral, non-toxic, pharmaceutically acceptable, inert carrier such as, but not limited to, lactose, starch, sucrose, glucose, methyl cellulose, magnesium stearate, dicalcium phosphate, calcium sulfate, mannitol, and sorbitol. For oral administration in liquid form, the oral drug components can be combined with any oral, nontoxic, pharmaceutically acceptable carrier such as, but not limited to, ethanol, glycerol, and water. Moreover, suitable binders, lubricants, disintegrating agents and coloring agents can also be incorporated into the mixture. Suitable binders include, but are not limited to, starch, gelatin, natural sugars (e.g., glucose, beta-lactose), corn sweeteners, natural and synthetic gums (e.g., acacia, tragacanth, sodium alginate), carboxymethylcellulose, polyethylene glycol, and waxes. Lubricants useful for an orally administered drug, include, but are not limited to, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, and sodium chloride. Disintegrators include, but are not limited to, starch, methyl cellulose, agar, bentonite, and xanthan gum.

Pharmaceutical compositions adapted for oral administration can be provided, for example, as capsules or tablets; as powders or granules; as solutions, syrups or suspensions (in aqueous or non-aqueous liquids); as edible foams or whips; or as emulsions. For oral administration in the form of a tablet or capsule, the active drug component can be combined with an oral, nontoxic, pharmaceutically acceptable, inert carrier such as, but not limited to, lactose, starch, sucrose, glucose, methyl cellulose, magnesium stearate, dicalcium phosphate, magnesium carbonate, stearic acid or salts thereof, calcium sulfate, mannitol, and sorbitol. For oral administration in the form of a soft gelatin capsule, the active drug component can be combined with an oral, non-toxic, pharmaceutically acceptable, inert carrier such as, but not limited to, vegetable oils, waxes, fats, semi-solid, and liquid polyols. For oral administration in liquid form, the oral drug components can be combined with any oral, non-toxic, pharmaceutically acceptable carrier such as, but not limited to, ethanol, glycerol, polyols, and water. Moreover, suitable binders, lubricants, disintegrating agents and coloring agents can also be incorporated into the mixture. Suitable binders include, but are not limited to, starch, gelatin, natural sugars (e.g. glucose, beta-lactose), corn sweeteners, natural and synthetic gums (e.g., acacia, tragacanth, sodium alginate), carboxymethylcellulose, polyethylene glycol, and waxes. Lubricants useful for an orally administered drug, include, but are not limited to, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, and sodium chloride. Disintegrators include, but are not limited to, starch, methyl cellulose, agar, bentonite, and xanthan gum.

Orally administered compositions may contain one or more agents, for example, sweetening agents such as, but not limited to, fructose, aspartame and saccharin. Orally administered compositions may also contain flavoring agents such as, but not limited to, peppermint, oil of wintergreen, and cherry. Orally administered compositions may also contain coloring agents and/or preserving agents.

The autophagy activators can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids, such as cholesterol, stearylamine or phosphatidylcholines. A variety of cationic lipids can be used in accordance with the invention including, but not limited to, N-(I (2,3 -dioleyloxy)propyl)-N,N,N- trimethylammonium chloride ("DOTMA") and diolesylphosphotidylemanolamine ("DOPE"). Such compositions suit the mode of administration.

Autophagy activators can also be delivered by the use of monoclonal antibodies as individual carriers to which the autophagy activators can be coupled. The autophagy activators can also be coupled with soluble polymers as targetable drug carriers. Such polymers can include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropyhnethacrylamide-phenol, polyhydroxyethylaspartamide-phenol, or polyethyleneoxide-polylysine substituted with pahnitoyl residues. Furthermore, the polyamine autophagy activator activators can be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyglycolic acid, copolymers of polylactic and polyglycolic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates and cross linked or amphipathic block copolymers of hydrogels.

