WO2010057271A1 - Production de polyhydroxyalcanoate dans des peroxysomes de plantes - Google Patents

Production de polyhydroxyalcanoate dans des peroxysomes de plantes Download PDF

Info

Publication number
WO2010057271A1
WO2010057271A1 PCT/AU2009/001523 AU2009001523W WO2010057271A1 WO 2010057271 A1 WO2010057271 A1 WO 2010057271A1 AU 2009001523 W AU2009001523 W AU 2009001523W WO 2010057271 A1 WO2010057271 A1 WO 2010057271A1
Authority
WO
WIPO (PCT)
Prior art keywords
pha
crop plant
genetically
targeted
leaves
Prior art date
Application number
PCT/AU2009/001523
Other languages
English (en)
Inventor
Stevens Brumbley
Original Assignee
Sugar Industry Innovation Pty Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2008906035A external-priority patent/AU2008906035A0/en
Application filed by Sugar Industry Innovation Pty Ltd filed Critical Sugar Industry Innovation Pty Ltd
Publication of WO2010057271A1 publication Critical patent/WO2010057271A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes

Definitions

  • This invention relates to the genetic modification of plants to produce polyhydroxyalkanoate (PHA) polymers and copolymers. More particularly it concerns methods for the production of PHA polymers and copolymers in the peroxisomes of crop plants such as sugarcane, and genetically-modified crop plants such as sugarcane, which are capable of biosynthesis of a PHA polymer or copolymer in peroxisomes.
  • PHA polyhydroxyalkanoate
  • PHAs Polyhydroxyalkanoates
  • Plant peroxisomes are also capable of harbouring PHA enzymes and producing PHAs of varying identity (Arai et al. 2002; Hahn et al. 1999; Nakashita et al. 2001a; Mittendorf et al. 1998). However, there is little focus on using peroxisomes for the commercial production of PHAs in plants. A more widespread use of peroxisomal PHA biosynthesis is as a reporter system for studies into lipid catabolism (Poirier, 2002).
  • PHB PHA polyhydroxybutyrate
  • PHA polyhydroxybutyrate
  • PhaA, PhaB and PhaC a polyester naturally synthesised by Ralstonia eutropha.
  • PhaA, PhaB and PhaC a polyester naturally synthesised by Ralstonia eutropha.
  • PhaA, PhaB and PhaC a polyester naturally synthesised by Ralstonia eutropha.
  • PhaA, PhaB and PhaC corresponding to a ⁇ -ketothiolase, acetoacetyl-CoA reductase and PHA synthase respectively.
  • PhaA, PhaB and PhaC the starting substrate acetyl-CoA and sufficient reducing power are the only requirements for PHB biosynthesis in vivo.
  • peroxisomes are the sole sight of fatty acid beta-oxidation through which acetyl-CoA is formed for use in other metabolic pathways (Baker et al. 2006), a crucial process especially during seed germination and tissue senescence. Both reducing species NADH and NADPH are also present in plant peroxisomes (Igamberdiev and Lea 2002) making them a suitable candidate organelle to target for PHB biosynthesis.
  • reducing species NADH and NADPH are also present in plant peroxisomes (Igamberdiev and Lea 2002) making them a suitable candidate organelle to target for PHB biosynthesis.
  • peroxisomal targeting of the R. eutropha PHB pathway has only been reported in maize cells maintained in culture.
  • the present invention is broadly directed to producing genetically- modified crop plants, such as sugarcane, although without limitation thereto, for biosynthesis of PHA polymers and/or copolymers in the peroxisomes of such plants.
  • a surprising an unexpected advantage of the invention is the production of genetically-modified crop plants that produce PHA polymer yields of at least 1% dry weight DW accumulated in plant leaves. Also unexpected is that a significant proportion of the PHA polymer accumulates in leaf vacuoles.
  • the invention provides a method of producing a genetically-modified crop plant capable of biosynthesis of a PHA polymer or copolymer, the method including the step of genetically modifying one or more crop plant cells or tissues to thereby produce a genetically-modified crop plant which expresses (i) a peroxisomal-targeted PhaA, or a fragment or homolog thereof; (ii) a peroxisomal-targeted PhaB, or a fragment or homolog thereof; and (iii) a peroxisomal-targeted PhaC, or a fragment or homolog thereof; and is thereby capable of biosynthesis of a PHA polymer or copolymer, wherein the PHA polymer or copolymer yields
  • the PHA polymer or copolymer yield is about 1-2% (DW) in leaves.
  • the invention provides a method of producing a PHA polymer or copolymer in a crop plant, the method including the step of producing a genetically-modified crop plant which expresses (i) a peroxisomal-targeted PhaA, or a fragment or homolog thereof; (ii) a peroxisomal targeted-PhaB, or a fragment or homolog thereof; and (iii) a peroxisomal-targeted PhaC, or a fragment or homolog thereof; to thereby produce the PHA polymer or copolymer in the crop plant, wherein the PHA polymer or copolymer yields are selected from the group consisting of:
  • the PHA polymer or copolymer yield is about 1-2% (DW) in leaves. In one particular embodiment, the PHA polymer yield is about 1.6% (DW).
  • the invention provides a genetically-modified crop plant capable of biosynthesis of a PHA polymer or copolymer in peroxisomes, wherein the PHA polymer or copolymer yields are selected from the group consisting of:
  • the genetically modified crop plant comprises (i) peroxisomal- targeted PhaA, or a fragment or homolog thereof; (ii) peroxisomal-targeted PhaB, or a fragment or homolog thereof; and (iii) peroxisomal-targeted PhaC, or a fragment or homolog thereof; which facilitate biosynthesis of the PHA polymer or copolymer.
  • the PHA polymer or copolymer yield is about 1-2% (DW) in leaves.
  • PhaA, PhaB and PhaC, or fragments or homologs thereof are targeted to crop plant peroxisomes with the peroxisome targeting sequence RAVARL (SEQ ID NO:1) or a functional fragment thereof.
  • a heterologous acyl- ACP thioesterase, or fragment or homolog thereof may be expressed, preferably in plastids of the genetically modified crop plant.
  • this increases the flux of fatty acids through the ⁇ oxidation cycle.
  • an acyl-ACP thioesterase, or fragment or homolog thereof, and a 3-ketoacyl ACP synthase, or fragment or homolog thereof may be expressed, preferably in plastids of the genetically modified crop plant.
  • the invention provides a genetic construct(s) for genetic modification of a crop plant, the genetic construct(s) comprising:
  • PhaC or fragment or homolog thereof; and (ii) a nucleotide sequence encoding a peroxisome targeting sequence; or
  • (B) (i) a nucleotide sequence encoding an acyl-ACP thioesterase or a 3-ketoacyl ACP synthase, or fragment or homolog thereof; amd (ii) a nucleotide sequence encoding a plastid targeting sequence.
  • the peroxisome targeting sequence is RAVARL (SEQ ID NO: 1) or a functional fragment thereof.
  • the invention provides a crop plant extract comprising a PHA polymer or copolymer obtainable from a genetically-modified crop plant according to the aforementioned aspects.
  • the invention provides substantially pure PHA polymers or copolymers obtainable from a genetically-modified crop plant according to the aforementioned aspects.
  • the monomer chain length of the PHA polymer is preferably three (3), four (4) or five (5) carbons.
  • the PHA polymer is 3-hydroxybutyrate.
  • the crop plant is sugarcane.
  • the invention provides a method of producing a genetically-modified crop plant capable of biosynthesis of a polyhydroxyalkanoate (PHA) polymer or copolymer, said method including the step of genetically modifying one or more crop plant cells or tissues to thereby produce a genetically-modified crop plant which expresses: (i) a peroxisomal-targeted PhaA, or a fragment or homolog thereof;
  • a 3-ketoacyl ACP synthase or a fragment or homolog thereof, and is thereby capable of biosynthesis of a PHA polymer or copolymer.
  • the acyl-ACP thioesterase and/or the 3-ketoacyl ACP synthase are plastid targeted.
  • the method is for producing a genetically-modified crop plant capable of biosynthesis of a polyhydroxyalkanoate (PHA) copolymer.
  • the invention provides a genetically-modified crop plant capable of biosynthesis of a polyhydroxyalkanoate (PHA) polymer or copolymer, which genetically-modified crop plant expresses:
  • an acyl-ACP thioesterase or a fragment or homolog thereof; and/or (v) a 3-ketoacyl ACP synthase, or fragment or homolog thereof.
  • the acyl-ACP thioesterase and/or the 3-ketoacyl ACP synthase are plastid targeted.
  • the genetically-modified crop plant is capable of biosynthesis of a polyhydroxyalkanoate (PHA) copolymer.
  • the invention provides a crop plant extract comprising a PHA polymer or copolymer, or a substantially pure PHA polymer or copolymer, obtainable from a genetically-modified crop plant according to the seventh and/or eighth aspects.
  • the invention provides a crop plant extract comprising a PHA copolymer, or a substantially pure PHA copolymer, obtainable from a genetically-modified crop plant according to the seventh and/or eighth aspects.
