WO2010068978A1 - Methods of modulating the sex of avians - Google Patents

Methods of modulating the sex of avians Download PDF

Info

Publication number
WO2010068978A1
WO2010068978A1 PCT/AU2009/001627 AU2009001627W WO2010068978A1 WO 2010068978 A1 WO2010068978 A1 WO 2010068978A1 AU 2009001627 W AU2009001627 W AU 2009001627W WO 2010068978 A1 WO2010068978 A1 WO 2010068978A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
seq
acid molecule
gene
egg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2009/001627
Other languages
English (en)
French (fr)
Inventor
Timothy James Doran
Robert John Moore
John William Lowenthal
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Commonwealth Scientific and Industrial Research Organization CSIRO
Australian Poultry CRC Pty Ltd
Original Assignee
Commonwealth Scientific and Industrial Research Organization CSIRO
Australian Poultry CRC Pty Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Commonwealth Scientific and Industrial Research Organization CSIRO, Australian Poultry CRC Pty Ltd filed Critical Commonwealth Scientific and Industrial Research Organization CSIRO
Priority to JP2011541021A priority Critical patent/JP2012511915A/ja
Priority to RU2011129621/10A priority patent/RU2011129621A/ru
Priority to MX2011006577A priority patent/MX2011006577A/es
Priority to US13/139,163 priority patent/US20120227119A1/en
Priority to CN200980154743.1A priority patent/CN102356158B/zh
Priority to EP09832707A priority patent/EP2376641A4/en
Priority to CA2747120A priority patent/CA2747120A1/en
Priority to BRPI0923005-0A priority patent/BRPI0923005A2/pt
Priority to AU2009328633A priority patent/AU2009328633B2/en
Publication of WO2010068978A1 publication Critical patent/WO2010068978A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00Modified animals
    • A01K2207/05Animals modified by non-integrating nucleic acids, e.g. antisense, RNAi, morpholino, episomal vector, for non-therapeutic purpose
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/30Bird
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/02Animal zootechnically ameliorated
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific

Definitions

  • the present invention relates to nucleic acids and methods for modulating the sex of avians.
  • the invention relates to the in ovo delivery of a dsRNA molecule, especially siRNAs, to increase the production of female birds.
  • nucleic acids and methods for modifying avian sex that do not result in transformation of the bird's genome, but are amenable to high throughout processing.
  • the present inventors have identified nucleic acid molecules, in particular dsRNA molecules, which can be used to modify the sex of avians in ovo.
  • the present invention provides an isolated and/or exogenous nucleic acid molecule comprising a double-stranded region which reduces the level of at least one RNA molecule and/or protein when administered to an avian egg, wherein if the embryo of the egg is male the sex is altered to female following administration of the isolated and/or exogenous nucleic acid molecule, and wherein the isolated and/or exogenous nucleic acid molecule does not comprise a sequence selected from:
  • the present invention provides an isolated and/or exogenous nucleic acid molecule comprising one or more of the sequence of nucleotides provided as SEQ ID NO's 11 to 3431 or a variant of any one or more thereof, wherein the isolated and/or exogenous nucleic acid molecule does not comprise a sequence selected from:
  • the nucleic acid molecule is dsRNA. More preferably, the dsRNA is a siRNA or a shRNA.
  • the nucleic acid molecule reduces the level of a protein encoded by a DMRTl gene, ASW gene or r-spondin gene, in an avian egg.
  • the nucleic acid does not comprise the full length open reading frame of the RNA molecule or the cDNA encoding therefor.
  • the nucleic acid does not comprise a sequence of nucleotides provided as SEQ ID NO's 2, 4 or 6, or a sequence of nucleotides provided as SEQ ID NO's 2, 4 or 6 where each T (thymine) is replaced with a U (uracil).
  • T thymine
  • U uracil
  • vector encoding a nucleic acid molecule, or a single strand thereof, according to the invention.
  • Such vectors can be used in a host cell or cell-free expression system to produce nucleic acid molecules useful for the method of the invention.
  • the present invention provides a host cell comprising an exogenous nucleic acid molecule, or a single strand thereof, of the invention and/or a vector of the invention.
  • the present invention provides a composition comprising a nucleic acid molecule, or a single strand thereof, of the invention, a vector of the invention, and/or a host cell of the invention.
  • the present invention provides a method of modifying the sex of an avian, the method comprising administering to an avian egg at least one nucleic acid molecule of the invention.
  • the nucleic acid is administered to a non-cellular site of the egg. More preferably, the non-cellular site is the air sac, yolk sac, amnionic cavity or chorion allantoic fluid.
  • the egg is not electroporated.
  • the nucleic acid is not delivered by administering a vector encoding the nucleic acid molecule.
  • the nucleic acid molecule administered is dsRNA.
  • the nucleic acid molecule is administered by injection.
  • the nucleic acid may be administered in a composition of the invention.
  • the method modifies the sex of the embryo of the egg from male to female.
  • the avian can be any species of the Class Aves. Examples include, but are not limited to, chickens, ducks, turkeys, geese, bantams and quails. In a particularly preferred embodiment, the avian is a chicken.
  • the present invention provides an avian produced using a method of the invention.
  • the present invention provides a chicken produced using a method of the invention.
  • the present invention provides an avian egg comprising a nucleic acid molecule, or a single strand thereof, of the invention, a vector of the invention, and/or a host cell of the invention.
  • the present invention provides a kit comprising a nucleic acid molecule, or a single strand thereof, of the invention, a vector of the invention, a host cell of the invention, and/or a composition of the invention.
  • Figure 1 Selected shRNAs for knockdown of EGFP-Dmrtl gene fusion expression. Mean fluorescence intensity for each transfection condition expressed relative to pEGFP-Dmrtl. Error bars indicate standard error calculated on each individual experiment completed in triplicate.
  • SEQ ID NO: 1 Partial chicken DMRTl protein sequence (Genbank AF123456).
  • SEQ ID NO:3 Chicken WPKCI (ASW) (Genbank AF 148455).
  • SEQ ID NO: 7 Nucleotide sequence of chicken U6-1 promoter.
  • SEQ ID NO: 8 Nucleotide sequence of chicken U6-3 promoter.
  • SEQ ID NO: 9 Nucleotide sequence of chicken U6-4 promoter.
  • SEQ ID NO: 10 Nucleotide sequence of chicken 7SK promoter.
  • avian refers to any species, subspecies or race of organism of the taxonomic Class Aves, such as, but not limited to, such organisms as chicken, turkey, duck, goose, quail, pheasants, parrots, finches, hawks, crows and ratites including ostrich, emu and cassowary.
  • the term includes the various known strains of Gallus gallus (chickens), for example, White Leghorn, Brown Leghorn, Barred-Rock, Wales, New Hampshire, Rhode Island, Australorp, Cornish, Minorca, Amrox, California Gray, Italian Partidge-coloured, as well as strains of turkeys, pheasants, quails, duck, ostriches and other poultry commonly bred in commercial quantities.
  • egg refers to a fertilized ovum that has been laid by a bird.
  • avian eggs consist of a hard, oval outer eggshell, the "egg white” or albumen, the egg yolk, and various thin membranes.
  • in ovo refers to in an egg.
  • non-cellular site refers a part of the egg other than the embryo.
  • RNA and/or target protein in the egg when compared to an egg from the same species of avian, more preferably strain or breed of avian, and even more preferably the same bird, that has not been administered with a nucleic acid as defined herein.
  • the term also refers to a measurable reduction in the activity of a target protein.
  • a reduction in the level of a target RNA and/or target protein is at least about 10%. More preferably, the reduction is at least about 20%, 30%, 40%, 50%, 60%, 80%, 90% and even more preferably, about 100%.
  • the phrase "the nucleic acid molecule results in a reduction” or variations thereof refers to the presence of the nucleic acid molecule in the egg inducing degradation of homologous RNAs in the egg by the process known in the art as "RNA interference” or “gene silencing". Furthermore, the nucleic acid molecule directly results in the reduction, and is not transcribed in ovo to produce the desired effect.
  • the "at least one RNA molecule” can be any type of RNA present in, and/or produced by, an avian egg. Examples include, but are not limited to, mRNA, snRNA, microRNA and tRNA.
  • a "variant" of a nucleic acid molecule of the invention includes molecules of varying sizes of, and/or with one or more different nucleotides, but which are still capable of being used to silence the target gene.
  • variants may comprise additional nucleotides (such as 1, 2, 3, 4, or more), or less nucleotides.
  • additional nucleotides such as 1, 2, 3, 4, or more
  • a few nucleotides may be substituted without influencing the ability of the nucleic acid to silence the target gene.
  • the variant includes additional 5' and/or 3' nucleotides which are homologous to the corresponding target RNA molecule and/or which enhance the stability of the nucleic acid molecule.
  • the nucleic acid molecules have no more than 4, more preferably no more than 3, more preferably no more than 2, and even more preferably no more than 1, nucleotide differences when compared to the sequences provided herein.
  • the nucleic acid molecules have no more than 2, and more preferably no more than 1, internal additional and/or deletional nucleotides when compared to the sequences provided herein.