Pharmaceutical compositions adapted for parenteral administration include, but are not limited to, aqueous and non-aqueous sterile injectable solutions or suspensions, which can contain antioxidants, buffers, bacteriostats and solutes that render the pharmaceutical compositions substantially isotonic with the blood of an intended recipient. Other components that can be present in such pharmaceutical compositions include water, alcohols, polyols, glycerine and vegetable oils, for example. Compositions adapted for parenteral administration can be presented in unit-dose or multi-dose containers (e.g., sealed ampoules and vials), and can be stored in a freeze-dried (i.e., lyophilized) condition requiring the addition of a sterile liquid carrier (e.g., sterile saline solution for injections) immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets.

Pharmaceutical compositions adapted for transdermal administration can be provided as discrete patches intended to remain in intimate contact with the epidermis for a prolonged period of time. Pharmaceutical compositions adapted for topical administration can be provided as, for example, ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols or oils. A topical ointment or cream is preferably used for topical administration to the skin, mouth, eye or other external tissues. When formulated in an ointment, the active ingredient can be employed with either a paraffinic or a water-miscible ointment base. Alternatively, the active ingredient can be formulated in a cream with an oil- in-water base or a water-in-oil base.

Pharmaceutical compositions adapted for topical administration to the eye include, for example, eye drops or injectable pharmaceutical compositions. In these pharmaceutical compositions, the active ingredient can be dissolved or suspended in a suitable carrier, which includes, for example, an aqueous solvent with or without carboxymethylcellulose. Pharmaceutical compositions adapted for topical administration in the mouth include, for example, lozenges, pastilles and mouthwashes.

Pharmaceutical compositions adapted for nasal administration can comprise solid carriers such as powders (preferably having a particle size in the range of 20 to 500 microns). Powders can be administered in the manner in which snuff is taken, i.e., by rapid inhalation through the nose from a container of powder held close to the nose. Alternatively, pharmaceutical compositions adopted for nasal administration can comprise liquid carriers such as, for example, nasal sprays or nasal drops. These pharmaceutical compositions can comprise aqueous or oil solutions of a polyamine autophagy activator. Compositions for administration by inhalation can be supplied in specially adapted devices including, but not limited to, pressurized aerosols, nebulizers or insufflators, which can be constructed so as to provide predetermined dosages of the polyamine autophagy activator.

Pharmaceutical compositions adapted for rectal administration can be provided as suppositories or enemas. Pharmaceutical compositions adapted for vaginal administration can be provided, for example, as pessaries, tampons, creams, gels, pastes, foams or spray formulations.

Suppositories generally contain active ingredients in the range of 0.5% to 10% by weight. Oral formulations preferably contain 10% to 95% active ingredient by weight. In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intratumoral injection, implantation, subcutaneous injection, or intravenous administration to humans.

Typically, pharmaceutical compositions for injection or intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition can also include a solubilizing agent and a local anesthetic such as lidocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachet indicating the quantity of active agent.

Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle, bag, or other acceptable container, containing sterile pharmaceutical grade water, saline, or other acceptable diluents. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration. For a patient who cannot orally ingest a nutrient, it is essential to supply all nutrients such as an amino acid, a saccharide and an electrolyte through a vein. This way is called the total parenteral nutrition therapy, (TPN therapy) which can be provided by a TPN solution.

The polyamine autophagy activator and optionally another therapeutic agent are administered at an effective dose. The dosing and regimen most appropriate for patient treatment will vary with the disease or condition to be treated, and in accordance with the patient's weight and with other parameters.

An effective dosage and treatment protocol can be determined by conventional means, comprising the steps of starting with a low dose in laboratory animals, increasing the dosage while monitoring the effects (e.g., histology, disease activity scores), and systematically varying the dosage regimen. Several factors may be taken into consideration by a clinician when determining an optimal dosage for a given patient. Additional factors include, but are not limited to, the size of the patient, the age of the patient, the general condition of the patient, the particular disease being treated, the severity of the disease, the presence of other drugs in the patient, and the in vivo activity of the polyamine autophagy activator.