  • the PHA copolymer comprises MCL monomers of chain length between ten (10) and sixteen (16) carbons or between ten (10) and twelve (12) carbons.
  • the crop plant of each of the aforementioned aspects is sugarcane.
  • FIGURES Figure 1 Constructs used to transform sugarcane. Schematic diagram of gene expression constructs created for the transformation of sugarcane and biosynthesis of PHB in the peroxisomes. Separate constructs exist for each of the Ralstonia eutropha PHB biosynthetic enzymes, PhaA (A), PhaB (B) and PhaC (C). Gene expression is driven by the maize polyubiquitin (Ubi) promoter.
  • PhaA and PhaC enzymes are targeted to plant peroxisomes by a six amino acid type 1 peroxisomal targeting signal (PTSl) (RAVARL) whilst PhaB is targeted by a three amino acid PTSl (ARL) all attached to the carboxy terminus (Table 1).
  • PTSl peroxisomal targeting signal
  • ARL three amino acid PTSl
  • PhaA is a 3-ketothiolase which combines two acetyl-CoA molecules to generate acetoacetyl-CoA.
  • PhaB is an acetoacetyl-CoA reductase and, using NADPH, reduces acetoacetyl-CoA to produce R-3 ⁇ hydroxybutyrl-CoA.
  • PhaB is an acetoacetyl-CoA reductase and, using NADH, reduces acetoacetyl-CoA to produce R-3-hydroxybutyrl-CoA.
  • PhaC a PHA synthase, then converts R-3- hydroxybutyrl-CoA into the PHB polymer.
  • PHAs fall into two general categories: 1) Short chain length (SCL) which are from 3 to 5 carbons long and 2) Medium chain length (MCL) which are from 6 to 16 carbons long.
  • SCL Short chain length
  • MCL Medium chain length
  • FIG. 4 Schematic representation of peroxisomal PHB production
  • the three PHB biosynthetic enzymes were targeted to the peroxisomes following nuclear expression by means of a six amino acid peroxisomal targeting signal type 1 (PTSl) for PhaA and PhaC and a three or six amino acid PTSl for PhaB.
  • PTSl peroxisomal targeting signal type 1
  • the PHB biosynthetic pathway makes use of local reducing power and converts the acetyl-CoA pool generated by fatty acid catabolism and the ⁇ -oxidation pathway into PHB.
  • FIG. 5 Schematic representation of PHB accumulating in the vacuoles of plant cells.
  • PHA biosynthetic enzymes are targeted to the sugarcane peroxisomes the PHAs accumulate in three different locations: 1) peroxisomes (Figure 15B, C); 2) vacuoles ( Figures 7B); and 3) lipid bodies ( Figures 7C, 15E- H).
  • the peroxisomes are recycled through the central vacuole by a process know as pexophagy.
  • Macropexophagy is where the peroxisome and vacuole membranes fuse and the contents of the peroxisome are incorporated into the vacuole; or 2) Micropexophagy is where the entire peroxisome is enveloped by the vacuole and then recycled. Either or both may be operating in plant cells.
  • FIG. 1 HPLC measurement of PHB production in sugarcane plants. Measurement of PHB contained in various parts of mature peroxisomal PHB producing sugarcane plants showing PHB accumulation up to and over 1% dry weight. Pooled leaf tissue and oldest green leaf sections were collected from 9 month old mature plants. Tips of the oldest green leaves were sampled periodically throughout the life of the same plants. Error bars represent triplicate sub samples of pooled, homogenised tissue.
  • FIG. 7 Subcellular location of PHB in cells from sugarcane plants synthesising PHB in the peroxisomes.
  • B PHB accumulation in sugarcane leaf cell storage vacuoles. Transmission electron microscopy of sugarcane leaf cells showing polymer accumulating in vacuoles. Arrows indicate polymer granules. Bar: 2 ran.
  • FIG. 1 Southern analysis for gene copy number in transgenic sugarcane lines. Verification and copy number determination of the Ralstonia eutropha PhaA, PhaB and PhaC genes contained in five peroxisomal PHB producing sugarcane lines.
  • FIG. 12 Schematic diagram of strategy for SCL-MCL PHA copolymer production in peroxisomes.
  • Figure 15 Compositions of chloroform-extractable PHA copolymer from transgenic lines as determined by GC-MS.
  • A Total monomer proportions.
  • B H10:0 - H16:0 monomers proportions only. Mean mol% values are shown for each series. Error bars show SE.
  • Figure 4. Electron micrographs of leaf sections from wild type, transformed control, and PHA producing lines.
  • A Wild type epidermal cell peroxisome;
  • B,C PHA inclusions within peroxisomes of Line J41 mesophyll (B) and bundle sheath (C) cells;
  • D Putative PHA inclusions within peroxisome of a Line J40 mesophyll cell;
  • E-H PHA inclusions within lipid droplets in mesophyll (E 5 F) and bundle sheath (G 5 H) cells of line J41;
  • I Transformed control line showing lipid droplets within vacuoles and plastids of both mesophyll (top) and bundle sheath (bottom).
  • Labels p, peroxisome; erv, endoplasmic reticulum vesicle; Id, lipid droplet; m, mitochondrion; pi, peroxisomal inclusion; v, vacuole; Ii, lipid inclusion.
  • Scale bars (a) and (d), 500 nm; (i), 2 ⁇ m; all other images, 1 ⁇ m.
  • Figure 16 Amino acid sequence of Cuphea wrightii KasAl enzyme and encoding nucleotide sequence.
  • Figure 17 Amino acid sequence of Cuphea wrightii FatB2 enzyme and encoding nucleotide sequence.
  • SEQ ID NO: 1 Amino acid sequence of a peroxisome targeting sequence.
  • SEQ ID NO:2 Amino acid sequence of a peroxisome targeting sequence.
  • SEQ ID NO:3 Amino acid sequence of the C-terminal portion of spinach glycolate oxidase.
  • SEQ ID NO:4 Amino acid sequence of the C-terminal portion of GFP- ARL.
  • SEQ ID NO.5 Amino acid sequence of the C-terminal portion of PhaB-
  • SEQ ID NO:6 Amino acid sequence of the C-terminal portion of PhaA-
  • SEQ ID NO:7 Amino acid sequence of the C-terminal portion of GFP-
  • SEQ ID NO:8 PhaB gene forward primer sequence.
  • SEQ ID NO:9 PhaB gene reverse primer sequence.
  • SEQ ID NO:10 PhaC gene forward primer sequence.
  • SEQ ID NO:11 PhaC gene reverse primer sequence.
  • SEQ ID NO: 12 PhaA RNA probe template forward primer sequence.
  • SEQ ID NO: 13 PhaA RNA probe template reverse primer sequence.
  • SEQ ID NO: 14 PhaB RNA probe template forward primer sequence.
  • SEQ ID NO:15 PhaB RNA probe template reverse primer sequence.
  • SEQ ID NO: 16 PhaC RNA probe template forward primer sequence.
  • SEQ ID N0:17 PhaC RNA probe template reverse primer sequence.
  • SEQ ID NO: 18 PhaA encoding nucleotide sequence.
  • SEQ ID NO: 19 PhaA amino acid sequence.
  • SEQ ID NO:20 PhaB encoding nucleotide sequence.
  • SEQ ID NO:21 PhaB amino acid sequence.
  • SEQ ID NO:22 PhaC encoding nucleotide sequence.
  • SEQ ID NO:23 PhaC amino acid sequence.
  • SEQ ID NO:24 KasAl amino acid sequence.
  • SEQ ID NO:25 KasAl nucleotide sequence.
  • SEQ ID NO:26 FatB2 amino acid sequence.
  • SEQ ID NO:27 Fat B2 nucleotide sequence.
  • SEQIDNO:28-63 Primer and competitor sequences used for transgene expression analysis.
  • the present invention has arisen, at least in part, from the inventor's realization that the flux of carbon through plant peroxisomes can be significantly exploited for PHB biosynthesis.
  • the potential of this organelle for PHB production has been realized by introducing the complete PHB biosynthetic pathway into the peroxisomes of transgenic Saccharum sp. (sugarcane interspecific hybrids) as a model for other high biomass crop species.
  • the present invention surprisingly demonstrates PHB biosynthesis in plant peroxisomes of sugarcane at production levels up to 1.6% of the dry weight (DW) of the sampled leaf tissue.
  • the PHA copolymer comprises MCL monomers of chain length between ten (10) and sixteen (16) carbons or between ten (10) and twelve (12) carbons.
  • the invention provides a method of producing a genetically-modified crop plant capable of biosynthesis of a PHA polymer or copolymer, the method including the step of genetically modifying one or more crop plant crop plant cells or tissues to thereby produce a genetically-modified crop plant which expresses (i) peroxisomal-targeted PhaA, or a fragment or homolog thereof; (ii) peroxisomal-targeted PhaB, or a fragment or homolog thereof; and (iii) peroxisomal-targeted PhaC, or a fragment or homolog thereof; and is thereby capable of biosynthesis of a PHA polymer or copolymer, wherein the PHA polymer or copolymer yields are selected from the group consisting of: (a) at least 0.1% dry weight (DW) accumulated in leaves; (b) at least 0.2% dry weight (DW) accumulated in leaves;
  • the invention provides a method of producing a PHA polymer or copolymer in a crop plant, the method including the step of producing a genetically-modified crop plant which expresses (i) peroxisomal- targeted PhaA, or a fragment or homolog thereof; (ii) peroxisomal targeted-PhaB, or a fragment or homolog thereof; and (iii) peroxisomal-targeted PhaC, or a fragment or homolog thereof, to thereby produce the PHA polymer or copolymer in the crop plant, wherein the PHA polymer or copolymer yields are selected from the group consisting of:
  • the invention provides a genetically- modified crop plant capable of biosynthesis of a PHA polymer or copolymer in peroxisomes, wherein the PHA polymer or copolymer yields are selected from the group consisting of:
  • the genetically-modified crop plant comprises (i) peroxisomal- targeted PhaA, or a fragment or homolog thereof; (ii) peroxisomal-targeted PhaB, or a fragment or homolog thereof; and (iii) peroxisomal-targeted PhaC, or a fragment or homolog thereof; which facilitate biosynthesis of the PHA polymer or copolymer.
  • the genetically-modified crop plant and methods for producing a genetically-modified crop plant employ introduction to a crop plant of isolated nucleic acids that encode the aforementioned PHA biosynthetic enzymes (collectively referred to herein as "PHA enzymes") that facilitate biosynthesis of PHA polymers in crop plant with yields of up to 1.6% or more DW accumulated in leaves.
  • PHA enzymes PHA biosynthetic enzymes
  • crop plant is meant any high biomass crop plant such as sugarcane, switchgrass, elephant grass, sorghum or corn.
  • a preferred crop plant is a grass such as sugarcane, elephant grass or switchgrass.
  • saccharum includes within its scope plants of the "Saccharum complex” including the genera Saccharum, Erianthus, Miscanthus, Sclerostachya, Narenga, and hybrids of any of the species of these genera.
  • a substantial portion of the PHA polymers or copolymers are accumulated in leaf vacuoles.
  • substantially portion means at least 50%, preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, or advantageously at least 85%, at least 90% or 91%, 92%, 93%, 94%, 95%, 96%,
  • vacuole is meant a membrane bound storage organelle present in a plant cell, such as, for example, the cells of a plant leaf.
  • the vacuole in a mature cell is a fluid-filled compartment in the cytoplasm of the plant cell. Vacuoles may constitute a large portion of the plant cell.
  • genetically-modified crop plant refers to a crop plant that has been produced by recombinant DNA technology and includes within its scope the term “transgenic” crop plant, as typically used in the art.
  • nucleic acid as used herein broadly designates single or double stranded mRNA, RNA, cRNA, and DNA, the DNA inclusive of cDNA and genomic DNA.
  • a nucleic acid may be native or recombinant and may comprise one or more artificial nucleotides, for example, nucleotides not normally found in nature.
  • Nucleic acid encompasses modified purines (e.g., inosine, methylinosine and methyladenosine) and modified pyrimidines (thiouridine and methylcytosine).
  • protein means an amino acid polymer comprising natural or non-natural amino acids, D or L amino acids.
  • peptides are proteins having up to 60 contiguous amino acids; “polypeptides” are proteins comprising more than 60 contiguous amino acids.
  • peroxisomal-targeted is meant the directing of a protein (e.g. PhaA, PhaB and/or PhaC enzymes) into the peroxisome using specific targeting signals as discussed herein.
  • Plant peroxisomes are important organelles involved in various metabolic processes including fatty acid beta-oxidation, the glyoxylate cycle and photorespiration (Sparkes and Baker, 2002; Kunze et al, 2006; Platta and Erdmann, 2007; Pracharoenwattana and Smith, 2008).
  • AU proteins that are needed for peroxisomal function are encoded by nuclear genes, synthesised in the cytosol and imported into the peroxisomal matrix using specific targeting signals.
  • a type I peroxisomal targeting signal exists in the majority of peroxisomal proteins and typically consists of three amino acids (SKL or a conservative variant) found at the extreme carboxyl terminus, which remain with the mature protein following import.
  • a type II signal (PTS2) has a loosely conserved sequence of nine amino acids located within the first 20 to 30 N- terminal amino acids and is cleaved once the protein arrives in the peroxisomal matrix (Johnson and Olsen, 2001).
  • Methods for directing a protein into the peroxisome are well known in the art. Typically, such methods involve operably linking a nucleotide sequence encoding a peroxisome targeting signal to the coding sequence of the protein, or modifying the coding sequence of the protein to additionally encode the peroxisome targeting signal without substantially affecting the intended function of the encoded protein. It will be understood that a protein of the invention may be directed to the peroxisome by operably linking a peroxisome targeting signal to the C-terminus or the N-terminus of the protein.
  • a protein which is synthesized with a peroxisome targeting signal may be processed proteolytically in vivo, resulting in the removal of the peroxisome targeting signal from the amino acid sequence of the mature, peroxisome-localized protein.
  • a suitable peroxisomal targeting sequence consists of the amino acid sequence RAVARL (SEQ ID NO:1) or a functional fragment thereof.
  • a functional fragment is meant is a segment, portion or piece of the amino acid sequence RAVARL (SEQ ID NO:1), which constitutes less than 100% of the amino acid sequence of the peptide and retains peroxisomal targeting activity.
  • a functional fragment may comprise at least 3, 4, or 5 contiguous amino acids of the amino acid sequence RAVARL (SEQ ID NO:1).
  • An example is a fragment consisting of the amino acid sequence ARL (SEQ ID NO:2).
  • the invention provides peroxisomal targeting of PHA biosynthetic enzymes (e.g. PhA, PhaB and PhaC enzymes) to enable PHA biosynthesis in plants.
  • PHAs can be in the form of polymers (i.e., homopolymers) or co-polymers inclusive of, random copolymers, block copolymers, or blends of any of these forms.
  • PHA polymers can be broadly divided into two groups: short-chain length
  • SCL SCL PHAs consisting of three to five carbon (C 3 -C 5 ) 3-hydroxyacid monomers
  • MCL medium chain length PHAs consisting of six (6) to sixteen (16) carbon (C 6 -C 16 ) 3-hydroxyacid monomers
  • PHAs include, but are not limited to, poly-3 - hydroxypropionate, poly-3-hydroxybutyrate (PHB), poly-3-hydroxyvalerate, poly-3-hydroxyhexanoate (or hydroxycaproate), poly-3-hydroxyheptanoate, poly-
  • PHA polymers preferably comprise 3, 4 or 5 carbons
  • the PHA polymer is PHB.
  • PhaA PhaA, PhaB and PhaC proteins. More specifically, “PhaA” describes a ketothiolase (e.g., ⁇ -ketothiolase or 3-ketothiolase), while “PhaB” refers to an acetoacetyl-CoA reductase (including both NADH- and NADPH-dependent forms) and “PhaC” describes a PHA synthase. PHA synthase (also known as
  • PHA synthetase and PHA polymerase is an enzyme that catalyzes the polymerization of constituent monomers to yield PHA, and largely determines the
  • PHA synthases may be naturally occurring or non-naturally occurring.
  • a non-naturally occurring PHA synthase includes a naturally occurring synthase that has been modified using any technique that results in addition, deletion, modification, or mutation of one or more amino acids in the enzyme polypeptide sequence, such as by way of genetic engineering, directed evolution, or synthetic biology, as long the catalytic activity of the enzyme is not eliminated.
  • directed evolution is provided in Nomura and Taguchi (2007), Rehm et al. (2002), Taguchi and Doi (2004), Taguchi et al. (2002).
  • the PHA synthase may be, for example, a type I (PhaC), a type II (e.g.
  • PhaCl or PhaC2 or a type III synthase as are well known in the art.
  • a preferred PHA synthase is a type 1 PHA synthase which polymerizes short chain length (SCL) PHAs consisting of three to five carbon (C 3 -C 5 ) 3- hydroxyacyl-CoAs to yield PHA SCL polymers.
  • type II PhaC enzymes e.g PhaCl or PhaC2
  • a type II PhaC may display a preference for substrates comprising six to sixteen carbons. Accordingly, a type II PhaC may be expressed in peroxisomes to facilitate production of medium chain length (MCL) polymers.
  • MCL medium chain length
  • isolated nucleic acids encoding PHA enzymes for crop plant transformation may be obtained, sourced or otherwise derived from bacteria.
  • PHA enzymes Bacterial genes from which isolated nucleic acids encoding PHA enzymes may be prepared, which are suitable for producing a genetically-modified crop plant capable of biosynthesis of PHA polymers, are well known in the art. However, by way of example, reference is made to Rehm, (2003) and Rehm & Steinb ⁇ chel, (1999), which provide numerous examples of PHA enzymes. In this regard, reference is also made to WO 2004/006657 and WO 01/23580 which also describe PHA enzymes.
  • Preferred bacterial sources include Pseudomonas sp., Cupriavidus sp. (also known as Alcaligenes sp. or Ralstonia sp.), such as Cupriavidus necator (also known as Ralstonia eutropha or Alcaligens eutrophyus), Aeromonas sp., and Zoogloea sp.
  • Cupriavidus sp. also known as Alcaligenes sp. or Ralstonia sp.
