WO2010057271A1

WO2010057271A1 - Polyhydroxyalkanoate production in plant peroxisomes

Info

Publication number: WO2010057271A1
Application number: PCT/AU2009/001523
Authority: WO
Inventors: Stevens Brumbley
Original assignee: Sugar Industry Innovation Pty Ltd
Priority date: 2008-11-21
Filing date: 2009-11-23
Publication date: 2010-05-27

Abstract

The invention provides genetic modification of crop plants such as sugarcane to produce polyhydroxyalkanoate (PHA) polymers and/or copolymers, particularly methods for the production of PHA polymers and/or copolymers in the peroxisomes of a crop plant, such as sugarcane. Genetically-modified crop plants capable of biosynthesis of a PHA polymer in peroxisomes are also provided. Genetically modified crop plants may comprise up to 1-2% dry weight of PHB polymer, a substantial portion of which is located in leaf vacuoles. Also provided is expression of an acyl-ACP thioesterase; and/or a 3-ketoacyl ACP synthase. This may facilitate modification or control of desired monomer content in PHA copolymers.

Description

TITLE POLYHYDROXYALKANOATE PRODUCTION IN PLANT PEROXISOMES

FIELD OF THE INVENTION

This invention relates to the genetic modification of plants to produce polyhydroxyalkanoate (PHA) polymers and copolymers. More particularly it concerns methods for the production of PHA polymers and copolymers in the peroxisomes of crop plants such as sugarcane, and genetically-modified crop plants such as sugarcane, which are capable of biosynthesis of a PHA polymer or copolymer in peroxisomes.

BACKGROUND OF THE INVENTION

Polyhydroxyalkanoates (PHAs) are bacterial carbon storage compounds that have attracted commercial attention as bioplastics. Current research efforts are focussed on PHA biosynthesis in crop plants (van Bielen et al. 2008), which has potential to replace PHA production through bacterial fermentation, thereby avoiding the high costs of feed stocks and infrastructure that accompany these systems. In the plant cell, PHA biosynthetic enzymes have been expressed in various subcellular compartments, resulting in PHA biosynthesis in the cytosol of Arabidopsis and tobacco (Poirier et al. 1992; Nakashita et al. 1999) and in the plastids of numerous plant species (Arai et al. 2001, 2004; Bohmert et al. 2000; Lδssl et al. 2003, 2005; Nakashita et al. 2001b; Nawrath et al. 1994; Matsumoto et al. 2005; Petrasovits, et al. 2007; Purnell et al. 2007; Somleva et al. 2008; Wrobel et al. 2004). Plant peroxisomes are also capable of harbouring PHA enzymes and producing PHAs of varying identity (Arai et al. 2002; Hahn et al. 1999; Nakashita et al. 2001a; Mittendorf et al. 1998). However, there is little focus on using peroxisomes for the commercial production of PHAs in plants. A more widespread use of peroxisomal PHA biosynthesis is as a reporter system for studies into lipid catabolism (Poirier, 2002).

Past instances of PHA biosynthesis in plants report predominantly on production of the simplest PHA polyhydroxybutyrate (PHB), a polyester naturally synthesised by Ralstonia eutropha. PHB is formed through the successive activity of three enzymes, PhaA, PhaB and PhaC corresponding to a β-ketothiolase, acetoacetyl-CoA reductase and PHA synthase respectively (Peoples and Sinskey 1989a, b; Schubert et al. 1988; Slater, et a 1988). Expression of PhaA, PhaB and PhaC, the starting substrate acetyl-CoA and sufficient reducing power are the only requirements for PHB biosynthesis in vivo. In plants, peroxisomes are the sole sight of fatty acid beta-oxidation through which acetyl-CoA is formed for use in other metabolic pathways (Baker et al. 2006), a crucial process especially during seed germination and tissue senescence. Both reducing species NADH and NADPH are also present in plant peroxisomes (Igamberdiev and Lea 2002) making them a suitable candidate organelle to target for PHB biosynthesis. However, to date, peroxisomal targeting of the R. eutropha PHB pathway has only been reported in maize cells maintained in culture.

SUMMARY OF THE INVENTION

The present invention is broadly directed to producing genetically- modified crop plants, such as sugarcane, although without limitation thereto, for biosynthesis of PHA polymers and/or copolymers in the peroxisomes of such plants.

A surprising an unexpected advantage of the invention is the production of genetically-modified crop plants that produce PHA polymer yields of at least 1% dry weight DW accumulated in plant leaves. Also unexpected is that a significant proportion of the PHA polymer accumulates in leaf vacuoles.

Another surprising feature of the invention is that monomer content of copolymers may be controlled or modified by expression of acyl-ACP thioesterase and/or 3-ketoacyl ACP synthase enzymes, preferably in the crop plant plastid. In a first aspect, the invention provides a method of producing a genetically-modified crop plant capable of biosynthesis of a PHA polymer or copolymer, the method including the step of genetically modifying one or more crop plant cells or tissues to thereby produce a genetically-modified crop plant which expresses (i) a peroxisomal-targeted PhaA, or a fragment or homolog thereof; (ii) a peroxisomal-targeted PhaB, or a fragment or homolog thereof; and (iii) a peroxisomal-targeted PhaC, or a fragment or homolog thereof; and is thereby capable of biosynthesis of a PHA polymer or copolymer, wherein the PHA polymer or copolymer yields are selected from the group consisting of: (a) at least 0.1% dry weight (DW) accumulated in leaves;

(b) at least 0.2% dry weight (DW) accumulated in leaves;

(c) at least 0.5% dry weight (DW) accumulated in leaves;

(d) at least 0.8% dry weight (DW) accumulated in leaves; and (e) about 1% or more dry weight (DW) accumulated in leaves.