A typical effective human dose of a polyamine autophagy activator would be from about 10 μg/kg body weight/day to about 100 mg/kg/day, preferably from about 50 μg/kg/day to about 50 mg/kg/day, and most preferably about 100 μg/kg/day to 20 mg/kg/day. As analogs of the polyamine autophagy activator disclosed herein can be 2 to 100 times more potent than naturally occurring counterparts, a typical effective dose of such an analog can be lower, for example, from about 100 ng/kg body weight/day to 1 mg/kg/day, preferably 10 μg/kg/day to 900 μg/kg/day, and even more preferably 20 μg/kg/day to 250 μg/kg/day.

In another embodiment, the effective dose of a polyamine autophagy activator of present is less than 10 μg/kg/day. In yet another embodiment the effective dose of a polyamine autophagy activator of present is greater than 10 mg/kg/day. The specific dosage for a particular patient, of course, has to be adjusted to the degree of response, the route of administration, the patient's weight, and the patient's general condition, and is finally dependent upon the judgment of the treating physician.

It is understandable that the ideal dosage per serving to have the health effect will have to vary according the body weight of the subject who consumes the oral ingestible dosage form which comprises the polyamine autophagy activator of present invention and the molecular weight of the compounds that will vary according to the amounts of glycoside groups on said the scaffold of general formula I of present invention. A autophagy effect can be obtained in a subject with about 50 kg body weight by an orally ingestible dosage form comprising between 5 mg and 2,5 gram, preferably 15 mg to 2 gram, more preferably between 25 mg and 1,5 gram, more preferably between 50 mg and 750 mg of the polyamine autophagy activator of present invention per serving of said food or beverage product (as demonstrated in Table 3)

Table 3. Possible amount of the polyamine autophagy activator active ingredient of present invention per serving by a subject.

Also contemplated are methods of prevention or treatment involving combination therapies comprising administering an effective amount of the polyamine autophagy activator molecule of present invention can be in combination with another therapeutic agent or agents. The other therapeutic agent or agent can be, for example, an anti-osteoporosis agent, a steroid hormones, a non-steroid hormone, growth factor, a selective estrogen receptor modulator, an insulin-releasing agent, an inhibitor of glucagon secretion, a glucagon antagonists, a circadian rhythm regulator, a growth hormone secretagogue, an agent that increase IGF-I levels, an immunotherapeutic agent, a cytokine, a protease inhibitor, a vitronectin receptor antagonist, a bisphosphonate compound, a kinase inhibitor, an integrin receptor or antagonist thereof, an anti-obesity agent, a lipid-metabolism improving agent, a neuropeptide Y blocker, a kainate/AMPA receptor antagonist, a β-adrenergic receptor agonist, a compound that reduces caloric intake, an anti-diabetes agent, or a dietary nutrient. Examples of therapeutic agents include, but are not limited to, those in Table 4.

Table 4. Other Therapeutics to be administered with the polyamine autophagy activator of present invention.

• anti-osteoporosis agent o alendronate sodium o calcium L-threonate (e.g., CsH₁₄Oi₀Ca) o clodronate o etidronate o gallium nitrate o mithramycin o norethindrone acetate (e.g., that which is commercially available as

