WO2010075303A1 - Facteurs d'épissage avec un domaine de liaison à l'arn de protéine puf et domaine effecteur d'épissage et leurs utilisations - Google Patents

Facteurs d'épissage avec un domaine de liaison à l'arn de protéine puf et domaine effecteur d'épissage et leurs utilisations Download PDF

Info

Publication number
WO2010075303A1
WO2010075303A1 PCT/US2009/069041 US2009069041W WO2010075303A1 WO 2010075303 A1 WO2010075303 A1 WO 2010075303A1 US 2009069041 W US2009069041 W US 2009069041W WO 2010075303 A1 WO2010075303 A1 WO 2010075303A1
Authority
WO
WIPO (PCT)
Prior art keywords
puf
rna
seq
domain
rna processing
Prior art date
Application number
PCT/US2009/069041
Other languages
English (en)
Inventor
Zefeng Wang
Traci Hall
Yang Wang
Original Assignee
The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
The University Of North Carolina At Chapel Hill
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The United States Of America, As Represented By The Secretary, Department Of Health And Human Services, The University Of North Carolina At Chapel Hill filed Critical The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Publication of WO2010075303A1 publication Critical patent/WO2010075303A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/85—Fusion polypeptide containing an RNA binding domain
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/10—Screening for compounds of potential therapeutic value involving cells

