WO2010067372A1 - Genetic markers of schizophrenia - Google Patents
Genetic markers of schizophrenia Download PDFInfo
- Publication number
- WO2010067372A1 WO2010067372A1 PCT/IL2009/001185 IL2009001185W WO2010067372A1 WO 2010067372 A1 WO2010067372 A1 WO 2010067372A1 IL 2009001185 W IL2009001185 W IL 2009001185W WO 2010067372 A1 WO2010067372 A1 WO 2010067372A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- allele
- snp
- single nucleotide
- nucleotide polymorphism
- polymorphism
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Definitions
- This invention relates to methods for genetic diagnosis and assessment of predisposition of a subject to mental or psychiatric disorder, particularly to schizophrenia.
- Schizophrenia is a severe and common psychiatric disorder with a lifetime risk of approximately 1% in the general population worldwide. It is a multi-factorial disorder, and its etiology includes strong genetic factors characterized by a complex inheritance pattern. Although the disease is predominantly hereditary, little is known about genetic factors and their effects on the pathophysiology of the disease. Multiple studies have reported oligodendrocyte and myelin abnormalities, as well as dysregulation of their related genes, in brains of schizophrenia patients (Tkachev et al 2003).
- Myelin basic protein encodes two families of proteins: classic-MBPs and golli-MBPs. While the classic-MBPs are predominantly located in the myelin sheaths of the nervous system, the golli proteins are more widely expressed and are found in both the immune and the nervous systems.
- Oligodendrocytes are responsible for the formation of myelin sheaths in the vertebrate central nervous system (CNS).
- Myelin basic protein (MBP) which is the second most abundant protein in the CNS myelin, is the only structural protein found so far to be essential for it's formation (Boggs 2006).
- the human MBP protein family arises from a genetic unit called genes of the oligodendrocyte lineage (golli), via use of various alternative splicing combinations among its 10 exons.
- the golli proteins are generated from the 5' transcription start site while the classic-MBPs are produced from a downstream transcription start site of the gene.
- the golli products differ from the classic-MBPs due to the presence of 133 additional amino-acids encoded by exons upstream to the classic-MBP transcription start site. While the classic-MBPs are predominantly located in the myelin sheaths of the nervous system, the golli proteins are more widely expressed and are found in both the immune and the nervous systems (Feng 2007). Golli knock-out (KO) mice, in which only the golli products of the MBP gene were ablated, have been reported to exhibit behavioral abnormalities reflective of neuronal abnormalities (Olmstead et al. 2000). Several studies have shown changes in MBP gene expression levels in schizophrenia and bipolar disorder in different brain regions (Chambers and Perrone-Bizzozero 2004, Haroutunian et al. 2007, Tkachev et al. 2003).
- the present invention is based on the finding that single nucleotide polymorphisms (SNPs) in the golli-MBP region of the MBP gene are associated with schizophrenia.
- SNPs include rsl2458282, rs2008323, rs721286 and any combination thereof.
- the SNPs of the present invention further include rs2013963, rs470549, rs7234883, rs9960721, rs685975, and rs7233574.
- these SNPs can serve as a basis for diagnosing a predisposition of a subject to schizophrenia. This can be achieved by determining allelic variants of the golli-MBP region of the MBP gene (golli-MBP), wherein the presence of a risk- haplotype is associated with predisposition to schizophrenia and the presence of a protective-haplotype is associated with non-schizophrenic subjects.
- allelic variants of the golli-MBP region of the MBP gene golli-MBP
- a risk- haplotype is associated with predisposition to schizophrenia and the presence of a protective-haplotype is associated with non-schizophrenic subjects.
- the present invention provides a method of diagnosing a predisposition of a subject to schizophrenia, wherein said method comprising testing a sample obtained from the subject for the presence of at least one allele or haplotype of the golli-MBP region selected from the group consisting of: (i) allele T of the C/T single nucleotide polymorphism (SNP) rs721286; (ii) allele A of the A/G single nucleotide polymorphism (SNP) rs2008323 ; (iii) allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282; (iv) allele A of the A/G single nucleotide polymorphism (SNP) rs2013963 ;
- the haplotype comprises allele C of the C/T polymorphism rsl2458282 5 and allele T of the C/T polymorphism rs721286.
- the haplotype comprises allele C of the C/T polymorphism rsl2458282, and allele A of the A/G polymorphism rs2008323.
- the haplotype may comprise allele A of the A/G polymorphism rs2008323, and allele T of the C/T polymorphism rs721286.
- the haplotype alternatively comprises allele C of the C/T polymorphism rs 12458282, allele A of the A/G polymorphism rs2008323, and allele T of the C/T polymorphism rs721286. Additionally, the haplotype can comprise allele C of the C/A single nucleotide polymorphism (SNP) rs9960721, allele A of the C/A single nucleotide polymorphism (SNP) rs685975, and allele G of the A/G single nucleotide polymorphism (SNP) rs7233574.
- SNP C/A single nucleotide polymorphism
- the present invention provides a method of diagnosing a subject as having low predisposition to schizophrenia, wherein said method comprising . _
- the haplotype may comprise allele T of the C/T polymorphism rs 12458282, and allele C of the C/T polymorphism rs721286. Additionally, the haplotype may comprise allele T of the C/T polymorphism rsl2458282, and allele G of the A/G polymorphism rs2008323. The haplotype may further comprise allele G of the A/G polymorphism rs2008323, and allele C of the C/T polymorphism rs721286.
- the haplotype may comprise allele T of the C/T polymorphism rs 12458282, allele G of the A/G polymorphism rs2008323, and allele C of the C/T polymorphism rs721286. Additionally, the haplotype can comprise allele A of the C/A single nucleotide polymorphism (SNP) rs9960721, allele C of the C/A single nucleotide polymorphism (SNP) rs685975, and allele A of the A/G single nucleotide polymorphism (SNP) rs7233574.
- the present invention provides a method of diagnosing a predisposition of a subject to schizophrenia, wherein said method comprising testing a sample obtained from the subject for the presence of at least one genotype of the golli- MBP region selected from the group consisting of:
- each of said genotype is indicative of a predisposition of the subject to schizophrenia.
- the subject may be human. Additionally, the subject may be an embryo, a fetus, a child, or an adult.
- the sample is a body fluid, preferably blood, saliva, cerebrospinal fluid, urine, or sperm.
- the testing for polymorphism is performed by SNP genotyping.
- the SNP genotyping is performed by a method selected from the group consisting of (a) a primer extension assay; (b) PCR assay; (c) an allele-specific PCR assay; (d) a nucleic acid amplification assay; (e) a hybridization assay; (f) a mismatch-detection assay, (g) an enzymatic nucleic acid cleavage assay, and (h) a sequencing assay.
- the methods of the present invention can further comprise measuring a clinical symptom of the subject.
- Clinical symptoms may be those known by physicians from literature or diagnosis manuals such as Diagnostic and Statistical Manual of Mental Disorders DSM-IV (American Psychiatric Association, 1994). The clinical symptoms may be used for increasing the confidence level results of the methods of the present invention.
- the methods of the invention may further comprise performing morphological analysis of the subject's brain for detecting aberrant brain morphology and microstructure changes.
- the morphological analysis is performed using magnetic resonance imaging (MRI).
- the morphological analysis is performed using functional magnetic resonance imaging (fMRI).
- the present invention further provides nucleic acid probes comprising a nucleotide sequence which hybridizes with at least a portion of golli-MBP region and which allows detection of at least one SNP.
- said at least one SNP is selected from the group consisting of rsl2458282, rs2008323, rs721286, rs2013963, rs470549, rs7234883, rs9960721, rs685975, rs7233574 or any combination thereof.
- said probe is used in diagnosis of schizophrenia or predisposition to schizophrenia
- the nucleic acid probe can also be used in correlating at least one SNP of golli-MBP region with the outcome of a schizophrenia treatment.
- the present invention further provides the use of nucleic acid probes comprising a nucleotide sequence which hybridizes with at least a portion of golli-MBP region and which allow detection of at least one SNP therein in diagnosis of schizophrenia or predisposition to schizophrenia.
- said at least one SNP comprises rsl2458282, rs2008323, rs721286, rs2013963, rs470549, rs7234883, rs9960721, rs685975, rs7233574 or any combination thereof .
- the present invention relates to a kit for carrying out any the methods provided herein.
- the kit is compartmentalized to receive a reagent for measuring single nucleotide polymorphism (SNP) in the golli- MBP region in a nucleic acid sample of a subject, said kit comprising at least one oligonucleotide that interacts with a single nucleotide polymorphism (SNP) in the golli- MBP polynucleotide region wherein said SNP polymorphism is selected from the group consisting of rsl2458282, rs2008323, rs721286, rs2013963, rs470549 3 rs7234883, rs9960721 , rs685975, rs7233574 and any combination thereof.
- SNP single nucleotide polymorphism
- the present invention further provides an array comprising a substrate having a plurality of segments, wherein at least one segment comprises a probe for detecting at least one single nucleotide polymorphisms (SNP) from the group consisting of:
- the present invention further provides use of the array in diagnosis of schizophrenia or predisposition to schizophrenia.
- the present invention provides a method for obtaining information regarding a predisposition of a subject to develop schizophrenia, said method comprising testing a sample obtained from the subject for the presence of at least one allele or haplotype of the golli-MBP region selected from the group consisting of:
- the information can be used for various purposes, for example to classify a subject in a clinical trial, or to screen populations.
- the present invention provides a method of diagnosing a subject having schizophrenic symptoms as a schizophrenic, comprising:
- step (b) identifying at least one schizophrenia symptom and optionally at least one schizophrenia risk factor in said subject; wherein presence of each of said single allele or haplotype in step (a) combined with the presence of at least one symptom or risk factor in step (b) is indicative of the subject as being schizophrenic.
- the present invention provides a method of determining a predisposition of a subject to having an aberrant brain morphology and micro structure changes, said method comprising testing a sample obtained from the subject for the presence of at least one allele or haplotype of the golli-MBP region selected from the group consisting of:
- the haplotype comprises allele C of the C/T polymorphism rsl2458282, allele A of the A/G polymorphism rs2008323, and allele T of the C/T polymorphism rs721286.
- aberrant brain morphology is manifested by at least one parameter selected from the group consisting of:
- ADC apparent diffusion coefficient
- FA fractional anisotropy
- the apparent diffusion coefficient (ADC) increase is observed in a brain region selected from the group consisting of: Right - middle temporal gyrus; Left - post central gyrus; Cerebellum; Post central lobule; Precuneus; Posterior cingulate cortex; and the anterior cingulated cortex (ACC).
- the fractional anisotropy (FA) change is observed as a decrease in FA in a brain region selected from the group consisting of: Left - superior longitudinal fasciculus; Right - superior frontal gyrus; Right - middle temporal gyrus; Right — medial frontal gyrus; anterior cingulated cortex and the Cerebellum.
- the fractional anisotropy (FA) change is observed as an increase in FA in a brain region selected from the group consisting of: Left — superior longitudinal fasciculus; Left Insula and the Claustrum.
- the change in gray matter volume is observed as a gray matter volume decrease in a brain region selected from the group consisting of: Left - medial frontal gyrus; Left - middle temporal gyrus; Left Insula; Left - superior temporal gyrus; Cerebellum; Lingual Gyrus; Right - superior frontal gyrus; Left - inferior frontal gyrus; Right - medial frontal gyrus; post central gyrus; Post central lobule and the anterior cingulated cortex.
- the change in gray matter volume is observed as a gray matter volume increase in a brain region selected from the group consisting of: Left - parahippocampal gyrus; Left - Claustrum and left amygdala.
- the present invention relates to a nucleic acid probe comprising a nucleotide sequence which hybridizes with at least a portion of golli-MBP region which allows detection of at least one polymorphism therein for use in correlating at least one polymorphism of golli-MBP region with the outcome of a schizophrenia treatment.
- the polymorphism of golli-MBP region is an allele or haplotype of the golli-MBP region selected from the group consisting of:
- the present invention is directed to a method for obtaining information regarding a predisposition of a subject to develop schizophrenia, the method comprising testing a sample obtained from the subject for the presence of at least one allele or haplotype of the golli-MBP region selected from the group consisting of: allele T of the C/T single nucleotide polymorphism (SNP) rs721286; allele A of the A/G single nucleotide polymorphism (SNP) rs2008323; allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282; allele C of the C/T single nucleotide polymorphism (SNP) rs721286; allele G of the A/G single nucleotide polymorphism (SNP) rs2008323; allele T of the C/T single nucleotide polymorphism (SNP) rsl2458282; allele A
- the information classifies a subject in a clinical trial. In other embodiments, the information classifies a population of subjects. In a specific embodiment, information correlates a specific haplotype/genotype with an outcome of a therapy for schzophrenia.
- Figure 1 is a schematic illustration of the genomic structure of the MBP gene.
- Figure 2 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO:1) that comprises rs721286 in accordance with an embodiment of the present invention
- Figure 3 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO.2) that comprises rs2008323 in accordance with an embodiment of the present invention
- Figure 4 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO:3) that comprises rs 12458282 hi accordance with an embodiment of the present invention
- Figure 5 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO:4) that comprises rs2013963 in accordance with an embodiment of the present invention
- Figure 6 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO: 5) that comprises rs470549 in accordance with an embodiment of the present invention
- Figure 7 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO:6) that comprises rs7234883 in accordance with an embodiment of the present invention
- Figure 8 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO:7) that comprises rs9960721in accordance with an embodiment of the present invention
- Figure 9 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO: 8) that comprises rs685975 in accordance with an embodiment of the present invention
- Figure 10 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO:9) that comprises rs7233574 in accordance with an embodiment of the present invention
- Figure 11 provides statistical parametric maps showing gray matter volume changes in risk-haplotype carriers compared with non-carriers.
- A Focusing on the ACC gray matter and
- B focusing on the left Amygdala gray matter.
- Figure 12 provides statistical parametric maps showing FA changes in risk- haplotype carriers compared with non-carriers.
- A Focusing on the ACC and
- B focusing on the left SFG.
- Figure 13 provides a statistical parametric map showing ADC elevation in risk- haplotype carriers compared with non-carriers.
- a polynucleotide includes a plurality of such polynucleotides and reference to “the SNP” includes reference to one or more SNPs and so forth.
- an "allele” is a particular form of a genetic locus, distinguished from other forms by its particular nucleotide sequence, or one of the alternative polymorphisms found at a polymorphic site.
- gene refers to a segment of genomic DNA that contains the coding sequence for a protein, wherein the segment may include promoters, exons, introns, and other untranslated regions that control expression.
- genotype is a 5' to 3 ' sequence of nucleotide pair(s) found at a set of one or more polymorphic sites in a locus on a pair of homologous chromosomes in an individual.
- genotype includes a full-genotype and/or a sub- genotype.
- Genetictyping shall mean a process for determining a genotype of an individual.
- haplotype shall mean a 5 ' to 3' sequence of nucleotides found at a set of one or more polymorphic sites in a locus on a single chromosome from a single individual.
- Haplotyping shall mean a process for determining one or more haplotypes in an individual and includes molecular techniques, and/or statistical inference.
- golli-MBP region or “goIH-MBP” refers to a genetic unit called genes of the oligodendrocyte lineage.
- risk-haplotype shall refer to an allele or haplotype, the presence of which is associated with predisposition to schizophrenia according to the present invention.
- protective-haplotype shall refer to an allele or haplotype, and the presence of which is associated with non-schizophrenic subjects.
- a "predisposition” or "susceptibility" of a subject to schizophrenia indicates that a subject has a tendency with a specified degree of statistical confidence to develop the disorder.
- the degree is determined by effect-sizing parameters (such as odds-ratio) relevant to the studied ethnic group.
- a “genetic locus” refers to a location on a chromosome or DNA molecule corresponding to a gene or a physical or phenotypic feature, where physical features include polymorphic sites.
- polymorphism shall refer to a sequence variation observed in an individual at a polymorphic site. Polymorphisms include nucleotide substitutions, insertions, deletions, and microsatellites and may but need not, result in detectable differences in gene expression or protein function. A “single nucleotide polymorphism” or “SNP” is a single nucleotide variation at a polymorphic site.
- An "oligonucleotide probe” or a “primer” refers to a nucleic acid molecule of between 8 and 2000 nucleotides in length, or is specified to be about 6 and 1000 nucleotides- in length.
- the length of these oligonucleotides can range from about 8, 10, 15, 20, or 30 to 100 nucleotides, but will typically be about 10 to 50 (e.g., 15 to 30 nucleotides).
- the appropriate length for oligonucleotides in assays of the invention under a particular set of conditions may be empirically determined by one of skill in the art.
- schizophrenia refers to a psychiatric disorder diagnosis that describes a mental disorder characterized by abnormalities in the perception or expression of reality. Typically, schizophrenia is diagnosed according to Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) (American Psychiatric Association 1994).
- DSM-IV Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition
- the term “Schizophrenia” shall also encompass schizophrenia related disorders such as but not limited to schizoaffective disorder, schizophreniform disorder, schizotypal personality disorder, schizotypy, a typical psychotic disorder, delusional disorder, brief psychotic disorder, avoidant personality disorders, bipolar disorder, and attention deficit hyperactivity disorder. It is to be understood that the methods, probes, arrays and kits of the present invention can also be used with respect to these conditions and disorders as well as for schizophrenia.
- a schizophrenic person i.e. a person suffering from schizophrenia, may exhibit numerous symptoms such as, but not limited to, abnormalities in the perception or in the expression of reality. Schizophrenia is typically manifested by various symptoms such as, for example, auditory hallucinations, paranoid or even playful delusions. Schizophrenia may also be manifested in disorganized speech and unusual thinking characterized by significant social or occupational dysfunction. Disorganized speech may be in the form loosely connected sentences and meaning, incoherence (word salad). A schizophrenic person may also suffer from loss of train of thought (thought disorder) and subject flow. In one uncommon species of schizophrenia, the person may be mute, motionless, or exhibit purposeless agitation, and other signs of catatonia. As a result the person may be socially impaired. The standardized criteria for diagnosing schizophrenia are derived from the
- schizophrenia symptoms refers to any biological sample obtained from a subject which is suitable for isolation of nucleic acids. Such biological sample may be obtained from e.g. blood, saliva, cerebrospinal fluid, urine, feces or sperm.
- SNPs are common single nucleotide variations that occur in a population. SNPs are obtainable from various repositories such as Ensembl, a joint project between EMBL - European Bioinformatics Institute (EBI) and the Wellcome Trust Sanger
- HapMap project seek to identify the genetic patterns of human DNA sequence variation. Information such as SNP genotypes, recombination rates may be downloaded from the HapMap website (www.hapmap.org).
- SNPs are conventionally identified by their relative position within a nucleotide sequence. Typically, following identification of an SNP a database reference is provided, "rs" number/SNP ID number. Consequently, sequence and other information related with a given "rs" number/SNP ID number may be obtained by browsing, for example, the dbSNP of the Entrez SNP which is provided by the NCBI, at www.ncbi.nlm.nih.gov.
- Magnetic resonance imaging or “MR/” - refers to an imaging method to visualize detailed internal structure and function of the brain.
- fMRI Functional MRI
- DTI diffusion tensor imaging
- DTI enables quantification of fractional anisotropy (FA) and apparent diffusion coefficient (ADC) of water molecules and can provide high-contrast images of the brain's white matter.
- FA fractional anisotropy
- ADC apparent diffusion coefficient
- brain morphology shall refer to the brain morphology of a subject and shall include at least one of the following structural features: morphological volume measurements of brain structures, gray matter, white matter, myelination of brain tissue, fiber organization, axon morphology, fractional anisotropy (FA) and apparent diffusion coefficient (ADC).
- FA fractional anisotropy
- ADC apparent diffusion coefficient
- aberrant brain morphology shall refer to at least one morphological brain feature selected from the group consisting of: myelin and myelination disruption, aberrant fiber organization or aberrant axon morphology, abnormally small axons, aberrant water content in the brain's regions, decrease of cellular compartment or increase of extra-cellular volume.
- grey matter shall refer to the component of the central nervous system, consisting of neuronal cell bodies, neuropil (dendrites and axons), glial cells (astroglia and oligodendrocytes), and capillaries.
- Grey matter contains neural cell bodies, in contrast to white matter, which mostly contains myelinated axon tracts.
- array refers to a two dimentional systematic arrangement of oligonucleotides, usually in rows and columns on a solid substrate.
- the array may consist of series of thousands of microscopic spots of oligonucleotides, each containing minute amounts of the oligonucleotide probes.
- the probes are used to hybridize with samples of nucleic acids under high-stringency conditions.
- Probe-target hybridization may be detected and quantified by detection of fluorophore-, silver-, or chemiluminescence-labeled targets to determine relative abundance of nucleic acid sequences in the target.
