WO2014153590A1

WO2014153590A1 - Rna interference in amoebas

Info

Publication number: WO2014153590A1
Application number: PCT/AU2013/001302
Authority: WO
Inventors: Mathew Thomas COOK; Paula Cristina Walger de Camargo LIMA; Natasha Angela BOTWRIGHT
Original assignee: Commonwealth Scientific And Industrial Research Organisation
Priority date: 2013-03-25
Filing date: 2013-11-12
Publication date: 2014-10-02

Abstract

The invention relates to nucleic acid molecules comprising a double-stranded region complementary to a target gene in Neoparamoeba species and methods of reducing the expression of the target genes. The invention further relates to methods of treating and preventing amoebic gill disease in fish.

Description

RNA INTERFERENCE IN AMOEBAS

FIELD OF THE INVENTION

BACKGROUND OF THE INVENTION

Amoebic gill disease (AGD), caused by the amphizoic amoebae Neoparamoeba perurans, is a parasite-mediated proliferative gill disease capable of affecting several cultured teleost fish species. Atlantic salmon appears the salmonid species most susceptible to AGD. Outbreaks of the disease in this species have been reported from Australia, Ireland, France, Chile, Spain, United States, New Zealand, Scotland and Norway.

AGD is considered the major health concern affecting marine Atlantic salmon aquaculture in many locations, including Tasmania, Australia. At the moment, bathing the fish in freshwater is the only commercially effective treatment available. However, since this practice was first introduced in the late 1980s, the bathing frequency throughout the marine production cycle has tripled in order to successfully avoid AGD progression during the same period. Therefore, due to the high costs associated with treatment and lost productivity, as well as limited freshwater resources in some locations, bathing is not considered a viable long-term management solution against AGD. As a result, the development of improved therapeutical strategies for coping with this disease is imperative for the continued sustainability of the Atlantic salmon aquaculture industry.

Accordingly, there remains a need for new methods of controlling diseases caused by amoebic pathogens.

SUMMARY OF THE INVENTION

The present inventors have now demonstrated that RNA interference can be induced in amoeba by the administration of double-stranded RNA molecules. In particular, the present inventors have demonstrated that amoeba belonging to the Neoparamoeba genus have functional RNAi machinery and that nucleic acid molecules comprising double-stranded regions can be used to modulate the expression of target genes. Accordingly, the present invention provides an isolated and/or exogenous nucleic acid molecule comprising a double-stranded region, wherein the double- stranded region comprises a sequence of nucleotides complementary to a target polynucleotide in a Neoparamoeba species.

In one embodiment, the double-stranded region reduces the expression of a polypeptide in a Neoparamoeba species cell when compared to an isogenic Neoparamoeba species cell lacking the isolated and/or exogenous nucleic acid molecule.

In another embodiment, the Neoparamoeba species is Neoparamoeba perurans. In yet another embodiment, the Neoparamoeba species is Neoparamoeba pemaquidensis .

In one embodiment, the isolated and/or exogenous nucleic acid molecule may comprise a double stranded region at least 19 basepairs in length.

In another embodiment, the double-stranded region is less than 100 basepairs in length.

In some instances it may be desirable that the isolated and/or exogenous nucleic acid molecule comprises more than one double-stranded region, for example 2, 3, 4, 5 or more double-stranded regions. Thus, in one embodiment, the isolated and/or exogenous nucleic acid molecule of the invention comprises two or more double- stranded regions.

In another embodiment, each of the double-stranded regions comprises a sequence of nucleotides complementary to a different target polynucleotide in a Neoparamoeba species.

In yet another embodiment, the isolated and/or exogenous nucleic acid molecule comprises double-stranded RNA.

In another embodiment, the isolated and/or exogenous nucleic acid molecule is selected from an siRNA, shRNA, eshRNA, miRNA and long dsRNA.

In one embodiment, the isolated and/or exogenous nucleic acid molecule comprises at least one modified nucleotide. In one particular embodiment, the isolated and/or exogenous nucleic acid molecule is a 2'-modified oligonucleotide.

In another embodiment, the isolated and/or exogenous nucleic acid molecule comprises a sequence of nucleotides at least 19 base pairs in length complementary to nucleotides within SEQ ID NO: 11 and/or SEQ ID NO: 12.

The present invention further provides a nucleic acid construct comprising a nucleotide sequence encoding the isolated and/or exogenous nucleic acid molecule of the invention. In one embodiment, the nucleotide sequence encodes two or more isolated and/or exogenous nucleic acid molecules of the invention.

In yet another embodiment, the nucleotide sequence comprises one or more promoters.

In one embodiment, the construct comprises an RNA polymerase II and/or RNA polymerase III promoter.

In one particular embodiment, each isolated and/or exogenous nucleic acid molecule encoded by the nucleic acid construct is operably linked to a different RNA polymerase III promoter.

The present invention further provides a vector comprising the isolated and/or exogenous nucleic acid molecule of the invention and/or the nucleic acid construct of the invention.

The present invention further provides a cell comprising the isolated and/or exogenous nucleic acid molecule of the invention, the nucleic acid construct of the invention, and/or the vector of the invention.

In one embodiment, the cell is a Neoparamoeba species cell. In one particular embodiment, the Neoparamoeba species is selected from Neoparamoeba perurans and Neoparamoeba pemaquidensis .

The present invention further provides a composition comprising the isolated and/or exogenous nucleic acid molecule of the invention, the nucleic acid construct of the invention, the vector of the invention, and/or the cell of the invention.

In one embodiment, the composition is a veterinary pharmaceutical composition.

In another embodiment, the composition is a feed composition. In one particular embodiment, the composition is a fish feed.

In yet another embodiment, the composition comprises a cell transfection reagent.

The present invention further provides a transgenic non-human organism comprising the isolated and/or exogenous nucleic acid molecule of the invention, the nucleic acid construct of the invention, the vector of the invention, the cell of the invention and/or the composition of the invention.

In one embodiment, the transgenic non-human organism is a Neoparamoeba species. In one particular embodiment, the Neoparamoeba species is selected from Neoparamoeba perurans and Neoparamoeba pemaquidensis.

In another embodiment, the transgenic non-human organism is a fish. In one particular embodiment, the fish is a salmonid. For example, the salmonid may be a salmon or trout.

In yet another embodiment, the transgenic non-human organism is a plant.

The present invention further provides a method of inhibiting the expression of a target polynucleotide in a Neoparamoeba cell, the method comprising synthesizing the isolated and/or exogenous nucleic acid construct of the invention in the cell.

The present invention further provides a method of inhibiting the expression of a target polynucleotide in a Neoparamoeba cell, the method comprising introducing into the cell the isolated and/or exogenous nucleic acid molecule of the invention, the nucleic acid construct of the invention, the vector of the invention and/or the composition of the invention.

The present invention further provides a method for determining the function of a target gene in a Neoparamoeba cell, the method comprising contacting the cell with and/or introducing into the cell the isolated and/or exogenous nucleic acid molecule of the invention, the nucleic acid construct of the invention, the vector of the invention and/or the composition of the invention.

The present invention further provides a method of treating or preventing amoebic gill disease in a fish, the method comprising administering to the fish the isolated and/or exogenous nucleic acid molecule of the invention, the nucleic acid construct of the invention, the vector of the invention, the composition of the invention, and/or the transgenic non-human organism of the invention.

In one embodiment, the method of treating or preventing amoebic gill disease in a fish comprises feeding the fish a composition comprising the isolated and/or exogenous nucleic acid molecule of the invention, the nucleic acid construct of the invention, the vector of the invention, the composition of the invention, and/or the transgenic non-human organism of the invention.

In another embodiment, the method comprises bathing the fish in a composition comprising the isolated and/or exogenous nucleic acid molecule of the invention, the nucleic acid construct of the invention, the vector of the invention and/or the composition of the invention.

As will be apparent, preferred features and characteristics of one aspect of the invention are applicable to many other aspects of the invention.

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps. Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.

The invention is hereinafter described by way of the following non-limiting Examples and with reference to the accompanying Figures.