Definitions

  • splicing As a key regulatory step in gene expression, alternative splicing is common in humans with most genes producing multiple splicing isoforms with distinct and sometimes opposing functions. Generally, the splicing process is regulated by a combination of exonic or intronic m-elements that recruit protein trans-factois (i.e., splicing factors) to either promote or inhibit the use of nearby splice sites. Some splicing factors have modular organization, with separate sequence-specific RNA binding modules and splicing effector domains.
  • An embodiment of the invention provides a fusion protein selected from the group consisting of a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NOS: 8-16.
  • the invention provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of SEQ ID NO: 8 or 12.
  • the invention also provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NOS: 9-11 or 13-16.
  • the invention further provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NO: 8-1 1.
  • the invention also provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NO: 12-16.
  • the invention also provides related nucleic acids, recombinant expression vectors, host cells, and populations of cells. Further provided by the invention are antibodies, or antigen binding portions thereof, and pharmaceutical compositions relating to the fusion proteins of the invention.
  • the invention also provides methods of treating or preventing diseases associated with RNA processing comprising administering to a host in need thereof an effective amount of the fusion proteins, the nucleic acids, the recombinant expression vectors, the host cells, the population of cells, the antibodies, and/or the antigen binding portions thereof of the invention.
  • Another embodiment of the invention provides use of an effective amount of a fusion protein of the invention, and/or a nucleic acid, recombinant expression vector, host cell, population of cells, and/or antibody, or antigen binding portions thereof, relating to a fusion protein of the invention, in the manufacture of a medicament for treating or preventing a disease associated with RNA processing.
  • the invention also provides methods of detecting in a host a disease associated with RNA processing comprising obtaining a first sample and a second sample each comprising one or more cells from the host; detecting the RNA processing of the first sample; contacting the second sample with the fusion proteins, the nucleic acids, the recombinant expression vectors, the host cells, the population of cells, the antibodies, and/or antigen binding portions thereof of the invention; detecting the RNA processing of the second sample; and comparing the RNA processing of the first and second samples.
  • the invention also provides a method of detecting the RNA processing capability of a test molecule comprising attaching the test molecule to a PUF domain of any of SEQ ID NOS: 1-7, contacting the attached test molecule with a RNA molecule that is recognized by the PUF domain, and detecting the RNA processing of the RNA molecule, wherein the RNA processing of the RNA molecule detects the RNA processing capability of the test molecule.
  • Figure 1 is a schematic diagram of the interaction of the human Pumiliol PUF domain with RNA, Each "R” oval represents one PUF motif, and each "N” circle represents one RNA base.
  • Figure 2 is a representative electrophoretic mobility shift assay (EMSA) of a mutated PUF domain (PUF 531 ) with Bcl-x RNA.
  • ESA electrophoretic mobility shift assay
  • Figure 3 is a diagram showing a detail of a region of amino acids used in the construction of the chimeras of Example 2.
  • Figure 4 is a chart showing diagrams of the chimeras of Example 2 and the associated ⁇ -galactosidase activity of the chimeras in three yeast hybrid assays. The numbered boxes represent individual PUF motifs of the chimeras.
  • Figure 5 is a schematic diagram showing the modular domain organization of engineered splicing factors (ESFs) described, e.g., in Example 3.
  • ESFs engineered splicing factors
  • Figure 6 is a schematic diagram showing inhibition of exon inclusion by GIy-PUF type ESFs in exon-skipping reporters containing an 8-nt cognate sequence in the cassette exon.
  • Figure 7 is a bar graph showing the fold change of cassette exon inclusion of target RNAs Nanos Response Element (NRE), A6G, and GU/UG in the presence of GIy- PUF wl , GIy-PUF 3"2 , and GIy-PUF 6 ⁇ 7"2 ESFs relative to the reporters alone (i.e., in the absence of ESFs).
  • NRE Nanos Response Element
  • A6G GU/UG
  • Figure 8 is a graph showing the correlation of ESF activities with the binding affinity of their PUF domains to target sequences.
  • the fold changes of the ESFs i.e., ESF activities
  • Figure 9 is a schematic diagram showing the promotion of exon inclusion by RS- PUF type ESFs with the exon-skipping reporters containing an 8-nt cognate sequence in the cassette exon.
  • Figure 10 is a bar graph showing the fold change of cassette exon inclusion of target RNAs NRE, A6G, and GU/UG in the presence of RS-PUF wt , RS-PUF 3'2 , and RS- pyp ⁇ - 2/7 - 2 £gp s re i a t lve to the reporters alone (i.e., in the absence of ESFs). The means of replicated experiments are plotted with error bars indicating the data ranges.
  • Figure 11 is a schematic diagram showing the regulation of alternative 5' splice sites (ss) by RS-PUF type ESFs.
  • Figure 12 is a bar graph showing the percentage of product with 5' ss (upper band) to total product of target RNAs NRE, A6G, and GU/UG in the presence of RS-PUF ⁇ , RS-PUF 3"2 , and RS-PUF 6"2/7"2 ESFs relative to the reporters alone (i.e., in the absence of ESFs).
  • the means of replicated experiments are plotted with error bars indicating the range of replicated experiments.
  • Figure 13 is a schematic diagram showing the regulation of alternative 3' ss usage by RS-PUF type ESFs.
  • Figure 14 is a bar graph showing fold change of product with 3' ss of target RNAs NRE 5 A6G, and GU/UG in the presence of RS-PUF ⁇ , RS-PUF 3'2 , and RS-PUF 6"2 ' 7'2 ESFs relative to the reporters alone (i.e., in the absence of ESFs).
  • the means of replicated experiments are plotted with error bars indicating the data ranges.
  • Figure 15 is a schematic diagram showing the alternative splicing of Bcl-x pre- mRNA by GIy-PUF 53 '.
  • Figure 16 is a bar graph showing the percentage of cells undergoing apoptosis (i.e. with fragmented nuclear DNA) in the presence of GIy-PUF 531 and Gly-PUF wt (control ESF).
  • Figure 17 is a bar graph showing the modulation of alternative splicing of Bcl-x in four cancer cell types transfected with GIy-PUF 531 or GIy-PUF" 1 (control ESF). Bcl-x splicing products were detected with RT-PCR.
  • Figure 18 A is a bar graph showing the effect of ESFs on cisplatin (5 ⁇ M) sensitivity of different cancer cell lines.
  • the asterisks indicate samples with significant difference (P ⁇ 0.05, judged by paired T-test) of cell viabilities between the GIy-PUF 531 and GIy-PUF ⁇ transfected cells.
  • Figure 18B is a bar graph showing the effect of ESFs on paclitaxel (10 nM) sensitivity of different cancer cell lines.
  • the asterisks indicate samples with significant difference (PO.05, judged by paired T-test) of cell viabilities between the GIy-PUF 531 and Gly-PUF wt transfected cells.
  • Figure 18C is a bar graph showing the effect of ESFs on TNF- ⁇ (20 ng/ml) sensitivity of different cancer cell lines. The asterisks indicate samples with significant difference (PO.05, judged by paired T-test) of cell viabilities between the GIy-PUF 531 and Gly-PUF wt transfected cells.
  • Figure 18D is a bar graph showing the effect of ESFs on TRAIL (100 ng/ml) sensitivity of different cancer cell lines. The asterisks indicate samples with significant difference (PO.05, judged by paired T-test) of cell viabilities between the GIy-PUF 531 and Gly-PUF wt transfected cells.
  • FIG 19 is a schematic diagram showing three different ESFs that can be designed (ESF #1, ESF #2, and ESF #3) to shift VEGF-A splicing towards producing more anti-angiogenic isoforms.
  • Figure 20 is a bar graph showing the percent of the b isoform of the VEGF-A gene generated with ESF #1 of Figure 19, where VEGF-A 165 b is the major isoform measured.
  • Figure 21 is a bar graph showing fold change of cassette exon inclusion for various ESFs relative to the reporter alone (without ESF).
  • One embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1 -7 and an RNA processing domain of any of SEQ ID NOS: 8-16.
  • Another embodiment of the invention provides a fusion protein selected from the group consisting of a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NOS: 8-16.
  • the invention provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of SEQ ID NO: 8 or 12.
  • the invention also provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NOS: 9-11 or 13-16.
  • the invention further provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NO: 8-11.
  • the invention also provides a fusion protein comprising a PUF RNA-binding domain of any of SEQ ID NOS: 1-7 and an RNA processing domain of any of SEQ ID NO: 12- 16.
  • Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 11, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 1 and an RNA processing domain of SEQ ID NO: 1 and
  • Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 11, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 2 and an RNA processing domain of SEQ ID NO: 8 and
  • Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 11 , a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 3 and an RNA processing domain of SEQ ID NO:
  • Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 11, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 4 and an RNA processing domain of SEQ ID NO: 8 and
  • Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 11, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 5 and an RNA processing domain of SEQ ID NO: 5 and
  • Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 11, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 6 and an RNA processing domain of SEQ ID NO: 8 and
  • Another embodiment of the invention provides a fusion protein comprising a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 8, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 9, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 10, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 11, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 12, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 13, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 14, a PUF RNA-binding domain of SEQ ID NO: 7 and an RNA processing domain of SEQ ID NO: 7 and
  • a "fusion protein” is a protein comprising two or more sequences and/or domains from two different polypeptide chains, one or both of which may be naturally occurring.
  • An engineered splicing factor (ESF) is a fusion protein.
  • a "PUF domain” is a protein domain comprising one or more PUF ⁇ - ⁇ - ⁇ motifs, such as those in the Pumiliol protein.
  • An "RNA-binding domain” is a protein sequence that recognizes and/or interacts with RNA. As in the case of the RNA-binding domains of the invention, the recognition of the domain is specific for particular RNA sequences.
  • An "RNA processing domain” is a protein sequence that alters the structure of RNA, e.g., through exon inclusion or removal.
  • RNA structure includes providing for alternative splice variants of mRNA from pre-mRNA.
  • a "marker sequence” is a protein sequence for which the protein may be marked for detection. Non-limiting examples include the FLAG epitope and green fluorescent protein, GFP.
  • PUF proteins named for Drosophila Pumilio and C. elegans fern- 3 binding factor, whose known functions involve mediating mRNA stability and translation, contain a unique RNA-binding domain.
  • the RNA-binding domain of human Pumiliol contains eight PUF motif repeats that recognize eight consecutive RNA bases with each repeat recognizing a single base in anti-parallel orientation, with repeat Rl to R8 recognizing nucleotides N8 to Nl, respectively ( Figure 1).
  • the code to recognize base U is the amino acid sequence "NYxxQ", whereas "(C/S)RxxQ” recognizes A and "SNxxE” recognizes G.
  • These amino acids correspond to positions 12, 13, and 16 in the human Pumiliol PUF motif.
  • the two recognition amino acid side chains at positions 12 and 16 in each PUF ⁇ - ⁇ - ⁇ repeat recognize the Watson-Crick edge of the corresponding base and largely determine the specificity of that repeat. Therefore, altering these amino acids would alter the specificity of the PUF domain.
  • RNA splicing factors have modular organization, with separate sequence- specific RNA binding modules and splicing effector domains.
  • members of the Serine/ Arginine-rich (SR) protein family contain N-terminal RNA recognition motifs (RRMs) that bind to exonic splicing enhancers (ESEs) in pre-mRNAs and C-terminal RS domains that promote exon inclusion.
  • RRMs N-terminal RNA recognition motifs
  • ESEs exonic splicing enhancers
  • ESSs exonic splicing silencers
  • splicing factors can regulate alternative use of splice site (ss) by binding to regulatory sequences between the two alternative sites.
  • ASF/SF2 can recognize ESEs and promote the use of intron proximal sites
  • hnRNP Al can bind to ESSs and shift splicing towards the use of intron distal sites.
  • One application for such factors is to generate ESFs that modulate alternative splicing of endogenous genes, particularly disease associated genes.
  • Bcl-x pre-mRNA produces two splicing isoforms with two alternative 5' ss to encode proteins of opposite functions.
  • the long splicing isoform Bcl-xL is a potent apoptosis inhibitor expressed in long-lived postmitotic cells and is up-regulated in many cancer cells, protecting cells against apoptotic signals.
  • the short isoform Bcl-xS is a pro-apoptotic isoform and expressed at high levels in cells with a high turnover rate (e.g., developing lymphocytes).
  • the ratio of the two Bcl-x splicing isoforms is regulated by multiple c ⁇ -elements that are located in either the core exon region or the exon extension region (i.e., between the two alternative 5' ss).
  • Examples of diseases associated with abnormal RNA processing include diabetes (insulin receptor), psoriasis (fibronectin), polycystic kidney disease (PKD2), and prostate cancer (fibroblast growth factor receptor 2).
  • Other diseases include cystic fibrosis (CFTR), neurofibromatosis type 1 (NFl), muscular dystrophy (dystrophin), and beta-thalassemia (HBB).
  • An example of a disease associated with abnormal RNA exclusion is spinal muscular atrophy, where the pre-mRNA of SMN2 is incorrectly spliced to exclude exon 7.
  • An example of a disease associated with disruption of use of an alternative splice site includes Frasier syndrome, where abnormal use of the 5' splice site for exon 9 alters the ratio of expressed isoforms. Normally, the expression of the isoform with additional amino acids of the exon 9 is greater than the expression of the isoform excluding these amino acids, whereas in the disease there is a shift in the expression ratio to the isoform without the additional amino acids.
  • VEGF-A gene where alternative splicing is indicated in disease
  • VEGFS-A when specifying VEGF in the serum and VEGFP-A when specifying VEGF in plasma
  • the VEGF-A gene contains 8 exons, of which exons 6 and 7 undergo extensive alternative splicing to produce multiple isoforms, named VEGF- A xxx , with xxx denoting the amino acid number of the mature protein.
  • VEGF- A may also be alternatively spliced to VEGF- A xxx b, which uses a distal 3' ss of exon 8, producing six different amino acids at the C-terminal.
  • the b isoforms have anti- angiogenic activity that is opposite to the canonical VEGF-A XXJt isoforms.
  • the basal expression of VEGF-A in most normal human tissues is predominantly the b isoforms, with the only exception of placenta where angiogenesis is known to occur.
  • the VEGF- A xxx isoforms comprise the majority of VEGF-A expression.
  • Embodiments of the present invention may encompass other RNA processing besides RNA alternative splicing (e.g., polyadenylation or RNA degradation) that are regulated through interactions between RNA-binding c/s-factors and other RNA-processing /r ⁇ r ⁇ -factors.
  • RNA alternative splicing e.g., polyadenylation or RNA degradation
  • Appropriate selections of a particular trar ⁇ -factor protein for coupling to a particular cw-factor PUF domain allow for sequence specificity, due to the PUF domain selected, and specific RNA processing, depending upon the selected trar ⁇ -factor.
  • Examples of /ram-factor proteins include, but are not limited to, deadenylases and Argonaute proteins involved in RNA interference.