- the probes may be attached to the solid surface by a covalent bond to a chemical matrix (for example via epoxy-silane, amino-silane, lysine, polyacrylamide or others).
- the solid surface can be glass, a silicon chip, or microscopic beads.
- the array or microarray is used to detect
- the present invention utilizes single nucleotide polymorphisms in the golli-MBP region for diagnosing a subject for predisposition to schizophrenia.
- the invention contemplates, inter alia, SNP genotyping of golli-MBP region, e.g. by allele-specific PCR and can be used to develop polynucleotide-based tests for use as prognostics to predict a subject susceptibility to schizophrenia.
- the invention also provides oligonucleotides, kits, devices, and substrates useful for detecting polymorphisms associated with subjects suffering or having a genetic predisposition to suffer from schizophrenia.
- Oligonucleotide primers and probes of the present invention can be prepared by any suitable method, including, for example, cloning and restriction of appropriate sequences and direct chemical synthesis.
- Oligonucleotide probes and primers can comprise DNA, RNA, nucleic acid analogs such as, for example peptide nucleic acids, locked nucleic acid (LNA) analogs, and morpholino analogs.
- the 3' end of the probe can be functionalized with a capture or a detectable label to assist in detection of a polymorphism.
- Any of the oligonucleotides or nucleic acids of the invention can be labeled by incorporating a detectable label measurable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means.
- such labels can comprise radioactive substances ( P, S 5 H, I), fluorescent dyes (5- bromodesoxyuridin, fluorescein, acetylaminofluorene, digoxigenin), biotin, nanoparticles, and the like.
- fluorescent dyes 5- bromodesoxyuridin, fluorescein, acetylaminofluorene, digoxigenin
- biotin nanoparticles, and the like.
- oligonucleotides are typically labeled at their 3' and 5' ends.
- a probe refers to a molecule which can detectably distinguish between target molecules differing in structure. Detection or testing for a single nucleotide polymorphism (SNP) can be accomplished in a variety of different ways depending on the type of probe used and the type of target molecule. Thus, for example, detection may be based on discrimination of activity levels of the target molecule, but typically is based on detection of specific binding. Non exhaustive examples of such specific binding include antibody binding and oligonucleotide probe hybridization, amplification techniques or others described below. Thus, for example, probes can include enzyme substrates, antibodies and antibody fragments, oligonucleotide hybridization probes and oligonucleotide primers.
- the detection of the presence or absence of the at least one variant, or single nucleotide polymorphism involves contacting a target polymorphic site with a probe, typically an oligonucleotide probe, where the probe binds or hybridizes with a form of the target polymorphic site (e.g., the target nucleic acid containing a complementary base at the variance site as compared to hybridization to a form of the target nucleic acid having a non-complementary base at the variance site, where the hybridization is carried out under selective hybridization conditions).
- a probe typically an oligonucleotide probe
- the probe binds or hybridizes with a form of the target polymorphic site (e.g., the target nucleic acid containing a complementary base at the variance site as compared to hybridization to a form of the target nucleic acid having a non-complementary base at the variance site, where the hybridization is carried out under selective hybridization conditions).
- polymorphisms associated herein with subjects having a genetic predisposition to suffer from schizophrenia disclosed in the present invention comprise the following SNPs:
- the specific alleles indicating predisposition or risk of manifestation of a schizophrenia can be selected from the group of:
- the polymorphisms associated with subjects having a genetic predisposition to suffer from a schizophrenia disclosed in the present invention may further comprise the following SNPs:
- the specific alleles indicating predisposition or risk of manifestation of schizophrenia may further be selected from the group of:
- the polymorphisms associated with subjects having a genetic predisposition to suffer from schizophrenia disclosed in the present invention may further comprise the following SNPs:
- the specific alleles indicating predisposition or risk of manifestation of schizophrenia may further be selected from the group of: (a) allele C of the C/A single nucleotide polymorphism (SNP) rs9960721 ;
- SNP A/G single nucleotide polymorphism rs7233574.
- the presence of any SNP of the present invention is determined in relation to the adjacent nucleotide sequence upstream and downstream from any of the polymorphic site disclosed herein, as a non-limiting example, about 14 nucleotides upstream and about 14 nucleotides downstream of the polymorphic site.
- FIG. 1 schematically illustrates the respective loci of rs721286, rs2008323, rsl2458282, rs2013963, rs470549, and rs7234883 at the MBP gene.
- Top figure 1 is a schematic illustration of the genomic structure of the MBP gene.
- Exons colored in black are golli-MBP exons and those colored in white are classic-MBP exons. Location of the 26 studied markers is shown; SNPs colored in black had significantly (PO.05) different genomic/allele distribution between patients and healthy controls. Markers marked with '*' are of haplotype rs721286-rs2008323-rsl2458282 that was genotyped in the second cohort. Linkage disequilibrium plot of the gene in the CEU population from the HapMap database (www.hapmap.org), adapted from Haploview (www.broad.mit.edu/mpg/haploview) was prepared.
- SNPs of the present invention are located approximately 4 kb downstream from the golli-MBP third exon.
- these SNPs represent a linkage disequilibrium (LD) block.
- the LD block with the associated haplotypes is marked at the bottom of Figure 1.
- this strongly associated block encompasses an exon, its SNPs are intronic. Without being bound by theory, it is possible that these SNPs affect the regulation of the gene, by creating alternative secondary structures or by influencing interactions with the transcriptional machinery.
- the respective location of each SNP in the sequence of the gene is shown in figures 2-10.
- the SNPs of the invention were identified in the Ashkenazi Jewish population.
- the Ashkenazi Jewish population is closely related to the general Caucasian population in terms of allele frequencies and linkage disequilibrium (Silberberg G et al. 2006). Therefore, the SNPs and all other aspects of the invention can be used in Caucasian populations as well.
- the use of the SNPs of the invention should not be limited to the Ashkenazi Jewish population or to Caucasian populations.
- the same SNPs may be schizophrenia-associated in other ethnic groups as well.
- DNA is obtained from a subject.
- the subject's DNA is then used to test for the presence of one or more of the schizophrenia- associated SNPs of the present invention. If the subject has been identified as carrying one or more of the SNPs then the subject is diagnosed as having a predisposition for schizophrenia.
- the present invention provides a method of diagnosing a predisposition of a subject to schizophrenia which comprises testing a sample obtained from the subject for the presence of an allele or haplotype of the golli-MBP region indicative that the subject is susceptible to schizophrenia, wherein at least one haplotype is selected from the group consisting of:
- the present invention provides a method of diagnosing a predisposition of a subject to schizophrenia which comprises testing a sample obtained from the subject for the presence of an allele or haplotype of the golli-MBP region indicative that the subject is susceptible to schizophrenia, wherein said allele or haplotype is an SNP in complete LD with any of the group consisting of: the single nucleotide polymorphisms (SNPs) rs721286, rs2008323 or rsl2458282; wherein the presence of each of said single allele or haplotype is indicative of a predisposition of the subject to schizophrenia.
- the presence of each of said single allele or haplotype is indicative of a predisposition to having an aberrant brain morphology or microstructure.
- the haplotype may comprise allele C of the C/T polymorphism rsl2458282, and allele T of the C/T polymorphism rs721286.
- the haplotype comprises allele C of the C/T polymorphism rsl 2458282, and allele A of the A/G polymorphism rs2008323.
- the haplotype may comprise allele A of the A/G polymorphism rs2008323, and allele T of the C/T polymorphism rs721286.
- the haplotype may also comprise allele C of the C/T polymorphism rsl2458282, allele A of the A/G polymorphism rs2008323, and allele T of the C/T polymorphism rs721286.
- the haplotype may also comprise allele C of the C/A single nucleotide polymorphism (SNP) rs9960721, allele A of the C/A single nucleotide polymorphism (SNP) rs685975, and allele G of the A/G single nucleotide polymorphism (SNP) rs7233574.
- the SNPs identified herein can be used in combination with additional predictive tests including, but not limited to, additional SNPs, mutations, and clinical tests.
- the present invention provides a method of diagnosing a subject as having low predisposition to schizophrenia, wherein said method comprising testing a sample obtained from the subject for the presence of at least one protective haplotype of the golli-MBP region.
- the protective haplotype of the present invention may comprise allele T of the C/T polymorphism rsl2458282, and allele C of the C/T polymorphism rs721286.
- the protective haplotype may comprise allele T of the C/T polymorphism rsl2458282, and allele G of the A/G polymorphism rs2008323.
- the protective haplotype may further comprise allele G of the A/G polymorphism rs2008323, and allele C of the C/T polymorphism rs721286.
- the protective haplotype may comprise allele T of the C/T polymorphism rs 12458282, allele G of the A/G polymorphism rs2008323, and allele C of the C/T polymorphism rs721286.
- the protective haplotype may comprise allele A of the C/A single nucleotide polymorphism (SNP) rs9960721, allele C of the C/A single nucleotide polymorphism (SNP) rs685975, and allele A of the A/G single nucleotide polymorphism (SNP) rs7233574.
- the present invention provides a method of diagnosing a subject as having low predisposition to schizophrenia, wherein said method comprising testing a sample obtained from the subject for the presence of at least one genotype of the golli'MBP region.
- the protective genotype is a G/G genotype of a single nucleotide polymorphism (SNP) rs2013963.
- the protective genotype is a G/G genotype of a single nucleotide polymorphism (SNP) rs470549.
- the present invention provides a method of diagnosing a predisposition of a subject to schizophrenia, wherein said method comprising testing a sample obtained from the subject for the presence of at least one genotype of the golli- MBP region selected from the group consisting of:
- any combination thereof wherein the presence of each of said genotype is indicative of a predisposition of the subject to schizophrenia.
- the subject may be human. Additionally, the subject can be an embryo, a fetus, a child, or an adult. In some embodiments, the human is of Caucasian descent.
- the sample is a body fluid, preferably blood, saliva, cerebrospinal fluid, urine, or sperm.
- the testing for polymorphism is performed by SNP genotyping.
- the SNP genotyping is performed by a method selected from the group consisting of (a) a primer extension assay; (b) PCR assay; (c) an allele-specific PCR assay; (d) a nucleic acid amplification assay; (e) a hybridization assay; (f) a mismatch-detection assay, (g) an enzymatic nucleic acid cleavage assay, and (h) a sequencing assay.
- primers may be derived from the following sequences:
- T (SEQ ID: 12, per rsl2458282).
- TGA 5 (SEQ ID: 13, per rs2013963 ).
- AAC (SEQ ID: 15, per rs7234883).
- CAG (SEQ ID: 17, per rs685975).
- schizophrenia-identifying marker (s) shall mean schizophrenia-identifying markers, genotype(s) and/or haplotype(s) or single allele(s) of genomic variations. It is therefore contemplated that the above described methods of the invention may be utilized in combiation with additional schizophrenia- identifying markers.
- the schizophrenia-identifying markers may include, but are not limited to, the following polymorphic variations, as disclosed in WO2006/072075 and WO2008/093343: allele A at rs9494332 in C6or£217 which is linked to the human abelson Helper Integration Site 1 gene (AHIl); rs6925684, rs6902485, rs6935033, rs7739635, rs9494332 and rsl475069 on chromosome 6q23; rs911507 and rsl2211505 on chromosome 6q23; rs737734, rsl36770, rs763126, rs738598, rsl573726, rs!38844, rs738596 5 rsl35819, rsl573726, rs!053744, rsl53221, rs2269523, rs737734, rsl34474,
- the schizophrenia- identifying markers may also include polymorphisms in the genes dysbindin (DTNBPl), D-amino acid oxidase (DAAO), neuregulinl (NRGl), D-amino acid oxidase activator (DAOA), catechol-0-methyltransferase (COMT) disclosed in WO 03/070082), regulator of G-protein signaling 4 (RGS4) disrupted-in-schizophrenia-1 (DISCI), proline dehydrogenase PRODH, trace amine receptor (TRAR4) reported in WO 2006/023719, human G protein coupled receptor Seq-40 disclosed in U.S. Patent Application Publication No. 20040115699, SP4 gene; other polymorphism associated with schizophrenia and schizophrenia related disorders located at chromosome 22; and polymorphisms of the Sulfotransferase 4Al (Sult4al) gene.
- DTNBPl dysbindin
- DAAO D-amino acid oxidase
- the methods of the present invention can further comprise measuring a clinical symptom of the subject.
- Clinical symptoms may be those known by physicians from literature or diagnosis manuals such as Diagnostic and Statistical Manual of Mental Disorders DSM-IV (American Psychiatric Association, 1994). The clinical symptoms may be used for increasing the confidence level results of the methods of the present invention.
- the methods of the present invention optionally further comprise diagnosis of a schizophrenia risk factor.
- the subject diagnosed has at least one additional risk factor associated with schizophrenia.
- the risk factor may typically comprise: ⁇
- the subject has a family relative being selected from the group: a parent, uncle, aunt, grandparent, sibling, or child diagnosed as schizophrenic; (3) mixed-handedness; and
- the present invention provides means for minimizing the effect of schizophrenia.
- the present invention can be used to identify, or diagnose and indeed allow early treatment of the prodromal phase of schizophrenia (pre-onset). This is achieved by early diagnosis of predisposition to schizophrenia in combination with identification of other schizophrenia associated symptoms and risk factors characterizing pre-onset of the illness.
- pre-onset of the illness is characterized by negative symptom of schizophrenia in which the individual lacks interest and drive i.e. avolition, or impairment of social behavior.
- the present invention further provides a kit useful for identifying polymorphisms associated with predisposition to schizophrenia.
- the kit of the invention can comprise one or more oligonucleotides designed for identifying both alleles for each SNP in the set of one or more SNPs of the present invention.
- the kit further comprises a manual with instructions for performing one or more reactions on a human nucleic acid sample to identify the allele or alleles present in the subject at each PS in the set of one or more SNPs.
- oligonucleotides in a kit of the invention may also be immobilized on or synthesized on a solid surface such as a microchip, bead, or glass slide (see, e.g., WO 98/20020 and WO 98/20019).
- a solid surface such as a microchip, bead, or glass slide.
- immobilized oligonucleotides may be used in a variety of polymorphism detection assays, including but not limited to probe hybridization and polymerase extension assays.
- Kits of the invention may also contain other components such as hybridization buffer (e.g., where the oligonucleotides are to be used as allele-specific probes) or dideoxynucleotide triphosphates (ddNTPs; e.g., where the alleles at the polymorphic sites are to be detected by primer extension).
- the set of oligonucleotides consists of primer-extension oligonucleotides.
- the kit may also contain a polymerase and a reaction buffer optimized for primer-extension mediated by the polymerase.
- kits may also include detection reagents, such as biotin- or fluorescent-tagged oligonucleotides or ddNTPs and/or an enzyme-labeled antibody and one or more substrates that generate a detectable signal when acted on by the enzyme.
- detection reagents such as biotin- or fluorescent-tagged oligonucleotides or ddNTPs and/or an enzyme-labeled antibody and one or more substrates that generate a detectable signal when acted on by the enzyme.
- the present invention further provides a nucleic acid probe comprising a nucleotide sequence which hybridizes with at least a portion of golli-MBP region and which allows detection of at least one polymorphism.
- the nucleic acid probe can be used for diagnosing schizophrenia, or for diagnosing a predisposition for schizophrenia.
- the nucleic acid probe can further be used in correlating at least one polymorphism of golli-MBP region with the outcome of a schizophrenia treatment.
- the present invention focuses on the golli-MBP gene, by analyzing it in two large Jewish-Ashkenazi cohorts.
- SNPs single nucleotide polymorphisms
- brain morphology and microstructure analyses using fMRI was performed in healthy subjects carrying the risk-haplotype: allele T of the C/T single nucleotide polymorphism (SNP) rs721286; allele A of the A/G single nucleotide polymorphism (SNP) rs2008323; and allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282 (referred to herein as the "TAC risk haplotype").
- TAC risk-haplotype carriers showed significant gray matter volume reduction, as compared to non-risk-haplotype carriers, in several brain regions: left medial frontal gyrus, left middle temporal gyrus, the left insula, left superior temporal gyrus, and the anterior cingulate cortex. These brain regions have been previously reported to manifest gray matter deficits in schizophrenia (For example, see Wilke et al., 2001; Shenton et al., 2001; and Kubicki et al., 2002).
- TAC risk-haplotype carriers also showed gray matter volume increase in the left side of the amygdala, claustrum and para-hippocampal gyrus. Increases of bilateral para-hippocampal gyrus volume have been reported in unaffected relatives of schizophrenia patients (Goghari et al., 2007).
- Maps of Fractional anisotropy (FA) and apparent diffusion coefficient (ADC) can be produced from the image analysis of the fMRI data.
- a decrease in FA was found in the right hemisphere frontal and temporal gyrus and the anterior cingulated cortex, while an increase in FA was observed in the Insula, left superior frontal gyrus and Claustrum of TAC risk-haplotype carriers.
- TAC risk-haplotype carriers also showed a wide-spread increase in the ADC in both hemispheres, including the anterior cingulate cortex, right middle temporal gyrus, left post central gyrus, cerebellum, post-central lobule, precuneus and posterior cingulate cortex.
- the first cohort included 120 unrelated Ashkenazi-Jewish schizophrenia patients (86 males, 34 females) and 236 unrelated control (143 males, 93 females) individuals.
- the patients were recruited in Abarbanel hospital, Bat- Yam Israel, and signed informed consent forms.
- the second cohort included 379 (235 males, 144 females) unrelated Ashkenazi-Jewish schizophrenia patients which were selected randomly from a larger cohort studied previously (Shifinan et al. 2002).
- SNP selection SNPs included in the association analysis were selected from the CEU (Caucasian European Utah) population in the HapMap project database (http://www.hapmap.com), which highly resembles the Ashkenazi-Jewish population as previously discussed [Korostishevsky et al. 2004]. Twenty six tagging SNP markers (the minimal group of SNPs required to define all haplotypes in a given linkage disequilibrium (LD) block), along the 123.5 kb DNA stretch of the two golli-MBP transcripts, were selected for genotyping using the Haploview software, version 3.32 (Broad Institute of MIT and Harvard, Cambridge, MA, USA) ( Figure 1).
- SNP genotyping Genomic DNA from patients and controls was isolated from peripheral blood using the PureGene kit (Gentra, MN) according to the manufacturer's protocol and was second-handed for genotyping. SNP genotyping was performed by the high-throughput system of chip-based mass spectrometry (matrix-assisted laser desorption/ionization time-of-flight; MALDI-TOF) (Sequenom, Inc., San Diego, CA 5 http://www.sequenom.com/) using the iPLEXTM chemistry.
- MALDI-TOF matrix-assisted laser desorption/ionization time-of-flight
- the reaction volume of 5 ⁇ L contained 7.5 ng of genomic DNA, 100 nM each of the forward and reverse sequence-specific primer that contained a universal sequence at its 5' end, 0.5 mM of each deoxynucleoside triphosphate, 1.625 mM MgC12, reaction buffer, and 0.5 units of HotStarTaq DNA polymerase (Qiagen, Germany).
- PCR conditions were as follows: an initial denaturation step for 15 min at 94°C, followed by 45 cycles of 20 sec at 94°C, 30 sec at 56°C, 1 min at 72°C, and a final extension step for 3 min at 72°C. Allele-specific primer extensions were conducted with the Mass EXTEND Reagents Kit containing di-deoxy nucleotides (Sequenom). The high- throughput liquid handling was performed with the aid of a MULTIMEK 96 automated 96-channel robot (Beckman Coulter, Fullerton, California).
- Primer extension products were loaded onto a 384-element chip (SpectroCHIP; Sequenom) by nanoliter pipetting robot (SpectroPOINT, Sequenom) and analyzed with a MassARRAY mass spectrometer (Bruker Daltonik, Bremen, Germany). The resulting mass spectra were processed and analyzed for peak identification and allele determination with the MassARRAY 3.0 software (Sequenom). All SNPs were re-genotyped in 22 randomly- selected DNA samples, and 8-12 spots on each chip were loaded with water as negative controls. AU replicates were in agreement with each other and no signal was observed in the negative control wells.
- DLPFC Brodmann area 46
- DSM-IIIR American Psychiatric Association
- DSM-IV American Psychiatric Association
- RNA isolation and golli-MBP expression were performed as previously described (Korostishevsky et al. 2004). Golli- MBP mRNA expression was quantified in DLPFC brain samples obtained from 32 schizophrenia patients and 34 controls by real-time PCR using Absolute SYBR Green Mix (ABgene, Epsom, UK) on an ABI Prism 7900HT sequence detection system (Applied Biosystems, Foster City, US). Amplification conditions were: 50°C for 2 min, 95°C for 15 min, followed by 40 cycles of 95°C for 15 s, 60 0 C for 1 min. Real-time primers were designed using PrimerExpress software, with a specified amplicon length between 80 and 150 bp.