  • a nucleic acid of the invention has one, preferably two, additional non-target nucleotides at the 5' and/or 3' end, for example an additional UU at the 3 'end. Such additions can increase the half-life of the molecule in ovo.
  • an “isolated nucleic acid molecule” we mean a nucleic acid molecule which is at least partially separated from the nucleic acid molecule with which it is associated or linked in its native state.
  • the isolated nucleic acid molecule is at least 60% free, preferably at least 75% free, and most preferably at least 90% free from other components with which they are naturally associated.
  • polynucleotide is used interchangeably herein with the term “nucleic acid”.
  • exogenous in the context of a nucleic acid molecule refers to the nucleic acid molecule when present in a cell, or in a cell-free expression system, in an altered amount.
  • the cell is a cell that does not naturally comprise the nucleic acid molecule.
  • the cell may be a cell which comprises an exogenous nucleic acid molecule resulting in an increased amount of the nucleic acid molecule.
  • An exogenous nucleic acid molecule of the invention includes nucleic acid molecules which have not been separated from other components of the recombinant cell, or cell- free expression system, in which it is present, and nucleic acid molecules produced in such cells or cell-free systems which are subsequently purified away from at least some other components.
  • the present invention relates to the modulation of the sex of avians in ovo.
  • genes which can be targeted to modulate avian sex include, but are not necessarily limited to, the DMRTl gene, the ASW (WPKCI) gene, the R-spondin gene, the Fox9 gene and the ⁇ -catenin gene.
  • the nucleic acid molecule reduces the level of a protein encoded by a DMRT 1 gene.
  • DMRT 1 was the first molecule implicated in sex determination that shows sequence conservation between phyla.
  • the avian homologue of DMRTl is found on the Z (sex) chromosome of chickens and is differentially expressed in the genital ridges of male and female chicken embryos (Raymond et al, 1999; Smith et al., 1999).
  • DMRTl is one of the few genes thus far implicated in mammalian sex determination that appears to have a strictly gonadal pattern of expression (Raymond et al., 1999).
  • nucleic acid molecules that can be used to reduce the level of chicken DMRT 1 protein, and mRNA encoding therefor, include, but are not limited to, nucleic acids comprising one or more of the sequence of nucleotides provided in Table 1 (SEQ ID NO' s 11 to 1644), or a variant of any one or more thereof, with the exception that the nucleic acid molecule does not comprise a sequence selected from:
  • the nucleic acid molecule that can be used to reduce the level of chicken DMRTl protein comprises a sequence selected from; GAGCCAGUUGUCAAGAAGA (SEQ ID NO:251),
  • nucleic acid molecule that can be used to reduce the level of chicken DMRTl protein comprises the sequence, GAGCCAGUUGUCAAGAAGA (SEQ ID NO:251), or a variant thereof such as GAGCCAGUUGUCAAGAAGAUU (SEQ ID NO:3431).
  • WPKCI A further example of a gene that can be targeted to modify sex is the WPKCI gene.
  • the avian gene WPKCI has been shown to be conserved widely on the avian W chromosome and expressed actively in the female chicken embryo before the onset of gonadal differentiation. It is suggested that WPKCI may play a role in the differentiation of the female gonad by interfering with the function of PKCI or by exhibiting its unique function in the nucleus (Hori et al., 2000). This gene has also been identified as ASW (avian sex-specific W-linked) (O'Neill et al., 2000).
  • ASW avian sex-specific W-linked
  • nucleic acid molecules that can be used to reduce the level of chicken ASW (WPKCI) protein, and mRNA encoding therefor, include, but are not limited to, nucleic acids comprising one or more of the sequence of nucleotides provided in Table 2 (SEQ ID NO's 1645 to 2209), or a variant of any one or more thereof.
  • a gene that can be targeted to modify sex is the r- spondin gene.
  • nucleic acid molecules that can be used to reduce the level of chicken r-spondin protein, and mRNA encoding therefor, include, but are not limited to, nucleic acids comprising one or more of the sequence of nucleotides provided in Table 3 (SEQ ID NO's 2210 to 3430), or a variant of any one or more thereof.
  • RNA interference refers generally to a process in which a double-stranded RNA (dsRNA) molecule reduces the expression of a nucleic acid sequence with which the double-stranded RNA molecule shares substantial or total homology.
  • dsRNA double-stranded RNA
  • gene silencing can be achieved using non-RNA double stranded molecules (see, for example, US 20070004667).
  • RNA interference is particularly useful for specifically inhibiting the production of a particular RNA and/or protein.
  • dsRNA duplex RNA
  • This technology relies on the presence of dsRNA molecules that contain a sequence that is essentially identical to the mRNA of the gene of interest or part thereof, in this case an mRNA encoding a polypeptide of interest.
  • the dsRNA can be produced from a single promoter in a recombinant vector or host cell, where the sense and anti-sense sequences are flanked by an unrelated sequence which enables the sense and anti-sense sequences to hybridize to form the dsRNA molecule with the unrelated sequence forming a loop structure.
  • the design and production of suitable dsRNA molecules for the present invention is well within the capacity of a person skilled in the art, particularly considering Waterhouse et al. (1998), Smith et al. (2000), WO 99/32619, WO 99/53050, WO 99/49029 and WO 01/34815.
  • the present invention includes nucleic acid molecules comprising and/or encoding double-stranded regions for gene silencing.
  • the nucleic acid molecules are typically RNA but may comprise DNA, chemically-modified nucleotides and non- nucleotides.
  • the double-stranded regions should be at least 19 contiguous nucleotides, for example about 19 to 23 nucleotides, or may be longer, for example 30 or 50 nucleotides, or 100 nucleotides or more.
  • the full-length sequence corresponding to the entire gene transcript may be used. Preferably, they are about 19 to about 100 nucleotides in length, more preferably about 19 to about 50 nucleotides in length, and even more preferably about 19 to about 23 nucleotides in length.
  • the degree of identity of a double-stranded region of a nucleic acid molecule to the targeted transcript should be at least 90% and more preferably 95-100%.
  • GAP Needleman and Wunsch, 1970 analysis
  • the nucleic acid molecule may of course comprise sequences unrelated to the target which may function to stabilize the molecule.
  • short interfering RNA or "siRNA” as used herein refers to a nucleic acid molecule which comprises ribonucleotides capable of inhibiting or down regulating gene expression, for example by mediating RNAi in a sequence-specific manner, wherein the double stranded portion is less than 50 nucleotides in length, preferably about 19 to about 23 nucleotides in length.
  • the siRNA can be a nucleic acid molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the siRNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary.
  • siRNA is equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid (siNA), short interfering modified oligonucleotide, chemically-modified siRNA, and others.
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • siNA short interfering nucleic acid
  • RNAi is equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • siRNA molecules of the invention can be used to epigenetically silence genes at both the post-transcriptional level or the pre- transcriptional level.
  • epigenetic regulation of gene expression by siRNA molecules of the invention can result from siRNA mediated modification of chromatin structure to alter gene expression.
  • Preferred siRNA molecules comprise a nucleotide sequence that is identical to about 19 to 23 contiguous nucleotides of the target mRNA.