ACTIVELLA) o osteoprotegerin o pamidronate o risedronate sodium

• steroid hormones o androgen (e.g., androstenedione, testosterone, dehydroepiandrosterone, dihydrotestosterone, 7-alpha-methyl- 19-nortestosterone, 7-alpha-methyl- 19- nortestosterone acetate, methandroil, oxymetholone, methanedione, oxymesterone, nordrolone phenylpropionate, noretbandrolone) o glucocorticoid o estrogenic hormones (e.g., that which is commercially available as PREMARIN) o progestin non-steroid hormone o calcitonin o calcitriol o growth hormone (e.g., osteoclast-activating factor) o melatonin o parathyroid hormone o prostaglandin o thyroid hormone growth factor o epidermal growth factor o fibroblast growth factor o insulin-like growth factor 1 o insulin-like growth factor 2 o platelet-derived growth factor o vascular endothelial growth factor selective estrogen receptor modulator o BE-25327 o CP-336156 o clometherone o delmadinone o droloxifene o idoxifene o nafoxidine o nitromifene o oπneloxifene o raloxifene (e.g., that which is commercially available as EVISTA) o tamoxifen o toremifene o trioxifene o [2-(4-hydroxyphenyl)-6-hydroxynaphthalen- 1 -yl] [4- [2-(l -piperidinyl)- ethoxy]phenyl] -methane insulin-releasing agent o GLP-I o nateglinide o repaglinide (e.g., that which is commercially available as PRANDIN) o sulfonylurea (e.g., glyburide, glipizide, glimepiride) o vasopressin inhibitor of glucagon secretion o somatostatin glucagon antagonists o substituted glucagons having an alanine residue at position 1, 2, 3-5, 9-11, 21, or 29 o des-His -Ala glucagons o des-His^Ala²'¹ ^Glu^glucagon circadian rhythm regulator o alkylene dioxybenzene agonist o melatonin o neuropeptide Y o tachykinin agonist o visible light therapy growth hormone secretagogue o cycloalkano[b]thien-4-ylurea o GHRP-I o GHRP-6 o growth hormone releasing factor o hexarelin o thiourea o B-HT920 o benzo-fused lactams (e.g., N-biphenyl-3-amido substituted benzolactams) o benzo-fused macrocycles (e.g., 2-substituted piperidines, 2-substituted pyrrolidines, 2-substituted hexahydro-lH-azepines, di-substituted piperidines, di-substituted pyrrolidines, di-substituted hexahydro-lH-azepines, tri- substituted piperidines, tri-substituted pyrrolidines, tri-substituted hexahydro- 1 H-azepines, L-pyroglutamyl-pyridylalanyl-L-prolinamides) agents that increase IGF-I levels o L-acetylcamitine o L-isovalerylcamitine o L-propionylcarnitine immunotherapeutic agent o antibody o immunomodulator cytokine o endothelial monocyte activating protein o granulocyte colony stimulating factor o interferon (e.g., IFN-γ) o interleukin (e.g., IL-6) o lymphokine o lymphotoxin-α o lymphotoxin-β o tumor necrosis factor o tumor necrosis-factor-like cytokine o macrophage inflammatory protein o monocyte colony stimulating factor o 4-1BBL o CD27 ligand o CD30 ligand o CD40 ligand o CD137 ligand o Fas ligand o OX40 ligand

• protease inhibitor o cysteine protease inhibitor (e.g., vinyl sulfone, peptidylfluoromethyl ketone, cystatin C, cystatin D, E-64) o DPP IV antagonist o DPP IV inhibitor (e.g., N-(substituted glycyl)-2-cyanopyrrolidines, N-Ala-Pro-

O-nitrobenzyl-hydroxylamine, and ε-(4-nitro)benzoxycarbonyl-Lys-Pro) o serine-protease inhibitor (e,g., azapeptide, BMS232632, antipain, leupeptin)

• vitronectin receptor antagonist o anti- vitronectin receptor antibody (e.g., 23 C6) o cyclo-S,S-N α-acetyl-cysteinyl-N alpha-rnethyl-argininyl-glycyl-aspartyl- penicillamine o RGD-containing peptide (e.g., echistatin)

• bisphosphonate compound o alendronate (e.g., that which is commercially available as FOSAMAX) o aminoalkyl bisphosphonate (e.g., alendronate, pamidronate (3-amino-l- hydroxypropylidene)bisphosphonic acid disodium salt, pamidronic acid, risedronate (l-hydroxy-2-(3-pyridinyl)ethylidene)bisphosphonate, YM 175 [(cycloheptylamino^ethylene-bisphosphonic acid], piridronate, aminohexanebisphosphonate, tiludronate, BM-210955, CGP-42446, EB-1053) o risedronate (e.g., that which is commercially available as ACTONEL)

• kinase inhibitor o Rho-kinase inhibitor (e.g., (+)-trans-4-(l -aminoethyl)- 1 -(4- pyridylcarbamoyl)cyclohexane, trans-N-( 1 H-pyrrolo [2,3 -b]pyridin-4-yl)-4- guanidinomethylcyclohexanecarbox amide, l-(5- isoquinolinesulfonyl)homopiperazine, 1 -(5-isoquinolinesulfonyl)-2- methylpiperazine)