  • Cupriavidus necator also known as Ralstonia eutropha or Alcaligens eutrophyus
  • Aeromonas sp. and Zoogloea sp.
  • the PhaA, PhaB and/or PhaC enzymes are obtained or derived from Ralstonia eurotropha.
  • the PhaA, PhaB and PhaC enzymes comprise amino acid sequences and encoding nucleotide sequences as set forth in FIGS 9-11 and SEQ ID NOS: 18-23.
  • the genetically-modified plants further comprise an acyl-ACP thioesterase to facilitate the supply of fatty acids to the fatty acid ⁇ - oxidation cycle.
  • an acyl-ACP thioesterase is encoded by a FatB gene.
  • a particular FatB gene is a FatB2 gene obtainable from Cuphea wrightii.
  • Another example of a FatB gene is a FatB3 gene obtainable from Cuphea lancelota.
  • the acyl-ACP thioesterase is expressed in a crop plant plastid.
  • the invention contemplates controlling or modifying monomer content of constituent PHA polymers.
  • genetically- modified plants further comprise: (i) an acyl-ACP thioesterase; and/or
  • a particular example of an acyl-ACP thioesterase is encoded by a FatB2 gene of Cuphea wrightii.
  • a particular example of a 3-ketoacyl ACP synthase is encoded by a KasAl gene of Cuphea wrightii.
  • Non-limiting examples of KasAl and FatB2 amino acid sequences and encoding nucleotide sequences are set forth in FIGS 16 and 17 (SEQ ID NOS : 24- 27).
  • a preferred PhaC enzyme is a type II PhaC such as PhaCl or PhaC2.
  • PhaA, PhaB and PhaC enzymes, an acyl-ACP thioesterase and a 3-ketoacyl ACP synthase includes fragments and homologs of these enzymes. Fragments preferably comprise up to 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95-99 % of the amino acid sequence of a corresponding full-length protein. Fragments preferably comprise at least 50%, at least 60%, at least 70%, at least 80% or more preferably at least 90% or 95-100 % of the enzymatic activity of the full-length protein.
  • Homologs include within their scope variants (whether naturally-occurring or artificially produced) having at least at least 70%, at least 80% or preferably at least 90% or 95-100 % amino acid sequence identity with a PhaA, PhaB or PhaC enzyme, an acyl-ACP thioesterase or a 3-ketoacyl ACP synthase described herein.
  • homologs comprise at least 50%, at least 60%, at least 70%, at least 80% or preferably at least 90% or 95-100 % of the enzymatic activity of the PhaA, PhaB or PhaC enzyme, acyl-ACP thioesterase or 3-ketoacyl ACP synthase described herein.
  • production of a genetically-modified crop plant of the invention includes the steps of:
  • a “genetic construct” may comprise a nucleic acid encoding one or more PHA enzymes and/or an acyl-ACP thioesterase or a 3-ketoacyl ACP synthase, and one or more additional nucleotide sequences that facilitate manipulation, propagation and/or expression of the nucleic acid of the invention.
  • each genetic construct encodes a single enzyme ⁇ e.g. a single PHA enzyme).
  • the genetic construct is an expression construct suitable for genetic modification of crop plant, wherein the isolated nucleic acid is operably linked or connected to one or more regulatory sequences in an expression vector.
  • the "expression vector” may be either a linear or circular nucleic acid construct that can integrate into a host plant genome.
  • the expression construct is a "transformation construct" which may be either a linear or circular genetic construct that integrates into a plant host genome. Preferably, this achieves stable integration of the PhaA,
  • PhaB and PhaC genes or genes encoding the acyl-ACP thioesterase or 3-ketoacyl
  • ACP synthase together with operably linked regulatory nucleotide sequences (e.g. promoter, intron and terminator) and peroxisome or plastid targeting sequence, into the plant host genome.
  • operably linked regulatory nucleotide sequences e.g. promoter, intron and terminator
  • peroxisome or plastid targeting sequence e.g. peroxisome or plastid targeting sequence
  • operably linked or connected is meant that the one or more additional (e.g. regulatory) nucleotide sequence(s) is/are positioned relative to the nucleic acid encoding the enzyme, fragment or homolog thereof to initiate, regulate or otherwise control transcription, translation and/or organelle targeting.
  • additional (e.g. regulatory) nucleotide sequence(s) is/are positioned relative to the nucleic acid encoding the enzyme, fragment or homolog thereof to initiate, regulate or otherwise control transcription, translation and/or organelle targeting.
  • suitable regulatory nucleotide sequences are known in the art for crop plant.
  • the one or more regulatory nucleotide sequences may include, promoter sequences, leader or signal sequences, introns, organelle targeting sequences, ribosomal binding sites, transcriptional start and termination sequences, translational start and termination sequences, and enhancer or activator sequences.
  • nucleotide sequences that encode peroxisome targeting sequences are suitably included in the expression construct.
  • peroxisomal targeting sequences are included for targeted expression of isolated nucleic acids encoding a ketothiolase, an acetoacetyl-CoA reductase and a Class 1 PHA synthase.
  • a crop plant- operable promoter is included in the expression constructs.
  • the promoter is positioned 5' of the nucleotide sequence encoding the enzyme.
  • promoters may be either naturally occurring promoters, or synthetic hybrid promoters that combine elements of more than one promoter.
  • Suitable promoters for sugarcane expression include, but are not limited to, Emu promoter, maize or rice polyubiquitin (Ub f) promoter, banana streak virus promoter, chlorophyll A/B binding protein (Cab5) promoter and maize adhl promoter.
  • Preferred promoters are the maize and rice Ub i and the maize Cab5 promoter.
  • the expression construct may comprise a selectable marker gene to allow the selection of transformed host cells.
  • selectable marker genes allow selective propagation of crop plant cells in the presence of paromomycin sulphate, hygromycin, Geneticin® (G418), kanamycin, bialaphos, and streptomycin.
  • Neomycin Phosphotransferase II (nptll) gene is a preferred selectable marker gene that confers resistance to aminoglycosides, preferably, kanamycin, paromycin, neomycin, and G418 for selection of positively transformed host cells.
  • the expression construct may also comprise other gene regulatory elements, such as a 3 '-non-translated sequence.
  • a 3 '-non-translated sequence refers to that portion of a gene that contains a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression.
  • suitable 3 '-non-translated sequences are the
  • a nopaline synthase (nos) polyadenylation signal is utilized.
  • the expression construct may also include a fusion partner
  • fusion partners typically provided by the expression vector
  • a recombinant protein is expressed as a fusion protein with the fusion partner.
  • An advantage of fusion partners is that they assist identification and/or purification (e.g., via affinity chromatography) of the fusion protein.
  • Well known examples of fusion partners include: green fluorescent protein
  • GFP hexahistidine
  • 6X-HIS hexahistidine
  • N-Flag Fc portion of human IgG
  • GST glutathione-S-transferase
  • MBP maltose binding protein
  • Fusion partners may also include within their scope "epitope tags", which are usually short peptide sequences for which a specific antibody is available. Genetic constructs of the invention may be introduced to crop plant by any of a number of non-limiting methods, generally referred to as "transformation”.
  • Transformation may be by methods that include microprojectile bombardment (e.g., of callus cells or axillary meristems), Agrobacterium- mediated transformation, liposome-mediated transformation, laser-mediated transformation, silicon carbide or tungsten whiskers, virus-mediated transformation, polyethylene-glycol-mediated transformation, as well as transformation by microinjection and electroporation of protoplasts.
  • a preferred transformation method for crop plant is microprojectile bombardment, such as described by Franks & Birch (1991) and Bower et at. (1996).
  • crop plant cells or tissues into which one or more genetic constructs may be introduced include callus, leaf disk, meristem, root, leaf spindle or whorl, leaf blade, stem, shoot, petiole, axillary bud, shoot apex, internode, or inflorescence tissue.
  • the tissue is callus.
  • Protein expression can conveniently be performed using antibodies specific for a particular PHA enzyme, such as in an enzyme-linked immunosorbent assay (ELISA) or by Western blotting and/or immunoprecipitation, and/or immunolocalization. Protein can also be detected by doing enzyme assays on proteins extracted from whole plants or from fractions thereof such as leaf, stalk or root tissue and/or on subcellular fractions such as, peroxisomes, mitochondria, plastids, vacuoles, endoplasmic reticulum, and/or cytosol.