  • Another embodiment of the invention provides for varying the length of the PUF domain.
  • the length of the recognized RNA will be correspondingly increased or decreased. Since one PUF motif recognizes one RNA base ( Figure 1), decreasing the domain by one motif decreases the length of the RNA recognized by one base; increasing the domain by one motif increases the length of the RNA recognized by one base. Any number of motifs may be present, including 5, 6, 7, 8, 9, 10, 1 1, 12, or longer, so long as the PUF domain binds the RNA. Therefore, the specificity of the ESFs may be altered due to changes in PUF domain length.
  • a PUF domain with PUF motifs of different proteins in the PUF domain.
  • a PUF domain may be constructed with PUF motifs from the Pumiliol protein and one or more other PUF proteins.
  • the one or more other PUF motifs may be from, for example, the PUF domain of PuDp or FBF.
  • RNA binding pockets of PUF domains have natural concave curvatures. Since different PUF proteins may have different curvatures, different PUF motifs in a PUF domain may be used to alter the curvature of the PUF domain. Altering the curvature is another method for altering the specificity of the PUF domain since flatter curvatures allow for the recognition of more RNA bases.
  • Another embodiment of the invention provides for varying the length of the trans- factor domains. For example, since RS and Gly-rich domains consist of highly repetitive sequences, smaller fragments of such domains may have sufficient activity to regulate splicing, as shown in Example 10 below.
  • Another embodiment of the invention provides use of nucleic acids encoding the ESFs of the invention to generate animal models of splicing disease or animal models to examine the physiological effects of particular alternative splicing choices.
  • Another embodiment of the invention provides ESFs to study the self-regulation of splicing factors that regulate splicing through a feedback loop.
  • the invention also provides related nucleic acids, recombinant expression vectors, host cells, and populations of cells related to the fusion proteins of the invention. Further provided by the invention are antibodies, or antigen binding portions thereof, and pharmaceutical compositions relating to the fusion proteins of the invention. [0056] Another embodiment of the invention provides a method of treating or preventing a disease associated with RNA processing comprising administering to a host in need thereof an effective amount of a fusion protein of the invention.
  • Another embodiment of the invention provides a method of treating or preventing a disease associated with RNA processing comprising administering to a host in need thereof an effective amount of a nucleic acid, recombinant expression vector, host cell, population of cells, and/or antibody, or antigen binding portions thereof, relating to a fusion protein of the invention.
  • Another embodiment of the invention provides use of an effective amount of a fusion protein of the invention, a nucleic acid, recombinant expression vector, host cell, population of cells, and/or antibody, or antigen binding portions thereof, relating to a fusion protein of the invention in the manufacture of a medicament for treating or preventing a disease associated with RNA processing.
  • Another embodiment of the invention provides a method of detecting in a host a disease associated with RNA processing due to inclusion of additional one or more exons comprising: (a) obtaining a first sample and a second sample each comprising one or more cells from the host; (b) detecting the RNA processing of the first sample; (c) contacting the second sample with the fusion proteins, the nucleic acids, the recombinant expression vectors, the host cells, the population of cells, the antibodies, and/or antigen binding portions thereof of the invention; (d) detecting the RNA processing of the second sample; and (e) comparing the RNA processing of the first and second samples; wherein detection of the additional one or more exons in a lower amount in the second sample compared to the first sample is indicative of the presence of a disease associated with RNA processing in the host.
  • Another embodiment of the invention provides a method of detecting in a host a disease associated with RNA processing due to removal of one or more exons comprising: (a) obtaining a first sample and a second sample each comprising one or more cells from the host; (b) detecting the RNA processing of the first sample; (c) contacting the second sample with the fusion proteins, the nucleic acids, the recombinant expression vectors, the host cells, the population of cells, the antibodies, and/or antigen binding portions thereof of the invention; (d) detecting the RNA processing of the second sample; and (e) comparing the RNA processing of the first and second samples; wherein detection of removal of the one or more exons in a higher amount in the first sample compared to the second sample is indicative of the presence of a disease associated with RNA processing in the host.
  • the host referred to herein can be any host.
  • the host may be a mammal.
  • the term "mammal” refers to any mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits.
  • the mammals may be from the order Carnivora, including Felines (cats) and Canines (dogs).
  • the mammals may be from the order Artiodactyla, including Bovines (cows) and S wines (pigs) or of the order Perssodactyla, including Equines (horses).
  • the mammals may be of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes).
  • the mammal may be a human.
  • functional variant refers to an ESF having substantial or significant sequence identity or similarity to a parent ESF, which functional variant retains the biological activity of the ESF of which it is a variant.
  • Functional variants encompass, for example, those variants of the ESFs described herein (the parent ESFs) that retain the ability to recognize target RNA to a similar extent, the same extent, or to a higher extent, as the parent ESFs.
  • the functional variant can, for instance, be at least about 30%, 50%, 75%, 80%, 90%, 98% or more identical in amino acid sequence to the parent ESF.
  • the functional variant can, for example, comprise the amino acid sequence of the parent ESF with at least one conservative amino acid substitution, for example, conservative amino acid substitutions in the scaffold of the PUF domain (i.e., amino acids that do not interact with the RNA).
  • the functional variants can comprise the amino acid sequence of the parent ESF with at least one non-conservative amino acid substitution. In this case, it is preferable for the non-conservative amino acid substitution to not interfere with or inhibit the biological activity or of the functional variant.
  • the non- conservative amino acid substitution may enhance the biological activity of the functional variant, such that the biological activity of the functional variant is increased as compared to the parent ESF, or may alter the stability of the ESF to a desired level (e.g., due to substitution of amino acids in the scaffold).
  • the ESF can consist essentially of the specified amino acid sequence or sequences described herein, such that other components e.g., other amino acids, do not materially change the biological activity of the functional variant.
  • the ESFs of the invention can be of any length, i.e., can comprise any number of amino acids, provided that the ESFs (or functional portions or functional variants thereof) retain their biological activity, e.g., the ability to specifically bind to RNA or treat or prevent disease in a host, etc.
  • the polypeptide can be about 50 to about 5000 amino acids long, such as 50, 70, 75, 100, 125, 150, 175, 200, 300, 400, 500, 60O 5 700, 800, 900, 1000 or more amino acids in length.
  • the ESFs of the invention (including functional portions and functional variants) of the invention can comprise synthetic amino acids in place of one or more naturally- occurring amino acids.
  • Such synthetic amino acids include, for example, aminocyclohexane carboxylic acid, norleucine, ⁇ -amino n-decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4-hydroxyproline, 4- aminophenylalanine, 4 -nitrophenyl alanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, ⁇ -phenylserine ⁇ -hydroxyphenylalanine, phenylglycine, ⁇ -naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2,3,4- tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-
  • the ESFs of the invention can be, for example, glycosylated, amidated, carboxylated, phosphorylated, esterified, N- acylated, cyclized via, e.g., a disulfide bridge, or converted into an acid addition salt and/or optionally dimerized or polymerized, or conjugated.
  • the polypeptides may be in the form of a pharmaceutically acceptable salt.
  • suitable pharmaceutically acceptable acid addition salts include those derived from mineral acids, such as hydrochloric, hydrobromic, phosphoric, metaphosphoric, nitric, and sulphuric acids, and organic acids, such as tartaric, acetic, citric, malic, lactic, fumaric, benzoic, glycolic, gluconic, succinic, and arylsulphonic acids, for example, p- toluenesulphonic acid.
  • the ESFs of the invention can be obtained by methods known in the art. Suitable methods of de novo synthesizing polypeptides and proteins are described in references, such as Chan et al., Fmoc Solid Phase Peptide Synthesis, Oxford University Press, Oxford, United Kingdom, 2005; Peptide and Protein Drug Analysis, ed. Reid, R., Marcel Dekker, Inc., 2000; Epitope Mapping, ed. Westwood et al., Oxford University Press, Oxford, United Kingdom, 2000; and U.S. Patent No. 5,449,752. Also, polypeptides and proteins can be recombinantly produced using the nucleic acids described herein using standard recombinant methods.
  • ESFs of the invention can be isolated and/or purified from a source, such as a plant, a bacterium, an insect, a mammal, e.g., a rat, a human, etc. Methods of isolation and purification are well- known in the art.
  • the ESFs described herein can be commercially synthesized by companies, such as Synpep (Dublin, CA), Peptide Technologies Corp. (Gaithersburg, MD), and Multiple Peptide Systems (San Diego, CA).
  • the inventive ESFs can be synthetic, recombinant, isolated, and/or purified.
  • the invention further provides an antibody, or antigen binding portion thereof, which specifically binds to an epitope of the ESF of the invention.
  • the antibody can be any type of immunoglobulin that is known in the art.
  • the antibody can be of any isotype, e.g., IgA, IgD, IgE, IgG, IgM, etc.
  • the antibody can be monoclonal or polyclonal.
  • the antibody can be a naturally-occurring antibody, e.g., an antibody isolated and/or purified from a mammal, e.g., mouse, rabbit, goat, horse, chicken, hamster, human, etc.
  • the antibody can be a genetically-engineered antibody, e.g., a humanized antibody or a chimeric antibody.
  • the antibody can be in monomelic or polymeric form.
  • the antibody can have any level of affinity or avidity for the functional portion of the inventive ESF.
  • Methods of testing antibodies for the ability to bind to any functional portion of the inventive ESF include any antibody-antigen binding assay, such as, for example, radioimmunoassay (RIA), ELISA, Western blot, immunoprecipitation, and competitive inhibition assays (see, e.g., Janeway et al., infra, and U.S. Patent Application Publication No. 2002/0197266 Al).
  • RIA radioimmunoassay
  • ELISA ELISA
  • Western blot Western blot
  • immunoprecipitation immunoprecipitation
  • competitive inhibition assays see, e.g., Janeway et al., infra, and U.S. Patent Application Publication No. 2002/0197266 Al.
  • Suitable methods of making antibodies are known in the art. For instance, standard hybridoma methods are described in, e.g., K ⁇ hler and Milstein, Eur. J. Immunol., 5, 511-519 (1976), Harlow and Lane (eds.), Antibodies: A Laboratory Manual, CSH Press (1988), and CA. Janeway et al. (eds.), Immunobiology, 5th Ed., Garland Publishing, New York, NY (2001)). Alternatively, other methods, such as EBV-hybridoma methods (Haskard and Archer, J. Immunol.
  • Phage display furthermore can be used to generate the antibody of the invention.
  • phage libraries encoding antigen-binding variable (V) domains of antibodies can be generated using standard molecular biology and recombinant DNA techniques (see, e.g., Sambrook et al. (eds.), Molecular Cloning, A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, New York (2001)). Phage encoding a variable region with the desired specificity are selected for specific binding to the desired antigen, and a complete or partial antibody is reconstituted comprising the selected variable domain.
  • Nucleic acid sequences encoding the reconstituted antibody are introduced into a suitable cell line, such as a myeloma cell used for hybridoma production, such that antibodies having the characteristics of monoclonal antibodies are secreted by the cell (see, e.g., Janeway et al., supra, Huse et al., supra, and U.S. Patent 6,265,150).
  • a suitable cell line such as a myeloma cell used for hybridoma production, such that antibodies having the characteristics of monoclonal antibodies are secreted by the cell (see, e.g., Janeway et al., supra, Huse et al., supra, and U.S. Patent 6,265,150).
  • Antibodies can be produced by transgenic mice that are transgenic for specific heavy and light chain immunoglobulin genes. Such methods are known in the art and described in, for example U.S. Patents 5,545,806 and 5,569,825, and Janeway et al., supra. [0074] Methods for generating humanized antibodies are well known in the art and are described in detail in, for example, Janeway et al., supra, U.S. Patents 5,225,539, 5,585,089 and 5,693,761, European Patent No. 0239400 Bl, and United Kingdom Patent No. 2188638. Humanized antibodies can also be generated using the antibody resurfacing technology described in U.S.
  • the invention also provides antigen binding portions of any of the antibodies described herein.
  • the antigen binding portion can be any portion that has at least one antigen binding site, such as Fab, F(ab')2, dsFv, sFv, diabodies, and triabodies.
  • a single-chain variable region fragment (sFv) antibody fragment which consists of a truncated Fab fragment comprising the variable (V) domain of an antibody heavy chain linked to a V domain of a light antibody chain via a synthetic peptide, can be generated using routine recombinant DNA technology techniques (see, e.g., Janeway et al., supra).
  • disulfide-stabilized variable region fragments (dsFv) can be prepared by recombinant DNA technology (see, e.g., Reiter et al., Protein Engineering, 7, 697-704 (1994)).
  • Antibody fragments of the invention are not limited to these exemplary types of antibody fragments.
  • the antibody, or antigen binding portion thereof can be modified to comprise a detectable label, such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles).
  • a detectable label such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles).
  • a detectable label such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC
  • nucleic acid includes “polynucleotide,” “oligonucleotide,” and “nucleic acid molecule,” and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide.
  • nucleic acid does not comprise any insertions, deletions, inversions, and/or substitutions. However, it may be suitable in some instances, as discussed herein, for the nucleic acid to comprise one or more insertions, deletions, inversions, and/or substitutions.
  • the nucleic acids of the invention may be recombinant.
  • the term "recombinant" refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above.
  • the replication can be in vitro replication or in vivo replication.
  • a recombinant nucleic acid may be one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques, such as those described in Sambrook et al., supra.
  • the nucleic acids can be constructed based on chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. See, for example, Sambrook et al., supra, and Ausubel et al., supra.
  • a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g., phosphorothioate derivatives and acridine substituted nucleotides).
  • modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil. 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3 -methyl cytosine, 5-methylcytosine, N ⁇ -substituted adenine, 7-methylguanine, 5 -methyl aminomethyluracil, 5- methoxyaminornethyl-2-thiouracil, beta-
  • the nucleic acid can comprise any isolated or purified nucleotide sequence which encodes any of the ESFs, or functional portions or functional variants thereof.