• integrin receptor o α subunit (e.g., subtype 1 -9, D, M, L, X, V, lib, IELb) o β subunit (e.g., subtype 1-8)

• integrin receptor antagonists o ethyl 3(S)-(2,3-dihydro-benzofuran-6-yl)-3-{2-oxo-3-[3-(5,6.7,8- tetrahydro-[l₅8] naph1iiyridin-2-yl)-propyl]-te1rahydro-pyrimidin-l-yl}- propionate; o ethyl 3(S)-(3-fluorophenyl)-3-(2-oxo-3(S or R)-[3-(5₅6,7,8-tetrahydro-

[l,8]naphthyridin-2-yl)-propyl]-piperidin-l-yl)-propionate; o ethyl 3(S)-(3-fluorophenyl)-3-(2-oxo-3® or S)-[3-(5,6,7,8-tetrahydro-

[l,8]naphthyridin-2-yl)-propyl]-piperidin-l-yl)-propio nate; o 3(S)-(2,3-dihydro-benzofuran-6-yl)-3-{2-oxo-3-[3-(5,6,7, 8-tetrahydro-[l,8]n aphthyridin-2-yl)-propyl] -telxahydro-pyrirnidin- 1 -yl } -propionic acid; o 3(S)-(3-fluorophenyl)-3-(2-oxo-3® or R)-[3-(5,6,7,8-tetrahydro-

[l,8]naphthyridin-2-yl)-propyl]-piperidin-l-yl)-propionic acid; o 3(S)-(3-fruorophenyl)-3-(2-oxo-3(S or S)-[3-(5,6,7,8-tetrahydro-

[l,8]naphthyridin-2-yl)-propyl]-piperidin-l-yl)-propionic acid anti-obesity agent o benzphetamine (e.g. that which is commercially available as DIDREX) o benzylisopropylamine (e.g. that which is commercially available as

IONAMIN) o bupropion o dexfenfluramine (e.g. that which is commercially available as REDUX) o dextroamphetamine (e.g. that which is commercially available as

DEXEDRINE) o diethylpropion (e.g. that which is commercially available as TENUATE) o dimemylphenemylamine (e.g. that which is commercially available as

ADEPEX or DESOXYN) o evodamine o fenfluramine (e.g. that which is commercially available as PONDIMIN) o fluoxetine o mazindol (e.g. that which is commercially available as SANOREX or

MAZANOR) o methamphetamine o naltrexone o orlistat (e.g. that which is commercially available as XENICAL) o phendimetrazine (e.g. that which is commercially available as BONTRIL or PLEGINE) o phentermine (e.g. that which is commercially available as FASTIN) o sibutramine (e.g. tiiat which is commercially available as MERIDIA)

• a lipid-metabolism improving agent o capsaicin

• an neuropeptide Y blocker o NGD-95-1

• kainate/AMPA receptor antagonist

• β-adrenergic receptor agonist

• compound that reduces caloric intake o fat substitute (e.g., that which is commercially available as OLESTRA) o sugar substitute (e.g., that which is commercially available as ASPARTAME)

• anti-diabetes agent o insulin glargine (e.g. that which is commercially available as LANTUS) o pioglitazone (e.g. that which is commercially available as ACTOS) o rosiglitazone maleate (e.g. that which is commercially available as AVANDIA)

• dietary nutrient o sugar o dietary fatty acid o triglyceride o oligosaccharides (e.g., fructo-oligosaccharides, raffinose, galacto- oligosaccharides, xylo-oligosaccharides, beet sugar and soybean oligosaccharides) o protein o vitamin (e.g., vitamin D) o mineral (e.g., calcium, magnesium, phosphorus and iron)