BRIEF DESCRIPTION OF THE FIGURES

Figure

Figure 2. Silencing of N. pemaquidensis β-actin gene expression by bacterially expressed dsRNA. A

and

\ :- i^ n . The PCR products were visualized on 1.5% agarose gel and the relative β-actin mRNA expression levels quantified by comparing the band intensity of samples treated with Λ^-β-actin-dsRNA (lane B) against the controls Λ^-EF la-dsRNA (lane E) and luc-dsRNA (lane L)

and The PCR products were visualized on 1.5% agarose gel and the relative EFIa mRNA expression levels quantified by comparing the band intensity of samples treated with Np- EFIa -dsRNA (lane E) against the controls Np- -dsRNA (lane B) and luc-dsRNA (lane L)

Figure 4.

Agarose gel electrophoresis of dsRNA purified from the /·,^'. coli I ΙΊΊ 1 (1)1· ). Following ΤΜΖθϋ'

The relative mRNA expression levels were quantified by comparing the band intensity of samples treated with dsRNA targeting the candidate genes against the internal and external controls

> Validation of bacterially expressed dsRNA ingestion by fluorescent microscopy, (a) E. coli HT115(DE3) cell successfully stained by propidium iodide under 100 x oil immersion objective (scale bar, 10 μπι). Phase contrast (b) and fluorescent (c) image of the same trophozoite following two hours incubation with stained bacteria, under standard culture conditions (40 ^χ objective, scale bar, 20 μπι). Fluorescent food vacuole and rod-shape bacteria can be clearly noticed within the trophozoite, confirming the E. coli HT115 uptake by the amoeba.

Figure 10. Degradation of RNA duplexes. The ability of N. perurans Dicer to cleave long dsRNA was validated by incubating in vitro transcribed dsRNA in the presence of amoeba lysate. A = 2 μg dsRNA; B = 2 μg dsRNA + RNAse III; C = 2 μg dsRNA + 5 μg amoebae lysate; D = 2 μg dsRNA + 2.5 μg amoebae lysate; E = 2 μg dsRNA + 1.25 amoebae lysate; F = 2 μg dsRNA + 0.6 μg amoebae lysate; G = 2 μg dsRNA + 0.3 μg ameobae lysate; H = 2 μg dsRNA and no amoebae lysate; I = 2 μg dsRNA + 10x EDTA before dsRNA incubation.

KEY TO THE SEQUENCE LISTING

SEQ ID NO: l - dsRNA β-actin 5' oligonucleotide primer sequence.

SEQ ID NO:2 - dsRNA β-actin 3' oligonucleotide primer sequence.

SEQ ID NO:3 - qRT-PCR β-actin 5' oligonucleotide primer sequence.

SEQ ID NO:4 - qRT-PCR β -actin 3' oligonucleotide primer sequence.

SEQ ID NO:5 - dsRNA EFla 5' oligonucleotide primer sequence.

SEQ ID NO: 6 - dsRNA EFla 3' oligonucleotide primer sequence.

SEQ ID NO: 7 - qRT-PCR EFla 5' oligonucleotide primer sequence.

SEQ ID NO: 8 - qRT-PCR EFla 3' oligonucleotide primer sequence.

SEQ ID NO:9 - dsRNA luciferase 5' oligonucleotide primer sequence.

SEQ ID NO: 10 - dsRNA luciferase 3' oligonucleotide primer sequence.

SEQ ID NO: 11— β -actin coding sequence.

SEQ ID NO: 12 - Elongation factor 1-a coding sequence. DETAILED DESCRIPTION OF THE INVENTION

General Techniques and Selected Definitions

Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, RNAi, aquaculture, protein chemistry, and biochemistry).

Unless otherwise indicated, the molecular biology, cell culture, and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3^rd ed., Cold Spring Harbour Laboratory Press (2001), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al., (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley- Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al., (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).

As used herein the terms "treating", "treat" or "treatment" include administering a therapeutically effective amount of a nucleic acid construct, vector, cell and/or nucleic acid molecule of the invention sufficient to reduce or eliminate at least one symptom of amoebic gill disease in a fish.

The term "preventing" refers to protecting a subject that is exposed to a

Neoparamoeba species from developing at least one symptom of infection, or reducing the severity of a symptom of infection in a subject exposed to the Neoparamoeba species.

By "reduces the expression of or "reducing the expression of a polypeptide, polynucleotide or gene is meant that the translation of a polypeptide sequence and/or transcription of a polynucleotide sequence in a cell is down-regulated or inhibited. The degree of down-regulation or inhibition will vary with the nature and quantity of the nucleic acid construct or nucleic acid molecule provided to the host cell, the identity, nature, and level of RNA molecule(s) expressed from the construct, the time after administration, etc., but will be evident e.g., as a detectable decrease in target gene protein expression and/or related target or cellular function, or e.g., decrease in level of viral replication, etc.; desirably a degree of inhibition greater than 10%, 33%, 50%, 75%), 90%), 95% or 99% as compared to a cell not treated according to the present invention will be achieved.

As used herein, the term "introducing" as it relates to a nucleic acid construct or nucleic acid molecule is to be taken in the broadest possible sense and include any method resulting in the nucleic acid construct or nucleic acid molecule being present in a cell or organism. For example, the nucleic acid construct or nucleic acid molecule may be delivered to a cell as naked RNA or DNA via any suitable transfection or transformation technique such as, for example, electroporation. Alternatively, the nucleic acid construct or nucleic acid molecule may be inserted into the genome and/or be expressed by a transgene in a cell.

As used herein, "isogenic" refers to organisms or cells that are characterised by essentially identical genomic DNA, for example the genomic DNA is at least about 92%), preferably at least about 98%>, and most preferably at least about 99%, identical to the genomic DNA of an isogenic organism or cell.

RNA Interference

The terms "RNA interference", "RNAi" or "gene silencing" are well known in the art and refer generally to a process in which a double-stranded RNA molecule reduces the expression of a nucleic acid sequence with which the double-stranded RNA molecule shares substantial or total homology. However, it has been shown that RNA interference can be achieved using non-RNA double stranded molecules such as chemically modified short interfering nucleic acid (siNA; see, for example, US 20070004667).

The present invention includes nucleic acid molecules comprising and/or encoding double-stranded regions for RNA interference. The nucleic acid molecules are typically RNA but may comprise chemically-modified nucleotides and non- nucleotides.

The double-stranded regions should be at least 19 contiguous nucleotides, for example about 19 to 23 nucleotides, or may be longer, for example 30 or 50 nucleotides, or 100 nucleotides or more. The full-length sequence corresponding to the entire gene transcript may be used.

The degree of identity of a double-stranded region of a nucleic acid molecule to the targeted transcript should be at least 90% and more preferably 95-100%). The nucleic acid molecule may of course comprise unrelated sequences which may function to stabilize the molecule. The nucleic acid molecules of the present invention may be siRNA, shRNA, miRNA, short interfering nucleic acid (siNA), short interfering modified oligonucleotide, chemically-modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), long double-stranded RNA and others.

The term "short interfering RNA" or "siRNA" as used herein refers to a nucleic acid molecule which comprises ribonucleotides capable of inhibiting or down regulating gene expression, for example by mediating RNAi in a sequence-specific manner, wherein the double stranded portion is less than 50 nucleotides in length, preferably about 19 to about 23 nucleotides in length. For example the siRNA can be a nucleic acid molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The siRNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary.

By "shRNA" or "short-hairpin RNA" is meant an RNA molecule where less than about 50 nucleotides, preferably about 19 to about 23 nucleotides, is base paired with a complementary sequence located on the same RNA molecule, and where said sequence and complementary sequence are separated by an unpaired region of at least about 4 to about 15 nucleotides which forms a single-stranded loop above the stem structure created by the two regions of base complementarity. An example of a sequence of a single-stranded loop includes: 5' UUCAAGAGA 3 '. In one embodiment, the nucleic acid molecule is an extended shRNA ("eshRNA") that can be processed by the RNAi machinery into multiple siRNA duplexes (Liu et al., (2007)). An eshRNA construct typically comprises a single promoter, two or three sequences encoding siRNA sequences targeting a gene of interest and a loop sequence.

Included shRNAs are dual or bi-finger and multi-finger hairpin dsRNAs, in which the RNA molecule comprises two or more of such stem-loop structures separated by single-stranded spacer regions.