  • the nucleotide sequence can comprise a nucleotide sequence which is degenerate to any of the sequences or a combination of degenerate sequences.
  • the invention also provides an isolated or purified nucleic acid comprising a nucleotide sequence which is complementary to the nucleotide sequence of any of the nucleic acids described herein or a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of any of the nucleic acids described herein.
  • the nucleotide sequence which hybridizes under stringent conditions may hybridize under high stringency conditions.
  • high stringency conditions is meant that the nucleotide sequence specifically hybridizes to a target sequence (the nucleotide sequence of any of the nucleic acids described herein) in an amount that is detectably stronger than non-specific hybridization.
  • High stringency conditions include conditions which would distinguish a polynucleotide with an exact complementary sequence, or one containing only a few scattered mismatches from a random sequence that happened to have a few small regions (e.g., 3-10 bases) that matched the nucleotide sequence. Such small regions of complementarity are more easily melted than a full-length complement of 14-17 or more bases, and high stringency hybridization makes them easily distinguishable.
  • Relatively high stringency conditions would include, for example, low salt and/or high temperature conditions, such as provided by about 0.02-0.1 M NaCl or the equivalent, at temperatures of about 50-70 0 C.
  • nucleic acids of the invention can be incorporated into a recombinant expression vector.
  • the invention provides recombinant expression vectors comprising any of the nucleic acids of the invention.
  • the term "recombinant expression vector” means a genetically-modified oligonucleotide or polynucleotide construct that permits the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the vector is contacted with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell.
  • the vectors of the invention are not naturally-occurring as a whole. However, parts of the vectors can be naturally-occurring.
  • the inventive recombinant expression vectors can comprise any type of nucleotides, including, but not limited to DNA and RNA, which can be single- stranded or double-stranded, synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides.
  • the recombinant expression vectors can comprise naturally-occurring, non-naturally-occurring internucleotide linkages, or both types of linkages.
  • the non-naturally occurring or altered nucleotides or internucleotide linkages does not hinder the transcription or replication of the vector.
  • the recombinant expression vector of the invention can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host.
  • Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses.
  • the vector can be selected from the group consisting of the pUC series (Fermentas Life Sciences, Glen Burnie, MD), the pBluescript series (Stratagene, LaJolla, CA), the pET series (Novagen, Madison, WI), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, CA).
  • Bacteriophage vectors such as ⁇ GTIO, ⁇ GTl 1, ⁇ ZapII (Stratagene), ⁇ EMBL4, and ⁇ NMl 149, also can be used.
  • plant expression vectors include pBIOl, pBI101.2, pBI101.3, pBI121 and pBIN19 (Clontech).
  • animal expression vectors include pEUK-Cl, pMAM and pMAMneo (Clontech).
  • the recombinant expression vector may be a viral vector, e.g., a retroviral vector.
  • the recombinant expression vectors of the invention can be prepared using standard recombinant DNA techniques described in, for example, Sambrook et al., supra, and Ausubel et al., supra.
  • Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell.
  • Replication systems can be derived, e.g., from CoIEl, 2 ⁇ plasmid, ⁇ , SV40, bovine papilloma virus, and the like.
  • the recombinant expression vector may comprise regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate, and taking into consideration whether the vector is DNA- or RNA-based, [0090]
  • the recombinant expression vector can include one or more marker genes, which allow for selection of transformed or transfected hosts. Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host to provide prototrophy, and the like. Suitable marker genes for the inventive expression vectors include, for instance, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes.
  • the recombinant expression vector can comprise a native or nonnative promoter operably linked to the nucleotide sequence encoding the ESF (including functional portions and functional variants thereof), or to the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the ESF.
  • the selection of promoters e.g., strong, weak, inducible, tissue-specific and developmental-specific, is within the ordinary skill of the artisan.
  • the combining of a nucleotide sequence with a promoter is also within the skill of the artisan.
  • the promoter can be a non- viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, and a promoter found in the long-terminal repeat of the murine stem cell virus.
  • CMV cytomegalovirus
  • the inventive recombinant expression vectors can be designed for either transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression.
  • the recombinant expression vectors can be made to include a suicide gene.
  • suicide gene refers to a gene that causes the cell expressing the suicide gene to die.
  • the suicide gene can be a gene that confers sensitivity to an agent, e.g., a drug, upon the cell in which the gene is expressed, and causes the cell to die when the cell is contacted with or exposed to the agent.
  • agent e.g., a drug
  • HSV Herpes Simplex Virus
  • TK thymidine kinase
  • conjugates e.g., bioconjugates, comprising any of the inventive ESFs (including any of the functional portions or variants thereof), nucleic acids, recombinant expression vectors, host cells, populations of host cells, or antibodies, or antigen binding portions thereof.
  • Conjugates, as well as methods of synthesizing conjugates in general, are known in the art (See, for instance, Hudecz, F., Methods MoI. Biol. 298: 209-223 (2005) and Kirin et al., Inorg Chem. 44(15): 5405-5415 (2005)).
  • the invention further provides a host cell comprising any of the recombinant expression vectors described herein.
  • the term "host cell” refers to any type of cell that can contain the inventive recombinant expression vector.
  • the host cell can be a eukaryotic cell, e.g., plant, animal, fungi, or algae, or can be a prokaryotic cell, e.g., bacteria or protozoa.
  • the host cell can be a cultured cell or a primary cell, i.e., isolated directly from an organism, e.g., a human.
  • the host cell can be an adherent cell or a suspended cell, i.e., a cell that grows in suspension.
  • Suitable host cells include, for instance, DH5 ⁇ E, coli cells, Chinese hamster ovarian (CHO) cells, monkey VERO cells, COS cells, HEK293 cells, and the like.
  • the host cell may be a prokaryotic cell, e.g., a DH5 ⁇ cell.
  • the host cell may be a mammalian cell.
  • the host cell may be a human cell.
  • the population of cells can be a heterogeneous population comprising the host cell comprising any of the recombinant expression vectors described, in addition to at least one other cell, e.g., a host cell which does not comprise any of the recombinant expression vectors, or another cell, e.g., a B cell, a macrophage, a neutrophil, an erythrocyte, a hepatocyte, an endothelial cell, an epithelial cells, a muscle cell, a brain cell, etc.
  • a B cell e.g., a macrophage, a neutrophil, an erythrocyte, a hepatocyte, an endothelial cell, an epithelial cells, a muscle cell, a brain cell, etc.
  • the population of cells can be a substantially homogeneous population, in which the population comprises mainly of host cells (e.g., consisting essentially of) comprising the recombinant expression vector.
  • the population also can be a clonal population of cells, in which all cells of the population are clones of a single host cell comprising a recombinant expression vector, such that all cells of the population comprise the recombinant expression vector.
  • the population of cells is a clonal population comprising host cells comprising a recombinant expression vector as described herein.
  • inventive ESFs including functional portions and variants thereof, nucleic acids, recombinant expression vectors, and host cells (including populations thereof), all of which are collectively referred to as "inventive ESF materials" hereinafter, can be isolated and/or purified.
  • isolated means having been removed from its natural environment.
  • a purified (or isolated) protein preparation is one in which the protein is more pure than the protein in its natural environment within a cell.
  • Such proteins may be produced, for example, by standard purification techniques, or by recombinant expression.
  • a preparation of a protein is purified such that the protein represents at least 50%, for example at least 70%, of the total protein content of the preparation.
  • the purity can be at least about 50%, can be greater than about 60%, about 70% or about 80%, or can be about 100%.
  • the inventive ESF materials can be formulated into a composition, such as a pharmaceutical composition.
  • the invention provides a pharmaceutical composition comprising any of the ESFs, polypeptides, proteins, functional portions, functional variants, nucleic acids, expression vectors, and host cells (including populations thereof) and a pharmaceutically acceptable carrier.
  • the inventive pharmaceutical compositions may contain stabilizing agents.
  • the ESFs of the invention may be stabilized by, for example, reducing agents (DTT, beta-mercaptoethanol, TCEP), glycerol, or higher NaCl.
  • inventive pharmaceutical compositions containing any of the inventive ESF materials can comprise more than one inventive ESF material, e.g., a polypeptide and a nucleic acid, or two or more different ESFs.
  • the pharmaceutical composition can comprise an inventive ESF material in combination with another pharmaceutically active agents or drugs, such as a chemotherapeutic agents, e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, vincristine, etc.
  • chemotherapeutic agents e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, vincristine, etc.
  • the pharamaceutically acceptable carrier can be any of those conventionally used and is limited only by chemico-physical considerations, such as solubility and lack of reactivity with the active(s), and by the route of administration.
  • the pharmaceutically acceptable carriers described herein, for example, vehicles, adjuvants, excipients, and diluents, are well-known to those skilled in the art and are readily available to the public. It is preferred that the pharmaceutically acceptable carrier be one which is chemically inert to the active agent(s) and one which has no detrimental side effects or toxicity under the conditions of use.
  • Preservatives may be used. Suitable preservatives may include, for example, methylparaben, propylparaben, sodium benzoate, and benzalkonium chloride. A mixture of two or more preservatives optionally may be used. The preservative or mixtures thereof are typically present in an amount of about 0.0001% to about 2% by weight of the total composition.
  • Suitable buffering agents may include, for example, citric acid, sodium citrate, phosphoric acid, potassium phosphate, and various other acids and salts. A mixture of two or more buffering agents optionally may be used. The buffering agent or mixtures thereof are typically present in an amount of about 0.001% to about 4% by weight of the total composition.
  • inventive ESFs in the pharmaceutical formulations can vary, e.g., from less than about 1%, usually at or at least about 10%, to as much as 20% to 50% or more by weight, and can be selected primarily by fluid volumes, and viscosities, in accordance with the particular mode of administration selected.
  • Methods for preparing administrable (e.g., parenterally administrable) compositions are known or apparent to those skilled in the art and are described in more detail in, for example, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins; 21st ed. (May 1, 2005).
  • an "effective amount” refers to a dose that is adequate to prevent or treat a disease or disorder in an individual. Amounts effective for a therapeutic or prophylactic use will depend on, for example, the stage and severity of the disease or disorder being treated, the age, weight, and general state of health of the patient, and the judgment of the prescribing physician. The size of the dose will also be determined by the active selected, method of administration, timing and frequency of administration as well as the existence, nature, and extent of any adverse side-effects that might accompany the administration of a particular active and the desired physiological effect. It will be appreciated by one of skill in the art that various diseases or disorders could require prolonged treatment involving multiple administrations, perhaps using the inventive ESF materials in each or various rounds of administration.
  • compositions for oral, aerosol, parenteral (e.g., subcutaneous, intravenous, intraarterial, intramuscular, intradermal, interperitoneal, and intrathecal), and rectal administration are merely exemplary and are in no way limiting. More than one route can be used to administer the inventive ESF materials, and in certain instances, a particular route can provide a more immediate and more effective response than another route.
  • Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the inventive ESF material dissolved in diluents, such as water, saline, or orange juice; (b) capsules, sachets, tablets, lozenges, and troches, each containing a predetermined amount of the active ingredient, as solids or granules; (c) powders; (d) suspensions in an appropriate liquid; and (e) suitable emulsions.
  • Liquid formulations may include diluents, such as water and alcohols, for example, ethanol, benzyl alcohol, and the polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant.
  • Capsule forms can be of the ordinary hard or soft shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers, such as lactose, sucrose, calcium phosphate, and corn starch.
  • Tablet forms can include one or more of lactose, sucrose, mannitoi, corn starch, potato starch, alginic acid, microcrystalline cellulose, acacia, gelatin, guar gum, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, calcium stearate, zinc stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, disintegrating agents, moistening agents, preservatives, flavoring agents, and other pharmacologically compatible excipients.
  • Lozenge forms can comprise the inventive ESF material in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the inventive ESF material in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to, such excipients as are known in the art.
  • an inert base such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to, such excipients as are known in the art.
  • Formulations suitable for parenteral administration include aqueous and non-aqueous isotonic sterile injection solutions, which can contain anti oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • the inventive ESF material can be administered in a physiologically acceptable diluent in a pharmaceutical carrier, such as a sterile liquid or mixture of liquids, including water, saline, aqueous dextrose and related sugar solutions, an alcohol, such as ethanol or hexadecyl alcohol, a glycol, such as propylene glycol or polyethylene glycol, dimethylsulfoxide, glycerol, ketals such as 2,2- dimethyl-l,3-dioxolane-4-methanol, ethers, poly(ethyleneglycol) 400, oils, fatty acids, fatty acid esters or glycerides, or acetylated fatty acid glycerides with or without the addition of a pharmaceutically acceptable surfactant, such as a soap or a detergent, suspending agent, such as pectin, carbomers, methylcellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose, or emulsifying agents and other pharmaceutical adjuvants.
  • Oils which can be used in parenteral formulations include petroleum, animal, vegetable, or synthetic oils. Specific examples of oils include peanut, soybean, sesame, cottonseed, corn, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.
  • Suitable soaps for use in parenteral formulations include, for example, fatty alkali metal, ammonium, and triethanolamine salts
  • suitable detergents include (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl- ⁇ -aminopropionates, and 2-alkyl-imidazoline quaternary ammonium salts, and (e) mixtures thereof.