- Primer sequences for the golli-MBP gene were: forward, 5'- GAGAAGGCCAGTACGAATAG-3' (SEQ ID: 19) and reverse, 5'- GAACACTTCGTTGTCCTCTG-S' (SEQ ID: 20).
- Primer sequences for the reference gene TFRC (Transferrin receptor) were: forward, 5'-
- TFRC gene was analyzed in our lab along with 15 other reference genes using a micro fluidic card (TaqMan® Gene Expression Assays) and was found to be the most stably expressed in the examined tissue (unpublished data).
- Ct is the threshold cycle
- ⁇ Ct Ct (target) - Ct (reference)
- ⁇ Ct ⁇ Ct (sample) - ⁇ Ct (calibrator sample).
- TFBS transcription factor binding sites
- UCSC Santa Cruz
- ORegAnno Open Regulatory Annotation
- PCR Polymerase chain reaction
- PCR was performed in 36 cycles of 94°C for 30 seconds, 62 0 C ⁇ golli-MBP exon 3) or 56°C ⁇ golli-MBP CTCF) for 45 seconds, 72°C for 45 seconds, with a final extension step at 72°C for 10 minutes.
- the primer sequences were (amplicon length is in parentheses): golli-MBP exon 3: forward 5'-GTGCATGCCACCACACCT-3 l (SEQ ID: 23) and reverse 5'-TGCTTAGGTGCTTAGGCAGA-S' (SEQ ID: 24) (597 bp); golli- MBP CTCF region: forward 5 l -AAAAATCAGGGGAATATTATTACAAG-3 1 (SEQ ID: 25) and reverse S'-CAGTTATACTCCATTACAGGATGCTT-S' (SEQ ID: 26) (818 bp).
- PCR products were purified using High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's instructions, and visualized on 2% agarose gels. Direct sequencing was carried out by using the ABI PRISM Big Dye Terminator Cycle Sequencing kit and the ABI PRISM 3100 automated sequencer (Applied Biosystems).
- Mantel-Haenszel P- value of genotypic association (2 by 3 by K tables) was calculated using Cochran-Mantel-Haenszel Chi- Squared test in "R”. Gene expression levels and correlations with the "risk'V'protective" haplotypes were compared by the appropriate tests using SPSS ** J J "
- mice According to their genotyping, 26 subjects (Table 4) were asked to undergo an MRI scan and signed informed consent forms of the of Tel-Aviv Sourasky Medical Center ethics committee.
- the genotyped subjects were: 8 individuals homozygous to the risk-haplotype (the TAC risk-haplotype), 6 individuals homo ⁇ ygous to the protective-haplotype and 12 individuals who carry a neutral-haplotype that is neither the defined risk/protective haplotypes. These subjects were divided and analyzed in two groups: individuals that carry the TAC risk-haplotype ("Risk-Haplotype carriers” group) and individuals that carry the 'protective' and 'neutral' haplotypes ("Non- carriers” group) (Table 4).
- Table 4 provides demographic characteristics of the studied groups which participated in the association study of DNA polymorphism in golli-MBP and fMRI brain morphology. Subjects were divided into two groups (Risk-Haplotype carriers; Non-carriers) according to their golli-MBP 3-SNPs haplotype status. There were no significant group differences in age or sex ratios. - -
- Genomic DNA was isolated from peripheral blood using the ArchiveGeneTM DNA Purification kit (5 PRIME, Gaithersburg, MD) according to the manufacturer's protocol. SNPs were genotyped by high-throughput chip-based mass spectrometry (matrix- assisted laser desorption/ionization time-of-flight; MALDI-TOF) (Sequenom, Inc., San Diego, CA, http://www.sequenom.com/) system, using the iPLEXTM chemistry. All assays for the PCR and associated extension reactions were designed by the SpectroDESIGNER software (Sequenom) and primers were synthesized by Integrated DNA Technologies (Coralville, Iowa).
- the 5 ⁇ L reaction volume contained 7.5 ng of genomic DNA, 100 nM each of the forward and reverse sequence-specific primer that contained a universal sequence at its 5' end, 0.5 mM of each deoxynucleoside triphosphate, 1.625 mM MgC12, reaction buffer, and 0.5 units of HotStarTaq DNA polymerase (Qiagen, Germany).
- PCR conditions were as follows: an initial denaturation step for 15 min at 94°C, followed by 45 cycles of 20 sec at 94°C, 30 sec at 56°C, 1 min at 72°C, and a final extension step for 3 min at 72°C.
- the MRI protocol included conventional anatomy sequences and DTI acquired with a standard head-coil.
- FLAIR images Fluid-attenuated inversion recovery sequence with 24 axial slices, TR/TE/TI - 9000/140/2100 ms and resolution 1x1x4 mm 3 . While the T2 and FLAIR images were used for radiological assessment of the subjects, the 3D Tl weighted images were used for volumetric analysis and as reference to the DTI experiments.
- Image analysis included processing of the DTI and SPGR data sets. From the DTI data sets, maps of the fractional anisotropy (FA) and apparent diffusion coefficient (ADC) indices were produced using in-house software written in Matlab 7.3.0 (mathworks, Natick, MA). Image artifacts, normalization, unwrapping and statistical analysis, were performed using the SPM software (version 2, UCL, London, UK). Correction of head motion was performed using a least squares algorithm and 6 parameter (rigid body) transformations. Spatial normalization was done using 12- . .
- FA fractional anisotropy
- ADC apparent diffusion coefficient
- Voxel based analysis was used detect regionally specific differences in brain tissue composition on a voxel by voxel basis (Ashburner and Friston, 2000) for each of the indexed maps (FA, ADC, GMP and WMP) (Cram et al., 2003). In this analysis we used ANOVA tests to compare between the genetically defined groups.
- the results of the VBA analysis are presented as statistical parametric t-maps superimposed on SPGR brain template with resolution of 1.5x1.5x1.5 mm 3 where colored regions represent areas passing the statistical threshold of p ⁇ 0.005 and the color-scale represents the t- values.
- Genotypes were obtained for most individuals with a mean completion rate of 95.2% ⁇ 3.6% for 25 SNPs, not including marker rs470291, which was successfully genotyped in only 25.7% of the samples and was excluded from the study.
- Table 1 provides a list of genotype and allele frequencies pertaining to 6 SNPs significantly associated with schizophrenia of cohort I; OR, odds ratio for the risk genotype/allele, except of markers rs2013963 and rs470549 in which OR is for the protective genotype; 95%-CI, 95% confidence interval; P, Chi square P-value, except of markers rs2013963 and rs470549 that were calculated by Fisher exact test.
- the study focused on 3 of the 6 SNPs 5 (rs721286, rs2008323, rsl2458282), which formed one LD block with associated haplotypes that contains exon 3 of the gene, and genotyped them in cohort II.
- the other 3 SNPs which were associated with schizophrenia in Cohort I rs2013963, rs470549 and rs7234883).
- Genotypes were 0 obtained for most individuals with a mean completion rate of 96.4% ⁇ 1.2% and all SNPs were within Hardy- Weinberg equilibrium both in schizophrenia and control groups. No gender effect was observed on any of the markers in either cohort.
- Table 2 provides a list of Genotype and allele frequencies pertaining to 3 SNPs of cohort II; OR, odds ratio for the risk genotype/allele; 95%-CI, 95% confidence0 interval.
- Table 3 provides a list of estimated haplotypes frequencies of cohort I, cohort II,5 and the combined data. Simulated P-values and OR were calculated using Mantel- Haenszel Chi-Squared Test for the combined data of cohorts I and II with assigned covariates. The three most common haplotypes of each block are presented; OR, odds ratio; D', standardized LD coefficient.
- the LD block is predicted to be highly conserved by a gap scoring algorithm ("chain” tracks) with placental mammals.
- RP regulatory potential
- 7x Reg potential 0.284
- average RP 0.108
- ORegAnno Open Regulatory Annotation
- golli-MBP exon 3 and regulatory CTCF-binding site regions were sequenced for 20 of the cohort I samples: 5 patients homozygote to the risk haplotype, 5 patients homozygote to the protective haplotype, 5 controls homozygote to the risk haplotype and 5 controls homozygote to the protective haplotype. While novel changes in the genomic sequence of the examined regions were not found, 3 SNPs in the CTCF-binding site region sequence (rs9960721, rs685975, rs7233574) were observed to be in complete LD with the associated haplotype.
- mRNA expression levels in postmortem DLPFC samples were examined.
- the haplotypes found to be associated with the disease were examined for their affect mRNA expression levels.
- Table 5 provides for significant differences in gray matter probability between risk-haplotype carrier and non carriers.
- L left, R — right, MFG - medial frontal gyrus, MTG - middle temporal gyrus, STG - superior temporal gyrus, SFG - superior frontal gyrus, IFG - inferior frontal gyrus, POG - post central gyrus, PCL - post-central lobule, ACC - anterior cingulate cortex, PHG - parahippocampal gyrus, Amg - amygdala.
- x,y,z (mm) represents the MNI atlas coordinate of the most significant voxel within the cluster
- P COr ⁇ e cte d represents the p-value at the cluster level following small volume correction
- K is the number of voxel of the cluster
- T represents the X- value at the most significant voxel.
- Voxel-based morphometry (VBM) of the gray matter probability maps revealed a significant decrease in gray matter volume of TAC risk-haplotype carriers compared to non-carriers in several brain regions, with strongest effects observed in the left medial frontal gyrus, left middle temporal gyrus, left insula and left superior temporal gyrus, Cerebellum, Lingual Gyrus, Right superior frontal gyrus, Left inferior frontal gyrus, Right medial frontal gyrus, Post central gyrus and the Post central lobule. Similar regions were found in the right hemisphere but with lower statistical significance (Table 5).
- Figure 11 provides statistical parametric maps showing gray matter volume decrease (Left (A): focusing on the ACC gray matter reduction and increase (Right (B): focusing on the left Amygdala gray matter elevation CP con - ectecT ⁇ -OOS)) in risk-haplotype carriers compared with non-carriers (at a threshold of P uncorreoted ⁇ .05). Threshold images have been transformed from MNI space into Talairach space and converted to T-scores, which were projected onto the pial surface of a representative standard surface; the range is shown in the corresponding color bars. Figure 11 shows a significant gray matter decrease as was observed in the anterior cingulate cortex. Increase in gray matter volume was most pronounced in the left amygdala, left claustrum and left para-hippocampal gyrus. Table 5
- Table 6 provides for significant differences in FA between risk-haplotype carrier and non carriers.
- x,y,z (mm) represents the MNI atlas coordinate of the most significant voxel within the cluster
- P c o rrect ed represents the p value at the cluster level following small volume correction
- K is the number of voxel of the cluster
- T represents the t- value at the most significant voxel.
- Figure 12 shows a significant FA reduction as found in the anterior cingulated cortex. Increase in FA values of the risk-haplotype group compared with the non- carriers group was found in small regions including the insula, left superior frontal gyrus and claustrum.
- Figure 13 provides statistical parametric map showing ADC elevation in risk- haplotype carriers compared with non-carriers (focusing on the ACC complex region at a threshold of i J Uncorrected ⁇ 0-01). Threshold images have been transformed from MNI - -
- T-scores 5 which were projected onto the pial surface of a representative standard surface; the range is shown in the corresponding color bars.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a method of diagnosing a predisposition of a subject to schizophrenia, by detecting the presence of single nucleotide polymorphisms (SNPs) in the golli-MBP region of the MBP (myelin basic protein) gene. This can be achieved by determining allelic variants of the golli-MBP region of the MBP gene (golli-MBP), wherein the presence of a risk-haplotype is associated with predisposition to schizophrenia and the presence of a protective-haplotype is associated with non-schizophrenic subjects. The invention further provides nucleic acid probes which allow detection of the SNPs, as well as kits comprising them. The invention further relates to the association of these SNPs with brain morphology changes.
Description
_ _
GENETIC MARKERS OF SCHIZOPHRENIA
FIELD OF THE INVENTION
This invention relates to methods for genetic diagnosis and assessment of predisposition of a subject to mental or psychiatric disorder, particularly to schizophrenia.
BACKGROUND OF THE INVENTION Schizophrenia is a severe and common psychiatric disorder with a lifetime risk of approximately 1% in the general population worldwide. It is a multi-factorial disorder, and its etiology includes strong genetic factors characterized by a complex inheritance pattern. Although the disease is predominantly hereditary, little is known about genetic factors and their effects on the pathophysiology of the disease. Multiple studies have reported oligodendrocyte and myelin abnormalities, as well as dysregulation of their related genes, in brains of schizophrenia patients (Tkachev et al 2003).
Myelin basic protein (MBP) encodes two families of proteins: classic-MBPs and golli-MBPs. While the classic-MBPs are predominantly located in the myelin sheaths of the nervous system, the golli proteins are more widely expressed and are found in both the immune and the nervous systems.
Oligodendrocytes are responsible for the formation of myelin sheaths in the vertebrate central nervous system (CNS). Myelin basic protein (MBP), which is the second most abundant protein in the CNS myelin, is the only structural protein found so far to be essential for it's formation (Boggs 2006). The human MBP protein family arises from a genetic unit called genes of the oligodendrocyte lineage (golli), via use of various alternative splicing combinations among its 10 exons. The golli proteins are generated from the 5' transcription start site while the classic-MBPs are produced from a downstream transcription start site of the gene. Although they share some common MBP epitopes, the golli products differ from the classic-MBPs due to the presence of 133 additional amino-acids encoded by exons upstream to the classic-MBP transcription
start site. While the classic-MBPs are predominantly located in the myelin sheaths of the nervous system, the golli proteins are more widely expressed and are found in both the immune and the nervous systems (Feng 2007). Golli knock-out (KO) mice, in which only the golli products of the MBP gene were ablated, have been reported to exhibit behavioral abnormalities reflective of neuronal abnormalities (Olmstead et al. 2000). Several studies have shown changes in MBP gene expression levels in schizophrenia and bipolar disorder in different brain regions (Chambers and Perrone-Bizzozero 2004, Haroutunian et al. 2007, Tkachev et al. 2003).
References
Ashburner, J., Friston, K.J., (2000) Voxel-based morphometry-the methods.
Neuroimage 11, 805-821.
Boggs, J.M. (2006) Myelin basic protein: a multifunctional protein. Cell MoI Life Sci, 63, 1945-1961.
Chambers, J.S. and Perrone-Bizzozero, N.I. (2004) Altered myelination of the hippocampal formation in subjects with schizophrenia and bipolar disorder. Neurochem Res, 29, 2293-2302.
Crum, W.R., Griffin, L.D., Hill, D.L., Hawkes, D.J. (2003) Zen and the art of medical image registration: correspondence, homology, and quality. Neuroimage 20, 1425-1437. Feng, J.M. (2007) Minireview: expression and function of golli protein in immune system. Neurochem Res, 32, 273-278.
Haroutunian, V., Katsel, P., Dracheva, S-, Stewart, D.G. and Davis, K.L. (2007) Variations in oligodendrocyte-related gene expression across multiple cortical regions: implications for the pathophysiology of schizophrenia. Int J Neuropsychopharmacol, 10, 565-573.
Korostishevsky, M., Kaganovich, M., Cholostoy, A., Ashkenazi, M., Ratner, Y., Dahary, D., Bernstein, J., Bening-Abu-Shach, U., Ben-Asher, E., Lancet, D.,
_ .
Ritsner, M. and Navon, R. (2004) Is the G72/G30 locus associated with schizophrenia? single nucleotide polymorphisms, haplotypes, and gene expression analysis. Biol Psychiatry, 56, 169-176.
Maldjian, J.A., Laurienti, P.J., Kraft, R.A., Burdette, XH. (2003) An automated method for neuroanatomic and cytoarchitectonic atlas-based interrogation of fMRI data sets. Neuroimage 19, 1233-1239.
Ohnstead, C, Pribyl, T., Kampf, K., Jacobs, E., Campagnoni, C, Handley, V.S., E. , Messing, A., Lazareff, J. and Campagnoni, A. (2000) Targeted ablation of the Golli products of the myelin basic protein gene: learning deficits. Soc Neurosci Abstr 26.30.17.
Shiftman, S., Bronstein, M-, Sternfeld, M., Pisante-Shalom, A., Lev-Lehman, E., Weizman, A., Reznik, I., Spivak, B., Grisaru, N., Karp, L., Schiffer, R., Kotler, M., Strous, R.D., Swartz-Vanetik, M., Knobler, H. Y., Shinar, E., Beckmann, J.S., Yakir, B., Risch, N., Zak, N.B. and Darvasi, A. (2002) A highly significant association between a COMT haplotype and schizophrenia.
Am J Hum Genet, 71, 1296-1302.
Tkachev, D., Mimmack, MX., Ryan, M.M., Wayϊand, M., Freeman, T., Jones, P.B., Starkey, M., Webster, M.J., Yolken, R.H. and Bahn, S. (2003) Oligodendrocyte dysfunction in schizophrenia and bipolar disorder. Lancet, 362, 798-805.
Torrey, E.F., Webster, M., Knable, M., Johnston, N. and Yolken, R.H. (2000) The Stanley foundation brain collection and neuropathology consortium. Schizophr Res, 44, 151-155.
SUMMARY OF THE INVENTION
The present invention is based on the finding that single nucleotide polymorphisms (SNPs) in the golli-MBP region of the MBP gene are associated with schizophrenia. Specifically, the SNPs include rsl2458282, rs2008323, rs721286 and any combination thereof. The SNPs of the present invention further include rs2013963, rs470549, rs7234883, rs9960721, rs685975, and rs7233574.
Accordingly, these SNPs can serve as a basis for diagnosing a predisposition of a subject to schizophrenia. This can be achieved by determining allelic variants of the golli-MBP region of the MBP gene (golli-MBP), wherein the presence of a risk-
haplotype is associated with predisposition to schizophrenia and the presence of a protective-haplotype is associated with non-schizophrenic subjects.
Accordingly, in the first of its aspects, the present invention provides a method of diagnosing a predisposition of a subject to schizophrenia, wherein said method comprising testing a sample obtained from the subject for the presence of at least one allele or haplotype of the golli-MBP region selected from the group consisting of: (i) allele T of the C/T single nucleotide polymorphism (SNP) rs721286; (ii) allele A of the A/G single nucleotide polymorphism (SNP) rs2008323 ; (iii) allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282; (iv) allele A of the A/G single nucleotide polymorphism (SNP) rs2013963 ;
(v) allele A of the A/G single nucleotide polymorphism (SNP) rs470549; (vi) allele A of the A/G single nucleotide polymorphism (SNP) rs7234883; (vii) allele C of the C/A single nucleotide polymorphism (SNP) rs9960721 ; (viii) allele A of the C/A single nucleotide polymorphism (SNP) rs685975; (ix) allele G of the A/G single nucleotide polymorphism (SNP) rs7233574; and
(x) any combination thereof; wherein the presence of each of said single allele or haplotype is indicative of a predisposition of the subject to schizophrenia. In an embodiment, the haplotype comprises allele C of the C/T polymorphism rsl24582825 and allele T of the C/T polymorphism rs721286. hi another embodiment, the haplotype comprises allele C of the C/T polymorphism rsl2458282, and allele A of the A/G polymorphism rs2008323. Additionally, the haplotype may comprise allele A of the A/G polymorphism rs2008323, and allele T of the C/T polymorphism rs721286. The haplotype alternatively comprises allele C of the C/T polymorphism rs 12458282, allele A of the A/G polymorphism rs2008323, and allele T of the C/T polymorphism rs721286. Additionally, the haplotype can comprise allele C of the C/A single nucleotide polymorphism (SNP) rs9960721, allele A of the C/A single nucleotide polymorphism (SNP) rs685975, and allele G of the A/G single nucleotide polymorphism (SNP) rs7233574.
In another aspect, the present invention provides a method of diagnosing a subject as having low predisposition to schizophrenia, wherein said method comprising
. _
testing a sample obtained from the subject for the presence of at least one allele or haplotype of the golli-MBP region selected from the group consisting of:
(i) allele C of the C/T single nucleotide polymorphism (SNP) rs721286; (ii) allele G of the A/G single nucleotide polymorphism (SNP) rs2008323 ; (iii) allele T of the C/T single nucleotide polymorphism (SNP) rsl2458282;
(iv) allele G of the A/G single nucleotide polymorphism (SNP) rs2013963 ; (v) allele G of the A/G single nucleotide polymorphism (SNP) rs470549; (vi) allele G of the A/G single nucleotide polymorphism (SNP) rs7234883; (vii) allele A of the C/A single nucleotide polymorphism (SNP) rs9960721 ; (viii) allele C of the C/A single nucleotide polymorphism (SNP) rs685975;
(ix) allele A of the A/G single nucleotide polymorphism (SNP) rs7233574; and (x) any combination thereof;
wherein the presence of each of said single allele or haplotype is indicative of having low predisposition of the subject to schizophrenia.