MicroRNAs (miRNAs) are small single-stranded non-coding RNAs that play critical roles in the regulation of biological processes. MicroRNAs are initially transcribed as a long, single-stranded miRNA precursor known as a primary-miRNA (pri-miRNA), which may contain one or several miRNAs. These pri-miRNAs typically contain regions of localized stem-loop hairpin structures that contain the mature miRNA sequences. Pri-miRNAs are processed into 70-100 nucleotide pre-miRNAs in the nucleus by the double-stranded RNA-specific nuclease Drosha. These 70-100 nucleotide pre-miRNAs are transported to the cytoplasm, where they are processed by the enzyme Dicer into single-stranded mature miRNAs of about 19-25 nucleotides. As known in the art, naturally-occurring or synthetic miRNAs may be modified to comprise a sequence of nucleotides complementary to one or more target gene sequences of interest.

Once designed, the nucleic acid molecules comprising a double-stranded region can be generated by any method known in the art, for example, by in vitro transcription, recombinantly, or by synthetic means.

Modifications or analogs of nucleotides can be introduced to improve the properties of the nucleic acid molecules of the invention. Improved properties include increased nuclease resistance and/or increased ability to permeate cell membranes. Accordingly, the terms "nucleic acid molecule" and "double-stranded RNA molecule" includes synthetically modified bases such as, but not limited to, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl-, 2-propyl- and other alkyl- adenines, 5-halo uracil, 5-halo cytosine, 6-aza cytosine and 6-aza thymine, pseudo uracil, 4-thiuracil, 8- halo adenine, 8-aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl adenine and other 8-substituted adenines, 8-halo guanines, 8-amino guanine, 8-thiol guanine, 8-thioalkyl guanines, 8-hydroxyl guanine and other substituted guanines, other aza and deaza adenines, other aza and deaza guanines, 5-trifluoromethyl uracil and 5- trifluoro cytosine.

Nucleic Acid Molecules

By "isolated nucleic acid molecule" we mean a nucleic acid molecule which has generally been separated from the nucleotide sequences with which it is associated or linked in its native state (if it exists in nature at all). Preferably, the isolated nucleic acid molecule is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated. Furthermore, the term "nucleic acid molecule" is used interchangeably herein with the term "polynucleotide".

The term "exogenous" in the context of a nucleic acid refers to the nucleic acid (including a nucleic acid construct of the invention) when present in a cell, or in a cell- free expression system, in an altered amount compared to its native state. In a particularly preferred embodiment, the cell is a cell that does not naturally comprise the nucleic acid or nucleic acid construct. The terms "nucleic acid molecule" or "polynucleotide" refer to an oligonucleotide, polynucleotide or any fragment thereof. It may be DNA or RNA of genomic or synthetic origin, and combined with carbohydrate, lipids, protein, or other materials to perform a particular activity defined herein.

The % identity of a nucleic acid molecule is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is at least 19 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 19 nucleotides. Alternatively, the query sequence is at least 150 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 150 nucleotides. Alternatively, the query sequence is at least 300 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 300 nucleotides. Preferably, the two sequences are aligned over their entire length.

With regard to the defined nucleic acid molecules, it will be appreciated that % identity figures higher than those provided above will encompass preferred embodiments. Thus, where applicable, in light of the minimum % identity figures, it is preferred that the nucleic acid molecule comprises a nucleotide sequence which is at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%), more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO or target.

A nucleic acid molecule of the present invention may selectively hybridise to a polynucleotide that encodes a Neoparamoeba polypeptide under stringent conditions. As used herein, under stringent conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1%) NaDodS04 at 50°C; (2) employ during hybridisation a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1%) sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 SSC and 0.1% SDS.

Usually, monomers of a nucleic acid are linked by phosphodiester bonds or analogs thereof to form oligonucleotides ranging in size from a relatively short monomelic units, e.g., 19-25, to several hundreds of monomeric units. Analogs of phosphodiester linkages include: phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate. Nucleic Acid Constructs

As used herein, the term "nucleic acid construct" refers to any nucleic acid molecule that encodes a double-stranded RNA molecule as defined herein and includes the nucleic acid molecule in a vector, the nucleic acid molecule when present in a cell as an extrachromosomal nucleic acid molecule, and a nucleic acid molecule that is integrated into the genome. Typically, the nucleic acid construct will be double stranded DNA or double-stranded RNA, or a combination thereof. Furthermore, the nucleic acid construct will typically comprise a suitable promoter operably linked to the open reading frame encoding the double-stranded RNA.

"Operably linked" as used herein refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory element to a transcribed sequence. For example, a promoter is operably linked to a coding sequence, such as an open reading frame encoding a double-stranded RNA molecule defined herein, if it stimulates or modulates the transcription of the coding sequence in an appropriate cell. Generally, promoter transcriptional regulatory elements that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are czs-acting. However, some transcriptional regulatory elements, such as enhancers, need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.

By "RNA polymerase III promoter" or "RNA pol III promoter" or "polymerase

III promoter" or "pol III promoter" is meant any invertebrate, vertebrate, or mammalian promoter, e.g., fish, human, murine, porcine, bovine, primate, simian, etc. that, in its native context in a cell, associates or interacts with RNA polymerase III to transcribe its operably linked gene, or any variant thereof, natural or engineered, that will interact in a selected host cell with an RNA polymerase III to transcribe an operably linked nucleic acid sequence. By U6 promoter (e.g., fish U6), HI promoter, or 7SK promoter is meant any invertebrate, vertebrate, or mammalian promoter or polymorphic variant or mutant found in nature to interact with RNA polymerase III to transcribe its cognate RNA product, i.e., U6 RNA, HI RNA, or 7SK RNA, respectively.

The nucleic acid construct may comprise a first open reading frame encoding a first single strand of the double-stranded RNA molecule, with the complementary (second) strand being encoded by a second open reading frame by a different, or preferably the same, nucleic acid construct. The nucleic acid construct may be a linear fragment or a circular molecule and it may or may not be capable of replication. The skilled person will understand that the nucleic acid construct of the invention may be included within a suitable vector. Transfection or transformation of the nucleic acid construct into a recipient cell allows the cell to express an RNA molecule encoded by the nucleic acid construct.

The nucleic acid construct of the invention may express multiple copies of the same, and/or one or more (e.g. 1, 2, 3, 4, 5, or more) including multiple different, RNA molecules comprising a double-stranded region, for example a short hairpin RNA. RNA molecules considered to be the "same" as each other are those that comprise only the same double-stranded sequence, and RNA molecules considered to be "different" from each other will comprise different double-stranded sequences, regardless of whether the sequences to be targeted by each different double-stranded sequence are within the same, or a different gene, or sequences of two different genes.

The nucleic acid construct also may contain additional genetic elements. The types of elements that may be included in the construct are not limited in any way and may be chosen by one with skill in the art. In some embodiments, the nucleic acid construct is inserted into a host cell as a transgene. In such instances it may be desirable to include "stuffer" fragments in the construct which are designed to protect the sequences encoding the RNA molecule from the transgene insertion process and to reduce the risk of external transcription read through. Stuffer fragments may also be included in the construct to increase the distance between, e.g., a promoter and a coding sequence and/or terminator component. The stuffer fragment can be any length from 5- 5000 or more nucleotides. There can be one or more stuffer fragments between promoters. In the case of multiple stuffer fragments, they can be the same or different lengths. The stuffer DNA fragments are preferably different sequences. Preferably, the stuffer sequences comprise a sequence identical to that found within a cell, or progeny thereof, in which they have been inserted. In a further embodiment, the nucleic acid construct comprises stuffer regions flanking the open reading frame(s) encoding the double stranded RNA(s). In some instances, the nucleic acid construct may include a transposable element, for example a transposon characterized by terminal inverted repeat sequences flanking the open reading frames encoding the double stranded RNA(s). Examples of suitable transposons include Tol2, mini-Tol, Sleeping Beauty, Mariner and Galluhop. Alternatively, the nucleic acid construct may comprise a Zinc Finger Nuclease which facilitates the insertion of DNA into a specific site in the genome.

Other examples of an additional genetic element which may be included in the nucleic acid construct include a reporter gene, such as one or more genes for a fluorescent marker protein such as GFP or RFP; an easily assayed enzyme such as beta- galactosidase, luciferase, beta-glucuronidase, chloramphenical acetyl transferase or secreted embryonic alkaline phosphatase; or proteins for which immunoassays are readily available such as hormones or cytokines. Other genetic elements that may find use in embodiments of the present invention include those coding for proteins which confer a selective growth advantage on cells such as adenosine deaminase, aminoglycodic phosphotransferase, dihydrofolate reductase, hygromycin-B- phosphotransferase, or drug resistance.