  • ELISA enzyme-linked immunosorbent assay
  • Nucleic acid based detection may by performed by Southern hybridization and PCR may be employed. Southern hybridization may be particularly useful to verify integration of a nucleic acid encoding a PHA enzyme into a crop plant genome.
  • RT-PCR and/or Northern hybridization may be employed.
  • Biochemical analysis of PHA polymer or copolymer production may also be undertaken to determine the status of genetically-modified crop plant cells and/or tissues.
  • HPLC high performance liquid chromatography
  • GPC gel permeation chromatography
  • GC-MS gas chromatography-mass spectrometry
  • the invention provides genetically- modified crop plant from which may be extracted PHA polymers or copolymers, preferably PHB polymers.
  • said PHA polymer is selected from the group consisting of: poly-3-hydroxypropionate, poly-3-hydroxybutyrate (PHB), poly-3- hydroxyvalerate, poly-3-hydroxyhexanoate (or hydroxycaproate), poly-3 - hydroxyheptanoate, poly-3-hydroxyoctanoate, poly-3-hydroxynonanoate, poly-3 - hydroxydecanoate, poly-3 -hydroxyundecanoate, poly-3 -hydroxydodecanoate, poly-4-hydroxybutyrate, poly-4-hydroxyvalerate, poly-5-hydroxybutyrate, poly-3- hydroxy-4-pentenoate, and poly-3 -hydroxy-2-butenoate.
  • PHB poly-3-hydroxypropionate
  • PHB poly-3-hydroxybutyrate
  • PHB poly-3- hydroxyvalerate
  • poly-3-hydroxyhexanoate or hydroxycaproate
  • poly-3 - hydroxyheptanoate poly-3-hydroxyoctanoate
  • the chain length of constituent monomers of the PHA polymer is preferably three (3), four (4) or five (5) carbons.
  • said PHA polymer is poly-3-hydroxybutyrate (PHB).
  • PHA co-polymers it is preferred that constituent monomers have chain lengths of ten (10) to sixteen (16) carbons, or more preferably ten (10) to twelve (12) carbons.
  • the invention provides genetically- modified crop plants having sufficient biomass to make production of PHA polymers or copolymers potentially viable on a commercial scale.
  • high biomass crop plants include sugarcane, switchgrass, elephantgrass sorghum and corn, although without limitation thereto.
  • PHA polymers or copolymers may be extracted and substantially purified from genetically-modified crop plant plants on an industrial scale by methods known in the art in sufficient quantities to make production of PHA polymers or copolymers in plants commercially feasible.
  • substantially purified (or pure) PHA polymers or copolymers refers to a PHA polymer or copolymer that is substantially free of other cellular material with which it is naturally associated in a genetically-modified crop plant.
  • the PHA polymer or copolymer is at least 50%, for example at least 60%, at least 70% or at least 80% free of other cellular material with which it is naturally associated in a genetically-modified crop plant.
  • the PHA polymer or copolymer is at least 90% free of other cellular material with which it is naturally associated in a genetically-modified crop plant. In yet another embodiment, the PHA polymer or copolymer is at least 95% free of other cellular material with which it is naturally associated in a genetically- modified crop plant.
  • MATERIALS AND METHODS Genetic Constructs used in this study all contain the nopaline synthase terminator (NOS 3') and the maize polyubiquitin (Ubi) promoter, including the first intron, for expression in sugarcane.
  • NOS 3' nopaline synthase terminator
  • Ubi maize polyubiquitin
  • the PHB biosynthetic enzymes were targeted to peroxisomes with the addition of a C-terminal type I peroxisomal targeting signal (PTSl) to the original phaA, phaB and phaC genes from Ralstonia eutropha.
  • PTSl C-terminal type I peroxisomal targeting signal
  • a three amino acid PTSl (ARL; SEQ ID NO: 2) was fused to the C-terminus of phaB and a six amino acid signal (RAVARL; SEQ ID NO:1) was used for phaA and phaC to ensure sufficient targeting of each enzyme to the peroxisomes (Tilbrook et ah, 2009).
  • phaA-RAVARL gene was cut out of vector pATS, whilst phaB-ARL and phaC-RAVARL genes were PCR amplified (template constructs containing phaB and phaC genes kindly provided by Yves Poirier, The University of Lausanne, Switzerland) with forward primers 5'- NNNNNNGGATCCATGACTCAGCGCATTGCG-3' (SEQ ID NO:8) and 5'- NNNNNNGGATCCATGGCGACCGGCAAAGGC-3' (SEQ ID NO:9) and reverse primers 5'-
  • phaA- RAVARL, phaB-ARL and phaC-RAVARL genes were cut out of intermediate cloning vectors and ligated between BamHI and Smal sites of vector pU3Z-MCS- NOS (McQualter et ah, 2005).
  • the resulting constructs were named pUbi-PhaA- PTS, pUbi-PhaB-PTS, pUbi-PhaC-PTS, ( Figure IA, B and C, respectively).
  • Emerging transgenic embryonic callus clumps were periodically transferred onto a shoot inducing medium, still containing 50mg/mL Geneticin, and moved into the light. Developing shoots were maintained in this manner for another two months until established seedlings were formed.
  • One seedling per transgenic callus clump was transferred to soil under glasshouse conditions and plants were allowed to establish for two months prior to screening for PHB accumulation using HPLC.
  • PHB measurements were periodically repeated for lines with the highest levels of polymer until the plants had reached maturity at approximately nine months after transfer to soil, at which time a more in depth, whole plant analysis of PHB production was undertaken.
  • PHB concentration was assayed by high performance liquid chromatography (HPLC) essentially as described by Karr et al. (1983), with the following modifications.
  • Sugarcane tissue was either freeze dried overnight or incubated in a drying oven at 7O 0 C for one week. Once completely dried, lOmg (approximately) samples were weighed (weight recorded) and placed into 2mL screw capped tubes.
  • Tissue was processed for PHB accumulation following the protocol described in Petrasovits et al. (2007). This procedure disrupts plant cells to release water insoluble PHB granules, which are then acid hydrolysed and dehydrated to form water soluble crotonic acid (CA). CA was then quantified using HPLC.
  • RNA probe templates were created using primers Fd- CTGAATTCGCGGCCATGACCATC (SEQ ID NO:12) and Rv- CTCCCGGGGTTGATCTCCATCAG (SEQ ID NO: 13) for phaA, Fd- CTGAATTCCGGCCATGGGTGGTAT (SEQ ID NO: 14) and Rv- CTCCCGGGCGCCGTTGAGCGAGA (SEQ ID NO: 15) for phaB and Fd- CTGAATTCCTTCGAGAACGAGTA (SEQ ID NO: 16) and Rv- CTCCCGGGCGTTCTGCAGGTAGG (SEQ ID NO: 17) for phaC.
  • probes were made using a Roche DIG RNA Labelling Kit (SP6/T7) following manufacturer's instructions.
  • SP6/T7 Roche DIG RNA Labelling Kit
  • genomic DNA was extracted and digested to completion with either Sphl or Mfel.
  • Genomic DNA from both Ql 17 (wild type) and pUKN (a transgenic line containing the selection gene only) were included as negative controls.
  • 15ug of Sphl or Mfel digested DNA was run per sugarcane line per lane on a 1% gel in TAE buffer. Separate gels were created and run for eventual hybridisation with each of the phaA, phaB and phaC Dig labelled riboprobes.
  • DNA was transferred to nitrocellulose membranes and hybridised with 30ng/mL of DIG labelled RNA probe. Hybridisation, membrane washes and signal detection were all carried out using Roche products and following manufacturer's instructions.
  • PHB production levels varied between each independent transgenic sugarcane line.
  • PHB production in older leaf tissue such as in sections of the oldest green leaf and in the extreme tips of the oldest leaves, was measured up to and greater than 1% dry weight (Figure 6).
  • PHB was found as high as 1.6% dry weight in leaf tips from a six month old plant ( Figure 6).
  • Measurements of PHB contained in quadruple sections of the oldest green leaf as well as pooled young, middle aged and old leaf tissue consistently demonstrated that older leaf tissue contained more polymer than younger tissue ( Figure 6). This indicates that PHB accumulates continuously in the living leaf tissue of these peroxisomal PHB sugarcane lines.
  • the present invention has shown that PHA biosynthetic enzymes can be successfully targeted to crop plant peroxisomes, specifically sugarcane, resulting in peroxisomal PHA biosynthesis.
  • the level of PHB production was as high as 1.6% dry weight.
  • PHB granules ultimately accumulate in the vacuole most likely due to a process well documented in other organisms known as pexophagy (Platta and Erdmann, 2007: Sakai et al. 2006). Accumulation of PHB in the vacuole allows the plant cell to contain an amount of PHB previously thought not possible when considering peroxisomal PHB production.
  • large PHB granules were also observed in lipid inclusions.