The other therapeutic agents can be made and used at doses as disclosed previously. For example, an anti-osteoporosis agent (see e.g., U.S. Pat. Nos. 2,565,115 and 2,720,483), a nonsteroid hormone (see, e.g., U.S. Pat. Nos. 6,121,253; 3,927,197; 6,124,314), a glucagon antagonists (see, e.g., U.S. Pat. No. 5,510,459), a growth hormone secretagogue (see, e.g., U.S. Pat. Nos. 3,239,345; 4,036,979; 4,411,890; 5,206,235; 5,283,241; 5,284,841; 5,310,737; 5,317,017; 5,374,721; 5,430,144; 5,434,261; 5,438,136; 5,494,919; 5,494,920; and 5,492,916; European Patent Nos. 144,230 and 513,974; International Patent Publication Nos. WO 89/07110; WO 89/07111; WO 93/04081; WO 94/07486; WO 94/08583; WO 94/11012; WO 94/13696; WO 94/19367; WO 95/03289; WO 95/03290; WO 95/09633; WO 95/11029; WO 95/12598; WO 95/13069; WO 95/14666; WO 95/16675; WO 95/16692; WO 95/17422; WO 95/17423; WO 95/34311; and WO 96/02530), an agent that increase IGF-I levels (see, e.g., U.S. Pat. No. 6,166,077), a cytokine (see, e.g., U.S. Pat. No. 4,921,697), a vitronectin receptor antagonist (see e.g., U.S. Pat. No. 6,239,138 and Horton et al., 1991, Exp. Cell Res. 195:368), a bisphosphonate compound (see e.g., U.S. Pat. No. 5,409,911), a kinase inhibitor (U.S. Pat. No. 6,218,410), and an integrin receptor or antagonist thereof (see, e.g., U.S. Pat. No. 6,211,191).

OμM 0,1 μM 1 μM 10 μM

SPD*28°C SPD*28°C SPD*28°C SPD*28°C days of offspring counting

0 (before T° stress) 26 0 44 106

Λ

I

2

3 363,0 320,0 346,0 390,0

4

5

6

7 292,0 322,0 305,0 275,0

8

9

10

Cumulative offspring in 1 week 681,0 642,0 695,0 771,0

OμM 0,1 μM 1 μM 10 μM

SPD*Cd²⁺ SPD*Cd²⁺ SPD*Cd² SPD*Cd²⁺ days of offspring counting

0 (before Cd stress) 80,0 33,0 125,0 318,0

I

2

3 267,0 402,0 453,0 68,0

4

5

6

7 334,0 277,0 293,0 416,0

8

9

10 Cumulative offspring in 1 week 681,0 712,0 871,0 802,0

OμM 0,1 μM 1 μM 10 μM

SPD*28°C SPD*28°C SPD*28°C SPD*28°C days of offspring counting

0 26 0 44 106

2

3 363,0 320,0 346,0 390,0

4

5

6

7 292,0 322,0 305,0 275,0

8

9

10

Cumulative offspring in 1 week 681,0 642,0 695,0 771,0

OμM 0,1 μM 1 μM 10 μM

SPD*Cd² SPD*Cd² SPD*Cd² SPD*Cd²⁺ days of offspring counting

0 80,0 33,0 125,0 318,0

I

2

3 267,0 402,0 453,0 68,0

4

5

6

7 334,0 277,0 293,0 416,0

8

9

10

Cumulative offspring in 1 week 681,0 712,0 871,0 802,0

Table 4 . Reproduction of Dαphniα mαgnα exposed to Spermidine, Spermidine + temperature stress and Spermidine + Cd stress. SPD is spermidine

Claims

Activators of the autophagic pathway Claims What is claimed is:

1) A polyamine compound of the group consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, 1,4-butanediamine N-(3-aminopropyl)- monohydrochloride or derivatives thereof or combinations thereof for use in a treatment to increase the survivability, lifespan or the life expectancy of a invertebrate animal or to increase the average lifespan of a population of such invertebrate animals.

2) The polyamine compound of claim 1 , is for use in a low treatment dose range of 10 mM to 1 μM, preferably of 1 mM to 10 μM.

3) A polyamine compound as claimed in claim 1 or claim 2, whereby the invertebrate animal is a microinvertebrate animal.

4) A polyamine compound as claimed in claim 1 or claim 2, whereby the invertebrate animal is an arthropod animal.

5) A polyamine compound as claimed in claim 1 or claim 2, whereby the arthropod is an arthropod animal of the group consisting of an insect, an arachnid and a crustacean.