  • the target mRNA sequence commences with the dinucleotide AA, comprises a GC-content of about 30-70% (preferably, 30-60%, more preferably 40-60% and more preferably about 45%-55%), and does not have a high percentage identity to any nucleotide sequence other than the target in the genome of the avain (preferably chickens) in which it is to be introduced, e.g., as determined by standard BLAST search.
  • siRNA or “short-hairpin RNA” is meant an siRNA molecule where less than about 50 nucleotides, preferably about 19 to about 23 nucleotides, is base paired with a complementary sequence located on the same RNA molecule, and where said sequence and complementary sequence are separated by an unpaired region of at least about 4 to 15 nucleotides which forms a single-stranded loop above the stem structure created by the two regions of base complementarity.
  • sequences of a single-stranded loops are 5' UUCAAGAGA 3' and 5' UUUGUGUAG 3'.
  • shRNAs are dual or bi-finger and multi-finger hairpin dsRNAs, in which the RNA molecule comprises two or more of such stem-loop structures separated by single-stranded spacer regions.
  • siRNAs can be generated in vitro by using a recombinant enzyme, such as T7 RNA polymerase, and DNA oligonucleotide templates, or can be prepared in vivo, for example, in cultured cells.
  • the nucleic acid molecule is produced synthetically.
  • RNA polymerase III a vector containing, for example, a RNA polymerase III promoter.
  • Various vectors have been constructed for generating hairpin siRNAs in host cells using either an Hl-RNA or an snU6 RNA promoter (see SEQ ID NO's 7 to 9).
  • a RNA molecule as described above e.g., a first portion, a linking sequence, and a second portion
  • the first and second portions form a duplexed stem of a hairpin and the linking sequence forms a loop.
  • the pSuper vector (OligoEngines Ltd., Seattle, Wash.) can also be used to generate siRNA.
  • nucleic acid molecule and “double-stranded RNA molecule” includes synthetically modified bases such as, but not limited to, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl-, 2-propyl- and other alkyl- adenines, 5-halo uracil, 5-halo cytosine, 6-aza cytosine and 6-aza thymine, pseudo uracil, 4-thiuracil, 8- halo adenine, 8-aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl adenine and other 8-substituted adenines, 8-halo guanines, 8-a
  • the present invention also provides a vector encoding a nucleic acid molecule comprising a double-stranded region, or single strand thereof, of the present invention.
  • the vector is an expression vector capable of expressing the open reading frame(s) encoding a dsRNA in a host cell and/or cell free system.
  • the host cell can be any cell type such as, not limited to, bacterial, fungal, plant or animal cells, preferably an avian cell.
  • a vector of the invention comprises a promoter operably linked to an open reading frame encoding a nucleic acid molecule of the invention, or a strand thereof.
  • promoter refers to a nucleic acid sequence which is able to direct transcription of an operably linked nucleic acid molecule and includes, for example, RNA polymerase II and RNA polymerase III promoters. Also included in this definition are those transcriptional regulatory elements (e.g., enhancers) that are sufficient to render promoter-dependent gene expression controllable in a cell type- specific, tissue-specific, or temporal-specific manner, or that are inducible by external agents or signals.
  • transcriptional regulatory elements e.g., enhancers
  • operably linked refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory element to a transcribed sequence.
  • a promoter is operably linked to a coding sequence, such as an open reading frame encoding a double-stranded RNA molecule defined herein, if it stimulates or modulates the transcription of the coding sequence in an appropriate cell.
  • promoter transcriptional regulatory elements that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are c ⁇ -acting.
  • RNA polymerase III promoter or "RNA pol III promoter” or “polymerase III promoter” or “pol III promoter” is meant any invertebrate, vertebrate, or mammalian promoter, e.g., chicken, human, murine, porcine, bovine, primate, simian, etc.
  • U6 promoter e.g., chicken U6, human U6, murine U6
  • Hl promoter, or 7SK promoter any invertebrate, vertebrate, or mammalian promoter or polymorphic variant or mutant found in nature to interact with RNA polymerase III to transcribe its cognate RNA product, i.e., U6 RNA, Hl RNA, or 7SK RNA, respectively.
  • suitable promoters include cU6-l (SEQ ID NO: 7), cU6-3 (SEQ ID NO:8), cU6-4 (SEQ ID NO:9) and c7SK (SEQ ID NO: 10).
  • E. coli When E. coli is used as a host cell, there is no limitation other than that the vector should have an "ori" to amplify and mass-produce the vector in E. coli (e.g., JM 109. DH5 ⁇ , HBlOl, or XLl Blue), and a marker gene for selecting the transformed E. coli (e.g., a drug-resistance gene selected by a drug such as ampicillin, tetracycline, kanamycin, or chloramphenicol).
  • a marker gene for selecting the transformed E. coli e.g., a drug-resistance gene selected by a drug such as ampicillin, tetracycline, kanamycin, or chloramphenicol.
  • M 13 -series vectors, pUC-series vectors, pBR322, pBluescript, pCR-Script, and such can be used.
  • such vectors include JMl 09, DH5 ⁇ , HBlOl, or XLl Blue
  • the vector should have a promoter such as lacZ promoter, araB promoter, or T7 promoter that can efficiently promote the expression of the desired gene in E. coli.
  • Other examples of the vectors are "QIAexpress system" (Qiagen), pEGFP, and pET (for this vector, BL21, a strain expressing T7 RNA polymerase, is preferably used as the host).
  • the vector may be a mammal- derived expression vector (e.g., pcDNA3 (Invitrogen), pEGF-BOS, pEF, and pCDM8), an insect cell-derived expression vector (e.g., "Bac-to-BAC baculovairus expression system" (GibcoBRL) and pBacPAK8), a plant-derived expression vector (e.g., pMHl and pMH2), an animal virus-derived expression vector (e.g., pHSV, pMV, and pAdexLcw), a retrovirus-derived expression vector (e.g., pZIPneo), a yeast-derived expression vector (e.g., "Pichia Expression Kit” (Invitrogen), pNVl l, and SP-QOl), or a Bacillus subtilis-derived expression vector (e.g., pPL608 and p
  • the vector In order to express nucleic acid molecules in animal cells, such as CHO, COS, Vero and NIH3T3 cells, the vector should have a promoter necessary for expression in such cells, e.g., SV40 promoter, MMLV-LTR promoter, EF l ⁇ promoter, CMV promoter, etc., and more preferably it has a marker gene for selecting transformants (for example, a drug resistance gene selected by a drug (e.g., neomycin, G418, etc.). Examples of vectors with these characteristics include pMAM, pDR2, pBK-RSV, pBK- CMV, pOPRSV and pOP13.
  • a promoter necessary for expression in such cells e.g., SV40 promoter, MMLV-LTR promoter, EF l ⁇ promoter, CMV promoter, etc.
  • a marker gene for selecting transformants for example, a drug resistance gene selected by a drug (e.g.,
  • Nucleic acid molecules comprising a double-stranded region of the present invention can be expressed in animals such as avians by, for example, inserting an open reading frame(s) encoding the nucleic acid into an appropriate vector and introducing the vector by the retrovirus method, liposome method, cationic liposome method, adenovirus method, and so on.
  • the vectors used include, but are not limited to, adenoviral vectors (e.g., pAdexlcw) and retroviral vectors (e.g., pZIPneo).
  • General techniques for gene manipulation such as insertion of nucleic acids of the invention into a vector, can be performed according to conventional methods.
  • the present invention also provides a host cell into which an exogenous nucleic acid molecule, typically in a vector of the present invention, has been introduced.