  • the present invention therefore provides a PHA biosynthetic system applicable particularly to high biomass crop plants which include but are not limited to elephant grass, Erianthus sp., Maize, Miscanthus sp., sorghum, sugarcane and switchgrass and will allow for highly efficient production of PHA polymers (Figure 3) which accumulate in the vacuoles of plant cells on a scale suitable for industrial production of these bio-based plastics and other end- products that utilize PHA polymers.
  • pJ2 was linearised with Hind ⁇ ll and ligated to the amplified Ubi-1 p ⁇ omoter.:aphA-2::nos terminator cassette with compatible ends produced by digestion with Hind ⁇ l.
  • a clone with the phaJ2 and aphA-2 cassettes oriented in the same direction to each other and the amp R gene was selected as the transformation vector p J2K.
  • Embryogenic callus cultures of commercial sugarcane cultivar Ql 17 were initiated and maintained as described by Bower et at. (1996). Essentially, 4 days following subculture, nodular embryogenic callus pieces of 3 to 5 mm diameter were arranged to cover a circle of approximately 3 cm diameter on MSC 3 medium supplemented with 0.2 M mannitol and 0.2 M sorbitol as an osmotic treatment for 4 hours prior to bombardment and 4 hours after bombardment. Calli were bombarded with 1 ⁇ m DNA-coated gold microprojectiles (Bio-Rad Laboratories, Hercules, CA, USA) using the Bio-Rad PDS-1000 system (Bio-Rad Laboratories) at 1200 psi.
  • Microprojectile preparation and bombardment were carried out according to the manufacturer's instructions. Following bombardment, embryogenic calli were cultured on MSC 3 medium in darkness without selection for 3 days. They were then transferred to MSC 3 medium containing 50 mg/L Geneticin® (Life Technologies Corporation, Carlsbad, California) in darkness and subcultured every 2 weeks to provide escape-free selection. After 8-10 weeks, actively growing calli were placed on MSC 0 medium (MSC 3 medium without 2,4- D) containing 50 mg/L Geneticin ® . Regeneration of plants from callus occurred 8- 12 weeks after transfer to MSC 0 . Only one shoot was recovered from each antibiotic-resistant callus clump to ensure that each transgenic line was derived from an independent transformation event. Regenerating plants were maintained at 28 °C under fluorescent lights until ready for establishment in pots in glasshouse. Samples were taken from fully expanded, non-senescing leaves of mature plants.
  • the PHA extraction method for initial screening of transgenic lines was adapted from Arai et al. (2002). Approximately 100 mg of freeze dried leaf blade tissue was pulverised for 20 min at 30 Hz in a Retsch MM300 ball mill (Retsch GmbH, Haan, Germany). Ground powder was transferred to glass centrifuge tubes (Corning #8142-10 with #9998 phenolic/PTFE seal cap, Corning, NY, USA, supplemented with custom-made 1 mm thick PTFE seal) and weighed. To remove lipids and other contaminants, the powder was extracted with 8 mL «-hexanes at 55 0 C, centrifuged at 3000 ⁇ g, and the supernatant discarded.
  • Methyl 3- hydroxybutyrate and the target standards ethyl-3-hydroxybutyrate and ethyl-3- hexanoate were purchased from Sigma Aldrich (St Louis, Missouri); methyl 3- hydroxypentanoate from Fluka AG (Buchs, Switzerland).
  • a modified version of this method was used for final analyses of PHA- producing lines, with the following modifications: (1) Methyl 3-hydroxybutyrate and methyl 3-hydroxypentanoate were replaced by methyl benzoate, which was added prior to methanolysis, acting as an extraction standard for subsequent steps and an internal standard for GC-MS analysis; (2) The chloroform extract was subjected to methanolysis rather than ethanolysis using the same procedure, by replacing ethanol with methanol.
  • Methyl benzoate and the target standard methyl 3-hydroxyhexanoate were purchased from Sigma Aldrich. Additional target standards methyl 3-hydroxyoctanoate, methyl 3 -hydroxy decanoate, methyl 3- hydroxy dodecanoate, methyl 3-hydroxytetradecanoate and methyl 3- hydroxyoctadecanoate were purchased from Larodan Fine Chemicals AB (Malm ⁇ , Sweden). Quantitation of targets was performed in selective ion monitoring mode using ions with m/z ratios 71, 74, and 103 for methyl 3- hydroxyesters and 77, 105, and 136 for methyl benzoate.
  • PHA was extracted from approximately 2.5 g of freeze dried leaf blade tissue using the same method as for GC-MS samples, but without the derivatization and purification steps.
  • the chloroform extract was concentrated to a final volume of 300 ⁇ L, and 100 ⁇ L used for injection. Separations were performed on a Shimadzu 1OA HPLC equipped with four columns in series: PhenogelTM guard, PhenogelTM Linear-2 mixed bed column (100-10,000 KDa), PhenogelTM 10 "4 A (5-500 KDa), PhenogelTM 10 "3 A (1-75 KDa) (all 5 ⁇ m bore, 300 x 7.8 mm; Phenomenex, Torrance, CA, USA; order as listed; chloroform mobile phase at 1 niL/min). Peaks were observed with a refractive index detector. ReadyCalTM polystyrene standards (Fluka AG, Buchs, Switzerland) were used for M w calibration.
  • RNeasy kit QIAGEN GmbH, Hilden, Germany
  • Reverse transcription was performed using 2 ⁇ g total RNA with an Omniscript kit and random hexamers (QIAGEN GmbH, Hilden, Germany) according to manufacturer's instructions.
  • Competitive PCR and Mass ArrayTM (Sequenom Inc., San Diego, CA) was carried out by the Australian Genome Research Facility (The University of Queensland, QId, Australia) according to the methodology of Ding and Cantor (2003). Primers used are listed in Table 6.
  • Electron microscopy was performed with a JEOL 1200 EX electron microscope (JEOL, Tokyo, Japan).
  • the phaA, phaB, phaC2 andphaJ2 genes were modified to include the C- terminal peroxisomal type 1 targeting sequence, RAVARL, which efficiently targets heterologous proteins to peroxisomes in tobacco (Volokita, 1991) and maize (Hahn et al, 1999).
  • the FatB2 and KasAl coding sequences contain native putative plastid-transit peptides (Leonard et al, 1997; Slabaugh et al, 1998). All transgenes were placed under the control of the maize Ubi-1 promoter (Christensen et al, 1992) and nopaline synthase terminator in direct gene transfer vectors.
  • the 3'- aminoglycoside transferase II (aphA-2) selectable marker and phaJ2 cassettes were combined in tandem on a single vector, while expression cassettes for all other transgenes were contained in separate vectors.
  • Sugarcane embryogenic callus was co-transformed with a total of six vectors.
  • Leaf blade samples from glasshouse-grown sugarcane plants for 143 independent transgenic lines were screened by GC-MS analysis of ethanol trans-esterified chloroform extracts, and six lines with multiple ethyl 3-hydroxyester peaks were identified ( ⁇ 4% of total lines).
  • low level H4:0 background is probably present in all lines, and may comprise a substantial proportion of the H4:0 content in lines J2, J40, J72 and J142.
  • the composition of PHA copolymers obtained was consistent among replicate samples and broadly similar across the six lines, with H8:0 predominant in all cases.
  • H5:0 and Hl 6:0 comprised the smallest and second smallest molar proportions in most lines.
  • Mean total PHA yields ranged from 17 ⁇ g/g DW (J40) to 87 ⁇ g/g DW (J41), while the highest total PHA yield for an individual sample was 155 ⁇ g/g DW (0.0155%) for line J41 (Table 2).
  • the PHA copolymer compositions contrast with the MCL PHA copolymers obtained by Mittendorf et ah (1998) from Arabidopsis seedlings expressing P. aeruginosa PhaCl, which contained substantial proportions of unsaturated 3-hydroxyalkanoic acids, as well as trace amounts of some saturated 3-hydroxyalkanoic acids with uneven numbers of carbons.
  • close inspection of the GC-MS chromatograms revealed a number of minor peaks for the m/z 103 ion that were not present in wild type or transformed controls. Due to the small size of the peaks relative to background, identification of the mass spectra with total ion chromatograms was not possible.
  • phaJ2 expression was only detected in lines J72 and J 142 at very low levels.
  • Transcripts for phaA and phaB were absent in lines J2 and J40, respectively, but present in all others. However, all phaA levels were at or below 2.7 fM, whereas phaB transcripts were expressed at levels up to 13.4 fM.
  • Line J41 the only line profiled for transgene expression that showed H4:0 content significantly higher than the wild type, had both the lowest level of phaA transcripts and the highest level of phaB transcripts of any line that co-expressed phaA. Four lines showed FatB2 transcript expression with the highest level in
  • line J72 as well as J40, J41 and J 142 provide evidence for a combined effect of FatB2 and KasAl on PHA composition.
  • J41 SCL-MCL PHA copolymer has a moderate molecular weight with a narrow distribution
  • the PHA copolymer in line J41 showed a weight- average molecular weight (M w ) of 112 KDa and a polydispersity index (PDI) of 1.8 (Table 4).
  • Non-extracted standards of bacterial origin for PHB and PHB-PHH (poly[3-hydroxybutyrate-co-3-hydroxyhexanoate]) had larger molecular weights of 2.92 x 10 5 and 6.41 x 10 5 , respectively, and broader distributions as indicated by PDI values of 5.8 and 5.4, respectively.