In one embodiment, the PHA polymer or copolymer yield is about 1-2% (DW) in leaves.

Typically, a substantial portion of the PHA polymer or copolymer is accumulated in leaf vacuoles. In a second aspect, the invention provides a method of producing a PHA polymer or copolymer in a crop plant, the method including the step of producing a genetically-modified crop plant which expresses (i) a peroxisomal-targeted PhaA, or a fragment or homolog thereof; (ii) a peroxisomal targeted-PhaB, or a fragment or homolog thereof; and (iii) a peroxisomal-targeted PhaC, or a fragment or homolog thereof; to thereby produce the PHA polymer or copolymer in the crop plant, wherein the PHA polymer or copolymer yields are selected from the group consisting of:

(a) at least 0.1% dry weight (DW) accumulated in leaves;

(b) at least 0.2% dry weight (DW) accumulated in leaves; (c) at least 0.5% dry weight (DW) accumulated in leaves;

(d) at least 0.8% dry weight (DW) accumulated in leaves; and

(e) about 1% or more dry weight (DW) accumulated in leaves.

In one embodiment, the PHA polymer or copolymer yield is about 1-2% (DW) in leaves. In one particular embodiment, the PHA polymer yield is about 1.6% (DW).

Typically, a substantial portion of the PHA polymer or copolymer is accumulated in leaf vacuoles.

In a third aspect, the invention provides a genetically-modified crop plant capable of biosynthesis of a PHA polymer or copolymer in peroxisomes, wherein the PHA polymer or copolymer yields are selected from the group consisting of:

(a) at least 0.1% dry weight (DW) accumulated in leaves;

(b) at least 0.2% dry weight (DW) accumulated in leaves;

(c) at least 0.5% dry weight (DW) accumulated in leaves;

(d) at least 0.8% dry weight (DW) accumulated in leaves; and (e) about 1 % or more dry weight (DW) accumulated in leaves.

Preferably, the genetically modified crop plant comprises (i) peroxisomal- targeted PhaA, or a fragment or homolog thereof; (ii) peroxisomal-targeted PhaB, or a fragment or homolog thereof; and (iii) peroxisomal-targeted PhaC, or a fragment or homolog thereof; which facilitate biosynthesis of the PHA polymer or copolymer.

Typically, a substantial portion of the PHA polymer or copolymer is accumulated in leaf vacuoles .

Also contemplated are cells, tissues, leaves, seeds and other reproductive material, material useful for vegetative propagation (e.g., ratoons), Fl hybrids, and all other crop plant products derivable from the genetically-modified crop plant. Preferably, PhaA, PhaB and PhaC, or fragments or homologs thereof, are targeted to crop plant peroxisomes with the peroxisome targeting sequence RAVARL (SEQ ID NO:1) or a functional fragment thereof.

In one embodiment of the aforementioned aspects, a heterologous acyl- ACP thioesterase, or fragment or homolog thereof, may be expressed, preferably in plastids of the genetically modified crop plant. Suitably, this increases the flux of fatty acids through the β oxidation cycle.

In another embodiment of the aforementioned aspects, an acyl-ACP thioesterase, or fragment or homolog thereof, and a 3-ketoacyl ACP synthase, or fragment or homolog thereof, may be expressed, preferably in plastids of the genetically modified crop plant.

Suitably, this embodiment facilitates modification or control of desired monomer content of PHA copolymers. In particular embodiments, the PHA copolymer comprises MCL monomers of chain length between ten (10) and sixteen (16) carbons or between ten (10) and twelve (12) carbons. In a fourth aspect, the invention provides a genetic construct(s) for genetic modification of a crop plant, the genetic construct(s) comprising:

(A) (i) a nucleotide sequence encoding a PhaA, a PhaB and/or a

PhaC, or fragment or homolog thereof; and (ii) a nucleotide sequence encoding a peroxisome targeting sequence; or

(B) (i) a nucleotide sequence encoding an acyl-ACP thioesterase or a 3-ketoacyl ACP synthase, or fragment or homolog thereof; amd (ii) a nucleotide sequence encoding a plastid targeting sequence.

In one preferred embodiment the peroxisome targeting sequence is RAVARL (SEQ ID NO: 1) or a functional fragment thereof.

In a fifth aspect, the invention provides a crop plant extract comprising a PHA polymer or copolymer obtainable from a genetically-modified crop plant according to the aforementioned aspects.

In a sixth aspect, the invention provides substantially pure PHA polymers or copolymers obtainable from a genetically-modified crop plant according to the aforementioned aspects. The monomer chain length of the PHA polymer is preferably three (3), four (4) or five (5) carbons.