  • the host cell of this invention can be used as, for example, a production system for producing or expressing the nucleic acid molecule.
  • eukaryotic cells or prokaryotic cells can be used.
  • Useful eukaryotic host cells may be animal, plant, or fungi cells.
  • animal cells mammalian cells such as CHO, COS, 3T3, myeloma, baby hamster kidney (BHK), HeLa, or Vero cells MDCK cells, DFl cells, amphibian cells such as Xenopus oocytes, or insect cells such as Sf9, Sf21, or Tn5 cells can be used.
  • CHO cells lacking DHFR gene (dhfr-CHO) or CHO K-I may also be used.
  • the vector can be introduced into the host cell by, for example, the calcium phosphate method, the DEAE-dextran method, cationic liposome DOTAP (Boehringer Mannheim) method, electroporation, lipofection, etc.
  • Useful prokaryotic cells include bacterial cells, such as E. coli, for example, JM109, DH5a, and HBlOl, or Bacillus subtilis.
  • Culture medium such as DMEM, MEM, RPMI- 1640, or IMDM may be used for animal cells.
  • the culture medium can be used with or without serum supplement such as fetal calf serum (FCS).
  • FCS fetal calf serum
  • the pH of the culture medium is preferably between about 6 and 8.
  • Cells are typically cultured at about 30 to 40° C for about 15 to 200 hr, and the culture medium may be replaced, aerated, or stirred if necessary.
  • compositions comprising a nucleic acid molecule comprising a double-stranded region that can be administered to an avian egg.
  • a composition comprising a nucleic acid molecule comprising a double-stranded region may contain a pharmaceutically acceptable carrier to render the composition suitable for administration.
  • Suitable pharmaceutical carriers, excipients and/or diluents include, but are not limited to, lactose, sucrose, starch powder, talc powder, cellulose esters of alkonoic acids, magnesium stearate, magnesium oxide, crystalline cellulose, methyl cellulose, carboxymethyl cellulose, gelatin, glycerin, sodium alginate, antibacterial agents, antifungal agents, gum arabic, acacia gum, sodium and calcium salts of phosphoric and sulfuric acids, polyvinylpyrrolidone and/or polyvinyl alcohol, saline, and water.
  • the carrier, excipient and/or diluent is phosphate buffered saline or water.
  • the composition may also comprise a transfection promoting agent.
  • Transfection promoting agents used to facilitate the uptake of nucleic acids into a living cell are well known within the art.
  • Reagents enhancing transfection include chemical families of the types; polycations, dendrimers, DEAE Dextran, block copolymers and cationic lipids.
  • the trans fection-promoting agent is a lipid- containing compound (or formulation), providing a positively charged hydrophilic region and a fatty acyl hydrophobic region enabling self-assembly in aqueous solution into vesicles generally known as micelles or liposomes, as well as lipopolyamines.
  • the composition comprises a polymeric biomaterial such as chitosan.
  • nucleic acid molecule comprising a double-stranded region is conveniently achieved by injection into the egg, and generally injection into the chorion allantoic fluid.
  • air sac is the preferred route of in ovo administration, other regions such as the yolk sac, air sac or amnionic cavity (amnion) may also be inoculated by injection.
  • the hatchability rate might decrease slightly when the air sac is not the target for the administration although not necessarily at commercially unacceptable levels.
  • the mechanism of injection is not critical to the practice of the present invention, although it is preferred that the needle does not cause undue damage to the egg or to the tissues and organs of the developing embryo or the extra-embryonic membranes surrounding the embryo.
  • the nucleic acid molecule is administered within four days of the egg having been laid.
  • hypodermic syringe fitted with an approximately 22 gauge needle is suitable.
  • the method of the present invention is particularly well adapted for use with an automated injection system, such as those described in US 4,903,635, US 5,056,464, US 5,136,979 and US 20060075973.
  • the nucleic acid molecule is administered in an effective amount sufficient to modify sex in at least some of the eggs which have been administered.
  • the modification can be detected by comparing a suitable number of samples subjected to the method of the invention to a similar number that have not. Statistically significant variation in the sex of the birds between the two groups will be indicative that an effective amount has been administered. Other means of determining an effective amount for sex are well within the capacity of those skilled in the art.
  • nucleic acid is administered to the egg.
  • nucleic acid to be administered is in a volume of about l ⁇ l to ImI, more preferably about lO ⁇ l to 500 ⁇ l.
  • the present inventors identified 51 predicted shRNA sequences to target chicken Dmrtl (Table 4).
  • the fourth criteria is based on a calculation for the free-energy of the 6 central bases of the shRNA sequence (bases 6-11 of the sense strand hybridised to bases 9-14 of the antisense strand).
  • shRNAs with a central duplex ⁇ G > -12.9 kcal/mol are preferred.
  • the shRNA designer website uses this algorithm to provide a score for each shRNA target. Based on the algorithm and their calculated ⁇ G value, the present inventors chose 4 of the shRNA target finder shRNA sequences as potentially effective shRNAs to test for their ability to knockdown Dmrtl gene expression. The selected sequences are shown in their 5' - 3' sequence in Table 5. These 4 sequences were used to construct ddRNAi plasmids for the expression of the 6 shRNAs.
  • oligonucleotides complementary to each other were designed to contain the sense, loop, antisense and termination signal, followed by a spacer sequence (GGAA) and a BamHI restriction site for screening.
  • the "bottom oligo (B)" or reverse oligonucleotide contained a Sail overhang at the 5' end for insertion into the expression vector containing the chicken polymerase III promoter cU6-4 (DQ531570).
  • Table 6 lists the shRNA targets to their corresponding oligonucleotides. The complementary oligonucleotides for each target shRNA, were annealed together and ligated into the Pmel-Sall digested pU6-4 vector.
  • Each ddRNAi plasmid was constructed so that the start of each shRNA sequence was at the +1 position of the native U6 snRNA transcripts.
  • All final shRNA expression vectors consisted of either one of the full length chicken U6 promoters, a shRNA sense sequence, a loop sequence, a shRNA antisense sequence, a termination sequence and a BamHI site.
  • the loop sequence used in all shRNAs was 5' UUCAAGAGA 3'.
  • a reporter gene expression assay was used to test shRNAs for silencing of Dmrtl.
  • the reporter gene was a transcriptional gene fusion of Dmrtl inserted downstream of the 3' end of the Enhanced Green Fluorescent Protein (EGFP) gene in pEGFP-C (Clontech).
  • the reporter plasmid was constructed as follows: cDNA of Dmrtl was reverse transcribed from total RNA isolated from 4 day old embryo's and cloned into the multiple cloning site of pCMV-Script (Stratagene). The Dmrtl insert was removed from the cloning vector as a Notl - EcoRI fragment and cloned downstream of the EGFP gene in pEGFP-C (Clontech).
  • the resulting plasmid was named pEGFP-Dmrtl. This plasmid was transfected into chicken DF-I cells and expression of the transcriptional gene fusion was confirmed by measuring EGFP fluorescence using flow cytometry as described below.
  • Dmrtl gene silencing assays were conducted by co-transfecting DF-I cells with the pEGFP-Dmrtl reporter plasmid and each of the ddRNAi plasmids expressing the Dmrtl specific and control shRNAs.
  • DF-I cells ATCC CRL-12203, chicken fibroblast
  • DMEM Dulbecco's Modified Eagle's Medium
  • FCS 10% foetal calf serum
  • EDTA trypsin-ethylenediaminetetraacetic acid
  • PBSA + 1% FCS cold phosphate buffered saline-A