  • the parenteral formulations will typically contain from about 0.5% to about 25% by weight of the inventive ESF material in solution. Preservatives and buffers may be used. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants, for example, having a hydrophile-lipophile balance (HLB) of from about 12 to about 17.
  • HLB hydrophile-lipophile balance
  • the quantity of surfactant in such formulations will typically range from about 5% to about 15% by weight.
  • Suitable surfactants include polyethylene glycol sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.
  • parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use.
  • sterile liquid excipient for example, water
  • Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
  • Injectable formulations are in accordance with the invention.
  • the requirements for effective pharmaceutical carriers for injectable compositions are well-known to those of ordinary skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, J.B. Lippincott Company, Philadelphia, PA, Banker and Chalmers, eds., pages 238-250 (1982), and ASHP Handbook on Injectable Drugs, Toissel, 4th ed., pages 622-630 (1986)),
  • the inventive ESFs materials can be formulated as, for example, inclusion complexes, such as cyclodextrin inclusion complexes, or liposomes.
  • Liposomes can serve to target the inventive ESF materials to a particular tissue. Liposomes also can be used to increase the half-life of the inventive ESF materials. Many methods are available for preparing liposomes, as described in, for example, Szoka et al., Ann. Rev. Biophys. Bioeng., 9, 467 (1980) and U.S. Patents 4,235,871, 4,501,728, 4,837,028, and 5,019,369.
  • the delivery systems useful in the context of embodiments of the invention may include time-released, delayed release, and sustained release delivery systems such that the delivery of the inventive composition occurs prior to, and with sufficient time to cause, sensitization of the site to be treated.
  • the inventive composition can be used in conjunction with other therapeutic agents or therapies. Such systems can avoid repeated administrations of the inventive composition, thereby increasing convenience to the subject and the physician, and may be particularly suitable for certain composition embodiments of the invention.
  • release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Patent 5,075,109.
  • Delivery systems also include non-polymer systems that are lipids including sterols such as cholesterol, cholesterol esters, and fatty acids or neutral fats such as mono-di-and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like.
  • lipids including sterols such as cholesterol, cholesterol esters, and fatty acids or neutral fats such as mono-di-and tri-glycerides
  • hydrogel release systems such as sterols such as cholesterol, cholesterol esters, and fatty acids or neutral fats such as mono-di-and tri-glycerides
  • sylastic systems such as cholesterol, cholesterol esters, and fatty acids or neutral fats such as mono-di-and tri-glycerides
  • peptide based systems such as fatty acids or neutral fats such as mono-di-and tri-glycerides
  • hydrogel release systems such
  • pump-based hardware delivery systems can be used, some of which are adapted for implantation.
  • Transfection methods include calcium phosphate co precipitation (see, e.g., Graham et al., supra), direct micro injection into cultured cells (see, e.g., Capecchi, Cell, 22: 479-488 (1980)), electroporation (see, e.g., Shigekawa et al., BioTechniques, 6: 742-751 (1988)), liposome mediated gene transfer (see, e.g., Mannino et al., BioTechniques, 6: 682-690 (1988)), lipid mediated transduction (see, e.g., Feigner et al., Proc. Natl. Acad. Sci. USA, 84: 7413-7417 (1987)), and nucleic acid delivery using high velocity microprojectiles (see, e.g., Klein et al. Nature, 327: 70-73 (1987)).
  • inventive ESF materials of the invention can be modified in any number of ways, such that the therapeutic or prophylactic efficacy of the inventive ESF materials is increased through the modification.
  • inventive ESF materials can be conjugated either directly or indirectly through a linker to a targeting moiety.
  • the practice of conjugating compounds, e.g., inventive ESF materials, to targeting moieties is known in the art. See, for instance, Wadwa et al., J. Drug Targeting 3: 1 11 (1995) and U.S. Patent No. 5,087,616.
  • targeting moiety refers to any molecule or agent that specifically directs the ESF to a particular location.
  • Targeting moieties include, but are not limited to, antibodies, or fragments thereof, peptides (such as a nuclear localization sequence, NLS, which may be, e.g., incorporated in to the sequence of a fusion protein), hormones, growth factors, and cytokines.
  • peptides such as a nuclear localization sequence, NLS, which may be, e.g., incorporated in to the sequence of a fusion protein
  • hormones such as a nuclear localization sequence, NLS, which may be, e.g., incorporated in to the sequence of a fusion protein
  • growth factors include, but are not limited to, antibodies, or fragments thereof, peptides (such as a nuclear localization sequence, NLS, which may be, e.g., incorporated in to the sequence of a fusion protein), hormones, growth factors, and cytokines.
  • linker refers to any agent or molecule that bridges the inventive ESF materials to the targeting moiety.
  • sites on the inventive ESF materials which are not necessary for the function of the inventive ESF materials, are ideal sites for attaching a linker and/or a targeting moiety, provided that the linker and/or targeting moiety, once attached to the inventive ESF materials, do(es) not interfere with the function of the inventive ESF materials, i.e., the ability to bind to RNA.
  • inventive ESF materials can be modified into a depot form, such that the manner in which the inventive ESF materials is released into the body to which it is administered is controlled with respect to time and location within the body (see, for example, U.S. Patent No. 4,450,150).
  • Depot forms of inventive ESF materials can be, for example, an implantable composition comprising the inventive ESF materials and a porous or non-porous material, such as a polymer, wherein the inventive ESF materials is encapsulated by or diffused throughout the material and/or degradation of the non-porous material.
  • the depot is then implanted into the desired location within the body and the inventive ESF materials are released from the implant at a predetermined rate.
  • the amount or dose of the inventive ESF material administered should be sufficient to effect, e.g., a therapeutic or prophylactic response, in the subject or animal over a reasonable time frame.
  • the dose of the inventive ESF material should be sufficient to bind to antigen, or detect, treat or prevent disease in a period of from about 2 hours or longer, e.g., 12 to 24 or more hours, from the time of administration. In certain embodiments, the time period could be even longer.
  • the dose will be determined by the efficacy of the particular inventive ESF material and the condition of the animal (e.g., human), as well as the body weight of the animal (e.g., human) to be treated.
  • the dose of the inventive ESF material also will be determined by the existence, nature and extent of any adverse side effects that might accompany the administration of a particular inventive ESF material. Typically, the attending physician will decide the dosage of the inventive ESF material with which to treat each individual patient, taking into consideration a variety of factors, such as age, body weight, general health, diet, sex, inventive ESF material to be administered, route of administration, and the severity of the condition being treated.
  • the dose of the inventive ESF material can be about 0.001 to about 1000 mg/kg body weight of the subject being treated/day, from about 0.01 to about 10 mg/kg body weight/day, about 0,01 mg to about 1 mg/kg body weight/day.
  • inventive ESF materials are administered with one or more additional therapeutic agents
  • one or more additional therapeutic agents can be coadministered to the mammal.
  • coadministering is meant administering one or more additional therapeutic agents and the inventive ESF materials sufficiently close in time such that the inventive ESF materials can enhance the effect of one or more additional therapeutic agents.
  • the inventive ESF materials can be administered first and the one or more additional therapeutic agents can be administered second, or vice versa.
  • the inventive ESF materials and the one or more additional therapeutic agents can be administered simultaneously.
  • the inventive methods wherein host cells or populations of cells are administered to the host, the cells can be cells that are allogeneic or autologous to the host. The cells may be autologous to the host.
  • inventive pharmaceutical compositions ESFs, polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, or populations of cells can be used in methods of treating or preventing a disease in a host.
  • inventive ESFs have biological activity, e.g., ability to recognize RNA and inhibit or promote RNA processing.
  • the invention provides a method of treating or preventing a disease in a host, comprising administering to the host any of the pharmaceutical compositions in an amount effective to treat or prevent the disease in the host.
  • the disease may be any disease due to aberrant splicing of RNA, such as cancer.
  • inventive methods can provide any amount of any level of treatment or prevention of cancer in a mammal.
  • the treatment or prevention provided by the inventive method can include treatment or prevention of one or more conditions or symptoms of the disease, e.g., cancer, being treated or prevented.
  • prevention can encompass delaying the onset of the disease, or a symptom or condition thereof.
  • RNA processing includes those where improper RNA splicing occurs, for example where exons are improperly included or removed.
  • diseases include cervical cancer, lung cancer, and breast cancer.
  • the ESFs of the present invention alter the splicing of cells associated with these diseases and generate apoptotic signals.
  • a biopsy is the removal of tissue and/or cells from an individual. Such removal may be to collect tissue and/or cells from the individual in order to perform experimentation on the removed tissue and/or cells. This experimentation may include experiments to determine if the individual has and/or is suffering from a certain condition or disease-state.
  • the condition or disease may be, e.g., cancer.
  • the sample comprising cells of the host can be a sample comprising whole cells, lysates thereof, or a fraction of the whole cell lysates, e.g., a nuclear or cytoplasmic fraction, a whole protein fraction, or a nucleic acid fraction.
  • the cells can be any cells of the host, e.g., the cells of any organ or tissue, including blood cells.
  • the contacting step can take place in vitro or in vivo with respect to the host. The contacting may be in vitro.
  • the invention also provides a method of detecting the RNA processing capability of a test molecule comprising attaching the test molecule to a PUF domain of any of SEQ ID NOS: 1-7, contacting the attached test molecule with a RNA molecule that is recognized by the PUF domain, and detecting the RNA processing of the RNA molecule, wherein the RNA processing of the RNA molecule detects the RNA processing capability of the test molecule.
  • a test molecule can be any molecule suspected of interacting with RNA, for example, a protein domain of a protein. The interaction can involve alternative splicing of the RNA or any other RNA processing, including polyadenylation or RNA degradation.
  • the inventive ESFs provide a new approach to study the activities of natural splicing factors by, for example, specifically recruiting different protein domains to certain regions of pre- mRNAs. Compared to conventional tethering experiments using the MS2 coat protein or lambda N-B box systems, the inventive ESFs can recognize the pre-mRNA in a natural context without introducing foreign RNA and are thus more advantageous for in vivo applications.
  • RNA processing can occur through any number of ways known in the art. Detection may occur through the RNA methods described in the Examples below.
  • Electrophoretic mobility shift assays The generated recombinant proteins were expressed and purified as described previously (Cheong and Hall, Proc. Natl. Acad. Sci. USA, 2006, 103: 13635-13639).
  • RNA oligonucleotides were obtained from Dharmacon, Inc. (Lafayette, CO) and radiolabeled at the 5' end by using [ ⁇ - 32 P]-ATP (PerkinElmer Life Sciences, Waltham, MA) and T4 polynucleotide kinase (New England BioLabs, Ipswich, MA) following manufacturer directions.
  • RNAs were purified on 20% polyacrylamide gels (Invitrogen, Carlsbad, CA) run with IX Tris-Borate- EDTA buffer (89 mM Tris, 89 mM boric acid, 2.5 mM EDTA, pH 8.3) at room temperature. Binding reactions included radiolabeled RNA (-15 pM for NRE (5'-
  • binding buffer 10 mM Hepes, pH 7.4, 50 mM KCl, 1 mM EDTA, 0.01% (v/v) Tween-20, 0.1 mg/ml
  • Binding reactions were incubated for 1-2 h at room temperature and immediately analyzed by electrophoresis on 6% nondenaturing polyacrylamide gels (Invitrogen). Gels were dried and exposed to storage phosphor screens (GE Healthcare, Piscataway, NJ), scanned with a Typhoon 8600 Imager (GE Healthcare), and analyzed with Image Quant 5.2 software (Molecular Dynamics/GE Healthcare), The data were analyzed using Origin 7.5 software (OriginLab, Northampton, MA). All binding assays were performed at least in triplicate. Figure 2 gives a representative binding curve. [0135] Dissociation constants (Kd) are presented in Table 1 (an asterisk indicates cognate pairs).
  • Wild-type PUF specifically binds Nanos Response Element (NRE) RNA, bearing a core 8-nt sequence 5'-UGUACAUA-3' (SEQ ID NO: 21), whereas the mutated PUF (3-2) (SEQ ID NO: 2) with two point mutations (C935S/Q939E) in the PUF repeat 3 recognizes a cognate RNA with a mutation at position 6 of the NRE (A6G; 5'- UGUACGUA-3'; SEQ ID NO: 22), and the mutated PUF (6-2/7-2) (SEQ ID NO: 3) with mutations (N1043S/Q1047E and S1079N/E1083Q) in repeats 6 and 7 recognizes a cognate RNA sequence with two mutations at positions 2 and 3 of the NRE (GU/UG; 5'- UUGACAUA-3'; SEQ ID NO: 23).
  • NRE Nanos Response Element
  • Table 1 Dissociation constants (nM) for wt, 3-2, and 6-2/7-2 PUF domains for NRE, A6G, and GU/UG RNAs. An asterisk indicates cognate pairs.
  • the PUF domain PUF 531 recognizes the sequence UGUGCGUG (SEQ ID NO: 24).
  • PUF 53 i (SEQ ID NO: 4) has mutations (Q867E/Q939E/C935S/Q1011E/C1007S) in wild type PUF repeats 1, 3 and 5.
  • the binding of PUF 531 to its target RNA sequence was too tight to allow an accurate determination of its Kd. Thus, a value of ⁇ 4 pM was reported.
  • This example demonstrates the production of chimeric PUF domain proteins and provides an analysis of their RNA binding.
  • DNA constructs utilized in a yeast three-hybrid system FBF-I (aa 121-614; SEQ ID NO: 25, full nucleotide sequence given in GenBank accession number NM 062815), FBF-2 (aa 121-632; SEQ ID NO: 26, full nucleotide sequence given in GenBank accession number NM_062819) and PUF-8 (aa 143-535; SEQ ID NO: 27, full nucleotide sequence given in GenBank accession number NM_063122) were used both in the three-hybrid analysis and as templates for creating the chimeric proteins.
  • FBF and PUF-8 employed in the chimeric proteins are as follows: Chimera 1 (PUF-8 M143-V320; FBF-I 1326- V399; PUF-8 H380-H535; SEQ ID NO: 28), Chimera 2 (PUF-8 M143-H366; FBF-I L371-V399; PUF-8 H380-H535; SEQ ID NO: 29), Chimera 3 (PUF-8 M143-V320; FBF-I I326-K370; PUF-8 C367-H535; SEQ ID NO: 30), Chimera 4 (PUF-8 M143-I325; FBF-2 A333-F342; PUF-8 I336-H535; SEQ ID NO: 31), and Chimera 5 (PUF-8 M143-T346; FBF-2 L353-G362; PUF-8 C357-H535; SEQ ID NO: 32).
  • Proteins were expressed in yeast using the pACT2 plasmid. For chimeras 1 , 2, and 3, the fragments were blunt-end ligated together. Ligated fragments were selected via PCR and subsequently cloned into the EcoRI and Ncol sites of pACT2. For chimeras 4 and 5, site-directed mutagenesis was utilized to create the chimeric protein. The single residue changes (triangles, Figure 3) were generated in FBF-2 (aa 121-632) via site-directed mutagenesis. DNA oligonucleotides designed to express various RNA sequences were cloned into the Xmal/Smal and Sphl sites of pllla MS2-2.