In a preferred embodiment, the PHA polymer is 3-hydroxybutyrate. Preferably, according to the aforementioned aspects, the crop plant is sugarcane. In a seventh aspect, the invention provides a method of producing a genetically-modified crop plant capable of biosynthesis of a polyhydroxyalkanoate (PHA) polymer or copolymer, said method including the step of genetically modifying one or more crop plant cells or tissues to thereby produce a genetically-modified crop plant which expresses: (i) a peroxisomal-targeted PhaA, or a fragment or homolog thereof;

(ii) a peroxisomal-targeted PhaB, or a fragment or homolog thereof;

(iii) a peroxisomal-targeted PhaC, or a fragment or homolog thereof;

(iv) an acyl-ACP thioesterase, or a fragment or homolog thereof; and/or

(v) a 3-ketoacyl ACP synthase, or a fragment or homolog thereof, and is thereby capable of biosynthesis of a PHA polymer or copolymer. Preferably , the acyl-ACP thioesterase and/or the 3-ketoacyl ACP synthase are plastid targeted.

Preferably, the method is for producing a genetically-modified crop plant capable of biosynthesis of a polyhydroxyalkanoate (PHA) copolymer. In an eighth aspect, the invention provides a genetically-modified crop plant capable of biosynthesis of a polyhydroxyalkanoate (PHA) polymer or copolymer, which genetically-modified crop plant expresses:

(i) a peroxisomal-targeted PhaA, or a fragment or homolog thereof; (ii) a peroxisomal-targeted PhaB, or a fragment or homolog thereof;

(iii) a peroxisomal-targeted PhaC, or a fragment or homolog thereof;

(iv) an acyl-ACP thioesterase, or a fragment or homolog thereof; and/or (v) a 3-ketoacyl ACP synthase, or fragment or homolog thereof.

Preferably, the acyl-ACP thioesterase and/or the 3-ketoacyl ACP synthase are plastid targeted.

Preferably, the genetically-modified crop plant is capable of biosynthesis of a polyhydroxyalkanoate (PHA) copolymer. In additional aspects, the invention provides a crop plant extract comprising a PHA polymer or copolymer, or a substantially pure PHA polymer or copolymer, obtainable from a genetically-modified crop plant according to the seventh and/or eighth aspects.

In a preferred embodiment, the invention provides a crop plant extract comprising a PHA copolymer, or a substantially pure PHA copolymer, obtainable from a genetically-modified crop plant according to the seventh and/or eighth aspects.

Preferably, the PHA copolymer comprises MCL monomers of chain length between ten (10) and sixteen (16) carbons or between ten (10) and twelve (12) carbons.

Preferably, the crop plant of each of the aforementioned aspects is sugarcane.

Throughout this specification, unless the context requires otherwise, the words "comprise", "comprises" and "comprising" will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

BRIEF DESCRIPTION OF THE FIGURES Figure 1. Constructs used to transform sugarcane. Schematic diagram of gene expression constructs created for the transformation of sugarcane and biosynthesis of PHB in the peroxisomes. Separate constructs exist for each of the Ralstonia eutropha PHB biosynthetic enzymes, PhaA (A), PhaB (B) and PhaC (C). Gene expression is driven by the maize polyubiquitin (Ubi) promoter. PhaA and PhaC enzymes are targeted to plant peroxisomes by a six amino acid type 1 peroxisomal targeting signal (PTSl) (RAVARL) whilst PhaB is targeted by a three amino acid PTSl (ARL) all attached to the carboxy terminus (Table 1). The three genes phaA, phaB md phaC encode a 3-ketothiolase, and acetoacetyl-CoA reductase and a PHB synthase respectively (Figure2).

Figure 2. The three enzymes of the PHB biosynthetic pathway PhaA is a 3-ketothiolase which combines two acetyl-CoA molecules to generate acetoacetyl-CoA. PhaB is an acetoacetyl-CoA reductase and, using NADPH, reduces acetoacetyl-CoA to produce R-3~hydroxybutyrl-CoA. Alternatively, PhaB is an acetoacetyl-CoA reductase and, using NADH, reduces acetoacetyl-CoA to produce R-3-hydroxybutyrl-CoA. PhaC, a PHA synthase, then converts R-3- hydroxybutyrl-CoA into the PHB polymer.

Figure 3. Types of PHAs. PHAs fall into two general categories: 1) Short chain length (SCL) which are from 3 to 5 carbons long and 2) Medium chain length (MCL) which are from 6 to 16 carbons long.

Figure 4. Schematic representation of peroxisomal PHB production The three PHB biosynthetic enzymes were targeted to the peroxisomes following nuclear expression by means of a six amino acid peroxisomal targeting signal type 1 (PTSl) for PhaA and PhaC and a three or six amino acid PTSl for PhaB. Within the peroxisomes, the PHB biosynthetic pathway makes use of local reducing power and converts the acetyl-CoA pool generated by fatty acid catabolism and the β-oxidation pathway into PHB. Targeting additional enzymes for acyl-ACP thioesterase and/or 3-ketoacyl ACP to the plastids results in the generation of unusual fatty acids which are then shunted to the peroxisome for recycling and which can be used to generate PHA polymers and copolymers. The PHB produced in peroxisomes eventually accumulates in the vacuole as peroxisomes in the cell are degraded by pexophagy.