  • Flow cytometry sampling was performed using a FACScalibur (Becton Dickinson) fluorescence activated cell sorter. Data acquisition and calculation of mean fluorescence intensity (MFI) values for triplicate co-transfection samples, was performed using CELLQuest software (Becton Dickinson).
  • siRNA targeted to a conserved exon of the chicken DMRTl gene was designed using the Ambion siRNA Target Finder tool (www.ainbion.com).
  • the chosen siRNA was designated DAfl.TV-343-siRNA (5'-GAGCCAGUUGUCAAGAAGAUU- 3') (SEQ ID NO:3431).
  • the siRNA was synthesized and obtained from Qiagen.
  • the siRNA was formulated with lipoefectamine 2000 (Invitrogen) according to the manufacturer's instructions. The now complexed siRNA was then delivered in ovo at a dose of either 100 pmol or 200 pmol.
  • the siRNA was injected into embryonated eggs via an intravenous (LV.) route or directly into the amnion at embryonic day 4.5 (E4.5). For both LV.
  • a small opening (lcm x lcm) was created at the top of the blunt end of the egg so as to avoid the membrane, veins and arteries, and 100 pmol or 200 pmol in a 4 ⁇ l volume was then injected directly into a vein or into the amnionic cavity using a micro-capillary pipette.
  • Micro-capillaries of 1 mm diameter were used for injections, and their tips were pulled to a diameter of 40 microns with bevelled tip of 22.5°. After injection, the holes in the eggs were sealed with appropriate sized parafilm squares using a heated scalpel blade.
  • Group 2 51 eggs were injected LV. with 100 pmol of siRNA;
  • Group 3 53 eggs were injected LV. with 200 pmol of siRNA;
  • Group 4 81 eggs were injected into the amnion with 100 pmol of siRNA and;
  • Group 5 53 eggs were injected into the amnion with 200 pmol of siRNA.
  • Control Group 1 had an embryo viability of 100%; Group 2 had a viability of 76%; Group 3 had a viability of 94%; Group 4 had a viability of 40% and; Group 5 had a viability of 75%.
  • a single limb bud from each embryo was removed and used in a sex determination PCR test to determine if the embryos were of male or female genotype.
  • Lower limb buds from each embryo were collected into 50 ⁇ l of PCR digestion buffer (50 mM KCl; 10 mM Tris-HCl, pH8.3; 0.1 mg/ml gelatine; 0.45% Nonidet P-40; 0.45% Tween-20; 0.2 mg/ml proteinase K; stock stored at -20 0 C) at room temperature and digested at 55°C for a minimum of 1 h, then at 95°C for 10 min to release genomic DNA.
  • PCR digestion buffer 50 mM KCl; 10 mM Tris-HCl, pH8.3; 0.1 mg/ml gelatine; 0.45% Nonidet P-40; 0.45% Tween-20; 0.2 mg/ml proteinase K; stock stored at -20 0 C
  • Sexing was carried out by PCR using the method of Clinton et al. (2001).
  • the PCR mix consisted of 1 ⁇ l of digestion mix, 10 X RedTaq reaction buffer (Sigma- Aldrich), MgCl 2 to 1.5 mM (Promega), 1 unit of RedTaq DNA polymerase (Sigma- Aldrich) and Milli-Q water (Millipore) to a total volume of 20 ⁇ l. Reactions were carried out in a Master cycler S (Eppendorf) PCR machine. Products were run on a 1.5% 1 X Tris-borate (TBE) agarose gels.
  • TBE 1.5% 1 X Tris-borate
  • the embryos were definitively labelled as either being genotypically male or female.
  • the embryos were then opened via dissection and the gonads exposed for macroscopic analysis of gonadal development.
  • the gonadal development of all control embryos was normal as expected.
  • Control female embryo's showed typical asymmetric development that was characterised by a large left ovary and smaller regressing right gonad.
  • Control male embryos all had typical bilateral testes.
  • All female embryos from the siRNA knockdown groups (Groups 2-5) had normal gonadal development. In contrast, some male embryos from the siRNA knockdown groups showed varying degrees of female- like asymmetry at the macroscopic level of the gonads.
  • the feminisation effect of the DMR77-343-siRNA was characterised by an average or small-sized right testis and a larger feminised left gonad (Table 7). Feminisation was observed in a number of male embryos in Groups 2, 3 and 5 and resulted in an increase in the ratio of embryos with female-like gonads in these groups. Table 7. DMRTl embr o in ection results.
  • Gonads from both male and female embryos in each treatment groups were assessed for DMRTl gene expression using quantitative RT-PCR analysis. Both the female and male gonads were pooled separately from each group and RNA was extracted for cDNA synthesis and qPCR analysis. The pooled gonads were added to 1 ml of Trizol and homogenised well by pipetting and vortexing at room temperature until all gonad tissue had dissolved. 200 ⁇ l of chloroform was added and mixed well by inverting the sample for 15 sec. The sample was then incubated at room temperature for 3 min and then centrifuged at 12000 g for 15 min at 4°C.
  • the aqueous phase of the sample was then transferred to a new tube and then 500 1 of isopropanol was added and mixed well by inversion. The mix was then incubated at room temperature for 10 min and then centrifuged at 12000 g for 10 min at 4°C. The supernatant was removed from the tube carefully, so as not to disturb the RNA pellet, and the pellet was then washed with 1 ml of 70% ethanol. The tube was then centrifuged at 7500 g for 5 min at 4°C and the supernatant again was carefully removed and the RNA pellet was air dried at room temperature for 10 min.
  • RNA pellet was then resuspended in 25 ⁇ l of RNase-free water and the final concentration of RNA was determined using a NanoDrop ND- 1000 Spectrophotometer (Thermo Scientific).
  • RNA was reverse transcribed to complimentary DNA (cDNA) using the Promega Reverse Transcription kit (Promega).
  • the reaction mix contained 1 ⁇ g of RNA, random hexamers (1 ⁇ l), dNTPs (2 ⁇ l), AMV reverse transcriptase (Promega) (0.5 ⁇ l) and nuclease free water added to a total reaction volume of 20 ⁇ l. The mix was incubated at 42°C for 1 hour, followed by a 10 min incubation at 95°C for enzyme inactivation.
  • cDNA was then used to quantify relative DMRTl gene expression levels in the pooled male and female gonad samples from each treatment group.
  • qPCR primers and probes were designed using Primer Express (Applied Biosystems) software and sequences are shown in Table 8.
  • PCR' s were set up in 20 ⁇ l reaction volumes that contained 2 X TaqMan qRT PCR mastermix (Applied Biosystems), 1 ⁇ l of primer/probe mix, 1 ⁇ l of cDNA sample and made up to final volume with Nuclease free water (Promega). PCR cycling was performed at 95°C for 1 min, followed by 40 cycles of 95°C for 15 sec; 61°C for 30 sec and; 68°C for 30 sec.
  • Ct values were obtained at a standard threshold value of 0.2 for all reactions. This threshold value corresponded to the midway point of the logarithmic phase of all amplification plots. Ct values were exported to Microsoft Excel for analysing relative gene expression using the comparative Ct method.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Environmental Sciences (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Toxicology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/AU2009/001627 2008-12-17 2009-12-16 Methods of modulating the sex of avians Ceased WO2010068978A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
JP2011541021A JP2012511915A (ja) 2008-12-17 2009-12-16 鳥類の性別の調節方法
RU2011129621/10A RU2011129621A (ru) 2008-12-17 2009-12-16 Способы модуляции пола птиц
MX2011006577A MX2011006577A (es) 2008-12-17 2009-12-16 Metodos para modular el sexo de aviarios.
US13/139,163 US20120227119A1 (en) 2008-12-17 2009-12-16 Methods of Modulating the Sex of Avians
CN200980154743.1A CN102356158B (zh) 2008-12-17 2009-12-16 调节禽类性别的方法
EP09832707A EP2376641A4 (en) 2008-12-17 2009-12-16 PROCEDURE FOR SEX MODULATION IN POULTRY
CA2747120A CA2747120A1 (en) 2008-12-17 2009-12-16 Methods of modulating the sex of avians
BRPI0923005-0A BRPI0923005A2 (pt) 2008-12-17 2009-12-16 Metodos para modulacao dos exo de aves
AU2009328633A AU2009328633B2 (en) 2008-12-17 2009-12-16 Methods of modulating the sex of avians