Where the nucleic acid construct is to be transfected into an animal, in some instances it is desirable that the promoter and any additional genetic elements consist of nucleotide sequences that naturally occur in the animal's genome.

Vectors and Host Cells

In some instances it may be desirable to insert the nucleic acid construct and/or nucleic acid molecule of the invention into a vector. The vector may be, e.g., a plasmid, virus or artificial chromosome derived from, for example, a bacteriophage, adenovirus, adeno-associated virus, retrovirus, poxvirus or herpesvirus. Such vectors include chromosomal, episomal and virus-derived vectors, e.g., vectors derived from bacterial plasmids, bacteriophages, yeast episomes, yeast chromosomal elements, and viruses, vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, cosmids and phagemids. Thus, one exemplary vector is a double-stranded DNA phage vector. Another exemplary vector is a double- stranded DNA viral vector.

The vector into which the nucleic acid construct is inserted may also include a transposable element, for example a transposon characterized by terminal inverted repeat sequences flanking the open reading frames encoding the double stranded RNA(s). Examples of suitable transposons include Tol2, Mini-Tol2, Sleeping Beauty, Mariner and Galluhop. Reference to a Tol2 tansposon herein includes a transposon derived from Tol2 such as Mini-Tol2.

The present invention also provides a host cell into which the nucleic acid construct, nucleic acid molecule and/or the vector of the present invention has been introduced. The host cell of this invention can be used as, for example, a production system for producing or expressing the dsRNA molecule. For in vitro production, eukaryotic cells or prokaryotic cells can be used.

Useful eukaryotic host cells may be animal, plant, or fungal cells. As animal cells, mammalian cells such as CHO, COS, 3T3, DF1, CEF, MDCK myeloma, baby hamster kidney (BHK), HeLa, or Vero cells, amphibian cells such as Xenopus oocytes, or insect cells such as Sf9, Sf21, or Tn5 cells can be used. CHO cells lacking DHFR gene (dhfr-CHO) or CHO K-l may also be used. The vector can be introduced into the host cell by, for example, the calcium phosphate method, the DEAE-dextran method, cationic liposome DOTAP (Boehringer Mannheim) method, electroporation, lipofection, etc.

Useful prokaryotic cells include bacterial cells, such as E. coli, for example, JM109, DH5a, and HB 101, or Bacillus subtilis .

Culture medium such as DMEM, MEM, RPM11640, or FMDM may be used for animal cells. The culture medium can be used with or without serum supplement such as fetal calf serum (FCS). The pH of the culture medium is preferably between about 6 and 8. Cells are typically cultured at about 30° to 40° C for about 15 to 200 hr, and the culture medium may be replaced, aerated, or stirred if necessary.

Transgenic Non-Human Organisms

A "transgenic non-human organism" refers to a plant or an animal, other than a human, that contains a nucleic acid construct ("transgene") not found in a wild-type plant or animal of the same species or breed. A "transgene" as referred to herein has the normal meaning in the art of biotechnology and includes a genetic sequence which has been produced or altered by recombinant DNA or RNA technology and which has been introduced into a plant or an animal cell. The transgene may include genetic sequences derived from an animal cell. Typically, the transgene has been introduced into the animal by human manipulation such as, for example, by transformation but any method can be used as one of skill in the art recognizes. A transgene includes genetic sequences that are introduced into a chromosome as well as those that are extrachromosomal. Techniques for producing transgenic animals are well known in the art. A useful general textbook on this subject is Houdebine, Transgenic animals - Generation and Use (Harwood Academic, 1997).

Heterologous DNA can be introduced, for example, into fertilized ova. For instance, totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or other means, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal. In one method, developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals produced from the infected embryo. In an alternative method, however, the appropriate DNAs are coinjected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos allowed to develop into mature transgenic animals.

Another method used to produce a transgenic animal involves microinjecting a nucleic acid into pro-nuclear stage eggs by standard methods. Injected eggs are then cultured before transfer into the oviducts of pseudopregnant recipients.

Transgenic animals may also be produced by nuclear transfer technology. Using this method, fibroblasts from donor animals are stably transfected with a plasmid incorporating the coding sequences for a binding domain or binding partner of interest under the control of regulatory sequences. Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients.

Sperm-mediated gene transfer (SMGT) is another method that may be used to generate transgenic animals. This method was first described by Lavitrano et al. (1989).

Another method of producing transgenic animals is linker based sperm-mediated gene transfer technology (LB-SMGT). This procedure is described in United States Patent 7067308. Briefly, freshly harvested semen is washed and incubated with murine monoclonal antibody mAbC (secreted by the hybridoma assigned ATCC accession number PTA-6723) and then the construct DNA. The monoclonal antibody aids in the binding of the DNA to the semen. The sperm/DNA complex is then artificially inseminated into a female.

Another method for generating germline transgenic animals is by using a transposon, for example the Tol2 transposon, to integrate a nucleic acid construct of the invention into the genome of an animal. The Tol2 transposon which was first isolated from the medaka fish Oryzias latipes and belongs to the hAT family of transposons is described in Koga et al. (1996) and Kawakami et al. (2000). Mini-Tol2 is a variant of Tol2 and is described in Balciunas et al. (2006). The Tol2 and Mini-Tol2 transposons facilitate integration of a transgene into the genome of an organism when co-acting with the Tol2 transposase. By delivering the Tol2 transposase on a separate non- replicating plasmid, only the Tol2 or Mini-Tol2 transposon and transgene is integrated into the genome and the plasmid containing the Tol2 transposase is lost within a limited number of cell divisions. Thus, an integrated Tol2 or Mini-Tol2 transposon will no longer have the ability to undergo a subsequent transposition event.

Any other suitable transposon system may be used in the methods of the present invention. For example, the transposon system may be a Sleeping Beauty, Frog Prince or Mosl transposon system, or any transposon belonging to the tcl/mariner or hAT family of transposons may be used.

A viral delivery system based on any appropriate virus may be used to deliver the nucleic acid constructs of the present invention to a cell. In addition, hybrid viral systems may be of use. The choice of viral delivery system will depend on various parameters, such as efficiency of delivery into the cell, tissue, or organ of interest, transduction efficiency of the system, pathogenicity, immunological and toxicity concerns, and the like. It is clear that there is no single viral system that is suitable for all applications. When selecting a viral delivery system to use in the present invention, it is important to choose a system where nucleic acid construct-containing viral particles are preferably: 1) reproducibly and stably propagated; 2) able to be purified to high titers; and 3) able to mediate targeted delivery (delivery of the nucleic acid expression construct to the cell, tissue, or organ of interest, without widespread dissemination).

Alternatively, a Zinc Finger Nuclease system may be used to produce a transgenic organism. As known in the art, Zinc-finger nucleases (ZFNs) are artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a DNA- cleavage domain. Zinc finger domains can be engineered to target desired DNA sequences and this enables zinc-finger nucleases to target unique sequences within complex genomes. By taking advantage of endogenous DNA repair machinery, these reagents can be used to precisely alter the genomes of higher organisms. Commercially available ZFN technology includes the CompoZr^® Zinc Finger Nuclease Technology (Sigma-Aldrich).

Compositions and Administration

In a preferred embodiment, a composition of the invention is a pharmaceutical composition comprising a suitable carrier. Suitable pharmaceutical carriers, excipients and/or diluents include, but are not limited to, lactose, sucrose, starch powder, talc powder, cellulose esters of alkonoic acids, magnesium stearate, magnesium oxide, crystalline cellulose, methyl cellulose, carboxymethyl cellulose, gelatin, glycerin, sodium alginate, antibacterial agents, antifungal agents, gum arabic, acacia gum, sodium and calcium salts of phosphoric and sulfuric acids, polyvinylpyrrolidone and/or polyvinyl alcohol, saline, and water.