The haplotype may comprise allele T of the C/T polymorphism rs 12458282, and allele C of the C/T polymorphism rs721286. Additionally, the haplotype may comprise allele T of the C/T polymorphism rsl2458282, and allele G of the A/G polymorphism rs2008323. The haplotype may further comprise allele G of the A/G polymorphism rs2008323, and allele C of the C/T polymorphism rs721286. The haplotype may comprise allele T of the C/T polymorphism rs 12458282, allele G of the A/G polymorphism rs2008323, and allele C of the C/T polymorphism rs721286. Additionally, the haplotype can comprise allele A of the C/A single nucleotide polymorphism (SNP) rs9960721, allele C of the C/A single nucleotide polymorphism (SNP) rs685975, and allele A of the A/G single nucleotide polymorphism (SNP) rs7233574.
In another aspect, the present invention provides a method of diagnosing a predisposition of a subject to schizophrenia, wherein said method comprising testing a sample obtained from the subject for the presence of at least one genotype of the golli- MBP region selected from the group consisting of:
(i) T/T genotype of a single nucleotide polymorphism (SNP) rs721286; (ii) A/A genotype of a single nucleotide polymorphism (SNP) rs2008323 ;
(iii) C/C genotype of a single nucleotide polymorphism (SNP) rsl2458282; (iv) A/A genotype of a single nucleotide polymorphism (SNP) rs2013963 ; (v) A/A genotype of a single nucleotide polymorphism (SNP) rs470549; (vi) A/A genotype of a single nucleotide polymorphism (SNP) rs7234883 ; (vii) C/C genotype of a single nucleotide polymorphism (SNP) rs9960721 ;
(viii) A/A genotype of a single nucleotide polymorphism (SNP) rs685975; (ix) G/G genotype of a single nucleotide polymorphism (SNP) rs7233574; and
(x) any combination thereof;
wherein the presence of each of said genotype is indicative of a predisposition of the subject to schizophrenia.
In accordance with the invention the subject may be human. Additionally, the subject may be an embryo, a fetus, a child, or an adult. In one embodiment, the sample is a body fluid, preferably blood, saliva, cerebrospinal fluid, urine, or sperm.
In an embodiment, the testing for polymorphism is performed by SNP genotyping. In one embodiment, the SNP genotyping is performed by a method selected from the group consisting of (a) a primer extension assay; (b) PCR assay; (c) an allele-specific PCR assay; (d) a nucleic acid amplification assay; (e) a hybridization assay; (f) a mismatch-detection assay, (g) an enzymatic nucleic acid cleavage assay, and (h) a sequencing assay.
Additionally, the methods of the present invention can further comprise measuring a clinical symptom of the subject. Clinical symptoms may be those known by physicians from literature or diagnosis manuals such as Diagnostic and Statistical Manual of Mental Disorders DSM-IV (American Psychiatric Association, 1994). The clinical symptoms may be used for increasing the confidence level results of the methods of the present invention.
The methods of the invention may further comprise performing morphological analysis of the subject's brain for detecting aberrant brain morphology and microstructure changes. In one embodiment the morphological analysis is performed using magnetic resonance imaging (MRI). In one particular embodiment the
morphological analysis is performed using functional magnetic resonance imaging (fMRI).
The present invention further provides nucleic acid probes comprising a nucleotide sequence which hybridizes with at least a portion of golli-MBP region and which allows detection of at least one SNP. In preferred embodiments said at least one SNP is selected from the group consisting of rsl2458282, rs2008323, rs721286, rs2013963, rs470549, rs7234883, rs9960721, rs685975, rs7233574 or any combination thereof. In one embodiment said probe is used in diagnosis of schizophrenia or predisposition to schizophrenia In another embodiment, the nucleic acid probe can also be used in correlating at least one SNP of golli-MBP region with the outcome of a schizophrenia treatment.
The present invention further provides the use of nucleic acid probes comprising a nucleotide sequence which hybridizes with at least a portion of golli-MBP region and which allow detection of at least one SNP therein in diagnosis of schizophrenia or predisposition to schizophrenia. In preferred embodiments said at least one SNP comprises rsl2458282, rs2008323, rs721286, rs2013963, rs470549, rs7234883, rs9960721, rs685975, rs7233574 or any combination thereof .
In another embodiment, the present invention relates to a kit for carrying out any the methods provided herein. In one embodiment, the kit is compartmentalized to receive a reagent for measuring single nucleotide polymorphism (SNP) in the golli- MBP region in a nucleic acid sample of a subject, said kit comprising at least one oligonucleotide that interacts with a single nucleotide polymorphism (SNP) in the golli- MBP polynucleotide region wherein said SNP polymorphism is selected from the group consisting of rsl2458282, rs2008323, rs721286, rs2013963, rs4705493 rs7234883, rs9960721 , rs685975, rs7233574 and any combination thereof.
The present invention further provides an array comprising a substrate having a plurality of segments, wherein at least one segment comprises a probe for detecting at least one single nucleotide polymorphisms (SNP) from the group consisting of:
(i) allele T of the C/T single nucleotide polymorphism (SNP) rs721286; (ii) allele A ofthe A/G single nucleotide polymorphism (SNP) rs2008323;
(iii) allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282; (iv) allele C of the C/T single nucleotide polymorphism (SNP) rs721286; (v) allele G of the A/G single nucleotide polymorphism (SNP) rs2008323 ;
(vi) allele T of the C/T single nucleotide polymorphism (SNP) rsl2458282;
(vii) allele A of the A/G single nucleotide polymorphism (SNP) rs2013963 ;
(viii) allele A of the A/G single nucleotide polymorphism (SNP) rs470549;
(ix) allele A of the A/G single nucleotide polymorphism (SNP) rs7234883; (x) allele G of the A/G single nucleotide polymorphism (SNP) rs2013963 ;
(xi) allele G of the A/G single nucleotide polymorphism (SNP) rs470549;
(xii) allele G of the A/G single nucleotide polymorphism (SNP) rs7234883;
(xiii) allele C of the C/A single nucleotide polymorphism (SNP) rs9960721 ;
(xiv) allele A of the C/A single nucleotide polymorphism (SNP) rs685975; (xv) allele G of the A/G single nucleotide polymorphism (SNP) rs7233574;
(xvi) allele A of the C/A single nucleotide polymorphism (SNP) rs9960721;
(xvii) allele C of the C/A single nucleotide polymorphism (SNP) rs685975; (xviii)allele A of the A/G single nucleotide polymorphism (SNP) rs7233574;
for use in diagnosis of schizophrenia or assessment of predisposition to schizophrenia.
The present invention further provides use of the array in diagnosis of schizophrenia or predisposition to schizophrenia.
In another aspect, the present invention provides a method for obtaining information regarding a predisposition of a subject to develop schizophrenia, said method comprising testing a sample obtained from the subject for the presence of at least one allele or haplotype of the golli-MBP region selected from the group consisting of:
(i) allele T of the C/T single nucleotide polymorphism (SNP) rs721286; (ii) allele A of the A/G single nucleotide polymorphism (SNP) rs2008323; (iii) allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282.
(iv) allele C of the C/T single nucleotide polymorphism (SNP) rs721286; (v) allele G of the A/G single nucleotide polymorphism (SNP) rs2008323; (vi) allele T of the C/T single nucleotide polymorphism (SNP) rsl2458282; (vii) allele A of the A/G single nucleotide polymorphism (SNP) rs2013963; (viii) allele A of the A/G single nucleotide polymorphism (SNP) rs470549;
(ix) allele A of the A/G single nucleotide polymorphism (SNP) rs7234883 ; (x) allele G of the A/G single nucleotide polymorphism (SNP) rs2013963; (xi) allele G of the A/G single nucleotide polymorphism (SNP) rs470549;
(xii) allele G of the A/G single nucleotide polymorphism (SNP) rs7234883; (xiii) allele C of the C/A single nucleotide polymorphism (SNP) rs9960721; (xiv) allele A of the C/A single nucleotide polymorphism (SNP) rs685975; (xv) allele G of the A/G single nucleotide polymorphism (SNP) rs7233574; (xvi) allele A of the C/A single nucleotide polymorphism (SNP) rs9960721 ;
(xvii) allele C of the C/A single nucleotide polymorphism (SNP) rs685975; (xviii) allele A of the A/G single nucleotide polymorphism (SNP) rs7233574; and
(xix) any combination thereof; wherein the presence of each of said single allele or haplotype is indicative of the predisposition of the subject to schizophrenia.
The information can be used for various purposes, for example to classify a subject in a clinical trial, or to screen populations.
Additionally, the present invention provides a method of diagnosing a subject having schizophrenic symptoms as a schizophrenic, comprising:
(a) diagnosing a predisposition of a subject to schizophrenia, comprising testing a sample obtained from the subject for the presence of at least one allele or haplotype of the golli-MBP region selected from the group consisting of:
1. allele T of the C/T single nucleotide polymorphism (SNP) rs721286; 2. allele A of the A/G single nucleotide polymorphism (SNP) rs2008323;
3. allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282;
4. allele A of the A/G single nucleotide polymorphism (SNP) rs2013963;
5. allele A of the A/G single nucleotide polymorphism (SNP) rs470549;
6. allele A of the A/G single nucleotide polymorphism (SNP) rs7234883; 7. allele C of the C/A single nucleotide polymorphism (SNP) rs9960721 ;
8. allele A of the C/A single nucleotide polymorphism (SNP) rs685975;
9. allele G of the A/G single nucleotide polymorphism (SNP) rs7233574; and
10. any combination thereof; (b) identifying at least one schizophrenia symptom and optionally at least one schizophrenia risk factor in said subject;
wherein presence of each of said single allele or haplotype in step (a) combined with the presence of at least one symptom or risk factor in step (b) is indicative of the subject as being schizophrenic.
It is therefore contemplated that the above described methods of the invention may be utilized in combination with additional schizophrenia-identifying markers (e.g. genetic markers) other than those disclosed in the present application.
In another aspect the present invention provides a method of determining a predisposition of a subject to having an aberrant brain morphology and micro structure changes, said method comprising testing a sample obtained from the subject for the presence of at least one allele or haplotype of the golli-MBP region selected from the group consisting of:
(i) allele T of the C/T single nucleotide polymorphism (SNP) rs721286; (ii) allele A of the A/G single nucleotide polymorphism (SNP) rs2008323 ; (iii) allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282; and (iv) any combination thereof; wherein presence of each of said allele or haplotype is indicative of a predisposition to having an aberrant brain morphology.
In one embodiment the haplotype comprises allele C of the C/T polymorphism rsl2458282, allele A of the A/G polymorphism rs2008323, and allele T of the C/T polymorphism rs721286.
In some embodiments, aberrant brain morphology is manifested by at least one parameter selected from the group consisting of:
(i) an increase in apparent diffusion coefficient (ADC); (ii) a change in fractional anisotropy (FA); and (iii) a change in gray matter volume.
In one embodiment, the apparent diffusion coefficient (ADC) increase is observed in a brain region selected from the group consisting of: Right - middle temporal gyrus; Left - post central gyrus; Cerebellum; Post central lobule; Precuneus; Posterior cingulate cortex; and the anterior cingulated cortex (ACC). In one embodiment, the fractional anisotropy (FA) change is observed as a decrease in FA in a brain region selected from the group consisting of: Left - superior longitudinal fasciculus; Right - superior frontal gyrus; Right - middle temporal gyrus; Right — medial frontal gyrus; anterior cingulated cortex and the Cerebellum.
In one embodiment, the fractional anisotropy (FA) change is observed as an increase in FA in a brain region selected from the group consisting of: Left — superior longitudinal fasciculus; Left Insula and the Claustrum.
In one embodiment, the change in gray matter volume is observed as a gray matter volume decrease in a brain region selected from the group consisting of: Left - medial frontal gyrus; Left - middle temporal gyrus; Left Insula; Left - superior temporal gyrus; Cerebellum; Lingual Gyrus; Right - superior frontal gyrus; Left - inferior frontal gyrus; Right - medial frontal gyrus; post central gyrus; Post central lobule and the anterior cingulated cortex. In one embodiment, the change in gray matter volume is observed as a gray matter volume increase in a brain region selected from the group consisting of: Left - parahippocampal gyrus; Left - Claustrum and left amygdala.
In a further aspect, the present invention relates to a nucleic acid probe comprising a nucleotide sequence which hybridizes with at least a portion of golli-MBP region which allows detection of at least one polymorphism therein for use in correlating at least one polymorphism of golli-MBP region with the outcome of a schizophrenia treatment. In some embodiments, the polymorphism of golli-MBP region is an allele or haplotype of the golli-MBP region selected from the group consisting of:
(i) allele T of the C/T single nucleotide polymorphism (SNP) rs721286; (ii) allele A of the A/G single nucleotide polymorphism (SNP) rs2008323;
(iii) allele C of the C/T single nucleotide polymorphism (SNP) rs 12458282; (iv) allele A of the A/G single nucleotide polymorphism (SNP) rs2013963; (v) allele A of the A/G single nucleotide polymorphism (SNP) rs470549; (vi) allele A of the A/G single nucleotide polymorphism (SNP) rs7234883; (vii) allele C of the C/A single nucleotide polymorphism (SNP) rs9960721 ;
(viii) allele A of the C/A single nucleotide polymorphism (SNP) rs685975; (ix) allele G of the A/G single nucleotide polymorphism (SNP) rs7233574; and (x) any combination thereof; wherein the presence of each of said single allele or haplotype is indicative of a predisposition of the subject to schizophrenia.
In another aspect, the present invention is directed to a method for obtaining information regarding a predisposition of a subject to develop schizophrenia, the method comprising testing a sample obtained from the subject for the presence of at
least one allele or haplotype of the golli-MBP region selected from the group consisting of: allele T of the C/T single nucleotide polymorphism (SNP) rs721286; allele A of the A/G single nucleotide polymorphism (SNP) rs2008323; allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282; allele C of the C/T single nucleotide polymorphism (SNP) rs721286; allele G of the A/G single nucleotide polymorphism (SNP) rs2008323; allele T of the C/T single nucleotide polymorphism (SNP) rsl2458282; allele A of the A/G single nucleotide polymorphism (SNP) rs2013963; allele A of the A/G single nucleotide polymorphism (SNP) rs470549; allele A of the A/G single nucleotide polymorphism (SNP) rs7234883; allele G of the A/G single nucleotide polymorphism (SNP) rs2013963; allele G of the A/G single nucleotide polymorphism (SNP) rs470549; allele G of the A/G single nucleotide polymorphism (SNP) rs7234883; allele C of the C/A single nucleotide polymorphism (SNP) rs9960721; allele A of the C/A single nucleotide polymorphism (SNP) rs685975; allele G of the A/G single nucleotide polymorphism (SNP) rs7233574; allele A of the C/A single nucleotide polymorphism (SNP) rs9960721; allele C of the C/A single nucleotide polymorphism (SNP) rs685975; allele A of the A/G single nucleotide polymorphism (SNP) rs7233574; and any combination thereof; wherein the presence of each of the allele or haplotype is indicative of the predisposition of the subject to schizophrenia, thereby obtaining information regarding a predisposition of a subject to develop schizophrenia.
In some embodiments, the information classifies a subject in a clinical trial. In other embodiments, the information classifies a population of subjects. In a specific embodiment, information correlates a specific haplotype/genotype with an outcome of a therapy for schzophrenia.
BRIEF DESCRIPTION OF THE FIGURES AND TABLES
Figure 1 is a schematic illustration of the genomic structure of the MBP gene. Figure 2 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO:1) that comprises rs721286 in accordance with an embodiment of the present invention; Figure 3 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO.2) that comprises rs2008323 in accordance with an embodiment of the present invention;
Figure 4 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO:3) that comprises rs 12458282 hi accordance with an embodiment of the present invention;
Figure 5 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO:4) that comprises rs2013963 in accordance with an embodiment of the present invention;
Figure 6 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO: 5) that comprises rs470549 in accordance with an embodiment of the present invention; Figure 7 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO:6) that comprises rs7234883 in accordance with an embodiment of the present invention;
Figure 8 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO:7) that comprises rs9960721in accordance with an embodiment of the present invention;
Figure 9 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO: 8) that comprises rs685975 in accordance with an embodiment of the present invention;
Figure 10 shows a portion of the golli-MBP nucleotide sequence (SEQ ID NO:9) that comprises rs7233574 in accordance with an embodiment of the present invention;
Figure 11 provides statistical parametric maps showing gray matter volume changes in risk-haplotype carriers compared with non-carriers. (A) Focusing on the ACC gray matter and (B) focusing on the left Amygdala gray matter.
Figure 12 provides statistical parametric maps showing FA changes in risk- haplotype carriers compared with non-carriers. (A) Focusing on the ACC and (B) focusing on the left SFG. Figure 13 provides a statistical parametric map showing ADC elevation in risk- haplotype carriers compared with non-carriers.
DETAILED DESCRIPTION OF EMBODIMENTS
Terms and definitions As used herein and in the appended claims, the singular forms "a," "and," and
"the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes a plurality of such polynucleotides and reference to "the SNP" includes reference to one or more SNPs and so forth.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein.
For the purposes of the present invention, an "allele" is a particular form of a genetic locus, distinguished from other forms by its particular nucleotide sequence, or one of the alternative polymorphisms found at a polymorphic site.
The term "gene" refers to a segment of genomic DNA that contains the coding sequence for a protein, wherein the segment may include promoters, exons, introns, and other untranslated regions that control expression.
The term "genotype" is a 5' to 3 ' sequence of nucleotide pair(s) found at a set of one or more polymorphic sites in a locus on a pair of homologous chromosomes in an individual. As used herein, genotype includes a full-genotype and/or a sub- genotype. "Genotyping" shall mean a process for determining a genotype of an individual. The term "haplotype" shall mean a 5 ' to 3' sequence of nucleotides found at a set of one or more polymorphic sites in a locus on a single chromosome from a single individual. "Haplotyping" shall mean a process for determining one or more haplotypes in an individual and includes molecular techniques, and/or statistical inference. The term "golli-MBP region" or "goIH-MBP" refers to a genetic unit called genes of the oligodendrocyte lineage.
The term "risk-haplotype" shall refer to an allele or haplotype, the presence of which is associated with predisposition to schizophrenia according to the present invention. The term "protective-haplotype" shall refer to an allele or haplotype, and the presence of which is associated with non-schizophrenic subjects.
A "predisposition" or "susceptibility" of a subject to schizophrenia indicates that a subject has a tendency with a specified degree of statistical confidence to develop the disorder. The degree is determined by effect-sizing parameters (such as odds-ratio) relevant to the studied ethnic group.
A "genetic locus" refers to a location on a chromosome or DNA molecule corresponding to a gene or a physical or phenotypic feature, where physical features include polymorphic sites.
The term "polymorphism" shall refer to a sequence variation observed in an individual at a polymorphic site. Polymorphisms include nucleotide substitutions, insertions, deletions, and microsatellites and may but need not, result in detectable differences in gene expression or protein function. A "single nucleotide polymorphism" or "SNP" is a single nucleotide variation at a polymorphic site.
An "oligonucleotide probe" or a "primer" refers to a nucleic acid molecule of between 8 and 2000 nucleotides in length, or is specified to be about 6 and 1000 nucleotides- in length. More particularly, the length of these oligonucleotides can range from about 8, 10, 15, 20, or 30 to 100 nucleotides, but will typically be about 10 to 50 (e.g., 15 to 30 nucleotides). The appropriate length for oligonucleotides in assays of the invention under a particular set of conditions may be empirically determined by one of skill in the art.
The term "schizophrenia" refers to a psychiatric disorder diagnosis that describes a mental disorder characterized by abnormalities in the perception or expression of reality. Typically, schizophrenia is diagnosed according to Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) (American Psychiatric Association 1994). As used herein the term "Schizophrenia" shall also encompass schizophrenia related disorders such as but not limited to schizoaffective disorder, schizophreniform disorder, schizotypal personality disorder, schizotypy, a typical psychotic disorder, delusional disorder, brief psychotic disorder, avoidant personality disorders, bipolar disorder, and attention deficit hyperactivity disorder. It is to be understood that the methods, probes, arrays and kits of the present invention can also be used with respect to these conditions and disorders as well as for schizophrenia.