Figure 5. Schematic representation of PHB accumulating in the vacuoles of plant cells. When PHA biosynthetic enzymes are targeted to the sugarcane peroxisomes the PHAs accumulate in three different locations: 1) peroxisomes (Figure 15B, C); 2) vacuoles (Figures 7B); and 3) lipid bodies (Figures 7C, 15E- H). The peroxisomes are recycled through the central vacuole by a process know as pexophagy. Two different methods have been described for absorbtion of peroxisomes into the vacuole: 1) Macropexophagy is where the peroxisome and vacuole membranes fuse and the contents of the peroxisome are incorporated into the vacuole; or 2) Micropexophagy is where the entire peroxisome is enveloped by the vacuole and then recycled. Either or both may be operating in plant cells.

Figure 6. HPLC measurement of PHB production in sugarcane plants. Measurement of PHB contained in various parts of mature peroxisomal PHB producing sugarcane plants showing PHB accumulation up to and over 1% dry weight. Pooled leaf tissue and oldest green leaf sections were collected from 9 month old mature plants. Tips of the oldest green leaves were sampled periodically throughout the life of the same plants. Error bars represent triplicate sub samples of pooled, homogenised tissue.

Figure 7. Subcellular location of PHB in cells from sugarcane plants synthesising PHB in the peroxisomes. A. Sugarcane leaf tissue sections were stained with the lysochrome stain Nile Blue A and were examined using a fluorescent microscope. The stain binds to all lipids in the plant tissue and the PHB can be seen as small glowing dots in the cells in both transverse sections (upper left) and in the leaf epidermal cells (upper right). These spots are not visible in leaf sections from non- transformed plants (bottom). B. PHB accumulation in sugarcane leaf cell storage vacuoles. Transmission electron microscopy of sugarcane leaf cells showing polymer accumulating in vacuoles. Arrows indicate polymer granules. Bar: 2 ran. C. PHB accumulation in sugarcane bundlesheath cell. Transmission electron microscopy of sugarcane leaf cells showing polymer accumulation in a lipid inclusion in a sugarcane bundlesheath cell. White arrows point to starch granules in plastids. Black arrow points to a large PHB particle (white) in a lipid inclusion (black). Bar: 1 μM

Figure 8. Southern analysis for gene copy number in transgenic sugarcane lines. Verification and copy number determination of the Ralstonia eutropha PhaA, PhaB and PhaC genes contained in five peroxisomal PHB producing sugarcane lines.

Figure 9. Ralstonia eurotropha PhaA and peroxisome targeting amino acid sequence and encoding nucleotide sequence.

Figure 10. Ralstonia eurotropha PhaB and peroxisome targeting amino acid sequence and encoding nucleotide sequence.

Figure 11. Ralstonia eurotropha PhaC and peroxisome targeting amino acid sequence and encoding nucleotide sequence.

Figure 12 Schematic diagram of strategy for SCL-MCL PHA copolymer production in peroxisomes.

Figure 13. Comparison of GCMS chromatograms for methanol-transesteriiied chloroform extracts from a transformed control line (inverted) and line J41. (A)

Major saturated methyl 3-hydroxyester peaks. Chromatograms shown were collected in selective ion monitoring mode and consist of ions with m/z ratios of

71, 74 and 103, except for the internal standard region from 11.56-11.8 min, which shows ions with m/z ratios of 77, 105, and 136. (B) Minor putative unsaturated methyl 3-hydroxyester saturated methyl 3-hydroxyesters with odd numbers of carbons, i-std, internal standard (methyl benzoate). Methyl esters are indicated by their corresponding 3-hydroxyalkanoic acid label. Figure 14. Compositions of chloroform-extractable PHA copolymer from transgenic lines as determined by GC-MS. (A) Total monomer proportions. (B) H10:0 - H16:0 monomers proportions only. Mean mol% values are shown for each series. Error bars show SE.

Figure 15. Compositions of chloroform-extractable PHA copolymer from transgenic lines as determined by GC-MS. (A) Total monomer proportions. (B) H10:0 - H16:0 monomers proportions only. Mean mol% values are shown for each series. Error bars show SE. Figure 4. Electron micrographs of leaf sections from wild type, transformed control, and PHA producing lines. (A) Wild type epidermal cell peroxisome; (B,C) PHA inclusions within peroxisomes of Line J41 mesophyll (B) and bundle sheath (C) cells; (D) Putative PHA inclusions within peroxisome of a Line J40 mesophyll cell; (E-H) PHA inclusions within lipid droplets in mesophyll (E₅F) and bundle sheath (G₅H) cells of line J41; (I) Transformed control line showing lipid droplets within vacuoles and plastids of both mesophyll (top) and bundle sheath (bottom). Labels: p, peroxisome; erv, endoplasmic reticulum vesicle; Id, lipid droplet; m, mitochondrion; pi, peroxisomal inclusion; v, vacuole; Ii, lipid inclusion. Scale bars: (a) and (d), 500 nm; (i), 2 μm; all other images, 1 μm.

Figure 16. Amino acid sequence of Cuphea wrightii KasAl enzyme and encoding nucleotide sequence.

Figure 17. Amino acid sequence of Cuphea wrightii FatB2 enzyme and encoding nucleotide sequence.