  • Yeast three-hybrid assays Gal4-activation domain fusion proteins were expressed from either pACT or pACT2 plasmids. RNA-protein interactions were analyzed using the B-glo assay described in Hook, et al. (RNA, 2005, 11, 227-233) with the following modification: Saturated cultures (36-48 hrs growth) were diluted 100 ⁇ L into 4 ml selective media and allowed to grow 2-2.5 hrs to reach an OD 66O of 0.1-0.2. For data analysis, the relative light units (RLUs) were adjusted to an OD 660 of 0.1 and divided by the sample volume to give RLUs/ ⁇ L. The values reported are an average of four separate experiments.
  • RLUs relative light units
  • FBF-2 has distinctive features: an extended 3 rd helix in its repeat 5 ("R5c," Figure 3) and a long extended loop between repeats 4 and 5.
  • a 74-aa fragment of FBF-2 (I328-V401; corresponding to 1326- V399 of FBF-I) grafted into PUF-8 generates a chimeric protein with FBF-2 's RNA recognition specificity ( Figure 4, Chimera 1).
  • a smaller fragment with both the extended helix and loop of FBF-2 does not transfer that specificity, as the chimera still binds the PBE ( Figure 4, Chimera 2).
  • the minimal region of FBF-2 that transferred specificity was a 45-aa fragment (I328-K372; corresponding to I326-K370 in FBF-I) containing portions of PUF repeats 4 and 5 outside the extended helix and loop (Chimera 3, Figure 4). Subsections of this region did not alter specificity, but instead bound the PBE (Chimeras 4 and 5, Figure 4).
  • the packing of ⁇ -helices in the 45-aa region likely yield a flatter curvature; however, swapping single amino acid identities between PUF-8 and FBF-2 did not alter either protein's RNA specificity ( Figure 3, triangles).
  • the minimal segment of FBF-2 (I328-K372) lies directly opposite flipped bases.
  • ESF expression constructs To express ESFs in cultured cells, expression constructs were generated using the pCI-neo vector (Promega, Madison, WI; SEQ ID NO: 35). An expression construct that encodes from N- to C-terminal a FLAG epitope (MDYKDDDDK; SEQ ID NO: 36), Gly-rich domain of hnRNP Al (residues 195-320 of GenBank Ace. No.
  • NP_002127; SEQ ID NO: 8 the MS2 coat protein
  • SEQ ID NO: 37 The fragment encoding the MS2 coat protein fragment was removed using BamHI/Sall digestion and replaced with a fragment encoding an NLS sequence (PPKKKRKV; SEQ ID NO: 38) and the PUF domain of human Pumiliol (SEQ ID NO: 1), which was amplified using primers Pum-Fl and Pum-Rl (Table 2).
  • the resulting construct can express a GIy-PUF type of ESF under the control of a CMV promoter ( Figure 5).
  • Figure 5 To make an expression construct for an RS-PUF type ESF, the fragment encoding the FLAG/Gly-rich domain was removed with Nhel/BamHI digestion and replaced with a fragment that encodes the RS domain (SEQ ID NO: 12) of ASF/SF2 protein with an N-terminal FLAG epitope, which was amplified using primers ASF-RS-F and ASF- RS-R (Table 2).
  • GLY-PUF WT SEQ ID NO: 39
  • GLY-PUF 3'2 SEQ ID NO: 40
  • GLY-PUF 6"2 ' 7'2 SEQ ID NO: 41
  • RS-PUF WT SEQ ID NO: 42
  • RS-PUF 3 SEQ ID NO: 43
  • RS-PUF 6 2/7
  • SEQ ID NO: 44 AND GLY-PUF 531 (SEQ ID NO: 45).
  • Splicing reporter constructs To assess the effects of ESFs on exon skipping, a "modular reporter system" was used that allows changes in an inserted splicing regulatory sequence near a test exon (Exon 12 of the human IGF-II mRNA-binding protein 1 (IGF2BP1, Ensembl ID ENSG00000159217); SEQ ID NO: 50) and assay for the inclusion of this test exon.
  • a forward primer CACCTCGAGAAT(N8)TTCGGGCCCCAC; SEQ ID NO: 51
  • a reverse primer GTGGGGCCCGAA(N8)ATTCTCGAGGTG; SEQ ID NO: 52
  • the two primers were annealed, digested, and ligated into the Xhol/Apal digested vector (inside the test exon).
  • test exon was assayed by RT-PCR with primers corresponding to the first and third exon (two GFP exons) of the reporter minigene.
  • All combinations of splicing reporters and ESF expression vectors were co- transfected into 293T or HeLa cells. Total RNA was isolated 24 hours after transfection and body-labeled RT-PCR was carried out using primers at exons 1 and 2 of the reporter minigene. All transfections were repeated at least twice.
  • the GIy-PUF type ESFs of PUF wt , PUF 3"2 , and PUF 6"2 ' 7"2 repressed inclusion of the cassette exon containing a cognate target sequence ( Figures 6 and 7).
  • Such inhibitions are sequence specific, with the maximal inhibition of exon inclusion occurring between cognate ESFs and reporters.
  • the splicing repressor activities of GIy-PUF type ESFs correlated with the binding affinities between PUF motifs and their targets ( Figure 8), suggesting that the binding affinity to its target is one of the variables to determine the splicing factor strength.
  • the RS-PUF type ESFs had the opposite activity on splicing and promoted inclusion of cassette exons containing the cognate targets ( Figures 9 and 10).
  • the splicing activator activities of ESFs are correlated with the binding affinities between PUF motifs and their targets ( Figure 8), supporting the modular activities of splicing factors.
  • This ratio was optimized by titrating the amount of the ESF expression plasmid to a fixed amount (0.2 ⁇ g in 1 ml cell culture) of splicing reporter plasmid.
  • the inhibition effect of exon inclusion by ESFs is sequence specific as only the GIy-PUF 3"2 that bind to A6G target clearly increases the exon skipping.
  • all ESFs can cause exon skipping even between the low affinity PUF-RNA pairs, leading to a sequence non-specific effect in splicing modulation.
  • Higher amounts of splicing factor expression vector caused exon skipping for all reporters, including those with pseudospecific target sequences.
  • Example 3 demonstrates PUF ESFs can modulate alternative splice site usage.
  • the general methods of Example 3 were used. To assess the effect of ESFs on the alternative use of 5' and 3' ss, reporters with competing 5' and 3' ss were used (see Wang et al, MoI. Cell, 2006, 23: 61-70). The same target sequences of PUF domains were inserted into these reporters using either Xhol/Apal sites (for the competing 3' ss reporter) or XhoI/EcoRI sites (for the competing 5' ss reporter).
  • Splicing reporters were designed containing cognate target sequences between two tandem 5' ss and were co-transfected with the RS-PUF type ESF expression constructs. These ESFs increased the use of the downstream intron proximal 5' ss, having strongest effect with reporters bearing their cognate sequence ( Figures 11 and 12. For Figure 12, the percentage 5' ss product was used to avoid exaggerating the relative change because there is little or undetectable upper band in the absence of ESF.). Similarly, the ESFs modulated alternative 3' ss usage in a sequence-specific fashion ( Figures 13 and 14). [0155] PUF ESF modulation of alternative splice site usage was shown in this example.
  • This example demonstrates the GIy-PUF 531 ESF modulates splicing of endogenous Bcl-x pre-mRNA.
  • RNA (2 ⁇ g) was then reverse-transcribed with Superscript III (Invitrogen) with poly T primer (for Bcl-x) or gene specific primer (for splicing reporter), and one-tenth of the RT product was used as the template for PCR amplification (25 cycles of amplification, with trace amount of Cy5-dCTP in addition to non-fluorescent dNTPs).
  • the primers used to detect splicing reporter were AGTGCTTCAGCCGCTACCC (forward; SEQ ID NO: 61) and GTTGTACTCCAGCTTGTGCC (reverse; SEQ ID NO: 62) and for Bcl-x were CATGGCAGCAGTAAAGCAAG (forward; SEQ ID NO: 63) and GCATTGTTCCCATAGAGTTCC (reverse; SEQ ID NO: 64).
  • RT-PCR products were separated on 10% PAGE gels run with IX TBE buffer, and scanned with a Typhoon 9400 scanner (Amersham Biosciences, Piscataway, NJ). The amount of each splicing isoform was measured with ImageQuant 5.2. All experiments were repeated at least three times.
  • GIy- PUF 531 increased splicing of the Bcl-xS isoform (see Figure 15) in a dose-dependent manner, whereas the control ESF (GIy-PUF'*) did not affect the Bcl-xS level.
  • the control ESF GIy-PUF'*
  • No ESF gave 12% Bcl-xS of total RNA
  • l ⁇ g GIy-PUF ⁇ gave 12%
  • 0.2 ⁇ g GIy-PUF 531 gave 24%
  • l ⁇ g GIy- PUF 331 gave 32%).
  • the increase of Bcl-xS splicing was detected as early as 4 hours after transfection and can last at least 36 hours.
  • GIy-PUF 531 ESF modulation of the splicing of endogenous Bcl-x pre-mRNA was described in this example.
  • This example demonstrates nuclear localization of the GIy-PUF 5 l ESF with greater DNA fragmentation, indicative of apoptosis, in the presence of the GIy-PUF 531 ESF.
  • Immunofluorescence HeLa cells were seeded onto poly-lysine coated glass coverslips in a 6- well plate, and then transfected with GIy-PUF ⁇ 1 or GIy-PUF 531 constructs of Example 3 using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). At 24 h after transfection, the cells were fixed on the coverslips with 4% formaldehyde in IX PBS for 20 min at room temperature and washed with IX PBS three times.
  • the cells were washed with IX PBS three times and the cover slips were mounted with mounting medium (vector mounting medium with DAPI (4 '-6- diamidino-2-phenylindole dihydrochloride), Vector Laboratories, Burlingame, CA). Cells were visualized using an Olympus fluorescence microscope, and photographs were generated using a Kodak digital camera.
  • mounting medium vector mounting medium with DAPI (4 '-6- diamidino-2-phenylindole dihydrochloride), Vector Laboratories, Burlingame, CA.
  • This example demonstrates a shift of splicing in and apoptosis of cancer cells due to the presence of GIy-PUF 531 .
  • Example 3 The GIy-PUF 531 ESF expression construct of Example 3 was used. [0169] The general cell culture, transfection, RNA purification and semi-quantitative RT- PCR methods of Example 5 were used, using MDA-MB-231, BT474, and A549 cells. [0170] Propidium iodide staining and flow cytometry: Cells were harvested at 24 hours after transfection and stained for 5 minutes in a PBS solution containing a final concentration of 2 ⁇ g/ml propidium iodide (PI). The Pi-stained cells were analyzed with a FACSCalibur fluorescence -activated cell sorter (FACS) using CELLQuest software (Becton Dickinson, Franklin Lakes, NJ).
  • FACS FACSCalibur fluorescence -activated cell sorter
  • Lentivirus infection and cell viability assay The full-length ESFs were PCR amplified from original expression vectors and integrated in the lenti viral expression vector pWPXLd (SEQ ID NO: 65) between Mlul/Spel sites. Lentiviruses were generated by co- transfecting 293T cells with packaging vectors pPAX2 and pMD2.G with either pWPXLd- Gly-Puf(531), pWPXLd-Gly-Puf(WT) (control), or pWPXLd-GFP (mock) using the standard calcium phosphate precipitation method.
  • the titer of lentivirus was determined by infecting 293 cells with serial dilutions of virus preparation. Cell viability was determined with the WST-I assay (Roche) following the manufacturer's instructions. MDA-MB-231, A549 and HeLa cells were infected with lentivirus expressing GFP (as non-ESF control), control ESF or designer ESF, and then seeded 72 h after infection in a 96-well plate for overnight incubation.
  • GIy-PUF 531 was tested in other cells, including HeLa, a breast cancer cell line (MDA-MB-231) and a lung cancer cell line (A549), using a lentivirus vector.
  • the GIy- PUF 531 caused a considerable shift of splicing to produce more Bcl-xS isoform in all cell types tested.
  • the lenti virus-infected HeIa cells had an elevated basal amount of Bcl-xS for unknown reasons.
  • the splicing shift increased apoptosis as determined by flow cytometry of propidium iodide-stained cells.
  • the increases of apoptotic cells were modest (about threefold) but significant in all cell types tested (P ⁇ 0.05, paired t-test), consistent with Bcl-xL being an important apoptosis inhibitor for most cancers.
  • Cell viability assay Cell viability was determined with the WST-I assay (Roche, Indianapolis, IN) following the manufacturer's instructions. MDA-MB-231, A549, BT474 and HeLa cells (1x10 4 ) were transfected with Gly-PUF wt or GIy-PUF 531 pCI constructs of Example 3 or lentivirus constructs of Example 7 (except for the BT474 cells), and then seeded 12 h after transfection in a 96-well plate for overnight incubation. Cisplatin (P4394, Sigma, St.
  • GIy-PUF 531 or control GIy-PUF *1 pCI constructs in combination with anti-tumor drugs (cisplatin and paclitaxel) or cytokines (TNF- ⁇ and TRAIL, TNF- related apoptosis inducing ligand) that are commonly used in cancer treatments.
  • anti-tumor drugs cisplatin and paclitaxel
  • cytokines TNF- ⁇ and TRAIL, TNF- related apoptosis inducing ligand
  • MDA- MB-231, A549 and HeLa cells were infected with lentivirus expressing GIy-PUF 531 or control ESF and then treated the infected cells with low doses of drugs for 24 h, conditions under which most mock- infected cancer cells were viable.
  • expression of GIy-PUF 531 sensitized cells to the antitumor drugs tested leading to significant decreases of cell viability compared to controls (P ⁇ 0.05) as judged by WST-I cell proliferation assay.
  • This example demonstrates a GIy-PUF ESF that modulates splicing of the VEGF- A gene.
  • Example 3 The general methods of Example 3 were used to produce a GIy-PUF ESF (ESF #1 of Figure 19; SEQ ID NO: 66) in a pCI-neo vector where the ESF recognizes the GTGACAAG sequence downstream of the proximal 3' splice site of exon 8 of the VEGF-A gene.
  • the sequence of ESF #1 comprises the PUF domain of SEQ ID NO: 5 and the GIy domain of SEQ ID NO: 8.
  • Cultured MDA-MB-231 cells were transfected with different amounts of the expression vector containing ESF #1, and total RNAs were then purified 24 hours after transfection to detect VEGF-A mRNA by RT-PCR.
  • the ESF shifts the splicing towards more VEGF-A b isoforms in the cultured breast cancer cells ( Figure 20).
  • the splicing shift caused an increase in the anti-angiogenic b isoforms, where VEGF-Ai 55 b is the major isoform measured.
  • Example 3 The ASF/SF2 ESF of Example 3 was used. Also, the general methods of Example 3 were used to generate ESFs in the pCI-neo vector using the PUF 3"2 domain (SEQ ID NO: 2) and the RS domains of 9G8 (residues 123-238 of GenBank Accession No. NP_001026854; SEQ ID NO: 13; full length at SEQ ID NO: 67), SC35 (residues 117-221 of GenBank Accession No. NP 003007; SEQ ID NO: 14; full length at SEQ ID NO: 68), SRP40 (residues 180-272 of GenBank Accession No.
  • NP_008856 SEQ ID NO: 15; full length at SEQ ID NO: 69), and a short RS repeat ((RS) 6 ; SEQ ID NO: 16; full length at SEQ ID NO: 70).
  • Additional ESFs were generated using PUF 3"2 (SEQ ID NO: 2) and the Gly-rich domains from members of the hnRNP Al family (hnRNP Al; SEQ ID NO: 8; full length at SEQ ID NO: 71), hnRNP A2/B1 (residues 203-353 of GenBank Accession No.
  • NP_112533 SEQ ID NO: 9; full length at SEQ ID NO: 72
  • hnRNP A3 residues 211-378 of GenBank Accession No. NP_919223; SEQ ID NO: 10; full length at SEQ ID NO: 73
  • Gly-rich short peptide (19 amino acids in length; SEQ ID NO: 11 ; full length at SEQ ID NO: 74).
  • the RS/Gly domains or fragments were amplified by PCR or synthesized and cloned between Xhol and BamHI.
  • Example 4 The general methods of Example 4 were used for the splicing reporter.
  • the splicing reporter and ESF expression plasmids were co-transfected into 293 cells, and the splicing outcomes of the reporter minigene were detected by RT-PCR. All transfections were repeated at least twice.
  • ESF #2 (PUF domain of SEQ ID NO: 6; GIy domain of SEQ ID NO: 8; full length at SEQ ID NO: 75) should inhibit the angiogenic VEGF-A XXX isoforms
  • ESF #3 (PUF domain of SEQ ID NO: 7; RS domain of SEQ ID NO: 13; full length at SEQ ID NO: 76) should promote the anti-angio genie b isoforms. Both should thus shift VEGF-A splicing towards more anti-angio genie isoforms.
  • VEGF-A ESFs are illustrated in this example.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Les modes de réalisation de l'invention portent sur une protéine de fusion comprenant un domaine de liaison à l'ARN PUF de l'une quelconque des SEQ ID N° 1-7 et un domaine de traitement de l'ARN de l'une quelconque des SEQ ID N° 8-16. L'invention porte également sur des acides nucléiques, des vecteurs d'expression recombinant, des cellules hôtes, des populations de cellules, des anticorps ou des parties de liaison à un antigène de ceux-ci, et sur des compositions pharmaceutiques apparentées aux protéines de l'invention. L'invention porte également sur des procédés de traitement ou de prévention de maladies associées au traitement de l'ARN. L'invention porte également sur des procédés de détection chez un hôte d'une maladie associée au traitement de l'ARN et de détection de la capacité de traitement de l'ARN d'une molécule de test.
PCT/US2009/069041 2008-12-23 2009-12-21 Facteurs d'épissage avec un domaine de liaison à l'arn de protéine puf et domaine effecteur d'épissage et leurs utilisations WO2010075303A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US14032608P 2008-12-23 2008-12-23
US61/140,326 2008-12-23