A schizophrenic person, i.e. a person suffering from schizophrenia, may exhibit numerous symptoms such as, but not limited to, abnormalities in the perception or in the expression of reality. Schizophrenia is typically manifested by various symptoms such as, for example, auditory hallucinations, paranoid or even bizarre delusions. Schizophrenia may also be manifested in disorganized speech and unusual thinking characterized by significant social or occupational dysfunction. Disorganized speech may be in the form loosely connected sentences and meaning, incoherence (word salad). A schizophrenic person may also suffer from loss of train of thought (thought disorder) and subject flow. In one uncommon species of schizophrenia, the person may be mute, motionless, or exhibit purposeless agitation, and other signs of catatonia. As a result the person may be socially impaired. The standardized criteria for diagnosing schizophrenia are derived from the
American Psychiatric Association's Diagnostic and Statistical Manual of Mental Disorders, version DSM-IV-TR, and also the World Health Organization's International Statistical Classification of Diseases and Related Health Problems, the ICD-10.
The current classification of psychoses holds that symptoms need to have been present for at least one month in a period of at least six months of disturbed functioning. The factors and symptoms of schizophrenia shall be referred to herein as "schizophrenia symptoms". As used herein a "sample" refers to any biological sample obtained from a subject which is suitable for isolation of nucleic acids. Such biological sample may be obtained from e.g. blood, saliva, cerebrospinal fluid, urine, feces or sperm.
SNPs are common single nucleotide variations that occur in a population. SNPs are obtainable from various repositories such as Ensembl, a joint project between EMBL - European Bioinformatics Institute (EBI) and the Wellcome Trust Sanger
Institute (WTSI), or the dbSNP, the SNP repository maintained by NCBI, The Human
Genie Bi-Allelic Sequences Database (HGVBase) and The SNP Consortium Ltd.(TSC).
International collaborations have envisaged classifying SNPs for genomes of numerous species including Homo sapiens, Mus musculus, and plant genomes. As a mere example, HapMap project seek to identify the genetic patterns of human DNA sequence variation. Information such as SNP genotypes, recombination rates may be downloaded from the HapMap website (www.hapmap.org).
SNPs are conventionally identified by their relative position within a nucleotide sequence. Typically, following identification of an SNP a database reference is provided, "rs" number/SNP ID number. Consequently, sequence and other information related with a given "rs" number/SNP ID number may be obtained by browsing, for example, the dbSNP of the Entrez SNP which is provided by the NCBI, at www.ncbi.nlm.nih.gov.
As used herein "magnetic resonance imaging" or "MR/" - refers to an imaging method to visualize detailed internal structure and function of the brain. In the form of Functional MRI (fMRI) it enable measurement of signal changes in the brain that are due to changing neural activity. In the form of diffusion tensor imaging (DTI) it allows an accurate measure of myelin and myelination disruptions.
DTI enables quantification of fractional anisotropy (FA) and apparent diffusion coefficient (ADC) of water molecules and can provide high-contrast images of the brain's white matter.
As used herein "brain morphology" shall refer to the brain morphology of a subject and shall include at least one of the following structural features: morphological volume measurements of brain structures, gray matter, white matter, myelination of
brain tissue, fiber organization, axon morphology, fractional anisotropy (FA) and apparent diffusion coefficient (ADC).
As used herein "aberrant brain morphology" shall refer to at least one morphological brain feature selected from the group consisting of: myelin and myelination disruption, aberrant fiber organization or aberrant axon morphology, abnormally small axons, aberrant water content in the brain's regions, decrease of cellular compartment or increase of extra-cellular volume.
As used herein the term "gray matter" (or "grey matter") shall refer to the component of the central nervous system, consisting of neuronal cell bodies, neuropil (dendrites and axons), glial cells (astroglia and oligodendrocytes), and capillaries. Grey matter contains neural cell bodies, in contrast to white matter, which mostly contains myelinated axon tracts.
As used herein the term "array" (also termed herein "microarray") refers to a two dimentional systematic arrangement of oligonucleotides, usually in rows and columns on a solid substrate. The array may consist of series of thousands of microscopic spots of oligonucleotides, each containing minute amounts of the oligonucleotide probes. The probes are used to hybridize with samples of nucleic acids under high-stringency conditions. Probe-target hybridization may be detected and quantified by detection of fluorophore-, silver-, or chemiluminescence-labeled targets to determine relative abundance of nucleic acid sequences in the target.
Methods for the preparation of arrays are well known in the art, the probes may be attached to the solid surface by a covalent bond to a chemical matrix (for example via epoxy-silane, amino-silane, lysine, polyacrylamide or others). The solid surface can be glass, a silicon chip, or microscopic beads.
In the context of the present invention the array or microarray is used to detect
SNPs.
The present invention utilizes single nucleotide polymorphisms in the golli-MBP region for diagnosing a subject for predisposition to schizophrenia. The invention contemplates, inter alia, SNP genotyping of golli-MBP region, e.g. by allele-specific PCR and can be used to develop polynucleotide-based tests for use as prognostics to predict a subject susceptibility to schizophrenia. The tests for the specific SNPs
- Io "
disclosed herein in the golli-MBP region will enable more accurate prediction and mental and psychiatric diagnosis, thereby leading to better treatment of the subject.
The invention also provides oligonucleotides, kits, devices, and substrates useful for detecting polymorphisms associated with subjects suffering or having a genetic predisposition to suffer from schizophrenia.
Oligonucleotide primers and probes of the present invention can be prepared by any suitable method, including, for example, cloning and restriction of appropriate sequences and direct chemical synthesis. Oligonucleotide probes and primers can comprise DNA, RNA, nucleic acid analogs such as, for example peptide nucleic acids, locked nucleic acid (LNA) analogs, and morpholino analogs. The 3' end of the probe can be functionalized with a capture or a detectable label to assist in detection of a polymorphism. Any of the oligonucleotides or nucleic acids of the invention can be labeled by incorporating a detectable label measurable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, such labels can comprise radioactive substances ( P, S5 H, I), fluorescent dyes (5- bromodesoxyuridin, fluorescein, acetylaminofluorene, digoxigenin), biotin, nanoparticles, and the like. Such oligonucleotides are typically labeled at their 3' and 5' ends.
A probe refers to a molecule which can detectably distinguish between target molecules differing in structure. Detection or testing for a single nucleotide polymorphism (SNP) can be accomplished in a variety of different ways depending on the type of probe used and the type of target molecule. Thus, for example, detection may be based on discrimination of activity levels of the target molecule, but typically is based on detection of specific binding. Non exhaustive examples of such specific binding include antibody binding and oligonucleotide probe hybridization, amplification techniques or others described below. Thus, for example, probes can include enzyme substrates, antibodies and antibody fragments, oligonucleotide hybridization probes and oligonucleotide primers.
Therefore, in one embodiment, the detection of the presence or absence of the at least one variant, or single nucleotide polymorphism (SNP) involves contacting a target polymorphic site with a probe, typically an oligonucleotide probe, where the probe binds or hybridizes with a form of the target polymorphic site (e.g., the target nucleic acid containing a complementary base at the variance site as compared to hybridization
to a form of the target nucleic acid having a non-complementary base at the variance site, where the hybridization is carried out under selective hybridization conditions). An oligonucleotide probe may span two or more variance sites. Unless otherwise specified, an oligonucleotide probe can include one or more nucleic acid analogs, labels or other substituents or moieties so long as the base-pairing function is retained.
The polymorphisms associated herein with subjects having a genetic predisposition to suffer from schizophrenia disclosed in the present invention, comprise the following SNPs:
(a) rs721286; (b) rs2008323; and
(c) rsl2458282.
The specific alleles indicating predisposition or risk of manifestation of a schizophrenia can be selected from the group of:
(a) allele T of the C/T single nucleotide polymorphism (SNP) rs721286; (b) allele A of the A/G single nucleotide polymorphism (SNP) rs2008323; and
(c) allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282.
The polymorphisms associated with subjects having a genetic predisposition to suffer from a schizophrenia disclosed in the present invention, may further comprise the following SNPs:
(a) rs2013963;
(b) rs470549; and
(c) rs7234883.
The specific alleles indicating predisposition or risk of manifestation of schizophrenia may further be selected from the group of:
(a) allele A of the A/G single nucleotide polymorphism (SNP) rs2013963;
(b) allele A of the A/G single nucleotide polymorphism (SNP) rs470549; and
(c) allele A of the A/G single nucleotide polymorphism (SNP) rs7234883. The polymorphisms associated with subjects having a genetic predisposition to suffer from schizophrenia disclosed in the present invention, may further comprise the following SNPs:
(a) rs9960721;
(b) rs685975; and
(c) rs7233574.
The specific alleles indicating predisposition or risk of manifestation of schizophrenia may further be selected from the group of: (a) allele C of the C/A single nucleotide polymorphism (SNP) rs9960721 ;
(b) allele A of the C/A single nucleotide polymorphism (SNP) rs685975; and
(c) allele G of the A/G single nucleotide polymorphism (SNP) rs7233574. In an embodiment of the present invention, the presence of any SNP of the present invention is determined in relation to the adjacent nucleotide sequence upstream and downstream from any of the polymorphic site disclosed herein, as a non-limiting example, about 14 nucleotides upstream and about 14 nucleotides downstream of the polymorphic site.
It should be understood that the present invention further contemplates that the presence of a specific haplotype or genotype may be determined in relation to a nucleotide sequence comprising 17, 24, 28, even 40 or more nucleotides upstream, or indeed any number within these ranges, and 17, 24, 28, even 40 or more nucleotides downstream or any number within these ranges, with respect to a polymorphic site disclosed herein. Figure 1 schematically illustrates the respective loci of rs721286, rs2008323, rsl2458282, rs2013963, rs470549, and rs7234883 at the MBP gene. Top figure 1 is a schematic illustration of the genomic structure of the MBP gene. Exons colored in black are golli-MBP exons and those colored in white are classic-MBP exons. Location of the 26 studied markers is shown; SNPs colored in black had significantly (PO.05) different genomic/allele distribution between patients and healthy controls. Markers marked with '*' are of haplotype rs721286-rs2008323-rsl2458282 that was genotyped in the second cohort. Linkage disequilibrium plot of the gene in the CEU population from the HapMap database (www.hapmap.org), adapted from Haploview (www.broad.mit.edu/mpg/haploview) was prepared. Three SNPs of the present invention, namely, rs721286- rs2008323- rsl2458282 are located approximately 4 kb downstream from the golli-MBP third exon. Interestingly, these SNPs represent a linkage disequilibrium (LD) block. The LD block with the associated haplotypes is marked at the bottom of Figure 1.
Although this strongly associated block encompasses an exon, its SNPs are intronic. Without being bound by theory, it is possible that these SNPs affect the regulation of the gene, by creating alternative secondary structures or by influencing interactions with the transcriptional machinery. The respective location of each SNP in the sequence of the gene is shown in figures 2-10.
The SNPs of the invention were identified in the Ashkenazi Jewish population. The Ashkenazi Jewish population is closely related to the general Caucasian population in terms of allele frequencies and linkage disequilibrium (Silberberg G et al. 2006). Therefore, the SNPs and all other aspects of the invention can be used in Caucasian populations as well. Moreover, the use of the SNPs of the invention should not be limited to the Ashkenazi Jewish population or to Caucasian populations. The same SNPs may be schizophrenia-associated in other ethnic groups as well.
In one embodiment of the invention, DNA is obtained from a subject. The subject's DNA is then used to test for the presence of one or more of the schizophrenia- associated SNPs of the present invention. If the subject has been identified as carrying one or more of the SNPs then the subject is diagnosed as having a predisposition for schizophrenia.
Therefore, in one aspect the present invention provides a method of diagnosing a predisposition of a subject to schizophrenia which comprises testing a sample obtained from the subject for the presence of an allele or haplotype of the golli-MBP region indicative that the subject is susceptible to schizophrenia, wherein at least one haplotype is selected from the group consisting of:
(a) allele T of the C/T single nucleotide polymorphism (SNP) rs721286; (b) allele A of the A/G single nucleotide polymorphism (SNP) rs2008323;
(c) allele C of the C/T single nucleotide polymorphism (SNP) rs 12458282;
(d) allele A of the A/G single nucleotide polymorphism (SNP) rs2013963;
(e) allele A of the A/G single nucleotide polymorphism (SNP) rs470549;
(f) allele A of the A/G single nucleotide polymorphism (SNP) rs7234883; (g) allele C of the C/A single nucleotide polymorphism (SNP) rs9960721 ;
(h) allele A of the C/A single nucleotide polymorphism (SNP) rs685975 ; (i) allele G of the A/G single nucleotide polymorphism (SNP) rs7233574; and
(j) any combination thereof;
In other embodiments., the present invention provides a method of diagnosing a predisposition of a subject to schizophrenia which comprises testing a sample obtained from the subject for the presence of an allele or haplotype of the golli-MBP region indicative that the subject is susceptible to schizophrenia, wherein said allele or haplotype is an SNP in complete LD with any of the group consisting of: the single nucleotide polymorphisms (SNPs) rs721286, rs2008323 or rsl2458282; wherein the presence of each of said single allele or haplotype is indicative of a predisposition of the subject to schizophrenia. In a specific a embodiment, the presence of each of said single allele or haplotype is indicative of a predisposition to having an aberrant brain morphology or microstructure.
In a specific embodiment, where two or more SNPs associated with having a genetic predisposition to suffer from schizophrenia are detected within a sample obtained from a subject then the confidence of the diagnostic result increases.
Therefore, in one embodiment, the haplotype may comprise allele C of the C/T polymorphism rsl2458282, and allele T of the C/T polymorphism rs721286. In another embodiment, the haplotype comprises allele C of the C/T polymorphism rsl 2458282, and allele A of the A/G polymorphism rs2008323. Additionally, the haplotype may comprise allele A of the A/G polymorphism rs2008323, and allele T of the C/T polymorphism rs721286. The haplotype may also comprise allele C of the C/T polymorphism rsl2458282, allele A of the A/G polymorphism rs2008323, and allele T of the C/T polymorphism rs721286. The haplotype may also comprise allele C of the C/A single nucleotide polymorphism (SNP) rs9960721, allele A of the C/A single nucleotide polymorphism (SNP) rs685975, and allele G of the A/G single nucleotide polymorphism (SNP) rs7233574.
Additionally, the SNPs identified herein can be used in combination with additional predictive tests including, but not limited to, additional SNPs, mutations, and clinical tests. In another aspect, the present invention provides a method of diagnosing a subject as having low predisposition to schizophrenia, wherein said method comprising testing a sample obtained from the subject for the presence of at least one protective haplotype of the golli-MBP region.
The protective haplotype of the present invention may comprise allele T of the C/T polymorphism rsl2458282, and allele C of the C/T polymorphism rs721286. Additionally, the protective haplotype may comprise allele T of the C/T polymorphism rsl2458282, and allele G of the A/G polymorphism rs2008323. The protective haplotype may further comprise allele G of the A/G polymorphism rs2008323, and allele C of the C/T polymorphism rs721286. The protective haplotype may comprise allele T of the C/T polymorphism rs 12458282, allele G of the A/G polymorphism rs2008323, and allele C of the C/T polymorphism rs721286. The protective haplotype may comprise allele A of the C/A single nucleotide polymorphism (SNP) rs9960721, allele C of the C/A single nucleotide polymorphism (SNP) rs685975, and allele A of the A/G single nucleotide polymorphism (SNP) rs7233574.
In another aspect, the present invention provides a method of diagnosing a subject as having low predisposition to schizophrenia, wherein said method comprising testing a sample obtained from the subject for the presence of at least one genotype of the golli'MBP region. In some embodiments, the protective genotype is a G/G genotype of a single nucleotide polymorphism (SNP) rs2013963. In other embodiments, the protective genotype is a G/G genotype of a single nucleotide polymorphism (SNP) rs470549.
In another aspect, the present invention provides a method of diagnosing a predisposition of a subject to schizophrenia, wherein said method comprising testing a sample obtained from the subject for the presence of at least one genotype of the golli- MBP region selected from the group consisting of:
(i) T/T genotype of a single nucleotide polymorphism (SNP) rs721286; (ii) A/A genotype of a single nucleotide polymorphism (SNP) rs2008323 ;
(iii) C/C genotype of a single nucleotide polymorphism (SNP) rsl2458282; (iv) A/A genotype of a single nucleotide polymorphism (SNP) rs2013963 ; (v) A/A genotype of a single nucleotide polymorphism (SNP) rs470549; (vi) A/A genotype of a single nucleotide polymorphism (SNP) rs7234883; (vii) C/C genotype of a single nucleotide polymorphism (SNP) rs9960721 ;
(viii) A/A genotype of a single nucleotide polymorphism (SNP) rs685975; (ix) G/G genotype of a single nucleotide polymorphism (SNP) rs7233574; and
(x) any combination thereof; wherein the presence of each of said genotype is indicative of a predisposition of the subject to schizophrenia.
In accordance with the invention the subject may be human. Additionally, the subject can be an embryo, a fetus, a child, or an adult. In some embodiments, the human is of Caucasian descent.
In one embodiment, the sample is a body fluid, preferably blood, saliva, cerebrospinal fluid, urine, or sperm.
In an embodiment, the testing for polymorphism is performed by SNP genotyping. In one embodiment, the SNP genotyping is performed by a method selected from the group consisting of (a) a primer extension assay; (b) PCR assay; (c) an allele-specific PCR assay; (d) a nucleic acid amplification assay; (e) a hybridization assay; (f) a mismatch-detection assay, (g) an enzymatic nucleic acid cleavage assay, and (h) a sequencing assay. Other methods and means for determining whether a particular SNP or group of polymorphisms is present within a subject, as would be known to a person of skill in the art can be employed in the practice of the present invention. By way of non-limiting example, PCR using primers comprising fluorescent probes is one exemplary technique. In a specific embodiment, primers may be derived from the following sequences:
GCGAAGTCTTAGGTCTCCCTAAAT[CZT]ATACTAAGGGAGGAGAGGAGTGGC
C, (SEQ ID: 10, per rs721286)
ACGTCACCAGCCCGCGTCTGTGTTC[AyG]CTGCGTCCACTTCACAGGGCCAA
GT, (SEQ ID: 1 l,per rs2008323) CTCCATTGTCTGAGCAATGAAGTTG[CZT]GAATGTTTTCCTCATGACTCTTCA
T, (SEQ ID: 12, per rsl2458282).
AGCAGAAACAGTGGGATGTAGTGCCtA/GJCCCGCAGCGCAGTTACTCAAAG
TGA5(SEQ ID: 13, per rs2013963 ).
TCTGCATGAGTGATGCACGTTTCTCATCCTAGCAC[A/G]GGGAGAGCACTGG CCTTCCTCAGCC, (SEQ ID: 14, per rs470549).
CTTGTGTCACGGCGCGCTGTGCTTG[AZG]GGTCACCAGGGAGGGCAAAGGA
AAC, (SEQ ID: 15, per rs7234883).
ATGTAAAGTAAAAATAAAGGCCCTAG[AZC]CCTCCAGGCAAGACGGAATAG
ACTC,( SEQ ID: 16,per rs9960721). AGCACATAGGCAGGACATCCTAGTAC[CZA]AATGATGAATGAGTGTTTATGG
CAG, (SEQ ID: 17, per rs685975).
CAGGTCCTCAGAGGCACATGAAAAAT[AZG]CTAATGAACGGCAGCACTCATT
ATT, (SEQ ID: 18, per rs7233574).
^
For the purpose of the present invention "schizophrenia-identifying marker (s)" shall mean schizophrenia-identifying markers, genotype(s) and/or haplotype(s) or single allele(s) of genomic variations. It is therefore contemplated that the above described methods of the invention may be utilized in combiation with additional schizophrenia- identifying markers. The schizophrenia-identifying markers may include, but are not limited to, the following polymorphic variations, as disclosed in WO2006/072075 and WO2008/093343: allele A at rs9494332 in C6or£217 which is linked to the human abelson Helper Integration Site 1 gene (AHIl); rs6925684, rs6902485, rs6935033, rs7739635, rs9494332 and rsl475069 on chromosome 6q23; rs911507 and rsl2211505 on chromosome 6q23; rs737734, rsl36770, rs763126, rs738598, rsl573726, rs!38844, rs7385965 rsl35819, rsl573726, rs!053744, rsl53221, rs2269523, rs737734, rsl34474, rsl34454, rs848768, and rs2073224 located at chromosome 22. The schizophrenia- identifying markers may also include polymorphisms in the genes dysbindin (DTNBPl), D-amino acid oxidase (DAAO), neuregulinl (NRGl), D-amino acid oxidase activator (DAOA), catechol-0-methyltransferase (COMT) disclosed in WO 03/070082), regulator of G-protein signaling 4 (RGS4) disrupted-in-schizophrenia-1 (DISCI), proline dehydrogenase PRODH, trace amine receptor (TRAR4) reported in WO 2006/023719, human G protein coupled receptor Seq-40 disclosed in U.S. Patent Application Publication No. 20040115699, SP4 gene; other polymorphism associated with schizophrenia and schizophrenia related disorders located at chromosome 22; and polymorphisms of the Sulfotransferase 4Al (Sult4al) gene.