6) A polyamine compound as claimed in claim 1 or claim 2, whereby the invertebrate poikilotherm animal is a crustacean of the group consisting of a crab, a lobster, a crayfish, a shrimp, krill and a barnacle.

7) A polyamine compound as claimed in claim 1 or claim 2, whereby the invertebrate poikilotherm animal is a crustacean of the group consisting of a crab, a lobster, a crayfish, a shrimp and a bivalve mollusk.

8) A polyamine compound as claimed in in claim 1 or claim 2, whereby the poikilotherm animal is a invertebrate poikilotherm animal.

9) A polyamine compound as claimed in claim 8, whereby the vertebrate poikilotherm animal is an invertebrate poikilotherm aquatic animal.

10) A polyamine compound as claimed in claim 1 or claim 2, whereby the inveterbrate animal is an inverterbrate animal under a stress condition.

11) A polyamine compound as claimed in claim 10, whereby the stress condition is anyone of the conditions of malnoursion, pollution, extreme abiotic factor, artificial environment.

12) A polyarnine compound as claimed in any of the previous claims, whereby polyamine compound is spermidine or a pharmaceutically or nutraceutically acceptable salt of such a polyamine compound.

13) A polyamine compound as claimed in any of the previous claims, whereby polyamine compound is spermine or a pharmaceutically or nutraceutically acceptable salt of such a polyamine compound.

14) A composition comprising the polyamine compound of claims 1 to 13 for use in a treatment to increase the survivability, lifespan or the life expectancy of a poikilotherm animal or to increase the average lifespan of a population of such poikilotherm animal, comprising: an amount of a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, 1,4-butanediamine N-(3- aminopropyl)-monohydrochloride or derivatives thereof or combinations thereof that is effective to activate the cellular autophagic pathway.

15) The composition of claim 14, wherein the polyamine compound is in a dose range of 10 mM to 1 μM, preferably of 1 mM to 10 μM.

16) The composition of any one of the claims 14 or 15, wherein the composition is an oral composition.

17) The composition of any one of the claims 14 or 15, wherein the composition is a pharmaceutical composition.

18) The composition of any one of the claims 14 or 15, wherein the composition is a nutraceutical composition.

19) The composition of any one of the claims 14 or 15, wherein the composition is for dilution in the culture water.

20) The composition of any one of the claims 14 or 15, wherein the composition is non-living. 2I)A composition comprising the polyamine compound of any one of the claims 1 to 13 for use in a treatment to increase the survivability of metamorphosing juvenile animal, comprising: an amount of a polyamine compound of the groups consisting of putrescine, spermine, spermidine, cholesteryl spermine, spermidine trihydrochloride, spermidine phosphate hexahydrate, spermidine phosphate hexahydrate, 1,4-butanediamine N-(3- aminopropyl)-monohydxochloride or derivatives thereof or combinations thereof that is effective to activate the cellular autophagic pathway.

22) The composition of claim 21, wherein the polyamine compound is in a dose range of 10 mM to 1 μM, preferably of 1 mM to 10 μM.

23) The composition of any of the claims 21 or 22, wherein the composition is an oral composition.

24) The composition of any of the claims 21 or 22, wherein the composition is a pharmaceutical composition.

25) The composition of any of the claims 21 or 22, wherein the composition is a nutraceutical composition.

26) The composition of any of the claims 21 or 22, the composition is for dilution in the culture water.

27) The composition of any of the claims 21 or 22, whereby the composition is non living.

28) Use of a polyamine compound of any of claims 1 to 13 to increase the survivability, lifespan or the life expectancy of a poiMlotherm animal or to increase the average lifespan of a population of such poikilotherm animal.

29) Use of a composition of any of claims 14 to 20 for increasing the survivability, lifespan or the life expectancy of a poikilotherm invertebrate animal or to increase the average lifespan of a population of such poikilotherm invertebrate animal.

30) Use of a composition of any of claims 21 to 27 for increasing the survivability, lifespan or the life expectancy of a metamorphosing juvenile inveterbrate animal or to increase the average lifespan of a population of such metamorphosing juvenile inverterbrate animal.