Publications (1)

Publication Number Publication Date
WO2010075303A1 true WO2010075303A1 (fr) 2010-07-01

Family

ID=41728359

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/069041 WO2010075303A1 (fr) 2008-12-23 2009-12-21 Facteurs d'épissage avec un domaine de liaison à l'arn de protéine puf et domaine effecteur d'épissage et leurs utilisations

Country Status (1)

Country Link
WO (1) WO2010075303A1 (fr)

Cited By (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014066663A1 (fr) * 2012-10-24 2014-05-01 Platelet Targeted Therapeutics, Llc Traitement ciblant les plaquettes
CN104163871A (zh) * 2014-08-12 2014-11-26 大连医科大学 抗肿瘤的特异性剪接因子及制备方法
WO2016036754A1 (fr) 2014-09-02 2016-03-10 The Regents Of The University Of California Procédés et compositions pour assurer la modification de l'adn cible arn dépendante
WO2016196655A1 (fr) 2015-06-03 2016-12-08 The Regents Of The University Of California Variants de cas9 et procédés d'utilisation associés
WO2016201138A1 (fr) 2015-06-12 2016-12-15 The Regents Of The University Of California Variants de cas9 rapporteurs et leurs procédés d'utilisation
WO2018017144A1 (fr) 2016-07-19 2018-01-25 Brandeis University Compositions et procédés d'identification de cibles polypeptidiques de liaison à l'arn
WO2018053037A1 (fr) * 2016-09-13 2018-03-22 The Jackson Laboratory Déméthylation d'adn améliorée ciblée
WO2018064371A1 (fr) 2016-09-30 2018-04-05 The Regents Of The University Of California Nouvelles enzymes de modification d'acides nucléiques guidées par arn et leurs méthodes d'utilisation
US10330674B2 (en) 2015-01-13 2019-06-25 Massachusetts Institute Of Technology Pumilio domain-based modular protein architecture for RNA binding
WO2019210326A2 (fr) 2018-04-27 2019-10-31 Genedit Inc. Polymère cationique et son utilisation pour l'administration de biomolécules
WO2020069331A1 (fr) * 2018-09-28 2020-04-02 The Jackson Laboratory Facteurs d'épissage guidés par arn artificiels
WO2020086910A1 (fr) 2018-10-24 2020-04-30 Genedit Inc. Polymère cationique comprenant des chaînes latérales alkyle et utilisation pour l'administration de biomolécules
WO2020219776A1 (fr) 2019-04-23 2020-10-29 Genedit Inc. Polymère cationique avec chaînes latérales alkyle
WO2020243370A1 (fr) 2019-05-28 2020-12-03 Genedit Inc. Polymère comprenant de multiples chaînes latérales fonctionnalisées pour l'administration de biomolécules
WO2020247882A1 (fr) 2019-06-07 2020-12-10 Scribe Therapeutics Inc. Systèmes casx modifiés
WO2021050593A1 (fr) 2019-09-09 2021-03-18 Scribe Therapeutics Inc. Compositions et méthodes pour le ciblage de sod1
WO2021050601A1 (fr) 2019-09-09 2021-03-18 Scribe Therapeutics Inc. Compositions et procédés destinés à être utilisés en immunothérapie
WO2021113763A1 (fr) 2019-12-06 2021-06-10 Scribe Therapeutics Inc. Compositions et méthodes pour le ciblage de la rhodopsine
WO2021113769A1 (fr) 2019-12-07 2021-06-10 Scribe Therapeutics Inc. Compositions et méthodes pour le ciblage de htt
WO2021113772A1 (fr) 2019-12-06 2021-06-10 Scribe Therapeutics Inc. Systèmes d'administration de particules
EP3835419A1 (fr) 2013-12-12 2021-06-16 The Regents of The University of California Procédés et compositions pour modifier un acide nucléique cible monobrin
WO2021142342A1 (fr) 2020-01-10 2021-07-15 Scribe Therapeutics Inc. Compositions et procédés pour le ciblage de pcsk9
WO2021188729A1 (fr) 2020-03-18 2021-09-23 Scribe Therapeutics Inc. Compositions et procédés pour le ciblage de c9orf72
WO2021217082A1 (fr) 2020-04-23 2021-10-28 Genedit Inc. Polymère à chaînes latérales cationiques et hydrophobes
DE212020000516U1 (de) 2019-03-07 2022-01-17 The Regents of the University of California CRISPR-CAS-Effektorpolypeptide
WO2022120095A1 (fr) 2020-12-03 2022-06-09 Scribe Therapeutics Inc. Systèmes crispr de classe ii, type v modifiés
WO2022120089A1 (fr) 2020-12-03 2022-06-09 Scribe Therapeutics Inc. Compositions et procédés pour le ciblage de ptbp1
WO2022125843A1 (fr) 2020-12-09 2022-06-16 Scribe Therapeutics Inc. Vecteurs aav pour l'édition de gènes
US11407995B1 (en) 2018-10-26 2022-08-09 Inari Agriculture Technology, Inc. RNA-guided nucleases and DNA binding proteins
US11434477B1 (en) 2018-11-02 2022-09-06 Inari Agriculture Technology, Inc. RNA-guided nucleases and DNA binding proteins
WO2022241059A2 (fr) 2021-05-11 2022-11-17 Mammoth Biosciences, Inc. Protéines effectrices et procédés d'utilisation
WO2022261561A1 (fr) 2021-06-11 2022-12-15 Genedit Inc. Polymère biodégradable comprenant des chaînes latérales avec des groupes polyamine et oxyde de polyalkylène
US11814620B2 (en) 2021-05-10 2023-11-14 Mammoth Biosciences, Inc. Effector proteins and methods of use
WO2024019801A1 (fr) * 2022-07-19 2024-01-25 Tacit Therapeutics, Inc. Systèmes et procédés pour favoriser le trans-épissage
US11976277B2 (en) 2021-06-09 2024-05-07 Scribe Therapeutics Inc. Particle delivery systems
US12037579B2 (en) 2010-06-18 2024-07-16 The University Of North Carolina At Chapel Hill Synthetic RNA binding polypeptides
US12077775B2 (en) 2022-01-21 2024-09-03 Mammoth Biosciences, Inc. Effector proteins and methods of use

Citations (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3832253A (en) 1973-03-21 1974-08-27 Baxter Laboratories Inc Method of making an inflatable balloon catheter
US3854480A (en) 1969-04-01 1974-12-17 Alza Corp Drug-delivery system
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4450150A (en) 1973-05-17 1984-05-22 Arthur D. Little, Inc. Biodegradable, implantable drug delivery depots, and method for preparing and using the same
US4452775A (en) 1982-12-03 1984-06-05 Syntex (U.S.A.) Inc. Cholesterol matrix delivery system for sustained release of macromolecules
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4667014A (en) 1983-03-07 1987-05-19 Syntex (U.S.A.) Inc. Nonapeptide and decapeptide analogs of LHRH, useful as LHRH antagonists
GB2188638A (en) 1986-03-27 1987-10-07 Gregory Paul Winter Chimeric antibodies
US4748034A (en) 1983-05-13 1988-05-31 Nestec S.A. Preparing a heat stable aqueous solution of whey proteins
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5019369A (en) 1984-10-22 1991-05-28 Vestar, Inc. Method of targeting tumors in humans
US5075109A (en) 1986-10-24 1991-12-24 Southern Research Institute Method of potentiating an immune response
US5087616A (en) 1986-08-07 1992-02-11 Battelle Memorial Institute Cytotoxic drug conjugates and their delivery to tumor cells
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US5239660A (en) 1990-10-31 1993-08-24 Nec Corporation Vector processor which can be formed by an integrated circuit of a small size
US5449752A (en) 1991-05-02 1995-09-12 Seikagaku Kogyo K.K. Polypeptides with affinity to lipopolysaccharides and their uses
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5569825A (en) 1990-08-29 1996-10-29 Genpharm International Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5585089A (en) 1988-12-28 1996-12-17 Protein Design Labs, Inc. Humanized immunoglobulins
US5639641A (en) 1992-09-09 1997-06-17 Immunogen Inc. Resurfacing of rodent antibodies
US5714352A (en) 1996-03-20 1998-02-03 Xenotech Incorporated Directed switch-mediated DNA recombination
US6265150B1 (en) 1995-06-07 2001-07-24 Becton Dickinson & Company Phage antibodies
WO2002038738A2 (fr) * 2000-11-09 2002-05-16 Cold Spring Harbor Laboratory Molecules chimeres servant a moduler l'expression d'un gene
US20020197266A1 (en) 2000-02-08 2002-12-26 Waldemar Debinski Immunotherapy using interleukin 13 receptor subunit alpha 2
WO2004015106A1 (fr) * 2002-08-12 2004-02-19 UNIVERSITé DE SHERBROOKE Methodes permettant de reprogrammer une selection de site d'epissage dans des arn pre-messagers

Patent Citations (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3854480A (en) 1969-04-01 1974-12-17 Alza Corp Drug-delivery system
US3832253A (en) 1973-03-21 1974-08-27 Baxter Laboratories Inc Method of making an inflatable balloon catheter
US4450150A (en) 1973-05-17 1984-05-22 Arthur D. Little, Inc. Biodegradable, implantable drug delivery depots, and method for preparing and using the same
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4452775A (en) 1982-12-03 1984-06-05 Syntex (U.S.A.) Inc. Cholesterol matrix delivery system for sustained release of macromolecules
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4667014A (en) 1983-03-07 1987-05-19 Syntex (U.S.A.) Inc. Nonapeptide and decapeptide analogs of LHRH, useful as LHRH antagonists
US4748034A (en) 1983-05-13 1988-05-31 Nestec S.A. Preparing a heat stable aqueous solution of whey proteins
US5019369A (en) 1984-10-22 1991-05-28 Vestar, Inc. Method of targeting tumors in humans
GB2188638A (en) 1986-03-27 1987-10-07 Gregory Paul Winter Chimeric antibodies
EP0239400B1 (fr) 1986-03-27 1994-08-03 Medical Research Council Anticorps recombinants et leurs procédés de production
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US5087616A (en) 1986-08-07 1992-02-11 Battelle Memorial Institute Cytotoxic drug conjugates and their delivery to tumor cells
US5075109A (en) 1986-10-24 1991-12-24 Southern Research Institute Method of potentiating an immune response
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5693761A (en) 1988-12-28 1997-12-02 Protein Design Labs, Inc. Polynucleotides encoding improved humanized immunoglobulins
US5585089A (en) 1988-12-28 1996-12-17 Protein Design Labs, Inc. Humanized immunoglobulins
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5569825A (en) 1990-08-29 1996-10-29 Genpharm International Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5239660A (en) 1990-10-31 1993-08-24 Nec Corporation Vector processor which can be formed by an integrated circuit of a small size
US5449752A (en) 1991-05-02 1995-09-12 Seikagaku Kogyo K.K. Polypeptides with affinity to lipopolysaccharides and their uses
US5639641A (en) 1992-09-09 1997-06-17 Immunogen Inc. Resurfacing of rodent antibodies
US6265150B1 (en) 1995-06-07 2001-07-24 Becton Dickinson & Company Phage antibodies
US5714352A (en) 1996-03-20 1998-02-03 Xenotech Incorporated Directed switch-mediated DNA recombination
US20020197266A1 (en) 2000-02-08 2002-12-26 Waldemar Debinski Immunotherapy using interleukin 13 receptor subunit alpha 2
WO2002038738A2 (fr) * 2000-11-09 2002-05-16 Cold Spring Harbor Laboratory Molecules chimeres servant a moduler l'expression d'un gene
WO2004015106A1 (fr) * 2002-08-12 2004-02-19 UNIVERSITé DE SHERBROOKE Methodes permettant de reprogrammer une selection de site d'epissage dans des arn pre-messagers

Non-Patent Citations (42)