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US13823508P 2008-12-17 2008-12-17
US61/138,235 2008-12-17

Publications (1)

Publication Number Publication Date
WO2010068978A1 true WO2010068978A1 (en) 2010-06-24

Family

ID=42268167

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2009/001627 Ceased WO2010068978A1 (en) 2008-12-17 2009-12-16 Methods of modulating the sex of avians

Country Status (10)

Country Link
US (1) US20120227119A1 (https=)
EP (1) EP2376641A4 (https=)
JP (1) JP2012511915A (https=)
CN (1) CN102356158B (https=)
AU (1) AU2009328633B2 (https=)
BR (1) BRPI0923005A2 (https=)
CA (1) CA2747120A1 (https=)
MX (1) MX2011006577A (https=)
RU (1) RU2011129621A (https=)
WO (1) WO2010068978A1 (https=)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2167645A4 (en) * 2007-06-13 2012-04-18 Commw Scient Ind Res Org MODULATION OF PRODUCTION CHARACTERS IN AVIATORS
US11492620B2 (en) 2017-12-01 2022-11-08 Suzhou Ribo Life Science Co., Ltd. Double-stranded oligonucleotide, composition and conjugate comprising double-stranded oligonucleotide, preparation method thereof and use thereof
US11633482B2 (en) 2017-12-29 2023-04-25 Suzhou Ribo Life Science Co., Ltd. Conjugates and preparation and use thereof
US11660347B2 (en) 2017-12-01 2023-05-30 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing same, preparation method, and use thereof
US11896674B2 (en) 2018-09-30 2024-02-13 Suzhou Ribo Life Science Co., Ltd. SiRNA conjugate, preparation method therefor and use thereof
US11918600B2 (en) 2018-08-21 2024-03-05 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition and conjugate containing nucleic acid, and use thereof
US12084661B2 (en) 2017-12-01 2024-09-10 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, and preparation method and use thereof
US12083142B2 (en) 2017-12-01 2024-09-10 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, and preparation method and use thereof
US12428642B2 (en) 2017-12-01 2025-09-30 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, preparation method and use thereof
US12490723B2 (en) 2017-05-31 2025-12-09 Commonwealth Scientific And Industrial Research Organisation Transgenic chicken that expresses a fluorescent protein and SIAT1
US12497622B2 (en) 2019-05-22 2025-12-16 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use
US12496347B2 (en) 2018-12-28 2025-12-16 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing nucleic acid, preparation method therefor and use thereof
US12540323B2 (en) 2019-05-22 2026-02-03 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use
US12565664B2 (en) 2019-03-05 2026-03-03 The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (Aro) (Volcani Center) Genome-edited birds
US12577565B2 (en) 2019-05-24 2026-03-17 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use
US12590304B2 (en) 2019-05-22 2026-03-31 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108474034A (zh) * 2015-12-03 2018-08-31 艾吉伊特有限公司 对未孵化卵中的禽类胚胎进行性别确定的方法及其用具
WO2018013759A1 (en) * 2016-07-13 2018-01-18 Yorktown Technologies, L.P. Poultry and offspring sex selection
CN107236814B (zh) * 2017-07-14 2020-02-28 集美大学 一种鉴别大黄鱼遗传性别的分子标记及其应用
WO2019058376A1 (en) * 2017-09-19 2019-03-28 The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (Aro) (Volcani Center) BIRDS WITH GENOME EDITION
CN108384845A (zh) * 2018-04-28 2018-08-10 武汉市农业科学院 鸭性别鉴定用rt-pcr引物、试剂盒及鉴定方法
CN110484635B (zh) * 2019-09-06 2020-06-09 南京市红山森林动物园管理处 一种双垂鹤鸵性别分子鉴定方法及引物