In some embodiments, the nucleic acid construct(s) and/or nucleic acid molecules of the invention are complexed with one or more cell transfection reagents such as cationic lipids or cationic amphiphiles, for instanceas the compositions disclosed in US 4,897,355; US 5,264,618; or US 5,459, 127. In other embodiments, they are complexed with a liposome/liposomic composition that includes a cationic lipid and optionally includes another component, such as a neutral lipid (see, for example, US 5,279,833; US 5,283,185; and US 5,932,241). In other embodiments, they are complexed with the multifunctional molecular complexes of US 5,837,533; 6, 127,170; and 6,379,965 or, desirably, the multifunctional molecular complexes or oil/water cationic amphiphile emulsions of WO 03/093449. The latter application teaches a composition that includes a nucleic acid, an endosomolytic spermine that includes a cholesterol or fatty acid, and a targeting spermine that includes a ligand for a cell surface molecule. The ratio of positive to negative charge of the composition is between 01. to 2.0, preferably 0.5 and 1.5, inclusive; the endosomolytic spermine constitutes at least 20% of the spermine-containing molecules in the composition; and the targeting spermine constitutes at least 10% of the spermine-containing molecules in the composition. Desirably, the ratio of positive to negative charge is between 0.8 and 1.2, inclusive, such as between 0.8 and 0.9, inclusive.

A nucleic acid construct, nucleic acid molecule and/or composition of the invention can also be added to animal feed or in water. It can be convenient to formulate the feed so that the animal takes in a therapeutically appropriate quantity along with its diet. It can also be convenient to present the composition as a premix for addition to the feed or water. Thus, the present invention also provides an animal feed comprising an isolated and/or exogenous nucleic acid molecule according to the invention.

Therapeutic and Prophylactic Methods

The present invention utilises the isolated and/or exogenous nucleic acid molecules of the invention for the treatment and prevention of disease caused by Neoparameoba species, in particular for the treatment and prevention of amoebic gill disease in fish caused by Neoparamoeba perurans. The method of the invention comprises administering to a fish the isolated and/or exogenous nucleic acid molecule of the invention, the nucleic acid construct of the invention, the vector of the invention, the composition of the invention, and/or the transgenic non-human organism of the invention.

In one embodiment, the isolated and/or exogenous nucleic acid molecule of the invention, the nucleic acid construct of the invention, the vector of the invention, the composition of the invention, and/or the transgenic non-human organism of the invention is fed to the fish that is treated. For example, any of the foregoing embodiments of the invention may be fed directly to the fish or formulated into a suitable edible carrier. As would be understood by one of skill in the art, the isolated and/or exogenous nucleic acid molecule of the invention, the nucleic acid construct of the invention, the vector of the invention, the composition of the invention, and/or the transgenic non-human organism of the invention may conveniently be formulated into a fish feed for consumption by a fish.

In light of the present inventors' findings that RNA interference can be induced in amoeba by soaking them in dsRNA, the nucleic acid molecules or compositions of the invention may be included in a liquid that is contacted with fish being treated. For example, the therapeutic or prophylactic methods of the present invention may be performed in conjunction with or separately to the existing technique employed in the aquaculture industry of bathing fish in freshwater. Thus, an isolated and/or exogenous nucleic acid or composition of the invention may be added to the water in which the fish will be bathed.

In addition, the therapeutic and prophylactic methods of the present invention may be performed in conjunction with other techniques for the treatment and prevention of amoebic gill disease. For example, feeding fish an isolated and/or exogenous nucleic acid molecule or composition of the invention may be performed in conjunction with freshwater bathing.

Furthermore, if desired, the fresh water in which the fish are bathed, and which may comprise an isolated and/or exogenous nucleic acid molecule or composition of the invention, may contain additional components, such as for example a suitable buffering agent, another veterinary pharmaceutical composition, disinfectant and/or medicament. Examples of disinfectants that may be included in the fresh water include choloramine and chlorine dioxide. One non-limiting example of a medicament that may be added to the water is the anti -parasitic drug Lemavisole. The skilled person can readily determine the necessary concentrations of such compounds in the bathing water. EXAMPLES

Example 1. Methods

Neoparamoeba culture conditions

. V. pemaquidensis originally isolated and cloned from AGD affected salmon were used in the present experiment. The amoeba were grown on malt-yeast-seawater agar plates (75% filtered seawater, 25% distil led water, 0.01 % malt, 0.01 % yeast 2%, bacto agar) and kept at 16°C. Prior to each experiment, the monolayer of amoeba was removed from agar plates using a transfer^' pipette and sterile seawater, followed by three low- speed cemritugati n (400 χ g, 2 mm) steps to eliminate bacterial load naturally present in agar culture. The supernatant containing the amoeba was centrifuged at 4000 ^χ g for 5 min and amoeba pellet resuspended in sterile seawater. Once enumerated by haemocytometer count, the amoeba trophozoites were evenly spread into 24 well culture plates^{■ "} :^■ to a final concentration of

10⁵ amoebae/mL/well . Plates were incubated at 16°C until the end of each experiment.

RNA isolation and reverse transcription

Total RNA was isolated from N. pemaquidensis cells using Trizol® (Invitrogen), according to the manufacturer's instructions. RNA was quantified using a NanoDrop ND-1000 Spectrophotometer and its integrity assessed on 1.5% TAE agarose gel. Residual contaminating DNA was digested using TURBO DNA-free™ (Ambion) and first-strand cDNA synthesized using Superscript™ III Reverse Transcriptase with oligo(dT) primer (Invitrogen).

Synthesis of bacterially expressed dsRNA

For the construction of dsRNA-expression vectors, specific primers designed against the coding sequences of N. pemaquidensis β-actin and elongation factor 1-a (EF l-a), as well as luciferase, were used to amplify fragments of 500, 700 and 600 bp, respectively (Table 1). The coding sequence of β-actin is provided as SEQ ID NO: 1 1 and the coding sequence of EFl-a is provided as SEQ ID NO: 12. The amoeba sequences were obtained from sequence analysis of a normalized EST library (data not published). Following PCR amplification using Phusion DNA polymerase (Invitrogen), the fragments were cloned into pAcquire vector and the purified plasmids submitted to restriction enzyme digestion with Nhe I and Spe I (New England BioLabs). Table 1. Primer sequences use for construction of dsRNA-expression vectors (ds) and qRT-PCR (q). primer nucleotide sequences (5'-3')

dsRNAJ3-actin.5' GATACTAGTACCTTCAACACCCCCGCCATG

(SEQ ID NO: l) dsRNAJ3-actin.3' AACGCTAGCTAGGACTTCTCGAGGGCAGAG

(SEQ ID NO:2) qRT-PCR_p-actin.5' CAATCCAAGCGTGGTATCCT

(SEQ ID NO:3) qRT-PCR_p-actin.3' GCTCGTTGTAGAAGGTGTGG

(SEQ ID NO:4) dsRNA_EFla.5' GAT ACT AGTGC CGG A A AGTC C AC C AC C AC T

(SEQ ID NO:5) dsRNA_EFla.3' AACGCTAGCTGTACCCGATCTTCTTCAAGA

(SEQ ID NO: 6) qRT-PCR_EFla.5' GTACAAGGGTCCCACTCTCCC

(SEQ ID NO: 7) qRT-PCR_EFla.3' AGCGAAGGTGACAACCATAC

(SEQ ID NO: 8) dsRNAJuciferase.5' GATACTAGTATGGAAGACGCCAAAAACATA

(SEQ ID NO: 9) dsRNAJuciferase.3 ' AACGCTAGCAACCCCTTTTTGGAAACAAAC

(SEQ ID NO: 10)

The correct sized bands were then gel purified and subcloned into the double T7 promoter vector PL4440. Following cloning, the nucleotide sequences of the recombinant plasmids were confirmed by DNA sequencing and the resultant constructs transformed into HT115 (DE3) RNase Ill-deficient E. coli strain, which is modified to express T7 RNA polymerase from an IPTG-inducible promoter. In addition to luciferase, an empty L4440 vector without any insert was also transformed into HT115 (DE3) and used as negative control. Individual colonies carrying the plasmids were inoculated in LB broth containing ampicillin (100 μg/mL) and tetracycline (12.5 μg/mL) and grown overnight at 37 °C, with shaking. Cultures were diluted 1 :50 in 2YT medium containing the same antibiotics and allowed to growth to OD₆₀o ~ 0.6. IPTG was added to 2 mM for initiation of dsRNA synthesis and cultures induced for 4 h incubation at 37 °C. The bacterial cells were harvested by centrifugation at 6000 ^χ g for 10 min at 4 °C.