* Cited by examiner, † Cited by third party
Title
"Antibodies: A Laboratory Manual", 1988, CSH PRESS
"ASHP Handbook on Injectable Drugs", 1986, pages: 622 - 630
"Epitope Mapping", 2000, OXFORD UNIVERSITY PRESS
"Immunobiology", 2001, GARLAND PUBLISHING
"Molecular Cloning, A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
"Peptide and Protein Drug Analysis", 2000, MARCEL DEKKER, INC.
"Pharmaceutics and Pharmacy Practice", 1982, J.B. LIPPINCOTT COMPANY, pages: 238 - 250
"Remington: The Science and Practice of Pharmacy", 1 May 2005, LIPPINCOTT WILLIAMS & WILKINS
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1994, GREENE PUBLISHING ASSOCIATES AND JOHN WILEY & SONS
CAPECCHI, CELL, vol. 22, 1980, pages 479 - 488
CARTEGNI L ET AL: "Correction of disease-associated exon skipping by synthetic exon-specific activators", NATURE STRUCTURAL BIOLOGY, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 10, no. 2, 1 February 2003 (2003-02-01), pages 120 - 125, XP002262731, ISSN: 1072-8368 *
CHAN ET AL.: "Fmoc Solid Phase Peptide Synthesis", 2005, OXFORD UNIVERSITY PRESS
CHEONG CHEORN-GIL ET AL: "Engineering RNA sequence specificity of Pumilio repeats", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 103, no. 37, September 2006 (2006-09-01), pages 13635 - 13639, XP002573354, ISSN: 0027-8424 *
CHEONG; HALL, PROC. NATL. ACAD. SCI. USA, vol. 103, 2006, pages 13635 - 13639
CHU ET AL., GENE, vol. 13, 1981, pages 97
DAVIS ET AL.: "Basic Methods in Molecular Biology", 1986, ELSEVIER
DEL GATTO-KONCZAK ET AL., MOL. CELL BIOL., vol. 19, 1999, pages 251 - 260
DEL GATTO-KONCZAK FABIENNE ET AL: "hnRNP A1 recruited to an exon in vivo can function as an exon splicing silencer", MOLECULAR AND CELLULAR BIOLOGY, vol. 19, no. 1, January 1999 (1999-01-01), pages 251 - 260, XP002573355, ISSN: 0270-7306 *
FELGNER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 7413 - 7417
GARCIA-BLANCO MARIANO A ET AL: "Alternative splicing in disease and therapy", NATURE BIOTECHNOLOGY, vol. 22, no. 5, May 2004 (2004-05-01), pages 535 - 546, XP002573358, ISSN: 1087-0156 *
GRAHAM ET AL., VIROLOGY, vol. 52, 1973, pages 456 - 467
GRAVELEY BRENTON R ET AL: "Arginine/serine-rich domains of SR proteins can function as activators of pre-mRNA splicing", MOLECULAR CELL, vol. 1, no. 5, May 1998 (1998-05-01), pages 765 - 771, XP002573356, ISSN: 1097-2765 *
HASKARD; ARCHER, J. IMMUNOL. METHODS, vol. 74, no. 2, 1984, pages 361 - 367
HOOK ET AL., RNA, vol. 11, 2005, pages 227 - 233
HUDECZ, F., METHODS MOL. BIOL., vol. 298, 2005, pages 209 - 223
HUSE ET AL., SCIENCE, vol. 246, 1989, pages 1275 - 1281
KIRIN ET AL., INORG CHEM., vol. 44, no. 15, 2005, pages 5405 - 5415
KLEIN ET AL., NATURE, vol. 327, 1987, pages 70 - 73
KOHLER; MILSTEIN, EUR. J. IMMUNOI., vol. 5, 1976, pages 511 - 519
MANNINO ET AL., BIOTECHNIQUES, vol. 6, 1988, pages 682 - 690
OZAWA TAKEAKI ET AL: "Imaging dynamics of endogenous mitochondrial RNA in single living cells", NATURE METHODS, vol. 4, no. 5, May 2007 (2007-05-01), pages 413 - 419, XP002573359, ISSN: 1548-7091 *
PEDERSEN ET AL., J. MOL. BIOL., vol. 235, 1994, pages 959 - 973
PHILIPPS DANA ET AL: "Arginine/serine repeats are sufficient to constitute a splicing activation domain.", NUCLEIC ACIDS RESEARCH, vol. 31, no. 22, 15 November 2003 (2003-11-15), pages 6502 - 6508, XP002573357, ISSN: 0305-1048 *
REITER ET AL., PROTEIN ENGINEERING, vol. 7, 1994, pages 697 - 704
RODER ET AL., METHODS ENZYMOL., vol. 121, 1986, pages 140 - 167
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR PRESS
SHIGEKAWA ET AL., BIOTECHNIQUES, vol. 6, 1988, pages 742 - 751
SZOKA ET AL., ANN. REV. BIOPHYS, vol. 9, 1980, pages 467
WADWA ET AL., J. DRUG TARGETING, vol. 3, 1995, pages 111
WANG ET AL., MOL. CELL, vol. 23, 2006, pages 61 - 70
WANG YANG ET AL: "Engineering splicing factors with designed specificities", NATURE METHODS, vol. 6, no. 11, November 2009 (2009-11-01), pages 825 - 830, XP002573360, ISSN: 1548-7091 *
WANG Z. ET AL., CELL, vol. 119, 2004, pages 831 - 45

Cited By (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12037579B2 (en) 2010-06-18 2024-07-16 The University Of North Carolina At Chapel Hill Synthetic RNA binding polypeptides
US10294291B2 (en) 2012-10-24 2019-05-21 Platelet Targeted Therapeutics, Llc Platelet targeted treatment
WO2014066663A1 (fr) * 2012-10-24 2014-05-01 Platelet Targeted Therapeutics, Llc Traitement ciblant les plaquettes
US9982034B2 (en) 2012-10-24 2018-05-29 Platelet Targeted Therapeutics, Llc Platelet targeted treatment
EP3835419A1 (fr) 2013-12-12 2021-06-16 The Regents of The University of California Procédés et compositions pour modifier un acide nucléique cible monobrin
CN104163871A (zh) * 2014-08-12 2014-11-26 大连医科大学 抗肿瘤的特异性剪接因子及制备方法
WO2016036754A1 (fr) 2014-09-02 2016-03-10 The Regents Of The University Of California Procédés et compositions pour assurer la modification de l'adn cible arn dépendante
US11275081B2 (en) 2015-01-13 2022-03-15 Massachusetts Institute Of Technology Pumilio domain-based modular protein architecture for RNA binding
US10330674B2 (en) 2015-01-13 2019-06-25 Massachusetts Institute Of Technology Pumilio domain-based modular protein architecture for RNA binding
WO2016196655A1 (fr) 2015-06-03 2016-12-08 The Regents Of The University Of California Variants de cas9 et procédés d'utilisation associés
WO2016201138A1 (fr) 2015-06-12 2016-12-15 The Regents Of The University Of California Variants de cas9 rapporteurs et leurs procédés d'utilisation
WO2018017144A1 (fr) 2016-07-19 2018-01-25 Brandeis University Compositions et procédés d'identification de cibles polypeptidiques de liaison à l'arn
WO2018053037A1 (fr) * 2016-09-13 2018-03-22 The Jackson Laboratory Déméthylation d'adn améliorée ciblée
WO2018064371A1 (fr) 2016-09-30 2018-04-05 The Regents Of The University Of California Nouvelles enzymes de modification d'acides nucléiques guidées par arn et leurs méthodes d'utilisation
WO2019210326A2 (fr) 2018-04-27 2019-10-31 Genedit Inc. Polymère cationique et son utilisation pour l'administration de biomolécules
WO2020069331A1 (fr) * 2018-09-28 2020-04-02 The Jackson Laboratory Facteurs d'épissage guidés par arn artificiels
WO2020086910A1 (fr) 2018-10-24 2020-04-30 Genedit Inc. Polymère cationique comprenant des chaînes latérales alkyle et utilisation pour l'administration de biomolécules
US11407995B1 (en) 2018-10-26 2022-08-09 Inari Agriculture Technology, Inc. RNA-guided nucleases and DNA binding proteins
US12071641B2 (en) 2018-11-02 2024-08-27 Inari Agriculture Technology, Inc. RNA-guided nucleases and DNA binding proteins
US11434477B1 (en) 2018-11-02 2022-09-06 Inari Agriculture Technology, Inc. RNA-guided nucleases and DNA binding proteins
DE212020000516U1 (de) 2019-03-07 2022-01-17 The Regents of the University of California CRISPR-CAS-Effektorpolypeptide
EP4219700A1 (fr) 2019-03-07 2023-08-02 The Regents of the University of California Polypeptides effecteurs crispr-cas et leurs procédés d'utilisation
WO2020219776A1 (fr) 2019-04-23 2020-10-29 Genedit Inc. Polymère cationique avec chaînes latérales alkyle
WO2020243370A1 (fr) 2019-05-28 2020-12-03 Genedit Inc. Polymère comprenant de multiples chaînes latérales fonctionnalisées pour l'administration de biomolécules
US11560555B2 (en) 2019-06-07 2023-01-24 Scribe Therapeutics Inc. Engineered proteins
WO2020247882A1 (fr) 2019-06-07 2020-12-10 Scribe Therapeutics Inc. Systèmes casx modifiés
US12084692B2 (en) 2019-06-07 2024-09-10 Scribe Therapeutics Inc. Guide scaffolds
WO2021050593A1 (fr) 2019-09-09 2021-03-18 Scribe Therapeutics Inc. Compositions et méthodes pour le ciblage de sod1
WO2021050601A1 (fr) 2019-09-09 2021-03-18 Scribe Therapeutics Inc. Compositions et procédés destinés à être utilisés en immunothérapie
US11613742B2 (en) 2019-09-09 2023-03-28 Scribe Therapeutics Inc. Compositions and methods for the targeting of SOD1
WO2021113772A1 (fr) 2019-12-06 2021-06-10 Scribe Therapeutics Inc. Systèmes d'administration de particules
US11535835B1 (en) 2019-12-06 2022-12-27 Scribe Therapeutics Inc. Compositions and methods for the targeting of rhodopsin
WO2021113763A1 (fr) 2019-12-06 2021-06-10 Scribe Therapeutics Inc. Compositions et méthodes pour le ciblage de la rhodopsine
WO2021113769A1 (fr) 2019-12-07 2021-06-10 Scribe Therapeutics Inc. Compositions et méthodes pour le ciblage de htt
WO2021142342A1 (fr) 2020-01-10 2021-07-15 Scribe Therapeutics Inc. Compositions et procédés pour le ciblage de pcsk9
WO2021188729A1 (fr) 2020-03-18 2021-09-23 Scribe Therapeutics Inc. Compositions et procédés pour le ciblage de c9orf72
WO2021217082A1 (fr) 2020-04-23 2021-10-28 Genedit Inc. Polymère à chaînes latérales cationiques et hydrophobes
WO2022120089A1 (fr) 2020-12-03 2022-06-09 Scribe Therapeutics Inc. Compositions et procédés pour le ciblage de ptbp1
WO2022120095A1 (fr) 2020-12-03 2022-06-09 Scribe Therapeutics Inc. Systèmes crispr de classe ii, type v modifiés
WO2022125843A1 (fr) 2020-12-09 2022-06-16 Scribe Therapeutics Inc. Vecteurs aav pour l'édition de gènes
US11814620B2 (en) 2021-05-10 2023-11-14 Mammoth Biosciences, Inc. Effector proteins and methods of use
WO2022241059A2 (fr) 2021-05-11 2022-11-17 Mammoth Biosciences, Inc. Protéines effectrices et procédés d'utilisation
US11976277B2 (en) 2021-06-09 2024-05-07 Scribe Therapeutics Inc. Particle delivery systems
WO2022261561A1 (fr) 2021-06-11 2022-12-15 Genedit Inc. Polymère biodégradable comprenant des chaînes latérales avec des groupes polyamine et oxyde de polyalkylène
US12077775B2 (en) 2022-01-21 2024-09-03 Mammoth Biosciences, Inc. Effector proteins and methods of use
WO2024019801A1 (fr) * 2022-07-19 2024-01-25 Tacit Therapeutics, Inc. Systèmes et procédés pour favoriser le trans-épissage

Similar Documents

Publication Publication Date Title
WO2010075303A1 (fr) Facteurs d'épissage avec un domaine de liaison à l'arn de protéine puf et domaine effecteur d'épissage et leurs utilisations
US11697676B2 (en) Anti-human papillomavirus 16 E6 T cell receptors
US20190054143A1 (en) Anti-ssx-2 t cell receptors and related materials and methods of use
JP6643394B2 (ja) Ｍ９７１キメラ抗原受容体
CA2657947C (fr) Fkbp-l et ses utilisations
JP6267644B2 (ja) 抗ｃｄ２２キメラ抗原受容体
US20160333422A1 (en) Anti-ny-br-1 polypeptides, proteins, and chimeric antigen receptors
AU2015266818A1 (en) Anti-human papillomavirus 16 E7 T cell receptors
US20220259317A1 (en) Flt3-specific chimeric antigen receptors and methods using same
US20230235049A1 (en) Chimeric antigen receptors and uses thereof
JP6233932B2 (ja) ＢＢＦ２Ｈ７（ＢＢＦ２ ｈｕｍａｎ ｈｏｍｏｌｏｇｕｅ ｏｎ ｃｈｒｏｍｏｓｏｍｅ７）部分アミノ酸配列を有するペプチドまたはそれに結合する抗体を含む細胞増殖調節用組成物
JPWO2005061704A1 (ja) 癌の予防・治療剤
Burns Development of a Protein-Based Therapy for the Treatment of Spinal Muscular Atrophy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09775074

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09775074

Country of ref document: EP

Kind code of ref document: A1