The methods of the present invention can further comprise measuring a clinical symptom of the subject. Clinical symptoms may be those known by physicians from literature or diagnosis manuals such as Diagnostic and Statistical Manual of Mental Disorders DSM-IV (American Psychiatric Association, 1994). The clinical symptoms may be used for increasing the confidence level results of the methods of the present invention.
The methods of the present invention optionally further comprise diagnosis of a schizophrenia risk factor. In one embodiment, the subject diagnosed has at least one additional risk factor associated with schizophrenia. The risk factor may typically comprise:
^
(1) the existence of a genetically based phenotypic trait associated with risk for schizophrenia;
(2) the subject has a family relative being selected from the group: a parent, uncle, aunt, grandparent, sibling, or child diagnosed as schizophrenic; (3) mixed-handedness; and
(4) eye tracking dysfunction. Additionally, the present invention provides means for minimizing the effect of schizophrenia. The present invention can be used to identify, or diagnose and indeed allow early treatment of the prodromal phase of schizophrenia (pre-onset). This is achieved by early diagnosis of predisposition to schizophrenia in combination with identification of other schizophrenia associated symptoms and risk factors characterizing pre-onset of the illness. As a mere non- limiting example, pre-onset of the illness is characterized by negative symptom of schizophrenia in which the individual lacks interest and drive i.e. avolition, or impairment of social behavior. The present invention further provides a kit useful for identifying polymorphisms associated with predisposition to schizophrenia. For example, the kit of the invention can comprise one or more oligonucleotides designed for identifying both alleles for each SNP in the set of one or more SNPs of the present invention. In another embodiment, the kit further comprises a manual with instructions for performing one or more reactions on a human nucleic acid sample to identify the allele or alleles present in the subject at each PS in the set of one or more SNPs.
The oligonucleotides in a kit of the invention may also be immobilized on or synthesized on a solid surface such as a microchip, bead, or glass slide (see, e.g., WO 98/20020 and WO 98/20019). Such immobilized oligonucleotides may be used in a variety of polymorphism detection assays, including but not limited to probe hybridization and polymerase extension assays.
Kits of the invention may also contain other components such as hybridization buffer (e.g., where the oligonucleotides are to be used as allele-specific probes) or dideoxynucleotide triphosphates (ddNTPs; e.g., where the alleles at the polymorphic sites are to be detected by primer extension). In a one embodiment, the set of oligonucleotides consists of primer-extension oligonucleotides. The kit may also contain a polymerase and a reaction buffer optimized for primer-extension mediated by the polymerase. Preferred kits may also include detection reagents, such as biotin- or
fluorescent-tagged oligonucleotides or ddNTPs and/or an enzyme-labeled antibody and one or more substrates that generate a detectable signal when acted on by the enzyme. It will be understood by the skilled artisan that the set of oligonucleotides and reagents for performing the genotyping or haplotyping assay will be provided in separate receptacles placed in the container if appropriate to preserve biological or chemical activity and enable proper use in the assay.
The present invention further provides a nucleic acid probe comprising a nucleotide sequence which hybridizes with at least a portion of golli-MBP region and which allows detection of at least one polymorphism.
The nucleic acid probe can be used for diagnosing schizophrenia, or for diagnosing a predisposition for schizophrenia. The nucleic acid probe can further be used in correlating at least one polymorphism of golli-MBP region with the outcome of a schizophrenia treatment.
EXAMPLES
The present invention focuses on the golli-MBP gene, by analyzing it in two large Jewish-Ashkenazi cohorts.
In particular, a case-control association analysis of golli-MBP in two separate Jewish-Ashkenazi cohorts was performed (cohort I: 120 patients, 236 controls; cohort II: 379 patients, 380 controls). In addition, an expression analysis of golli-MBP mRNA in postmortem dorsolateral prefrontal cortex (DLPFC) samples of schizophrenia patients, and matched controls was performed.
In the first cohort association between 6 (out of 26 tested) single nucleotide polymorphisms (SNPs) and the disease (PO.05) was observed. Out of these, 3 are from one linkage disequilibrium (LD) block which contains a CCCTC-binding factor (CTCF) binding region. As demonstrated below, haplotype analysis revealed significant risk- and protective-haplotypes (strongest P=O.005, each) for schizophrenia. The 3 SNPs (rsl2458282, rs2008323, rs721286) were then genotyped in the second cohort. The combined results showed strong effects, both in the single marker (strongest ORFI.77, P=0.0005) and in the haplotype analyses (strongest OR=1.61, P=COOOOl). As demonstrated below, the present invention discloses that single nucleotide polymorphisms (SNPs) of the golli-MBP are susceptibility indicators for schizophrenia.
In addition, brain morphology and microstructure analyses using fMRI was performed in healthy subjects carrying the risk-haplotype: allele T of the C/T single nucleotide polymorphism (SNP) rs721286; allele A of the A/G single nucleotide polymorphism (SNP) rs2008323; and allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282 (referred to herein as the "TAC risk haplotype").
TAC risk-haplotype carriers showed significant gray matter volume reduction, as compared to non-risk-haplotype carriers, in several brain regions: left medial frontal gyrus, left middle temporal gyrus, the left insula, left superior temporal gyrus, and the anterior cingulate cortex. These brain regions have been previously reported to manifest gray matter deficits in schizophrenia (For example, see Wilke et al., 2001; Shenton et al., 2001; and Kubicki et al., 2002).
TAC risk-haplotype carriers also showed gray matter volume increase in the left side of the amygdala, claustrum and para-hippocampal gyrus. Increases of bilateral para-hippocampal gyrus volume have been reported in unaffected relatives of schizophrenia patients (Goghari et al., 2007).
Maps of Fractional anisotropy (FA) and apparent diffusion coefficient (ADC) can be produced from the image analysis of the fMRI data.
A decrease in FA was found in the right hemisphere frontal and temporal gyrus and the anterior cingulated cortex, while an increase in FA was observed in the Insula, left superior frontal gyrus and Claustrum of TAC risk-haplotype carriers.
TAC risk-haplotype carriers also showed a wide-spread increase in the ADC in both hemispheres, including the anterior cingulate cortex, right middle temporal gyrus, left post central gyrus, cerebellum, post-central lobule, precuneus and posterior cingulate cortex.
The results showed herein indicate that the TAC risk haplotype is associated with morphological changes in specific brain regions.
At least some of these changes are similar to brain morphology changes observed in schizophrenia. These results provide further support for the association between the risk-haplotype and the schizophrenia.
~ JSy ~
MATERIALS AND METHODS DNA Polymorphism in golli-MBP
Subjects The study enrolled two case/control groups. The first cohort included 120 unrelated Ashkenazi-Jewish schizophrenia patients (86 males, 34 females) and 236 unrelated control (143 males, 93 females) individuals. The patients included in this group were 18-65 years old (average=38.2, SD=8.5) and met the DSM-IV criteria (American Psychiatric Association, 1994) for schizophrenia. The patients were recruited in Abarbanel hospital, Bat- Yam Israel, and signed informed consent forms. The control group included non-clinical 22-54 years old (average=32.4, SD=5.8) ethnically- matched subjects who approached the molecular genetics laboratory at Meir Hospital, Kfar-Sava, Israel (run by R. Navon, 1990-2000). The second cohort included 379 (235 males, 144 females) unrelated Ashkenazi-Jewish schizophrenia patients which were selected randomly from a larger cohort studied previously (Shifinan et al. 2002). The patients included in this group were diagnosed according to the DSM-IV, and were 18- 83 years old (average=46.5, SD=13.6). Control samples were acquired from 380 (319 males, 61 females) healthy 19-68 years old (average=39.6, SD=13.7) Ashkenazi-Jewish individuals using blood bank volunteers. Only individuals who reported having 4 Ashkenazi-Jewish grandparents were included in the study. Controls were asked to report on cases of psychiatric disorders in their families, and those who did were excluded from the study. For patients in both cohorts, all diagnoses and exclusion criteria were assigned by a standard procedure. This procedure included a direct interview using the structured clinical interview for personality disorders (SCID), a questionnaire with inclusion and exclusion criteria and cross-references to medical records (for further detailing see Shirman et al. 2002). All samples were collected with appropriate IRB (Internal Review Board) approvals and the participants voluntarily signed an informed consent form prior to joining.
SNP selection SNPs included in the association analysis were selected from the CEU (Caucasian European Utah) population in the HapMap project database (http://www.hapmap.com), which highly resembles the Ashkenazi-Jewish population as previously discussed [Korostishevsky et al. 2004]. Twenty six tagging SNP markers (the minimal group of SNPs required to define all haplotypes in a given linkage disequilibrium (LD) block), along the 123.5 kb DNA stretch of the two golli-MBP
transcripts, were selected for genotyping using the Haploview software, version 3.32 (Broad Institute of MIT and Harvard, Cambridge, MA, USA) (Figure 1). Screening criteria applied were: minor allele frequency > 0.1, minimum haplotype frequency > 0.05 and Hardy-Weinberg cutoff = 0.05. SNP genotyping Genomic DNA from patients and controls was isolated from peripheral blood using the PureGene kit (Gentra, MN) according to the manufacturer's protocol and was second-handed for genotyping. SNP genotyping was performed by the high-throughput system of chip-based mass spectrometry (matrix-assisted laser desorption/ionization time-of-flight; MALDI-TOF) (Sequenom, Inc., San Diego, CA5 http://www.sequenom.com/) using the iPLEX™ chemistry. All assays for the PCR and associated extension reactions were designed by the SpectroDESIGNER software (Sequenom) and primers were synthesized by Integrated DNA Technologies (Coralville, Iowa). The reaction volume of 5 μL contained 7.5 ng of genomic DNA, 100 nM each of the forward and reverse sequence-specific primer that contained a universal sequence at its 5' end, 0.5 mM of each deoxynucleoside triphosphate, 1.625 mM MgC12, reaction buffer, and 0.5 units of HotStarTaq DNA polymerase (Qiagen, Germany). PCR conditions were as follows: an initial denaturation step for 15 min at 94°C, followed by 45 cycles of 20 sec at 94°C, 30 sec at 56°C, 1 min at 72°C, and a final extension step for 3 min at 72°C. Allele-specific primer extensions were conducted with the Mass EXTEND Reagents Kit containing di-deoxy nucleotides (Sequenom). The high- throughput liquid handling was performed with the aid of a MULTIMEK 96 automated 96-channel robot (Beckman Coulter, Fullerton, California). Primer extension products were loaded onto a 384-element chip (SpectroCHIP; Sequenom) by nanoliter pipetting robot (SpectroPOINT, Sequenom) and analyzed with a MassARRAY mass spectrometer (Bruker Daltonik, Bremen, Germany). The resulting mass spectra were processed and analyzed for peak identification and allele determination with the MassARRAY 3.0 software (Sequenom). All SNPs were re-genotyped in 22 randomly- selected DNA samples, and 8-12 spots on each chip were loaded with water as negative controls. AU replicates were in agreement with each other and no signal was observed in the negative control wells.
Golli-MBP mRNA Quantification
Brain samples Samples from DLPFC (Brodmann area 46) were obtained from the Stanley Foundation Brain Collection and Neuropathology Consortium, Bethesda,
Maryland. The collection is well-matched for age, pH and gender (Torrey et al. 2000). Schizophrenic patients were diagnosed according to DSM-IIIR (American Psychiatric Association, 1987) or DSM-IV (American Psychiatric Association, 1994) criteria.
RNA isolation and golli-MBP expression RNA isolation and cDNA synthesis procedures were performed as previously described (Korostishevsky et al. 2004). Golli- MBP mRNA expression was quantified in DLPFC brain samples obtained from 32 schizophrenia patients and 34 controls by real-time PCR using Absolute SYBR Green Mix (ABgene, Epsom, UK) on an ABI Prism 7900HT sequence detection system (Applied Biosystems, Foster City, US). Amplification conditions were: 50°C for 2 min, 95°C for 15 min, followed by 40 cycles of 95°C for 15 s, 600C for 1 min. Real-time primers were designed using PrimerExpress software, with a specified amplicon length between 80 and 150 bp. Primer sequences for the golli-MBP gene were: forward, 5'- GAGAAGGCCAGTACGAATAG-3' (SEQ ID: 19) and reverse, 5'- GAACACTTCGTTGTCCTCTG-S' (SEQ ID: 20). Primer sequences for the reference gene TFRC (Transferrin receptor) were: forward, 5'-
TGGCTACTTGGGCTATTGTAAACG -3' (SEQ ID: 21) and reverse, 5'- GGTGGTTCTGTTCCCTCTATCTCC -3' (SEQ ID: 22). TFRC gene was analyzed in our lab along with 15 other reference genes using a micro fluidic card (TaqMan® Gene Expression Assays) and was found to be the most stably expressed in the examined tissue (unpublished data). Golli-MBP mRNA quantity was expressed as the amount of target, normalized to an endogenous reference and relative to a calibrator according to the formula 2"ΔΔCt, where Ct is the threshold cycle, ΔCt = Ct (target) - Ct (reference), and ΔΔCt = ΔCt (sample) - ΔCt (calibrator sample). Real-time SYBR-green dissociation curves showed one species of amplicon for each primer combination (data not shown).
Genome analysis
The region surrounding the LD block with the associated SNPs was investigated for the presence of regulatory elements, transcription factor binding sites (TFBS) and conserved regions using the University of California, Santa Cruz (UCSC) Genome Browser (http://genome.ucsc.edu). The conservation among species, ESPERR (Evolutionary and Sequence Pattern Extraction through Reduced Representations) regulatory potential ("7x Reg potential" track), TFBS conservation and the ORegAnno (Open Regulatory Annotation) tracks were examined.
„
Polymerase chain reaction and DNA direct sequencing
Polymerase chain reaction (PCR) was used to amplify exon 3 and the CTCF- binding site region of golli-MBP. PCR was performed in a 50 μl reaction volume containing 100 ng genomic DNA, 0.2 μM dNTP mix, 1Ox reaction buffer, 5x enhancer solution, 10 μM of each primer and 2 units of Taq DNA polymerase (all reagents are from PeqLab, Erlangen, Germany). After DNA denaturation at 94°C for 3 minutes, PCR was performed in 36 cycles of 94°C for 30 seconds, 620C {golli-MBP exon 3) or 56°C {golli-MBP CTCF) for 45 seconds, 72°C for 45 seconds, with a final extension step at 72°C for 10 minutes. The primer sequences were (amplicon length is in parentheses): golli-MBP exon 3: forward 5'-GTGCATGCCACCACACCT-3l (SEQ ID: 23) and reverse 5'-TGCTTAGGTGCTTAGGCAGA-S' (SEQ ID: 24) (597 bp); golli- MBP CTCF region: forward 5l-AAAAATCAGGGGAATATTATTACAAG-31 (SEQ ID: 25) and reverse S'-CAGTTATACTCCATTACAGGATGCTT-S' (SEQ ID: 26) (818 bp). PCR products were purified using High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's instructions, and visualized on 2% agarose gels. Direct sequencing was carried out by using the ABI PRISM Big Dye Terminator Cycle Sequencing kit and the ABI PRISM 3100 automated sequencer (Applied Biosystems).
Statistical analysis
Allele, genotype and haplotype frequencies were compared between patients and controls using the chi-square test. Simulated P- values (10,000 iterations for single markers and haplotypes) were calculated using the Haplo. Stats package in the "R" software (www.R-project.org). SNPs rs2013963 and rs470549 simulated P-values were calculated using two-tailed Fisher exact test. The Haploview program was used to estimate pairwise LD between SNP markers and to detect departure from Hardy- Weinberg equilibrium (HWE). Odds ratios were calculated according to Mantel- Haenszel method using the StatCalc program (Epi Info 2002; Centers for Disease Control and Prevention, Atlanta, GA). Mantel-Haenszel P- value of genotypic association (2 by 3 by K tables) was calculated using Cochran-Mantel-Haenszel Chi- Squared test in "R". Gene expression levels and correlations with the "risk'V'protective" haplotypes were compared by the appropriate tests using SPSS
** J J "
v 14.0 (SPSS, Chicago, IL). In the expression by haplotype analysis, phase resolutions for each individual were calculated by the em.haplotype function (DGCgenetics: R package version 1.0) in the "R" programming environment. Power analysis was carried out using the Power Calculator for Two Stage Association Studies (CaTS) (http://www.sph.umich.edu/csg/abecasis/CaTS/). Our study design had more than 90% power to detect a relative risk of 1.5 with a disease allele frequency above 0.15 and an estimated disease prevalence of 0.0I3 in a multiplicative genetic model.
Association of DNA Polymorphism in golli-MBP with brain morphology Subjects
Blood samples were acquired from 100 healthy Jewish Ashkenazi volunteers, who were required to have no history of any familial psychiatric disorders. Written informed consent was obtained from all study participants. The study was approved by the ethics committee of the Health Ministry of Israel. DNA was isolated from blood samples and genotyping was preformed for the golli~MBP 3-SNPs haplotype (rsl2458282, rs2008323, rs721286).
According to their genotyping, 26 subjects (Table 4) were asked to undergo an MRI scan and signed informed consent forms of the of Tel-Aviv Sourasky Medical Center ethics committee. The genotyped subjects were: 8 individuals homozygous to the risk-haplotype (the TAC risk-haplotype), 6 individuals homo∑ygous to the protective-haplotype and 12 individuals who carry a neutral-haplotype that is neither the defined risk/protective haplotypes. These subjects were divided and analyzed in two groups: individuals that carry the TAC risk-haplotype ("Risk-Haplotype carriers" group) and individuals that carry the 'protective' and 'neutral' haplotypes ("Non- carriers" group) (Table 4).
Table 4 provides demographic characteristics of the studied groups which participated in the association study of DNA polymorphism in golli-MBP and fMRI brain morphology. Subjects were divided into two groups (Risk-Haplotype carriers; Non-carriers) according to their golli-MBP 3-SNPs haplotype status. There were no significant group differences in age or sex ratios.
- -
Table 4
DNA isolation and Genotyping
Genomic DNA was isolated from peripheral blood using the ArchiveGene™ DNA Purification kit (5 PRIME, Gaithersburg, MD) according to the manufacturer's protocol. SNPs were genotyped by high-throughput chip-based mass spectrometry (matrix- assisted laser desorption/ionization time-of-flight; MALDI-TOF) (Sequenom, Inc., San Diego, CA, http://www.sequenom.com/) system, using the iPLEX™ chemistry. All assays for the PCR and associated extension reactions were designed by the SpectroDESIGNER software (Sequenom) and primers were synthesized by Integrated DNA Technologies (Coralville, Iowa). The 5 μL reaction volume contained 7.5 ng of genomic DNA, 100 nM each of the forward and reverse sequence-specific primer that contained a universal sequence at its 5' end, 0.5 mM of each deoxynucleoside triphosphate, 1.625 mM MgC12, reaction buffer, and 0.5 units of HotStarTaq DNA polymerase (Qiagen, Germany). PCR conditions were as follows: an initial denaturation step for 15 min at 94°C, followed by 45 cycles of 20 sec at 94°C, 30 sec at 56°C, 1 min at 72°C, and a final extension step for 3 min at 72°C. Allele-specific primer extensions were conducted with the Mass EXTEND Reagents Kit containing di-deoxy nucleotides (Sequenom). The high-throughput liquid handling was performed with the aid of a MULTIMEK 96 automated 96-channel robot (Beckman Coulter, FuUerton, California). Primer extension products were loaded onto a 384-element chip (SpectroCHIP; Sequenom) by nanoliter pipetting robot (SpectroPOINT, Sequenom) and analyzed with a MassARRAY mass spectrometer (Bruker Daltonik, Bremen, Germany). The resulting mass spectra were processed and analyzed for peak identification and allele determination by the MassARRAY 3.0 software (Sequenom). All SNPs were re- genotyped in 6 randomly-selected DNA samples, and 8 spots were loaded with water as
negative controls. AU replicates were in agreement with each other and no signal was observed in the negative control wells.
Image Acquisition Magnetic resonance imaging was performed by a 3T (GE) MRI system at the
Sourasky Medical Center (Tel Aviv, Israel). The MRI protocol included conventional anatomy sequences and DTI acquired with a standard head-coil.