BRIEF DESCRIPTION OF THE SEQUENCE LISTING

SEQ ID NO: 1 : Amino acid sequence of a peroxisome targeting sequence. SEQ ID NO:2: Amino acid sequence of a peroxisome targeting sequence.

SEQ ID NO:3: Amino acid sequence of the C-terminal portion of spinach glycolate oxidase.

SEQ ID NO:4: Amino acid sequence of the C-terminal portion of GFP- ARL.

SEQ ID NO.5: Amino acid sequence of the C-terminal portion of PhaB-

ARL.

SEQ ID NO:6: Amino acid sequence of the C-terminal portion of PhaA-

RAVARL.

SEQ ID NO:7: Amino acid sequence of the C-terminal portion of GFP-

PhaC-RAVARL.

SEQ ID NO:8: PhaB gene forward primer sequence.

SEQ ID NO:9: PhaB gene reverse primer sequence.

SEQ ID NO:10: PhaC gene forward primer sequence.

SEQ ID NO:11: PhaC gene reverse primer sequence.

SEQ ID NO: 12: PhaA RNA probe template forward primer sequence.

SEQ ID NO: 13: PhaA RNA probe template reverse primer sequence.

SEQ ID NO: 14: PhaB RNA probe template forward primer sequence.

SEQ ID NO:15: PhaB RNA probe template reverse primer sequence.

SEQ ID NO: 16: PhaC RNA probe template forward primer sequence.

SEQ ID N0:17: PhaC RNA probe template reverse primer sequence.

SEQ ID NO: 18: PhaA encoding nucleotide sequence.

SEQ ID NO: 19: PhaA amino acid sequence.

SEQ ID NO:20: PhaB encoding nucleotide sequence.

SEQ ID NO:21: PhaB amino acid sequence.

SEQ ID NO:22: PhaC encoding nucleotide sequence.

SEQ ID NO:23: PhaC amino acid sequence.

SEQ ID NO:24: KasAl amino acid sequence.

SEQ ID NO:25: KasAl nucleotide sequence.

SEQ ID NO:26: FatB2 amino acid sequence.

SEQ ID NO:27: Fat B2 nucleotide sequence.

SEQIDNO:28-63: Primer and competitor sequences used for transgene expression analysis.

DETAILED DESCRIPTION OF THE INVENTION The present invention has arisen, at least in part, from the inventor's realization that the flux of carbon through plant peroxisomes can be significantly exploited for PHB biosynthesis. The potential of this organelle for PHB production has been realized by introducing the complete PHB biosynthetic pathway into the peroxisomes of transgenic Saccharum sp. (sugarcane interspecific hybrids) as a model for other high biomass crop species. The present invention surprisingly demonstrates PHB biosynthesis in plant peroxisomes of sugarcane at production levels up to 1.6% of the dry weight (DW) of the sampled leaf tissue. Particularly unexpected was the accumulation of a substantial portion of the PHB in leaf vacuoles, or vacuole-like organelles or bodies. This unexpected ability of the plant leaf to effectively accumulate the synthesized PHB in the vacuole appears to contribute to the 1.6% DW production levels that were observed. Accordingly, concentration of PHA polymers or copolymers in leaf vacuoles allows for a relatively simple extraction process which yields a substantial portion of the PHA produced by the genetically-modified plant. PHB production may be further improved by expression of a heterologous acyl-ACP thioesterase to increase the flux of fatty acids through the β oxidation cycle. Also provided by the invention is expression of an acyl-ACP thioesterase; and a 3-ketoacyl ACP synthase to facilitate modification or control of desired monomer content of PHA copolymers. In particular embodiments, the PHA copolymer comprises MCL monomers of chain length between ten (10) and sixteen (16) carbons or between ten (10) and twelve (12) carbons. In one particular aspect, the invention provides a method of producing a genetically-modified crop plant capable of biosynthesis of a PHA polymer or copolymer, the method including the step of genetically modifying one or more crop plant crop plant cells or tissues to thereby produce a genetically-modified crop plant which expresses (i) peroxisomal-targeted PhaA, or a fragment or homolog thereof; (ii) peroxisomal-targeted PhaB, or a fragment or homolog thereof; and (iii) peroxisomal-targeted PhaC, or a fragment or homolog thereof; and is thereby capable of biosynthesis of a PHA polymer or copolymer, wherein the PHA polymer or copolymer yields are selected from the group consisting of: (a) at least 0.1% dry weight (DW) accumulated in leaves; (b) at least 0.2% dry weight (DW) accumulated in leaves;

(c) at least 0.5% dry weight (DW) accumulated in leaves;

(d) at least 0.8% dry weight (DW) accumulated in leaves; and

(e) about 1-2% dry weight (DW) accumulated in leaves. In another particular aspect, the invention provides a method of producing a PHA polymer or copolymer in a crop plant, the method including the step of producing a genetically-modified crop plant which expresses (i) peroxisomal- targeted PhaA, or a fragment or homolog thereof; (ii) peroxisomal targeted-PhaB, or a fragment or homolog thereof; and (iii) peroxisomal-targeted PhaC, or a fragment or homolog thereof, to thereby produce the PHA polymer or copolymer in the crop plant, wherein the PHA polymer or copolymer yields are selected from the group consisting of:

(a) at least 0.1% dry weight (DW) accumulated in leaves; (b) at least 0.2% dry weight (DW) accumulated in leaves;

(c) at least 0.5% dry weight (DW) accumulated in leaves;

(d) at least 0.8% dry weight (DW) accumulated in leaves; and

(e) about 1-2% dry weight (DW) accumulated in leaves.