Purification of dsRNA

The dsRNA was purified from the bacteria using a protocol adapted from Ongvarrasopone et al. (2007) and Solis et al. (2009). Briefly, following centrifugation, every 1 mL of bacterial pellet was resuspended in 50 μΐ_^ of 0.1% SDS and boiled for 2 min to lyse the cells. Total RNA was isolated from the bacterial lysate using Trizol^® (Invitrogen), and subsequently incubated for lh at 37°C with 0.4 υ/μΐ. of Turbo DNase and 0.2 μg/μL of RNase A (Ambion) to remove contaminating genomic DNA and single-stranded RNA, respectively. The remaining dsRNA was then purified with an equal volume of phenol :chl or of orm:isoamyl alcohol (Sigma) and precipitated with 0.5 volume of 7.5 M ammonium acetate and 1 volume of isopropanol. Following centrifugation at 12,000 g for 30 min, the dsRNA-containing pellet was washed twice with ethanol 70% and resuspended in nuclease free water. Double-stranded RNAs were analysed by agarose gel electrophoresis and concentration determined using a NanoDrop ND-1000 Spectrophotometer. The dsRNA integrity was further confirmed by Shortcut RNAse III (NEB) digestion at 37 °C for 20 min.

Delivery of bacterial dsRNA by soaking

Prior to the experiments, the amoebae were transferred to 24-well culture plates (Nunclon™ Delta Surface) containing 1 mL of filtered seawater in each well. The treatments were performed in quadruplicate and each replicate comprised all the amoebae within a single well (10⁵ amoebae). Purified dsRNA targeting the N. pemaquidensis β-actin and EFl-a, as well as the unrelated luciferase and the empty L4440 vector, were directly administrated by immersion to a final concentration of 2, 20 and 50 μg/mL of culture media.

When β-actin knockdown was being assessed, samples treated with dsRNA expressing EFla were regard as internal controls and vice versa. dsRNA exposed amoebae were cultured under standard in vitro conditions and sampled at 0, 6, 12, 24, 48 and 72 h post dsRNA administration. A second experiment was also performed with the aim to assess whether continuous administration of dsRNA would result in more effective downregulation of the targeted genes as opposed to a one-off addition. For this purpose, daily administration of 20 μg/mL of each dsRNA construct was performed and sampling carried out at 0, 24, 48, 72 h and 7 days following the first dsRNA administration. Delivery of dsRNA by feeding

10^" amoebae).

>;^'.·. The selected amoeba/bacteria ratio was based on a study performed by Solis et al. (2009) when using similar methodology to silence gene expression in Entamoeba histolytica. Cellular density of bacterial inoculums was determined assuming that an optical density of 1 at 600 nm corresponds to 10⁸ bacteria/mL Solis et al. (2009). Amoebae fed once with dsRNA-expressing bacteria were cultured . ^ l v ;

i.^' 0; : di o: !:^'i :.^:; and sampled at 0, 24, 48, 72 h and 7 days post introduction of bacteria producing dsRNA. Total RNA extraction and RT-PCR

At every sampling time point, the seawater from the sampled wells was removed by pipetting and each well rinsed twice with filtered seawater to eliminate unattached debris and remaining dsRNA. The amoebae were then detached from the culture plates by adding Trizol^® (Invitrogen) and transferred to fresh 1.5 mL tubes. Total RNA was isolated from dsRNA treated amoebae as described previously, followed by Turbo DNAse-treatment (Ambion) and reverse transcription (Invitrogen). To determine whether the β-actin and EFl-a transcripts were effectively silenced, RT-PCR was conducted using the synthesized cDNA as a template in a reaction containing GoTaq® (Promega) and the target genes' specific primers. The temperature profile for PCR amplification was performed by holding at 94 °C for 5 min, followed by 28 cycles of 94 °C for 30 s, 50 °C for 30 s and 72 °C for 1 min; and a final extension at 72 °C for 7 min. The PCR products were analysed by agarose gel electrophoresis and the mRNA expression of the target genes evaluated using the intensity of the bands from luciferase-dsRNA treated samples as a control. Quantitative RT-PCR

Quantitative real-time RT-PCR (qRT-PCR) was performed on an ABI 7600 system to determine whether the administration of bacterially expressed dsRNA targeting the N. pemaquidensis β-actin and EFl-a would significantly down-regulate the mRNA expression levels of the target genes. Previous studies performed in our laboratory have shown that dsRNA submitted to reverse transcription can be detected during quantitative real time PCR (qRT-PCR) (results not shown). Therefore, considering that dsRNA residues could remain attached to the amoebae membrane, qRT-PCR primers specific to each target gene (Table 1) were designed to amplify different sections of the gene sequence than those selected to build the dsRNA constructs. All reactions were performed in triplicate, each containing 4 μΙ_, of diluted cDNA, 2 x SensiMix SYBR (Bioline) and 0.5 mM forward and reverse primers in a 10 μΐ, reaction. The amplification profile consisted of an initial denaturation step at 95 °C for 10 min; 40 cycles of 95 °C for 20 s, 58 °C for 20 s and 72 °C for 20 s, followed by a dissociation stage according to the manufacturer's instructions. Dissociation curve analysis was performed to verify the specificity of the PCR amplification. Absolute quantification of β-actin and EFl-a was determined by generating external standard curves using 10-fold serial dilution of plasmid DNA as templates. The absolute amount of each target gene was expressed as copy number using the following equation: Quantity = 10^(Ct-^b)/m.

Where Ct is the threshold cycle, b is the y-intercept and m is the slope of the linear regression equation obtained from each standard curve. The efficiency of each primer set was calculated from the formula E = io^"1/slope. The expression levels of β- actin and EFl-a were presented as relative copy number which was normalized against the samples that received empty L4440 vector treatment.

Statistical analysis

Significant variation in β-actin or EFl-a expression levels within treatments, at each sampling period, was calculated by one-way analysis of variance (ANOVA) using the R version 2.14 software (R Development Core Team 2007). Values were considered to be significant at p < 0.05. All numerical data were expressed as the mean ± standard error.

Microscopy

Possible phenotypic changes in dsRNA-treated amoeba were examined by microscopy, using a Zeiss Axio Observer inverted microscope, equipped with Zeiss AxioCam CCD camera and AxioVision Software (Carl Zeiss, Jena, Germany). Aliquots of trophozoites soaked for 72 h in 50 μ§/ιηΙ. of each treatment were transferred to glass slides carefully covered with a coverslip and immediately visualised under 10 x and 40 x magnification. Oil immersion was employed when the 100 x objective was used. The 50 μg/mL dose was selected as it efficiently silenced both target genes.

Validation of dsRNA expressing bacteria ingestion

In order to differentiate the administered bacteria from the ones naturally present in the amoeba culture, the E. coli expressing dsRNA was stained using propidium iodide (PI), a nucleic acid binding fluorescent dye. Fluorochrome stock solution of PI was prepared in phosphate buffered saline (PBS) at 500 μg/mL and filtered with 0.2 μπι Millipore filter. Approximately 1 mL of IPTG induced bacteria was harvest by centrifugation (6000 ^x g, 3 min), followed by overnight formaldehyde fixation at 4°C. The bacterial pellet was incubated with PI ^g/mL) for 30 min in the dark and washed several times with PBS to remove unbound dye.

Successful bacterial PI fluorescence was verified using a Zeiss Axio Observer inverted microscope under Rhodamine filter set (excitation 540-552 nm, emission 575- 640 nm) and 100 x oil-immersion objective. Stained bacteria and trophozoites were associated for two hours under standard culture conditions, at the same ratio described at section 2.5. Following the incubation period, amoebae and bacteria were separated by low-speed centrifugation (400 ^χ g, 2 min) and the fraction containing the trophozoites resuspended in PBS. Using the same microscope as above, trophozoites and stained bacteria within food vacuoles were identified by phase contrast (40 ^χ, Ph 2) and fluorescence (40 ^χ, Rhodamine filter set), respectively. Images were acquired with a Zeiss Axiocam CCD camera and Zeiss AxioVision 4.8.1 software.