Conventional anatomy sequences T1 weighted images: 3D spoiled gradient recalled echo (SPGR) sequence with the following parameters: 66-78 axial slices, TR/TE = 400/3.2 ms and resolution 1x1x2 mm3. T2 weighted images: Fast spin echo T2 weighted sequence with 24 axial slices, TR/TE=4600/85ms, echo train length of 32 echos and resolution of 1x1x3 mm3. FLAIR images: Fluid-attenuated inversion recovery sequence with 24 axial slices, TR/TE/TI - 9000/140/2100 ms and resolution 1x1x4 mm3. While the T2 and FLAIR images were used for radiological assessment of the subjects, the 3D Tl weighted images were used for volumetric analysis and as reference to the DTI experiments.
DTIprotocol Spin-echo diffusion weighted echo planar imaging (DW-EPI) sequence was performed with 48 axial slices and resolution of 2.5x2.5x2.5 mm3. Diffusion parameters were: Δ/δ=25/19ms, b value of 1000 s/mm2 acquired with 19 gradient directions. The DW-EPI sequence was gated to the cardiac cycle with TR of 30 R-R intervals and TE of 88ms.
Image Analysis
Image analysis included processing of the DTI and SPGR data sets. From the DTI data sets, maps of the fractional anisotropy (FA) and apparent diffusion coefficient (ADC) indices were produced using in-house software written in Matlab 7.3.0 (mathworks, Natick, MA). Image artifacts, normalization, unwrapping and statistical analysis, were performed using the SPM software (version 2, UCL, London, UK). Correction of head motion was performed using a least squares algorithm and 6 parameter (rigid body) transformations. Spatial normalization was done using 12-
. .
- Jo -
parameter affine non-linear transformation of the DTI's T2 (b=0) or SPGR images to the Montreal Neurological Institute (MNI) template (EPI or Tl). The normalization variables that best fit the DTI's T2 image were calculated, and were applied on the FA and ADC maps. The normalized image resolution was set to 1.5x1.5x1.5 mm3. The normalized SPGR images were then segmented into gray matter, white matter and CSF probability maps. AU normalized images (FA, ADC, gray matter and white matter probability maps (GMP and WMP)) were then smoothed with 8mm full width half maximum Gaussian kernel.
Statistical Analysis
Voxel based analysis (VBA) was used detect regionally specific differences in brain tissue composition on a voxel by voxel basis (Ashburner and Friston, 2000) for each of the indexed maps (FA, ADC, GMP and WMP) (Cram et al., 2003). In this analysis we used ANOVA tests to compare between the genetically defined groups. The results of the VBA analysis are presented as statistical parametric t-maps superimposed on SPGR brain template with resolution of 1.5x1.5x1.5 mm3 where colored regions represent areas passing the statistical threshold of p<0.005 and the color-scale represents the t- values.
ROI analysis
Using the statistical parametric maps, post-hoc region of interest analysis was performed. In each cluster surpassing the statistical threshold, a small volume correction was performed, using a sphere with radius of 6mm around the peak voxel. Only significant clusters (p<0.05, Family-wise error (FWE) corrected) and clusters larger than 50 voxels are reported. The anatomic location was determined using the SPM Wake Forest University WFU pickatlas toolbox (Maldjian et al., 2003).
RESULTS
GoIH-MBP association analysis
Polymorphism analysis was performed in a two-stage design; In cohort I5 a total of 26 SNPs were genotyped in 120 patients and 236 controls. A schematic representation of the MBP gene including the 26 SNPs and an LD map of the CEU
- 7 -
population are presented in Figure 1. Genotypes were obtained for most individuals with a mean completion rate of 95.2%±3.6% for 25 SNPs, not including marker rs470291, which was successfully genotyped in only 25.7% of the samples and was excluded from the study.
Table 1 provides a list of genotype and allele frequencies pertaining to 6 SNPs significantly associated with schizophrenia of cohort I; OR, odds ratio for the risk genotype/allele, except of markers rs2013963 and rs470549 in which OR is for the protective genotype; 95%-CI, 95% confidence interval; P, Chi square P-value, except of markers rs2013963 and rs470549 that were calculated by Fisher exact test.
Table 1
Cohort I- Genotype and Allele frequencies of the SNPs associated with schizophrenia.
Allele and genotype frequencies of six SNPs (rs2013963, rs721286, rs2008323, rsl2458282, rs470549 and rs7234883) were found to differ significantly between patients and controls (Table 1). Allele and genotype frequencies of both schizophrenia and control groups were within the Hardy- Weinberg equilibrium (HWE) except for
marker rs7233242 which departed from HWE for patients and controls combined (P=0.0006) and for patients alone (P=0.0014), but not for controls alone (P=O.075). The deviation in patients, however, is unlikely to be a consequence of a genetic effect since an excess of both homozygous genotypes was observed. Therefore, this SNP was 5 excluded from our further analyses.
In the second stage, the study focused on 3 of the 6 SNPs5 (rs721286, rs2008323, rsl2458282), which formed one LD block with associated haplotypes that contains exon 3 of the gene, and genotyped them in cohort II. The other 3 SNPs which were associated with schizophrenia in Cohort I (rs2013963, rs470549 and rs7234883). Genotypes were 0 obtained for most individuals with a mean completion rate of 96.4%±1.2% and all SNPs were within Hardy- Weinberg equilibrium both in schizophrenia and control groups. No gender effect was observed on any of the markers in either cohort.
In cohort II, SNP rs 12458282 showed both allelic and genotypic associations (Allele C P-value=0.003, OR[95%CI]-1.46[1.12-1.91]; Genotype CC P-value=0.018,5 OR[95%CI] =1.86[1.01-3.42]); SNPs rs721286 and rs2008323, however, exhibited trends in the same allelic directionality as in cohort I (jP-value=0.07, OR[95%CI]= 1.25[0.97-1.6O] and P-value=0.1, OR[95%CI]=1.20 [0.96-1.50], respectively).
Table 2 provides a list of Genotype and allele frequencies pertaining to 3 SNPs of cohort II; OR, odds ratio for the risk genotype/allele; 95%-CI, 95% confidence0 interval.
Table 2
Table 2. Combined Mantel-Haenszel Analysis - Genotype and Allele frequencies.
SNP lD Genotype Distribution (%) Allele Distribution (%) and Location in OR OR
N samples P samples P chrl8 [95%-CI] [95%-CI] rs721286 C/C C/T T/T C T
72903128 402 Patients 11.3 42.6 46 TT : 1.42 Patients 32.6 67.4 T : 1.35
0.0156 0.004 508 Controls 16.1 43 40.9 [1.08-1.88] Controls 37.6 62.4 [1.10-1.65] rs2008323 A/A A/G G/G A G
72902924 4S6 Patients 38 47.4 14.6 AA : 1.31 Patients 61.7 38.3
0.0323 A : 1.27
0.012 549 Controls 33.3 48 18.7 [1.00-1.72] Controls 57.3 42.7 [1.05-1.53] rsl2458282 C/C C/T T/T C T
72902841 400 Patients 12.6 41 46.4 CC : 1.77 Patients 33.1 66.9
0.0005 CC . 1.51 [1.05-2.97] 0.0001 504 Controls 7.2 36.1 56.7 Controls 25.3 74.7 [1.22-1.87]
Table 3 provides a list of estimated haplotypes frequencies of cohort I, cohort II,5 and the combined data. Simulated P-values and OR were calculated using Mantel-
Haenszel Chi-Squared Test for the combined data of cohorts I and II with assigned covariates. The three most common haplotypes of each block are presented; OR, odds ratio; D', standardized LD coefficient.
- -
The combined results for the 3 SNPs from cohort I and II were calculated using the Mantel-Haenszel method, revealing no confounding effects for any of the 3 SNPs (Table 2). The 3 SNPs formed an LD block with strongly associated risk and protective haplotypes, in cohorts I, II as well as in the combined data (table 3). The strongest association effects were observed in the combined data analysis of the 3 SNPs - rs721286, rs2008323 and rsl2458282 (Table 2), where rsl2458282 had the strongest effect, both in genotypic (P=0.0005, OR[95%CI]=1.77[1.05-2.97] for the CC genotype) and allelic association (P=O-OOOl5 OR[95%CI]=1.51 [1.22-1.87] for the C allele). In addition, haplotypes constructed from the same three SNPs, were generally more strongly associated with schizophrenia (global LD block P-value=0.0003) than the single-marker analysis (Table 3). In this block, haplotype C-G-T had a protective effect (P = 0.0009, OR [95%CI]=0.74[0.56-0.96]), whereas the T-A-C haplotype presented a risk effect (P=0.00005, OR[95%CI]=1.60[1.17-2.16]). Two-marker haplotype combinations within the block also showed significant effects, where the haplotypes composed of the nonadjacent markers rs721286-rsl2458282 (LD D'=97) had the strongest effect (global block P-value=0.00001). In this block, the C-T haplotype had a protective effect (P = 0.00105, OR[95%CI]=0.73 [0.56-0.96]), whereas T-C showed the opposite effect (P=0.00001, OR[95%CI]= 1.61[1.20-2.14]).
Conservation and regulatory elements analysis
Conservation and regulatory elements analyses of the LD block with the associated haplotypes DNA region using the UCSC genome browser have yielded interesting findings. The LD block is predicted to be highly conserved by a gap scoring algorithm ("chain" tracks) with placental mammals. The associated haplotype lies in a region that has a high regulatory potential (RP)5 which is conserved among 7 species ("7x Reg potential" track, predicted by the ESPERR algorithm; Max RP= 0.284, average RP = 0.108). Approximately 1.5 kb downstream of this haplotype, within the same LD block, there is a CCCTC-binding factor (CTCF) regulatory element (ORegAnno (Open Regulatory Annotation) database). When expanding the view, 3 more CTCF-binding sites were observed, 2 of which were downstream to the cϊassic- MBP promoter.
- -
Direct sequencing of golli-MBP exon 3 and CTCF-binding site regions
To examine the hypothesis that the associated markers/haplotypes were co- transmitted with a functional factor in the same LD block, golli-MBP exon 3 and regulatory CTCF-binding site regions were sequenced for 20 of the cohort I samples: 5 patients homozygote to the risk haplotype, 5 patients homozygote to the protective haplotype, 5 controls homozygote to the risk haplotype and 5 controls homozygote to the protective haplotype. While novel changes in the genomic sequence of the examined regions were not found, 3 SNPs in the CTCF-binding site region sequence (rs9960721, rs685975, rs7233574) were observed to be in complete LD with the associated haplotype. Namely, all subjects (patients and controls) who carry the associated risk haplotype were C-A-G homozygotes in the CTCF-binding site region SNPs, while all subjects (patients and controls) who carry the associated protective haplotype were A- C-A homozygotes in the CTCF-binding site region SNPs.
Expression analysis of Golli-MBP mRNA
To further investigate the link between golli-MBP and schizophrenia from another aspect, mRNA expression levels in postmortem DLPFC samples were examined. Real-time PCR analysis found no significant difference in the expression levels of the gene between schizophrenia patients and controls (Average relative quantification (RQ) values were 0.630 and 0.659 for schizophrenia patients and controls, respectively. P = 0.15). No correlation was observed between the gene expression levels and antipsychotic drug administration in patients, and therefore no correction for this variable was applied. The haplotypes found to be associated with the disease were examined for their affect mRNA expression levels. When the sample was divided into 3 groups (individuals that carry 1, 2 or 0 copies of the "risk'V'protective" haplotype (T-A-C and C-G-T, respectively) - no significant changes were observed. When the sample was divided into 2 groups (individuals that carry the "risk'V'protective" haplotype vs. those who do not) - no significant changes were observed.
This study demonstrated that SNPs in golli-MBP play a role in schizophrenia susceptibility.
Risk-haplotype for Golli-MBP correlates with changes in brain morphology
Table 5 provides for significant differences in gray matter probability between risk-haplotype carrier and non carriers. L — left, R — right, MFG - medial frontal gyrus, MTG - middle temporal gyrus, STG - superior temporal gyrus, SFG - superior frontal gyrus, IFG - inferior frontal gyrus, POG - post central gyrus, PCL - post-central lobule, ACC - anterior cingulate cortex, PHG - parahippocampal gyrus, Amg - amygdala. x,y,z (mm) represents the MNI atlas coordinate of the most significant voxel within the cluster, PCOrτected represents the p-value at the cluster level following small volume correction, K is the number of voxel of the cluster, T represents the X- value at the most significant voxel.
Voxel-based morphometry (VBM) of the gray matter probability maps revealed a significant decrease in gray matter volume of TAC risk-haplotype carriers compared to non-carriers in several brain regions, with strongest effects observed in the left medial frontal gyrus, left middle temporal gyrus, left insula and left superior temporal gyrus, Cerebellum, Lingual Gyrus, Right superior frontal gyrus, Left inferior frontal gyrus, Right medial frontal gyrus, Post central gyrus and the Post central lobule. Similar regions were found in the right hemisphere but with lower statistical significance (Table 5). Figure 11 provides statistical parametric maps showing gray matter volume decrease (Left (A): focusing on the ACC gray matter reduction
and increase (Right (B): focusing on the left Amygdala gray matter elevation CPcon-ectecT^-OOS)) in risk-haplotype carriers compared with non-carriers (at a threshold of Puncorreoted^.05). Threshold images have been transformed from MNI space into Talairach space and converted to T-scores, which were projected onto the pial surface of a representative standard surface; the range is shown in the corresponding color bars. Figure 11 shows a significant gray matter decrease as was observed in the anterior cingulate cortex. Increase in gray matter volume was most pronounced in the left amygdala, left claustrum and left para-hippocampal gyrus.
Table 5
FA changes
Table 6 provides for significant differences in FA between risk-haplotype carrier and non carriers. L - left, R - right, SLF - superior longitudinal fasc, MFG - medial
frontal gyrus, MTG - middle temporal gyrus, SFG - superior frontal gyrus, ACC - anterior cingulate cortex. x,y,z (mm) represents the MNI atlas coordinate of the most significant voxel within the cluster, P corrected represents the p value at the cluster level following small volume correction, K is the number of voxel of the cluster, T represents the t- value at the most significant voxel.
Voxel-wise analysis of the FA maps between the two genetic groups revealed significant FA reduction in the risk-haplotype carriers in several frontal and temporal regions of the right hemisphere (including the superior frontal gyrus, middle temporal gyrus and medial frontal gyrus) (Table 6). Figure 12 provides statistical parametric maps showing FA decrease (Left (A): focusing on the ACC FA reduction (i> corτected =0.02)) and increase (Right (B): focusing on the left SFG FA elevation (Pcorrected^O-OS)) in risk-haplotype carriers compared with non-carriers (at a threshold of
Threshold images have been transformed from MNI space into Talairach space and converted to T-scores, which were projected onto the pial surface of a representative standard surface; the range is shown in the corresponding color bars.
Figure 12 shows a significant FA reduction as found in the anterior cingulated cortex. Increase in FA values of the risk-haplotype group compared with the non- carriers group was found in small regions including the insula, left superior frontal gyrus and claustrum.
- 4 -
Table 6
ADC changes
The most significant changes were observed in the voxel- wise analysis of the ADC maps indicating a wide-spread increase in the ADC in both hemispheres. The strongest effects were in the right middle temporal gyrus, the left post central gyrus and the posterior cingulated cortex. ADC comparison results are summarized in Table 7 and are presented in Figure 13 for the cingulate cortex at a threshold of PO.001 in purpose of localizing the specific significantly differentiated areas.
Figure 13 provides statistical parametric map showing ADC elevation in risk- haplotype carriers compared with non-carriers (focusing on the ACC complex region at a threshold of iJ Uncorrected <0-01). Threshold images have been transformed from MNI
- -
space into Talairach space and converted to T-scores5 which were projected onto the pial surface of a representative standard surface; the range is shown in the corresponding color bars.
Table 7
Claims
1. A method of diagnosing a predisposition of a subject to schizophrenia, said method comprising testing a sample obtained from the subject for the presence of at least one allele or haplotype of the golli-MBP region selected from the group consisting of:
(i) allele T of the C/T single nucleotide polymorphism (SNP) rs721286; (ii) allele A of the A/G single nucleotide polymorphism (SNP) rs2008323; (iii) allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282; (iv) allele A of the A/G single nucleotide polymorphism (SNP) rs2013963;
(v) allele A of the A/G single nucleotide polymorphism (SNP) rs470549; (vi) allele A of the A/G single nucleotide polymorphism (SNP) rs7234883; (vii) allele C of the C/A single nucleotide polymorphism (SNP) rs9960721; (viii)allele A of the C/A single nucleotide polymorphism (SNP) rs685975; (ix) allele G of the A/G single nucleotide polymorphism (SNP) rs7233574; and
(x) any combination thereof; wherein presence of each of said allele or haplotype is indicative of a predisposition of the subject to schizophrenia.
2. A method according to claim I5 wherein said haplotype comprises allele C of the C/T polymorphism rsl2458282, and allele T of the C/T polymorphism rs721286.
3. A method according to claim I5 wherein said haplotype comprises allele C of the C/T polymorphism rsl2458282, and allele A of the A/G polymorphism rs2008323.
4. A method according to claim 1, wherein said haplotype comprise allele A of the A/G polymorphism rs2008323, and allele T of the C/T polymorphism rs721286.
5. A method according to claim 1, wherein said haplotype comprises allele C of the C/T polymorphism rsl2458282, allele A of the A/G polymorphism rs2008323, and allele T of the C/T polymorphism rs721286. - -
6. A method according to claim 1, wherein said haplotype comprises allele C of the C/A polymorphism rs9960721, allele A of the C/A polymorphism rs685975, and allele G of the A/G polymorphism rs7233574.
7. A method according to claim 1, further comprising testing for the presence of at least one additional schizophrenia-identifying marker.
8. A method according to claims 1-7, wherein said subject is human.
9. A method according to claims 1-8, wherein said subject is an embryo, a fetus, a child, or an adult.
10. A method according to claims 1-9, wherein said sample is a body fluid.
11. A method according to claims 10, wherein said body fluid is selected from the group consisting of blood, saliva, cerebrospinal fluid, urine, and sperm.
12. A method according to claims 1-11, wherein said testing for polymorphism is performed by SNP genotyping.
13. A method according to claim 12, wherein said SNP genotyping is performed by a method selected from the group consisting of (a) a primer extension assay; (b) PCR assay; (c) an allele-specific PCR assay; (d) a nucleic acid amplification assay; (e) a hybridization assay; (f) a mismatch-detection assay, (g) an enzymatic nucleic acid cleavage assay, and (h) a sequencing assay.
14. A method according to claims 1-13, further comprising measuring a clinical symptom of the subject.
15. A method according to claims 1-14, further comprising performing morphological analysis of the subject's brain for detecting aberrant brain morphology or microstructure.
16. A method according to claim 15 wherein said morphological analysis is performed using MRI or functional magnetic resonance imaging (fMRI).
17. A nucleic acid probe comprising a nucleotide sequence which hybridizes with at least a portion of golli-MBP region and which allows detection of at least one polymorphism therein for use in diagnosis of schizophrenia or predisposition to schizophrenia.
18. A nucleic acid probe of claims 17, wherein said polymorphism comprises at least one single nucleotide polymorphisms (SNP) selected from the group consisting of:
(i) allele T of the C/T single nucleotide polymorphism (SNP) rs721286;
(ii) allele A ofthe A/G single nucleotide polymorphism (SNP) rs2008323;
(iii) allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282;
(iv) allele C of the C/T single nucleotide polymorphism (SNP) rs721286; (v) allele G ofthe A/G single nucleotide polymorphism (SNP) rs2008323;
(vi) allele T of the C/T single nucleotide polymorphism (SNP) rsl2458282;
(vii) allele A of the A/G single nucleotide polymorphism (SNP) rs2013963 ;
(viii) allele A of the A/G single nucleotide polymorphism (SNP) rs470549;
(ix) allele A of the A/G single nucleotide polymorphism (SNP) rs7234883 ; (x) allele G of the A/G single nucleotide polymorphism (SNP) rs2013963 ;
(xi) allele G of the A/G single nucleotide polymorphism (SNP) rs470549;
(xii) allele G of the A/G single nucleotide polymorphism (SNP) rs7234883 ;
(xiii) allele C of the C/A single nucleotide polymorphism (SNP) rs9960721 \
(xiv) allele A of the C/A single nucleotide polymorphism (SNP) rs685975; (xv) allele G of the A/G single nucleotide polymorphism (SNP) rs7233574;
(xvi) allele A of the C/A single nucleotide polymorphism (SNP) rs9960721 ;
(xvii) allele C of the C/A single nucleotide polymorphism (SNP) rs685975;
(xviii) allele A of the A/G single nucleotide polymorphism (SNP) rs7233574; and (xix) any combination thereof.
19. A nucleic acid probe of claims 17 or 18, for use in combination with least one additional schizophrenia-identifying marker.