In a yet another particular aspect, the invention provides a genetically- modified crop plant capable of biosynthesis of a PHA polymer or copolymer in peroxisomes, wherein the PHA polymer or copolymer yields are selected from the group consisting of:

(a) at least 0.1% dry weight (DW) accumulated in leaves;

(d) at least 0.8% dry weight (DW) accumulated in leaves; and

(e) about 1-2% dry weight (DW) accumulated in leaves. Preferably, the genetically-modified crop plant comprises (i) peroxisomal- targeted PhaA, or a fragment or homolog thereof; (ii) peroxisomal-targeted PhaB, or a fragment or homolog thereof; and (iii) peroxisomal-targeted PhaC, or a fragment or homolog thereof; which facilitate biosynthesis of the PHA polymer or copolymer.

Suitably, the genetically-modified crop plant and methods for producing a genetically-modified crop plant employ introduction to a crop plant of isolated nucleic acids that encode the aforementioned PHA biosynthetic enzymes (collectively referred to herein as "PHA enzymes") that facilitate biosynthesis of PHA polymers in crop plant with yields of up to 1.6% or more DW accumulated in leaves. By "crop plant" is meant any high biomass crop plant such as sugarcane, switchgrass, elephant grass, sorghum or corn. A preferred crop plant is a grass such as sugarcane, elephant grass or switchgrass.

The term "sugarcane" includes within its scope plants of the "Saccharum complex" including the genera Saccharum, Erianthus, Miscanthus, Sclerostachya, Narenga, and hybrids of any of the species of these genera.

In some embodiments, a substantial portion of the PHA polymers or copolymers are accumulated in leaf vacuoles.

In this context "substantial portion" means at least 50%, preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, or advantageously at least 85%, at least 90% or 91%, 92%, 93%, 94%, 95%, 96%,

97%, 98%, 99% or 100% of the total PHA polymers or copolymers produced by said genetically-modified plant.

By "vacuole" is meant a membrane bound storage organelle present in a plant cell, such as, for example, the cells of a plant leaf. Typically, the vacuole in a mature cell is a fluid-filled compartment in the cytoplasm of the plant cell. Vacuoles may constitute a large portion of the plant cell.

The term "genetically-modified crop plant" refers to a crop plant that has been produced by recombinant DNA technology and includes within its scope the term "transgenic" crop plant, as typically used in the art.

The term "nucleic acid" as used herein broadly designates single or double stranded mRNA, RNA, cRNA, and DNA, the DNA inclusive of cDNA and genomic DNA. A nucleic acid may be native or recombinant and may comprise one or more artificial nucleotides, for example, nucleotides not normally found in nature. Nucleic acid encompasses modified purines (e.g., inosine, methylinosine and methyladenosine) and modified pyrimidines (thiouridine and methylcytosine).

The term "protein" means an amino acid polymer comprising natural or non-natural amino acids, D or L amino acids. Typically, "peptides" are proteins having up to 60 contiguous amino acids; "polypeptides" are proteins comprising more than 60 contiguous amino acids.

By "peroxisomal-targeted" is meant the directing of a protein (e.g. PhaA, PhaB and/or PhaC enzymes) into the peroxisome using specific targeting signals as discussed herein. Plant peroxisomes are important organelles involved in various metabolic processes including fatty acid beta-oxidation, the glyoxylate cycle and photorespiration (Sparkes and Baker, 2002; Kunze et al, 2006; Platta and Erdmann, 2007; Pracharoenwattana and Smith, 2008). AU proteins that are needed for peroxisomal function are encoded by nuclear genes, synthesised in the cytosol and imported into the peroxisomal matrix using specific targeting signals. A type I peroxisomal targeting signal (PTSl) exists in the majority of peroxisomal proteins and typically consists of three amino acids (SKL or a conservative variant) found at the extreme carboxyl terminus, which remain with the mature protein following import. In contrast, a type II signal (PTS2) has a loosely conserved sequence of nine amino acids located within the first 20 to 30 N- terminal amino acids and is cleaved once the protein arrives in the peroxisomal matrix (Johnson and Olsen, 2001).

Methods for directing a protein into the peroxisome are well known in the art. Typically, such methods involve operably linking a nucleotide sequence encoding a peroxisome targeting signal to the coding sequence of the protein, or modifying the coding sequence of the protein to additionally encode the peroxisome targeting signal without substantially affecting the intended function of the encoded protein. It will be understood that a protein of the invention may be directed to the peroxisome by operably linking a peroxisome targeting signal to the C-terminus or the N-terminus of the protein. It is further to be understood that a protein which is synthesized with a peroxisome targeting signal may be processed proteolytically in vivo, resulting in the removal of the peroxisome targeting signal from the amino acid sequence of the mature, peroxisome-localized protein.

An example of a suitable peroxisomal targeting sequence consists of the amino acid sequence RAVARL (SEQ ID NO:1) or a functional fragment thereof.