  • Extraction of the PHB standard spiked onto the wild type sugarcane leaf matrix resulted in a ⁇ 12% reduction in M w . It is known that the molecular weight distribution of PHB extracted from bacteria can be influenced by the extraction process used (Poirier et al, 1995b), and hence the data for line J41 are probably a small underestimate of actual M w and PDI.
  • peroxisomes are (1) bounded by a single membrane, (2) typically spheroid in shape, ranging from 0.2 - 1.7 ⁇ m in diameter, and (3) contain a coarsely granular or fibrillar matrix, occasionally with amorphous or paracrystalline inclusions (Huang et al, 1983; Figure 15A).
  • Mesophyll and bundle sheath cell peroxisomes of line J41 contained electron-lucent, globular inclusions that occupied the majority of the organelle volume ( Figure 15B, C). The inclusions formed large and small globules, surrounded by granular peroxisomal matrix.
  • the inclusions formed single globules within each lipid droplet, and were more rounded in shape. While the lipid droplet inclusions appeared to be contained within the cytoplasm, they were typically closely associated with plastids ( Figure 15E-H), and in some cases appeared to be within plastids (15G).
  • the second mechanism used FatB2 and KasAl to supply unusual MCL fatty acids from plastid fatty acid biosynthesis.
  • the PHA composition and transgene expression data provided evidence that FatB2 increased H10:0-H16:0 contents, and in combination with KasAl, shifted the distribution within Hl 0:0- H16:0 towards H12:0 and H10:0 ( Figure 14A, 3). These results are consistent with the expected activities for each enzyme. To our knowledge, this is the first time a ketoacyl-ACP synthase has been used to influence the composition of PHA produced in transgenic plants.
  • ketoacyl-ACP synthases may provide a useful tool for fine-tuning PHA composition to match specific functional requirements.
  • An increased supply of MCL fatty acids may have increased PHA yield in line J 142, which had the second highest mean PHA yield of confirmed F ⁇ tj32-expressing lines.
  • H8:0 was also dominant in PHA accumulated in Arabidopsis seeds using the same PHA synthase, and did not change substantially with co-expression of the FatB3 thioesterase despite a 4-fold increase in H10:0 (Poirier et al, 1999). Mittendorf et al. (1998) concluded that their results were consistent with trienoic and dienoic fatty acids with cis double bonds at an even carbon undergoing ⁇ -oxidation via an epimerase pathway, which involves direct production of i?-3-hydroxyoctenoyl-CoA and R-3- hydroxyoctanoyl-CoA intermediates, respectively.
  • Arai et al (2002) found that feeding PHA synthase-expressing transgenic plants with Tween-20 did not change the molar composition of the H4:0/H5:0/H6:0 PHA copolymer as expected, and suggested the existence of an unknown metabolic flow producing R-3- hydroxypentanoyl-CoA.
  • One possible pathway is condensation of propanoyl-CoA and acetyl-CoA to yield 3-ketopentanoyl-CoA, and subsequent reduction to 3- hydroxypentanoyl-CoA (Matsumoto et al, 2006).
  • PhaCl expressed in Ar ⁇ bidopsis peroxisomes produced PHA copolymers with an average of 40 mol% H4:0 (Matsumoto et al, 2006).
  • an engineered version of PhaCl with greater specific activity for i?-3-hydroxybutyryl-CoA was tested in the same study and did not change the PHA composition, presumably due to substrate limitation (Matsumoto et ah, 2006). Due to the order in which ⁇ -oxidation intermediates become available for polymerisation, PHA synthases with not only high specific activity for i?-3-hydroxybutyryl-CoA, but also low specific activities for MCL i?-3-hydroxyacyl-CoAs may be required to achieve high 4:0 content.
  • PHA copolymer from line J41 showed a relatively low molecular weight and uniform polymer chain length distribution compared to non-extracted bacterial PHB and PHB-PHHx standards, but similar to some previous examples of PHAs produced in plants.
  • the narrow chain length distribution of J41 PHA copolymer is not uncommon in biological systems.
  • P. sp. 61-3 PhaCl was expressed in E. coli produced SCL-MCL PHA copolymer with a PDI of 1.5 (Takase, 2004).
  • Higher molecular weights of 500,000-700,000 are typically required for commercial applications (Noda et al, 2005b). This may be achieved using PHA synthases engineered for production of higher molecular weight PHA, of which there have been several examples (Nomura and Taguchi, 2007).
  • the maximum PHA yield of 0.0155% we obtained is lower but comparable to several previous examples of PHA copolymer production in Arabidopsis peroxisomes in vegetative leaves using other PHA synthases. It is approximately 3 -fold less than for A. caviae PhaC (Arai et ah, 2002); three- quarters of the yield obtained with P. aeruginosa PhaCl (Mittendorf, 1998); and two thirds that for P. sp.61-3 PhaCl (Matsumoto et ah, 2006). These low yields are consistent with expectations for leaf peroxisomes, which are principally engaged with photorespiration and are not expected to have high carbon flux through fatty acid ⁇ -oxidation.
  • PHA yields that occur in bacteria from ⁇ -oxidation may be enabled by a 3-hydroxyacyl-CoA epimerase or other activity that is not present in plants, and that metabolic channelling of intermediates in plant peroxisomes may also limit yields (van Beilen and Poirier, 2008). If this is the case, i?-specific enoyl-CoA hydratases may hold potential for yield improvement if expression can be achieved.
  • PHA yield might also be improved by increasing the activities of the PHA synthase and other enzymes, either through optimisation of transgene expression or the use of engineered enzymes. As noted earlier, increased supply of MCL fatty acids due to FatB2 and KasAl probably contributed to the yields we obtained.
  • Protein ID C-terminus Pl Charge at pH 7 Hydrophilic/ Positive/ Targeting Accumulation Species Tested Hydrophobic Negative Prediction of Transient residues* Residues* Classification GFP
  • WT wild type
  • UKN transformed control
  • + 5 ug PHB spiked with 5 ug PHB.
  • the number of replicate extractions (n) is indicated in brackets.
  • the fM values shown represent the mean of two replicate analyses of the same cDNA sample. R 2 values for all standard curves were > 0.9.
  • PHB-PHH poly(hydroxybutyrate-co-hexanoate).
  • Vector Gene(s) Source organism Genbank Forward primer (5' - 3') Reverse primer (5' - 3') Amplification accession product length
  • GCCCATATGCAGGCCGCCG pC2TS phaC2 Pseudomonas AX105569 CAGTGATCAATGCGAGAGAAACAGGTGTCG ACTGJGJ ⁇ KnTATAATCTGGCAACAGCACG 1719 fluoresceins GCGCACGTGCACGTAGGTGC pFB2 FatB2 Cuphea wrightii U56104 AAAGGATCCAAACATGGTGGTGGCTGC TCGg ⁇ gCICTTTCATGTTG ATATCG CC 1251 pKAl KasAl Cuphea wrightii U67316 GGCAGATCTTTGGTGTTTCAATGGCGG TGGg ⁇ gmGGCATTAAGCTACTAACG 1689 pJ2K phaJ2 Pseudomonas .
  • GAPDH 106 GCATCTITGCTTGG CAAGGC TGC CCTTCAGATGCGCAGCAGCCTTGTC ⁇ TGTCAGTGAA
  • ACGTT6GATGTGC6CGT ACGTT6GATGTCGGCACCTCCGCT TGCGTTCATGTAGTTAGCGGGGACCGGCAAGGCTCCCGACACCTGTTTC phaC2-TS 120 CTCCCGACACCTGTTTC
  • Igamberdiev AU Lea PJ (2002) The role of peroxisomes in the integration of metabolism and evolutionary diversity of photosynthetic organisms.
  • Poirier, Y. (2002) Polyhydroxyalknoate synthesis in plants as a tool for biotechnology and basic studies of lipid metabolism. Progress in Lipid Research 41:131-155. Poirier Y, Dennis DE, Klomparens K, Somerville C (1992) Polyhydroxybutyrate, a Biodegradable Thermoplastic, Produced in Transgenic Plants. Science 256:520-523.
  • Cuphea wrightii associated with medium chain fatty acid biosynthesis Plant J. 13, 611-620.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention porte sur une modification génétique de plantes cultivées telles que la canne à sucre pour produire des polymères et/ou copolymères de polyhydroxyalcanoate (PHA), en particulier sur des procédés pour la production de polymères et/ou copolymères de PHA dans les peroxysomes d'une plante cultivée, telle que la canne à sucre. L'invention porte également sur des plantes cultivées génétiquement modifiées aptes à biosynthétiser un polymère de type PHA dans des peroxysomes. Les plantes cultivées génétiquement modifiées peuvent comprendre jusqu'à 1-2 % en poids sec de polymère de PHA, dont une partie importante est située dans les vacuoles foliaires. L'invention porte également sur l'expression d'une acyl-ACP thioestérase; et/ou d'une 3-cétoacyl-ACP synthase. Ceci permet de faciliter la modification ou la régulation d'une teneur en monomère souhaitée dans des copolymères de PHA.
PCT/AU2009/001523 2008-11-21 2009-11-23 Production de polyhydroxyalcanoate dans des peroxysomes de plantes WO2010057271A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2008906035 2008-11-21
AU2008906035A AU2008906035A0 (en) 2008-11-21 Polyhydroxyalkanoate production in plant peroxisomes