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008151364A1 (en) * 2007-06-13 2008-12-18 Commonwealth Scientific And Industrial Research Organisation Modulating production traits in avians

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1612930A (zh) * 2001-11-21 2005-05-04 三菱化学株式会社 抑制基因表达的方法
EP2305812A3 (en) * 2002-11-14 2012-06-06 Dharmacon, Inc. Fuctional and hyperfunctional sirna
KR100740153B1 (ko) * 2004-11-24 2007-07-16 (주)아비코아생명공학연구소 정소-특이 뉴클레오타이드 서열

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008151364A1 (en) * 2007-06-13 2008-12-18 Commonwealth Scientific And Industrial Research Organisation Modulating production traits in avians

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GRAVES, J.A.M: "Birds do it with a Nature gene", NATURE., vol. 461, no. 7261, 2009, pages 177 - 178 *
SMITH, C.A. ET AL.: "Sex determination: insights from the chicken.", BIOESSAYS., vol. 26, no. 2, 2004, pages 120 - 132 *
SMITH, C.A. ET AL.: "The avian Z-linked gene DMRT1 is required for male sex determination in the chicken", NATURE., vol. 461, no. 7261, 2009, pages 267 - 271, XP055020867 *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2167645A4 (en) * 2007-06-13 2012-04-18 Commw Scient Ind Res Org MODULATION OF PRODUCTION CHARACTERS IN AVIATORS
US12490723B2 (en) 2017-05-31 2025-12-09 Commonwealth Scientific And Industrial Research Organisation Transgenic chicken that expresses a fluorescent protein and SIAT1
US11492620B2 (en) 2017-12-01 2022-11-08 Suzhou Ribo Life Science Co., Ltd. Double-stranded oligonucleotide, composition and conjugate comprising double-stranded oligonucleotide, preparation method thereof and use thereof
US11660347B2 (en) 2017-12-01 2023-05-30 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing same, preparation method, and use thereof
US12084661B2 (en) 2017-12-01 2024-09-10 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, and preparation method and use thereof
US12083142B2 (en) 2017-12-01 2024-09-10 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, and preparation method and use thereof
US12274752B2 (en) 2017-12-01 2025-04-15 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing same, preparation method, and use thereof
US12428642B2 (en) 2017-12-01 2025-09-30 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, preparation method and use thereof
US11633482B2 (en) 2017-12-29 2023-04-25 Suzhou Ribo Life Science Co., Ltd. Conjugates and preparation and use thereof
US11918600B2 (en) 2018-08-21 2024-03-05 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition and conjugate containing nucleic acid, and use thereof
US11896674B2 (en) 2018-09-30 2024-02-13 Suzhou Ribo Life Science Co., Ltd. SiRNA conjugate, preparation method therefor and use thereof
US12496347B2 (en) 2018-12-28 2025-12-16 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing nucleic acid, preparation method therefor and use thereof
US12565664B2 (en) 2019-03-05 2026-03-03 The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (Aro) (Volcani Center) Genome-edited birds
US12497622B2 (en) 2019-05-22 2025-12-16 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use
US12540323B2 (en) 2019-05-22 2026-02-03 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use
US12590304B2 (en) 2019-05-22 2026-03-31 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use
US12577565B2 (en) 2019-05-24 2026-03-17 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use

Also Published As

Publication number Publication date
JP2012511915A (ja) 2012-05-31
AU2009328633A1 (en) 2011-07-28
EP2376641A1 (en) 2011-10-19
US20120227119A1 (en) 2012-09-06
RU2011129621A (ru) 2013-01-27
CA2747120A1 (en) 2010-06-24
AU2009328633B2 (en) 2013-03-28
EP2376641A4 (en) 2013-01-09
BRPI0923005A2 (pt) 2015-08-04
CN102356158B (zh) 2014-04-02
MX2011006577A (es) 2011-07-12
CN102356158A (zh) 2012-02-15

Similar Documents

Publication Publication Date Title
AU2009328633B2 (en) Methods of modulating the sex of avians
AU2008261604B2 (en) Modulating production traits in avians
KR101485071B1 (ko) 마이크로 rna를 이용한 근육 세포 증식 및 분화 조절방법과 근육 세포 치료방법 및 유전자 발현 억제방법그리고 마이크로 rna 분자의 발현용 벡터와 이를 이용한키트 및 미오사이트
AU2008250973B2 (en) Treatment and prevention of influenza
KR20060029597A (ko) Rna 간섭에 기반한 hbv 유전자 발현의 억제 방법 및조성물
Liu et al. Efficient RNA interference in zebrafish embryos using siRNA synthesized with SP6 RNA polymerase
US20190233819A1 (en) A method of releasing the suppression of egg maturation in economically-important prawn/shrimp species
Zhao et al. Schistosoma japonicum: inhibition of Mago nashi gene expression by shRNA-mediated RNA interference
Su et al. The cytomegalovirus promoter-driven short hairpin RNA constructs mediate effective RNA interference in zebrafish in vivo
US20140289881A1 (en) Double-stranded rna
AU2012204092B2 (en) Modulating production traits in avians
AU2013202277A1 (en) Methods of modulating the sex of avians
WO2014153590A1 (en) Rna interference in amoebas
AU2013200109A1 (en) Treatment and prevention of influenza
JP5263729B2 (ja) ネコ伝染性腹膜炎ウイルス(fipv)の予防及び治療剤
Chen et al. Chicken 7SK promoter drives efficient shRNA transcription with species specificity
HK1178572A (en) Treatment and prevention of influenza
Piatek The biological role of naturalantisense transcripts in zebrafishdevelopment

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200980154743.1

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09832707

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2747120

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2011541021

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: MX/A/2011/006577

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2009328633

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 5003/CHENP/2011

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2009832707

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011129621

Country of ref document: RU

ENP Entry into the national phase

Ref document number: 2009328633

Country of ref document: AU

Date of ref document: 20091216

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 13139163

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0923005

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20110617