By "functional fragments thereof is meant is a segment, portion or piece of the amino acid sequence RAVARL (SEQ ID NO:1), which constitutes less than 100% of the amino acid sequence of the peptide and retains peroxisomal targeting activity. For example, a functional fragment may comprise at least 3, 4, or 5 contiguous amino acids of the amino acid sequence RAVARL (SEQ ID NO:1). An example is a fragment consisting of the amino acid sequence ARL (SEQ ID NO:2). In certain aspects, the invention provides peroxisomal targeting of PHA biosynthetic enzymes (e.g. PhA, PhaB and PhaC enzymes) to enable PHA biosynthesis in plants.

PHAs can be in the form of polymers (i.e., homopolymers) or co-polymers inclusive of, random copolymers, block copolymers, or blends of any of these forms. PHA polymers can be broadly divided into two groups: short-chain length

(SCL) PHAs consisting of three to five carbon (C₃-C₅) 3-hydroxyacid monomers, and medium chain length (MCL) PHAs consisting of six (6) to sixteen (16) carbon (C₆-C₁₆) 3-hydroxyacid monomers (Steinbϋchel and Valentin, 1995). Examples of PHAs include, but are not limited to, poly-3 - hydroxypropionate, poly-3-hydroxybutyrate (PHB), poly-3-hydroxyvalerate, poly-3-hydroxyhexanoate (or hydroxycaproate), poly-3-hydroxyheptanoate, poly-

3-hydroxyoctanoate, poly-3-hydroxynonanoate, poly-3 -hydroxy decanoate, poly-

3 -hydroxyundecanoate, poly-3 -hydroxydodecanoate, poly-4-hydroxybutyrate, poly-4-hydroxyvalerate, poly-5-hydroxybutyrate, poly-3 -hydroxy-4-pentenoate, and poly-3 -hydroxy-2-butenoate.

PHA polymers preferably comprise 3, 4 or 5 carbons

In a preferred embodiment, the PHA polymer is PHB.

The nomenclature "PhaA", "PhaB", "PhaC" as generally used herein refers to PhaA, PhaB and PhaC proteins. More specifically, "PhaA" describes a ketothiolase (e.g., β-ketothiolase or 3-ketothiolase), while "PhaB" refers to an acetoacetyl-CoA reductase (including both NADH- and NADPH-dependent forms) and "PhaC" describes a PHA synthase. PHA synthase (also known as

PHA synthetase and PHA polymerase) is an enzyme that catalyzes the polymerization of constituent monomers to yield PHA, and largely determines the

PHA type.

PHA synthases may be naturally occurring or non-naturally occurring. A non-naturally occurring PHA synthase includes a naturally occurring synthase that has been modified using any technique that results in addition, deletion, modification, or mutation of one or more amino acids in the enzyme polypeptide sequence, such as by way of genetic engineering, directed evolution, or synthetic biology, as long the catalytic activity of the enzyme is not eliminated. A non- limiting example of directed evolution is provided in Nomura and Taguchi (2007), Rehm et al. (2002), Taguchi and Doi (2004), Taguchi et al. (2002). In particular embodiments, the PHA synthase may be, for example, a type I (PhaC), a type II (e.g. PhaCl or PhaC2) or a type III synthase as are well known in the art. A preferred PHA synthase is a type 1 PHA synthase which polymerizes short chain length (SCL) PHAs consisting of three to five carbon (C₃-C₅) 3- hydroxyacyl-CoAs to yield PHA SCL polymers. By way of example only, type II PhaC enzymes (e.g PhaCl or PhaC2) may display a preference for substrates comprising six to sixteen carbons. Accordingly, a type II PhaC may be expressed in peroxisomes to facilitate production of medium chain length (MCL) polymers.

Suitably, isolated nucleic acids encoding PHA enzymes for crop plant transformation may be obtained, sourced or otherwise derived from bacteria.

Bacterial genes from which isolated nucleic acids encoding PHA enzymes may be prepared, which are suitable for producing a genetically-modified crop plant capable of biosynthesis of PHA polymers, are well known in the art. However, by way of example, reference is made to Rehm, (2003) and Rehm & Steinbϋchel, (1999), which provide numerous examples of PHA enzymes. In this regard, reference is also made to WO 2004/006657 and WO 01/23580 which also describe PHA enzymes.

Preferred bacterial sources include Pseudomonas sp., Cupriavidus sp. (also known as Alcaligenes sp. or Ralstonia sp.), such as Cupriavidus necator (also known as Ralstonia eutropha or Alcaligens eutrophyus), Aeromonas sp., and Zoogloea sp.

In particular embodiments, the PhaA, PhaB and/or PhaC enzymes are obtained or derived from Ralstonia eurotropha. Preferably, the PhaA, PhaB and PhaC enzymes comprise amino acid sequences and encoding nucleotide sequences as set forth in FIGS 9-11 and SEQ ID NOS: 18-23.

In other embodiments, the genetically-modified plants further comprise an acyl-ACP thioesterase to facilitate the supply of fatty acids to the fatty acid β- oxidation cycle. Advantageously, this increases substrate availability for PHA polymer and co-polymer biosynthesis. A non-limiting example of an acyl-ACP thioesterase is encoded by a FatB gene. A particular FatB gene is a FatB2 gene obtainable from Cuphea wrightii. Another example of a FatB gene is a FatB3 gene obtainable from Cuphea lancelota.