Example 2. Results of Soaking Experiments

Verification of dsRNA integrity

Long dsRNA targeting both N. pemaquidensis target genes (β-actin and EFl-a), as well as the unrelated luciferase and the empty L4440 vector, were successfully produced in RNase III deficient E. coli. As expected, a small product of approximately 220 bp was detected in samples extracted from bacteria transformed with L4440 vector only (Figure 1), presumably representing the uncut multiple cloning site (MCS) of this vector. The dsRNA integrity was also verified by incubation with RNAse A and RNase III, which specifically digest ssRNA and dsRNA, respectively. The results showed that all synthesized RNAs were cleaved by RNAse III but not RNAse A, clearly suggesting that intact dsRNA were obtained by the aforementioned method (Figure 1). dsRNA delivery by soaking and its effect on β-actin mRNA levels

dsRNAs targeting the amoebae β-actin (Λ^-β-actin-dsRNA), EFl-a (Np- EFla- dsRNA), as well as the non-specific luciferase (luc-dsRNA) and the empty L4440 vector (L4440-dsRNA), were administrated to cultured N. pemaquidensis and analysed by qRT-PCR. No reduction of β-actin mRNA levels was observed when amoebae were incubated with 2 μg/mL of Λ^-β-actin-dsRNA, at any sampling period (Figure 2A, B). However, a slight but non-significant decrease in β-actin relative copy number was detected at 12 h after the 20 μg/mL dosage was administered (Figure 2C, D). This reduction was significant at 24 h (p < 0.001), reaching a relative knockdown of approximately 84±7% in Λ^-β-actin-dsRNA treated samples. The silencing effect remained significant at 48 h (77 ±4%) and 72 h (88 ±7.5%). The significant knockdown described above was not increased when a higher dosage (50 μg/mL) was used (Figure 2E, F). Although the β-actin relative copy number declined slightly at 24 h, the relative knockdown only reached significant levels at 48 h (p < 0.05), 24 h later than when the 20 μg/mL dosage was employed (Figure 2E, F). The most effective knockdown in samples treated with 50 μg/mL of Λ^-β-dsRNA (77 ±10.2%) was detected at 72 h (p < 0.001) (Figure 2E), which was not significantly higher than the levels obtained, at the same sampling point, for the 20 μg/mL treatment. No major variations on β-actin expression levels were observed when either the internal (Np- EFla-dsRNA) or the non-specific (luc-dsRNA) controls were added into the amoebae culture at any of the test concentrations (Figure 2A-F). dsRNA delivery by soaking and its effect on EFla mRNA levels

In experiments using N. pemaquidensis EFla as a target gene, Λ^-β-actin- dsRNA was used as the internal control. Similar to what was found when knocking down β-actin mRNA levels, EFla silencing was not triggered when the lower concentration of Njo-EFla-dsRNA (2 μg/mL) was administered (Figure 3A, B). The EFla expression levels also remained significantly stable throughout the experiment when the 20 μg/mL dosage was employed (Figure 3C, D). However, significant relative knockdown of EFla was achieved at 48 h (83 ±7.3%) post the administration of NjP-EFla-dsRNA at the concentration of 50 μg/mL (p < 0.05) (Figure 3E, F). This silencing effect did not remain significant for longer than 24 h (Figure 3E). Daily administration of dsRNA

20 μg/mL of each dsRNA was administered daily to the amoeba culture for a period of seven days. The experiments were carried out under the same conditions as detailed before with sampling performed at 0, 24, 48, 72 h and 7 days after the first dsRNA addition. The daily administration of Λ^-β-actin-dsRNA did not improve the effectiveness of β-actin downregulation, when compared to a single administration of 20 μg/mL (Figure 4A, B). Moreover, the silencing effect triggered by the daily introduction of Λ^-β-actin-dsRNA was delayed by 24 h, with significant downregulation only observed from 48 h (p < 0.05) (Figure 4A). At 72 h, the β-actin mRNA expression reached the lowest level, with a relative knockdown of 89 ±7.63%.

The observed reduction remained significant until the end of the experiment (Figure 4A). On the contrary, while no silencing effect was detected when amoebae received an one-off 20 μg/mL dose of Njo-EFla-dsRNA (Figure 3C), a significant downregulation of EFla was observed at both 48 and 72 h (70 ±11.29%) and 41 ±4.37%o) when the same dosage was administered daily to the amoeba culture (p < 0.01) (Figure 4C, D). However, the target gene depletion was not significantly superior to when the 50 μg/mL dosage was employed (83 ±7.3% at 48h) (Figure 3E). Similarly to previous observations, both the β-actin and EFla mRNA levels were not affected by administration of control dsRNA's (Figure 4A-C).

Phenotypic changes in N. pemaquidensis

Image based analysis of dsRNA-treated trophozoites showed that all β-actin depleted amoebae developed into an unexpected dormant cyst-like phase (Figure 5A, B), which has not been previously described in species from the genus Neoparamoeba (Douglas-Helders et al., 2003; Dykova et al., 1999; Dykova et al., 2000). The round shape encysted amoeba were approximately 15 μπι in diameter and, when analysed under 100 ^χ magnification, small spherical structures similar to nuclei could also be observed within each individual (Figure 6). Unlike trophozoites, cysts were immobile and attached to the substratum. While 100%> of Λ^-β-actin-dsRNA treated amoeba showed noticeable phenotypic change, approximately 70% of the trophozoites soaked in 50 μg/mL of Njo-EFla-dsRNA showed less mobility and pseudopodia radiation, assuming a corrugated globular shape (Figure 5 C, D). All amoebae in luciferase- dsRNA solution remained in the active feeding trophozoite stage (Figure 5 E, F). Example 3. Results of Feeding Experiments

Verification of dsRNA integrity

Successful production of dsRNA in E. coli HT115 was validated by analysing purified dsRNAs on 1% agarose gel before and after RNAse A and RNAse III digestion. As shown in Figure 1, all synthesised dsRNAs were resistant to RNAse A digestion, but susceptible to RNAse III, indicating that good quality dsRNA was obtained for this study. Prominent bands of about the expected size were observed for dsRNA constructs targeting N. pemaquidensis specific genes and non-specific luciferase, while a small product of approximately 220 bp was detected in samples extracted from bacteria transformed with empty L4440 vector (Figure 7).

Downregulation of target genes

E. coli strain HT115 genetically engineered to express dsRNA targeting N. pemaquidensis β-actin and EFla dsRNA, as well as luciferase and empty L4440 vector were directly fed to the amoeba trophozoites to a final concentration of 10⁴ bacteria/amoeba. To confirm that ingestion of dsRNA triggered specific RNAi in N. pemaquidensis, qRT-PCR was performed to detect the mRNA level of both target genes at each sampling period. When β-actin knockdown was being assessed, samples treated with EFla-dsRNA were regarded as internal controls and vice versa.

Quantitative analysis of gene expression revealed that significant knockdown of β-actin mRNA transcripts was only detected one week after the bacteria expressing β- actin dsRNA was introduced to the amoeba culture (Figure 8a). At 7 days, the target gene mRNA levels was reduced by 83 ±6.63% as opposed to samples exposed to either internal (EFla-dsRNA) or external (luciferase-dsRNA) controls. The observed suppression was supported by RT-PCR analysis, where a less intense band was detected in β-actin-dsRNA treat group, at the same sampling period (Figure 8b). Conversely, EFla expression levels remained significantly stable during the entire experimental period, regardless of the treatment administered (Figure 8c and 8d).

After feeding on bacteria expressing dsRNA for 7 days, no phenotypic changes were observed in trophozoites across the treatment groups (results not shown).

Confirmation of bacteria ingestion

To confirm that bacterially expressed dsRNA was successfully introduced into the amoeba, E. coli HT115 was stained with fluorescent dye and its ingestion assessed by fluorescent microscopy. Bacteria incubated for 30 min in solution containing PI at 3μg/mL appeared bright orange under the microscope, with strong fluorescent signal and low background (Figure 9a). Following two hours incubation, ingestion of stained bacteria was successfully confirmed by fluorescence microscopy. Trophozites showed fluorescent food vacuoles, as well as intact rod-shape bacteria in the cytoplasm (Figure 9b and c). A light orange background could also be observed in some areas of the trophozoites, which appears to be soluble products of bacterial digestion that were diffused into the cytoplasm. Rapid uptake, and possible digestion, of dsRNA expressing bacteria was verified in the majority of trophozoites. However, a small fraction of amoeba presented no fluorescence signal, suggesting that the bacteria were not equally ingested by the trophozoites.