Publications (1)

Publication Number Publication Date
WO2010057271A1 true WO2010057271A1 (fr) 2010-05-27

Family

ID=42197765

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2009/001523 WO2010057271A1 (fr) 2008-11-21 2009-11-23 Production de polyhydroxyalcanoate dans des peroxysomes de plantes

Country Status (1)

Country Link
WO (1) WO2010057271A1 (fr)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999035278A1 (fr) * 1998-01-05 1999-07-15 Monsanto Company Biosynthese de polyhydroxyalcanoates a longueur de chaine moyenne
US6103956A (en) * 1998-03-31 2000-08-15 Regents Of The University Of Minnesota Polyhydroxyalkanoate synthesis in plants
WO2000052183A1 (fr) * 1999-03-05 2000-09-08 Monsanto Technology Llc Vecteurs d'expression multigeniques destines a la biosynthese de produits au moyen de mecanismes biologiques multienzymes
WO2001023580A2 (fr) * 1999-09-29 2001-04-05 Pioneer Hi-Bred International, Inc. Genes de la polyhydroxyalcanoate synthase
WO2004006657A1 (fr) * 2002-07-11 2004-01-22 Bureau Of Sugar Experiment Stations Plantes transgeniques utilisees comme systeme bioreacteur
WO2006101983A2 (fr) * 2005-03-16 2006-09-28 Metabolix, Inc. Expression inductible chimiquement de voies biosynthetiques

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999035278A1 (fr) * 1998-01-05 1999-07-15 Monsanto Company Biosynthese de polyhydroxyalcanoates a longueur de chaine moyenne
US6103956A (en) * 1998-03-31 2000-08-15 Regents Of The University Of Minnesota Polyhydroxyalkanoate synthesis in plants
WO2000052183A1 (fr) * 1999-03-05 2000-09-08 Monsanto Technology Llc Vecteurs d'expression multigeniques destines a la biosynthese de produits au moyen de mecanismes biologiques multienzymes
WO2001023580A2 (fr) * 1999-09-29 2001-04-05 Pioneer Hi-Bred International, Inc. Genes de la polyhydroxyalcanoate synthase
WO2004006657A1 (fr) * 2002-07-11 2004-01-22 Bureau Of Sugar Experiment Stations Plantes transgeniques utilisees comme systeme bioreacteur
WO2006101983A2 (fr) * 2005-03-16 2006-09-28 Metabolix, Inc. Expression inductible chimiquement de voies biosynthetiques

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
PETRASOVITS L.A. ET AL.: "Production of polyhydroxybutyrate in sugarcane.", PLANT BIOTECHNOLOGY JOURNAL, vol. 5, 2007, pages 162 - 172 *
SOMLEVA M.N ET AL.: "Production of polyhydroxybutyrate in switchgrass, a value-added co-product in an important lignocellulosic biomass crop.", PLANT BIOTECHNOLOGY JOURNAL, vol. 6, September 2008 (2008-09-01), pages 663 - 678 *

Similar Documents

Publication Publication Date Title
US6228623B1 (en) Polyhydroxyalkanoates of narrow molecular weight distribution prepared in transgenic plants
US5959179A (en) Method for transforming soybeans
US5958745A (en) Methods of optimizing substrate pools and biosynthesis of poly-β-hydroxybutyrate-co-poly-β-hydroxyvalerate in bacteria and plants
US6946588B2 (en) Nucleic acid encoding a modified threonine deaminase and methods of use
JP4121541B2 (ja) 脂肪酸生合成経路からの中間鎖長のポリヒドロキシアルカノエートの産生
Nakashita et al. Production of biodegradable polyester by a transgenic tobacco
EP2159287A2 (fr) Construction pour expression multigénique portant des intéines modifiées.
AU770120B2 (en) Plant multi-gene expression constructs
US20080233629A1 (en) Enzymes for biopolymer production
EP1161539B1 (fr) Procede de production de polyhydroxyalcanoates dans des organismes recombinants
JP2009291204A (ja) 植物における脂肪酸代謝の改変
Anderson et al. Synthesis of short-chain-length/medium-chain length polyhydroxyalkanoate (PHA) copolymers in peroxisomes of transgenic sugarcane plants
EP1044278A1 (fr) Biosynthese de polyhydroxyalcanoates a longueur de chaine moyenne
US6586658B1 (en) Modification of fatty acid metabolism in plants
WO2010057271A1 (fr) Production de polyhydroxyalcanoate dans des peroxysomes de plantes
Romano Production of polyhydroxyalkanoates (PHAs) in transgenic potato

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09827060

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09827060

Country of ref document: EP

Kind code of ref document: A1