20. Use of a nucleic acid probe comprising a nucleotide sequence which hybridizes with at least a portion of golli-MBP region and which allows detection of at least one polymorphism in diagnosis of schizophrenia or predisposition to schizophrenia.
21. The use of claim 20, wherein said polymorphism comprises at least one single nucleotide polymorphisms (SNP) selected from the group consisting of:
(i) allele T of the C/T single nucleotide polymorphism (SNP) rs721286;
(ii) allele A of the AJG single nucleotide polymorphism (SNP) rs2008323 ; (iii) allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282;
(iv) allele C of the C/T single nucleotide polymorphism (SNP) rs721286;
(v) allele G of the AJG single nucleotide polymorphism (SNP) rs2008323;
(vi) allele T of the C/T single nucleotide polymorphism (SNP) rsl2458282;
(vii) allele A of the AJG single nucleotide polymorphism (SNP) rs2013963 ; (viii) allele A of the AJG single nucleotide polymorphism (SNP) rs470549;
(ix) allele A of the AJG single nucleotide polymorphism (SNP) rs7234883;
(x) allele G of the AJG single nucleotide polymorphism (SNP) rs2013963 ;
(xi) allele G of the AJG single nucleotide polymorphism (SNP) rs470549;
(xii) allele G of the AJG single nucleotide polymorphism (SNP) rs7234883 ; (xiii) allele C of the C/A single nucleotide polymorphism (SNP) rs9960721 ;
(xiv) allele A of the C/A single nucleotide polymorphism (SNP) rs685975;
(xv) allele G of the AJG single nucleotide polymorphism (SNP) rs7233574;
(xvi) allele A of the C/A single nucleotide polymorphism (SNP) rs9960721 ;
(xvii) allele C of the C/A single nucleotide polymorphism (SNP) rs685975; (xviii) allele A of the AJG single nucleotide polymorphism (SNP) rs7233574; and
(xix) any combination thereof.
22. An array comprising a substrate having a plurality of segments, wherein at least one of said segments comprises a probe which hybridizes with at least a portion of golli- MBP region and which allows detection of at least one polymorphism therein in diagnosis of schizophrenia or predisposition to schizophrenia.
23. The array of claim 22, wherein said polymorphism is at least one single nucleotide polymorphisms (SNP) from the group consisting of:
(i) allele T of the C/T single nucleotide polymorphism (SNP) rs721286;
(ii) allele A of the A/G single nucleotide polymorphism (SNP) rs2008323 ; (iii) allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282;
(iv) allele C of the C/T single nucleotide polymorphism (SNP) rs721286;
(v) allele G of the A/G single nucleotide polymorphism (SNP) rs2008323;
(vi) allele T of the C/T single nucleotide polymorphism (SNP) rsl2458282;
(vii) allele A of the A/G single nucleotide polymorphism (SNP) rs2013963; (viii) allele A of the A/G single nucleotide polymorphism (SNP) rs470549 ;
(ix) allele A of the A/G single nucleotide polymorphism (SNP) rs7234883;
(x) allele G of the A/G single nucleotide polymorphism (SNP) rs2013963 ;
(xi) allele G of the A/G single nucleotide polymorphism (SNP) rs470549;
(xii) allele G of the A/G single nucleotide polymorphism (SNP) rs7234883 ; (xiii) allele C of the C/A single nucleotide polymorphism (SNP) rs9960721 ;
(xiv) allele A of the C/A single nucleotide polymorphism (SNP) rs6S5975;
(xv) allele G of the A/G single nucleotide polymorphism (SNP) rs7233574;
(xvi) allele A of the C/A single nucleotide polymorphism (SNP) rs9960721 ;
(xvii) allele C of the C/A single nucleotide polymorphism (SNP) rs685975; (xviii) allele A of the A/G single nucleotide polymorphism (SNP) rs7233574; and
(xix) any combination thereof.
24. Use of an array comprising a substrate having a plurality of segments, wherein at least one of said segment comprises a probe which hybridizes with at least a portion of golli-MBP region and allows detection of at least one polymorphism therein in diagnosis of schizophrenia or predisposition to schizophrenia.
25. A kit for carrying out the methods of any of claims 1 -24.
26. The kit of claim 25, wherein said kit is compartmentalized to receive a reagent for measuring single nucleotide polymorphism (SNP) in the golli-MBP region in a nucleic acid sample of a subject, said kit comprising at least one oligonucleotide that interacts with a single nucleotide polymorphism (SNP) in the golli-MBP polynucleotide region wherein said SNP polymorphism is selected from the group consisting of rsl2458282, rs2008323, rs721286, rs2013963, rs470549, rs7234883, rs9960721, rs685975, rs7233574 and any combination thereof.
27. The kit of claim 25 or 26, wherein said kit comprises at least one additional oligonucleotide that interacts with a single nucleotide polymorphism (SNP) of at least one additional schizophrenia-identifying marker.
28. A method of determining a predisposition of a subject to having an aberrant brain morphology or microstructure, said method comprising testing a sample obtained from the subject for the presence of at least one allele or haplotype of the golli-MBP region selected from the group consisting of:
(v) allele T of the C/T single nucleotide polymorphism (SNP) rs721286; (vi) allele A of the A/G single nucleotide polymorphism (SNP) rs2008323;
(vii) allele C of the C/T single nucleotide polymorphism (SNP) rsl2458282; and (viii) any combination thereof; wherein presence of each of said allele or haplotype is indicative of a predisposition to having an aberrant brain morphology.
29. A method according to claim 28, wherein said haplotype comprises allele C of the C/T polymorphism rsl2458282, allele A of the A/G polymorphism rs20083235 and allele T of the C/T polymorphism rs721286.
30. A method according to claim 15 or 28, wherein aberrant brain morphology is manifested by at least one parameter selected from the group consisting of:
(i) an increase in apparent diffusion coefficient (ADC); (ii) a change in fractional anisotropy (FA); and (iii) a change in gray matter volume.
31. A method according to claim 30, wherein the apparent diffusion coefficient (ADC) increase is observed in a brain region selected from the group consisting of: - -
(a) Right - middle temporal gyrus;
(b) Left - post central gyrus;
(c) Cerebellum;
(d) Post central lobule; (e) Precuneus;
(f) Posterior cingulate cortex; and
(g) anterior cingulated cortex ACC.
32. A method according to claim 30, wherein the fractional anisotropy (FA) change is observed as a decrease in FA in a brain region selected from the group consisting of:
(a) Left — superior longitudinal fasciculus;
(b) Right - superior frontal gyrus;
(c) Right - middle temporal gyrus;
(d) Right - medial frontal gyrus; (e) anterior cingulated cortex; and
(f) Cerebellum.
33. A method according to claim 30, wherein the fractional anisotropy (FA) change is observed as an increase in FA in a brain region selected from the group consisting of: (a) Left - superior longitudinal fasciculus;
(b) Left Insula; and
(c) Claustrum.
34. A method according to claim 30, wherein the change in gray matter volume is observed as a gray matter volume decrease in a brain region selected from the group consisting of:
(a) Left - medial frontal gyrus;
(b) Left - middle temporal gyrus;
(c) Left Insula; (d) Left - superior temporal gyrus;
(e) Cerebellum;
(f) Lingual Gyrus;
(g) Right - superior frontal gyrus; (h) Left - inferior frontal gyrus; (i) Right - medial frontal gyrus; (j) post central gyrus; (k) Post central lobule; and (I) anterior cingulated cortex.
35. A method according to claim 30, wherein the change in gray matter volume is observed as a gray matter volume increase in a brain region selected from the group consisting of: (a) Left — parahippocampal gyrus;
(b) Left - Claustrum; and
(c) left amygdala.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US20151508P | 2008-12-11 | 2008-12-11 | |
| US61/201,515 | 2008-12-11 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010067372A1 true WO2010067372A1 (en) | 2010-06-17 |
Family
ID=41664677
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2009/001185 Ceased WO2010067372A1 (en) | 2008-12-11 | 2009-12-13 | Genetic markers of schizophrenia |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2010067372A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7951543B2 (en) | 2009-11-04 | 2011-05-31 | Suregene, Llc | Methods and compositions for the treatment of psychotic disorders through the identification of the SULT4A1-1 haplotype |
| US7951542B2 (en) | 2009-11-04 | 2011-05-31 | Surgene, LLC | Methods and compositions for the treatment of psychotic disorders through the identification of the SULT4A1-1 haplotype |
| US7972793B2 (en) | 2009-11-04 | 2011-07-05 | Suregene, Llc | Methods and compositions for the treatment of psychotic disorders through the identification of the SULT4A1-1 haplotype |
| US7985551B2 (en) | 2009-11-04 | 2011-07-26 | Suregene, Llc | Methods and compositions for the treatment of psychotic disorders through the identification of the SULT4A1-1 haplotype |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998020020A2 (en) | 1996-11-06 | 1998-05-14 | Sequenom, Inc. | High density immobilization of nucleic acids |
| WO1998020019A1 (en) | 1996-11-06 | 1998-05-14 | Sequenom, Inc. | Compositions and methods for immobilizing nucleic acids to solid supports |
| WO2003070082A2 (en) | 2002-02-21 | 2003-08-28 | Idgene Pharmaceuticals Ltd. | Association of snps in the comt locus and neighboring loci with schizophrenia, bipolar disorder, breast cancer and colorectal cancer |
| US20040115699A1 (en) | 2001-08-28 | 2004-06-17 | Kaytes Paul S. | Single nucleotide polymorphisms diagnostic for schizophrenia |
| WO2006023719A2 (en) | 2004-08-20 | 2006-03-02 | Enh Research Institute | Identification of snp’s associated with schizophrenia, schizoaffective disorder and bipolar disorder |
| WO2006072075A2 (en) | 2004-12-30 | 2006-07-06 | University Of Louisville Research Foundation, Inc. | Genetic markers of schizophrenia |
| WO2008093343A2 (en) | 2007-01-31 | 2008-08-07 | Hadasit Medical Research Services And Development Ltd. | Schizophrenia associated genes and markers |
-
2009
- 2009-12-13 WO PCT/IL2009/001185 patent/WO2010067372A1/en not_active Ceased
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998020020A2 (en) | 1996-11-06 | 1998-05-14 | Sequenom, Inc. | High density immobilization of nucleic acids |
| WO1998020019A1 (en) | 1996-11-06 | 1998-05-14 | Sequenom, Inc. | Compositions and methods for immobilizing nucleic acids to solid supports |
| US20040115699A1 (en) | 2001-08-28 | 2004-06-17 | Kaytes Paul S. | Single nucleotide polymorphisms diagnostic for schizophrenia |
| WO2003070082A2 (en) | 2002-02-21 | 2003-08-28 | Idgene Pharmaceuticals Ltd. | Association of snps in the comt locus and neighboring loci with schizophrenia, bipolar disorder, breast cancer and colorectal cancer |
| WO2006023719A2 (en) | 2004-08-20 | 2006-03-02 | Enh Research Institute | Identification of snp’s associated with schizophrenia, schizoaffective disorder and bipolar disorder |
| WO2006072075A2 (en) | 2004-12-30 | 2006-07-06 | University Of Louisville Research Foundation, Inc. | Genetic markers of schizophrenia |
| WO2008093343A2 (en) | 2007-01-31 | 2008-08-07 | Hadasit Medical Research Services And Development Ltd. | Schizophrenia associated genes and markers |
Non-Patent Citations (21)
| Title |
|---|
| "Diagnostic and Statistical Manual of Mental Disorders Fourth Edition", 1994, AMERICAN PSYCHIATRIC ASSOCIATION |
| ASHBURNER, J.; FRISTON, K.J.: "Voxel-based morphometry--the methods", NEUROIMAGE, vol. 11, 2000, pages 805 - 821 |
| BOGGS, J.M.: "Myelin basic protein: a multifunctional protein", CELL MOL LIFE SCI, vol. 63, 2006, pages 1945 - 1961, XP019419206, DOI: doi:10.1007/s00018-006-6094-7 |
| CHAMBERS, J.S.; PERRONE-BIZZOZERO, N.I.: "Altered myelination of the hippocampal formation in subjects with schizophrenia and bipolar disorder", NEUROCHEM RES, vol. 29, 2004, pages 2293 - 2302, XP019289708 |
| CRUM, W.R.; GRIFFIN, L.D.; HILL, D.L.; HAWKES, D.J.: "Zen and the art of medical image registration: correspondence, homology, and quality", NEUROIMAGE, vol. 20, 2003, pages 1425 - 1437 |
| DATABASE Geneseq [online] 4 October 2007 (2007-10-04), "SNP found in human HindII fragment SEQ ID NO:22278.", XP002569076, retrieved from EBI accession no. GSN:AFF22860 Database accession no. AFF22860 * |
| DATABASE Probe [online] 2005, "Bead microarray element (bead) probe for Homo sapiens variation rs721286. Has been used in the HapMap project for genotyping. Reagent is available from Illumina.", XP002569073, retrieved from NCBI Database accession no. Pr864193.1 * |
| DATABASE Probe 16 September 2005 (2005-09-16), "Bead microarray element (bead) probe for Homo sapiens variation rs2008323. Has been used in the HapMap project for genotyping. Reagent is available from Illumina.", XP002569074, retrieved from NCBI Database accession no. Pr863453.1 * |
| DATABASE Probe 2 March 2006 (2006-03-02), "Sequence-specific oligonucleotide (SSO) probe for Homo sapiens variation rs12458282. Has been used in the HapMap project for genotyping. Reagent is available from Perlegen.", XP002569075, retrieved from NCBI Database accession no. Pr005575599.1 * |
| FENG, J.M.: "Minireview: expression and function of golli protein in immune system", NEUROCHEM RES, vol. 32, 2007, pages 273 - 278, XP019483211 |
| HAROUTUNIAN, V.; KATSEL, P.; DRACHEVA, S.; STEWART, D.G.; DAVIS, K.L.: "Variations in oligodendrocyte-related gene expression across multiple cortical regions: implications for the pathophysiology of schizophrenia", INT J NEUROPSYCHOPHARMACOL, vol. 10, 2007, pages 565 - 573 |
| JUNGERIUS B J ET AL: "An association screen of myelin-related genes implicates the chromosome 22q11 PIK4CA gene in schizophrenia", MOLECULAR PSYCHIATRY, vol. 13, no. 11, November 2008 (2008-11-01), pages 1060 - 1068, XP002569079, ISSN: 1359-4184 * |
| KOROSTISHEVSKY, M.; KAGANOVICH, M.; CHOLOSTOY, A.; ASHKENAZI, M.; RATNER, Y.; DAHARY, D.; BERNSTEIN, J.; BENING-ABU-SHACH, U.; BEN: "Is the G72/G30 locus associated with schizophrenia? single nucleotide polymorphisms, haplotypes, and gene expression analysis", BIOL PSYCHIATRY, vol. 56, 2004, pages 169 - 176 |
| MALDJIAN, J.A.; LAURIENTI, P.J.; KRAFT, R.A.; BURDETTE, J.H.: "An automated method for neuroanatomic and cytoarchitectonic atlas-based interrogation of fMRI data sets", NEUROIMAGE, vol. 19, 2003, pages 1233 - 1239 |
| MCINTOSH A M ET AL: "The effects of a neuregulin 1 variant on white matter density and integrity", MOLECULAR PSYCHIATRY, vol. 13, no. 11, November 2008 (2008-11-01), pages 1054 - 1059, XP002569078, ISSN: 1359-4184 * |
| OLMSTEAD, C.; PRIBYL, T.; KAMPF, K.; JACOBS, E.; CAMPAGNONI, C.; HANDLEY, V.S.; E.; MESSING, A.; LAZAREFF, J.; CAMPAGNONI, A.: "Targeted ablation of the Golli products of the myelin basic protein gene: learning deficits", SOC NEUROSCI ABSTR, 2000 |
| SHIFMAN, S.; BRONSTEIN, M.; STERNFELD, M.; PISANTE-SHALOM, A.; LEV-LEHMAN, E.; WEIZMAN, A.; REZNIK, I.; SPIVAK, B.; GRISARU, N.; K: "A highly significant association between a COMT haplotype and schizophrenia", AM J HUM GENET, vol. 71, 2002, pages 1296 - 1302 |
| TKACHEV, D.; MIMMACK, M.L.; RYAN, M.M.; WAYLAND, M.; FREEMAN, T.; JONES, P.B.; STARKEY, M.; WEBSTER, M.J.; YOLKEN, R.H.; BAHN, S.: "Oligodendrocyte dysfunction in schizophrenia and bipolar disorder", LANCET, vol. 362, 2003, pages 798 - 805, XP004779174, DOI: doi:10.1016/S0140-6736(03)14289-4 |
| TORREY, E.F.; WEBSTER, M.; KNABLE, M.; JOHNSTON, N.; YOLKEN, R.H.: "The stanley foundation brain collection and neuropathology consortium", SCHIZOPHR RES, vol. 44, 2000, pages 151 - 155, XP005158675, DOI: doi:10.1016/S0920-9964(99)00192-9 |
| WALSS-BASS CONSUELO ET AL: "Evidence of genetic overlap of schizophrenia and bipolar disorder: linkage disequilibrium analysis of chromosome 18 in the Costa Rican population.", AMERICAN JOURNAL OF MEDICAL GENETICS. PART B, NEUROPSYCHIATRIC GENETICS : THE OFFICIAL PUBLICATION OF THE INTERNATIONAL SOCIETY OF PSYCHIATRIC GENETICS 5 NOV 2005, vol. 139B, no. 1, 5 November 2005 (2005-11-05), pages 54 - 60, XP002569077, ISSN: 1552-4841 * |
| WAN ET AL: "Polymorphisms of myelin-associated glycoprotein gene are associated with schizophrenia in the Chinese Han population", NEUROSCIENCE LETTERS, LIMERICK, IE, vol. 388, no. 3, 18 November 2005 (2005-11-18), pages 126 - 131, XP005046279, ISSN: 0304-3940 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7951543B2 (en) | 2009-11-04 | 2011-05-31 | Suregene, Llc | Methods and compositions for the treatment of psychotic disorders through the identification of the SULT4A1-1 haplotype |
| US7951542B2 (en) | 2009-11-04 | 2011-05-31 | Surgene, LLC | Methods and compositions for the treatment of psychotic disorders through the identification of the SULT4A1-1 haplotype |
| US7972793B2 (en) | 2009-11-04 | 2011-07-05 | Suregene, Llc | Methods and compositions for the treatment of psychotic disorders through the identification of the SULT4A1-1 haplotype |
| US7985551B2 (en) | 2009-11-04 | 2011-07-26 | Suregene, Llc | Methods and compositions for the treatment of psychotic disorders through the identification of the SULT4A1-1 haplotype |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20150322518A1 (en) | Biomarkers for autism spectrum disorders | |
| US20210395823A1 (en) | Genetic markers associated with asd and other childhood developmental delay disorders | |
| US20100075308A1 (en) | Polymorphisms in genes affecting cns disorders and uses thereof | |
| KR20170034830A (en) | Genetic polymorphic markers for determining type of white skin and use thereof | |
| US20120053070A1 (en) | Genetic Risk Analysis In Reward Deficiency Syndrome | |
| KR102158717B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of CD163L1 gene | |
| KR102158716B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of ARHGAP32 gene | |
| WO2010067372A1 (en) | Genetic markers of schizophrenia | |
| US20140194310A1 (en) | Genes dysregulated in autism as biomarkers and targets for therapeutic pathways | |
| Ide et al. | Genetic and expression analyses of FZD3 in schizophrenia | |
| KR20170051747A (en) | Single nucleotide polymorphism markers for determining of probability of skin wrinkle and use thereof | |
| KR102158713B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of GBA gene | |
| KR102158721B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of RNF144A gene | |
| JP2016512950A (en) | Method for predicting the onset of extrapyramidal symptoms (EPS) induced by treatment based on antipsychotics | |
| Liu et al. | No association evidence between schizophrenia and dystrobrevin-binding protein 1 (DTNBP1) in Taiwanese families | |
| KR102158715B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of OLFML2A gene | |
| KR20170049768A (en) | Single nucleotide polymorphism markers for determining of skin color and melanism sensitivity and use thereof | |
| US20100216653A1 (en) | Use of polymorphisms in the tmem132d gene in the prediction and treatment of anxiety disorders | |
| Macías et al. | Towards a personalized medicine through liquid biopsy in alzheimer’s disease: epigenome of cell-free DNA reveals methylation differences linked to APOE status | |
| KR102158725B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of MINK1 gene | |
| KR102158723B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of SPCS3 gene | |
| KR102158719B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of LOC102724084 gene | |
| KR102158714B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of TCF24 gene | |
| KR102158720B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of LRRC3 gene | |
| KR102158722B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of FLJ45964 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09787565 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 09787565 Country of ref document: EP Kind code of ref document: A1 |