Example 4. RNAi Activity in N. perurans

Method

The ability of N. perurans Dicer to recognise and cleave dsRNA was assessed by RNAse III activity assay, as described by Abed and Ankri (2005). Briefly, approximately 2 μg of in vitro transcribed dsRNA was incubated for 1 h, at 37 °C, with 5 μg of N. perurans lysate in a 20

reaction containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl₂, 10 mM dithiothreitol, 1 mM ATP and 25 μg/mL bovine serum albumin. The lysate was prepared with Nonidet P-40 1% in phosphate-buffered saline (PBS). Efficient degradation of dsRNA by Dicer present in the amoeba lysate was verified on a 2% agarose gel. Incubation with serially diluted lysate was also performed to confirm reduction of degradation effectiveness. Moreover, the addition of 10 ^χ EDTA prior dsRNA incubation was carried out to validate Dicer inactivation.

Results

The ability of N. perurans Dicer to cleave long dsRNA was validated by incubating in vitro transcribed dsRNA in the presence of amoeba lysate. Gel electrophoretic analysis of incubated dsRNA showed complete degradation of the RNA duplexes, as soon as 1 h of continuous incubation (Figure 10, lane C). As expected, the digestion efficiency was significantly reduced when serially diluted lysates were added to the substrate (Figure 10, lanes D-H). Additionally, the dsRNA remained intact when the lysate was treated with 10 x EDTA, suggesting inactivation of Dicer enzymatic activity (Figure 10, lane I).

All publications discussed and/or referenced herein are incorporated herein in their entirety. The present application claims priority from AU 2013901018 filed 25 March 2013, the entire contents of which are incorporated herein by reference.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the above-described embodiments, without departing from the broad general scope of the present disclosure. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.

REFERENCES

Abed and Ankri (2005) Exp Parasitol, 110(3):265-269.

Balciunas et al. (2006) PLoS Genet, 2(l l):el69.

Douglas-Helders et al. (2003) Journal of Fish Diseases, 26:231-240. Dykova et al. (1999) Diseases of Aquatic Organisms, 38:33-38.

Dykova et al. (2000) Diseases of Aquatic Organisms, 43 :217-223. Kawakami et al. (2000) Proc Natl Acad Sci USA, 97(21): 11403-11408. Koga et al. (1996) Nature, 383 :30.

Lavitrano et al. (1989) Cell, 57(5):717-723.

Liu et al. (2007) Nucleic Acids Res, 35:5683-5693.

Needleman and Wunsch, (1970) J Mol Biol, 48: 443-453.

Ongsvarraspone et al. (2007) Science Asia, 33 :35-39.

Solis et al. (2009) PLoS One, 4:e8424.

Claims

1. An isolated and/or exogenous nucleic acid molecule comprising a double- stranded region, wherein the double-stranded region comprises a sequence of nucleotides complementary to a target polynucleotide in a Neoparamoeba species.

2. The isolated and/or exogenous nucleic acid molecule of claim 1, wherein the double-stranded region reduces the expression of a polypeptide in a Neoparamoeba species cell when compared to an isogenic Neoparamoeba species cell lacking the isolated and/or exogenous nucleic acid molecule.

3. The isolated nucleic acid molecule of claim 1 or claim 2, wherein the double- stranded region is at least 19 basepairs in length.

4. The isolated and/or exogenous nucleic acid molecule of any one of the preceding claims, wherein the double-stranded region is less than 100 basepairs in length.

5. The isolated and/or exogenous nucleic acid molecule of any one of the preceding claims, wherein the RNA molecule comprises two or more double-stranded regions.

6. The isolated and/or exogenous nucleic acid molecule of claim 5, wherein each of the double-stranded regions comprises a sequence of nucleotides complementary to a different target polynucleotide in a Neoparamoeba species.

7. The isolated and/or exogenous nucleic acid molecule of any one of the previous claims, wherein the molecule comprises double-stranded RNA.

8. The isolated and/or exogenous nucleic acid molecule of any one of the preceding claims, wherein the nucleic acid molecule is selected from an siRNA, shRNA, eshRNA, miRNA and long dsRNA.

9. The isolated and/or exogenous nucleic acid molecule of any one of the preceding claims, wherein the nucleic acid molecule comprises at least one modified nucleotide.

10. The isolated and/or exogenous nucleic acid molecule of claim 9, wherein the at least one modified nucleotide is a 2'-modified oligonucleotide.

11. A nucleic acid construct comprising a nucleotide sequence encoding the isolated and/or exogenous nucleic acid molecule of any one of claims 1 to 10.

12. The nucleic acid construct of claim 11, wherein the nucleotide sequence encodes two or more isolated and/or exogenous nucleic acid molecules of any one of claims 1 to 10.

13. The nucleic acid construct of claim 11 or claim 12 comprising one or more promoters.

14. The nucleic acid construct of claim 13, wherein the construct comprises an RNA polymerase II and/or RNA polymerase III promoter.

15. The nucleic acid construct of claim 13, wherein each isolated and/or exogenous nucleic acid molecule encoded by the nucleic acid construct is operably linked to a different RNA polymerase III promoter.

16. A vector comprising the isolated and/or exogenous nucleic acid molecule of any one of claims 1 to 10 and/or the nucleic acid construct of any one of claims 11 to 15.

17. A cell comprising the isolated and/or exogenous nucleic acid molecule of any one of claims 1 to 10, the nucleic acid construct of any one of claims 11 to 15, and/or the vector of claim 16.

18. The cell of claim 17 which is a Neoparamoeba species cell.

19. The cell of claim 17, wherein the Neoparamoeba species is selected from Neoparamoeba pemaquidensis and Neoparamoeba perurans.

20. A composition comprising the isolated and/or exogenous nucleic acid molecule of any one of claims 1 to 10, the nucleic acid construct of any one of claims 11 to 15, the vector of claim 16, and/or the cell of any one of claims 17 to 19.

21. The composition of claim 20 which is a veterinary pharmaceutical composition.

22. The composition of claim 20 which is a feed composition.

23. The composition of any one of claims 20 to 22 which comprises a cell transfection reagent.

24. A transgenic non-human organism comprising the isolated and/or exogenous nucleic acid molecule of any one of claims 1 to 10, the nucleic acid construct of any one of claims 11 to 15, the vector of claim 16, the cell of any one of claims 17 to 19 and/or the composition of any one of claims 20 to 23.

25. The transgenic non-human organism of claim 24 which is a Neoparamoeba species.

26. The transgenic non-human organism of claim 25 which is a fish.

27. The transgenic non-human organism of claim 26 which is a salmonid.

28. The transgenic non-human organism of claim 27 which is salmon or trout.

29. The transgenic non-human organism of claim 24 which is a plant.

30. A method of inhibiting the expression of a target polynucleotide in a Neoparamoeba cell, the method comprising synthesizing the isolated and/or exogenous nucleic acid construct of any one of claims 1 to 10 in the cell.

31. A method of inhibiting the expression of a target polynucleotide in a Neoparamoeba cell, the method comprising introducing into the cell the isolated and/or exogenous nucleic acid molecule of any one of claims 1 to 10, the nucleic acid construct of any one of claims 11 to 15, the vector of claim 16 and/or the composition of any one of claims 20 to 23.

32. A method for determining the function of a target gene in a Neoparamoeba cell, the method comprising contacting the cell with and/or introducing into the cell the isolated and/or exogenous nucleic acid molecule of any one of claims 1 to 10, the nucleic acid construct of any one of claims 11 to 15, the vector of claim 16 and/or the composition of any one of claims 20 to 23.

33. A method of treating or preventing amoebic gill disease in a fish, the method comprising administering to the fish the isolated and/or exogenous nucleic acid molecule of any one of claims 1 to 10, the nucleic acid construct of any one of claims 11 to 15, the vector of claim 16, the composition of any one of claims 20 to 23, and/or the transgenic non-human organism of any one of claims 24 to 29.

34. The method of claim 33, wherein the method comprises feeding the fish a composition comprising the isolated and/or exogenous nucleic acid molecule of any one of claims 1 to 10, the nucleic acid construct of any one of claims 11 to 15, the vector of claim 16, the composition of any one of claims 20 to 23, and/or the transgenic non-human organism of any one of claims 24 to 29.

35. The method of claim 33, wherein the method comprises bathing the fish in a composition comprising the isolated and/or exogenous nucleic acid molecule of any one of claims 1 to 10, the nucleic acid construct of any one of claims 11 to 15, the vector of claim 16 and/or the composition of any one of claims 20 to 23.