Preferably, the acyl-ACP thioesterase is expressed in a crop plant plastid. In yet further embodiments particularly relating to production of PHA copolymers, the invention contemplates controlling or modifying monomer content of constituent PHA polymers. In one particular embodiment, genetically- modified plants further comprise: (i) an acyl-ACP thioesterase; and/or

(ii) a 3-ketoacyl ACP synthase.

A particular example of an acyl-ACP thioesterase is encoded by a FatB2 gene of Cuphea wrightii.

A particular example of a 3-ketoacyl ACP synthase is encoded by a KasAl gene of Cuphea wrightii.

Non-limiting examples of KasAl and FatB2 amino acid sequences and encoding nucleotide sequences are set forth in FIGS 16 and 17 (SEQ ID NOS : 24- 27).

In such embodiments, a preferred PhaC enzyme is a type II PhaC such as PhaCl or PhaC2.

As will be described in more detail in the Examples, expression of FatB2 increased the ten (10) to sixteen (16) carbon MCL PHA content of PHA copolymers. Co-expression with KasAl shifted this content towards ten (10) and twelve (12) carbon MCL PHAs. It will also be appreciated that reference herein to PHA enzymes such as

PhaA, PhaB and PhaC enzymes, an acyl-ACP thioesterase and a 3-ketoacyl ACP synthase includes fragments and homologs of these enzymes. Fragments preferably comprise up to 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95-99 % of the amino acid sequence of a corresponding full-length protein. Fragments preferably comprise at least 50%, at least 60%, at least 70%, at least 80% or more preferably at least 90% or 95-100 % of the enzymatic activity of the full-length protein. Homologs include within their scope variants (whether naturally-occurring or artificially produced) having at least at least 70%, at least 80% or preferably at least 90% or 95-100 % amino acid sequence identity with a PhaA, PhaB or PhaC enzyme, an acyl-ACP thioesterase or a 3-ketoacyl ACP synthase described herein. Preferably, homologs comprise at least 50%, at least 60%, at least 70%, at least 80% or preferably at least 90% or 95-100 % of the enzymatic activity of the PhaA, PhaB or PhaC enzyme, acyl-ACP thioesterase or 3-ketoacyl ACP synthase described herein. Suitably, production of a genetically-modified crop plant of the invention includes the steps of:

(i) introducing one or more genetic constructs described herein to a crop plant cell or tissue; and (ii) selectively propagating a genetically-modified crop plant from the crop plant cell or tissue in (i).

A "genetic construct" may comprise a nucleic acid encoding one or more PHA enzymes and/or an acyl-ACP thioesterase or a 3-ketoacyl ACP synthase, and one or more additional nucleotide sequences that facilitate manipulation, propagation and/or expression of the nucleic acid of the invention.

Preferably, each genetic construct encodes a single enzyme {e.g. a single PHA enzyme).

In a preferred embodiment, the genetic construct is an expression construct suitable for genetic modification of crop plant, wherein the isolated nucleic acid is operably linked or connected to one or more regulatory sequences in an expression vector.

Preferably, the "expression vector" may be either a linear or circular nucleic acid construct that can integrate into a host plant genome.

In certain embodiments, the expression construct is a "transformation construct" which may be either a linear or circular genetic construct that integrates into a plant host genome. Preferably, this achieves stable integration of the PhaA,

PhaB and PhaC genes, or genes encoding the acyl-ACP thioesterase or 3-ketoacyl

ACP synthase, together with operably linked regulatory nucleotide sequences (e.g. promoter, intron and terminator) and peroxisome or plastid targeting sequence, into the plant host genome.

By "operably linked or connected" is meant that the one or more additional (e.g. regulatory) nucleotide sequence(s) is/are positioned relative to the nucleic acid encoding the enzyme, fragment or homolog thereof to initiate, regulate or otherwise control transcription, translation and/or organelle targeting. Numerous types of suitable regulatory nucleotide sequences are known in the art for crop plant. Typically, the one or more regulatory nucleotide sequences may include, promoter sequences, leader or signal sequences, introns, organelle targeting sequences, ribosomal binding sites, transcriptional start and termination sequences, translational start and termination sequences, and enhancer or activator sequences.

It will be appreciated that to facilitate targeted expression of PHA enzymes in crop plant peroxisomes, nucleotide sequences that encode peroxisome targeting sequences are suitably included in the expression construct. Thus, peroxisomal targeting sequences are included for targeted expression of isolated nucleic acids encoding a ketothiolase, an acetoacetyl-CoA reductase and a Class 1 PHA synthase.

Suitably, for expression of the aforementioned enzymes, a crop plant- operable promoter is included in the expression constructs. Typically, the promoter is positioned 5' of the nucleotide sequence encoding the enzyme.

Constitutive or inducible promoters as known in the art are contemplated by the invention. The promoters may be either naturally occurring promoters, or synthetic hybrid promoters that combine elements of more than one promoter. Suitable promoters for sugarcane expression include, but are not limited to, Emu promoter, maize or rice polyubiquitin (Ub f) promoter, banana streak virus promoter, chlorophyll A/B binding protein (Cab5) promoter and maize adhl promoter.

Preferred promoters are the maize and rice Ub i and the maize Cab5 promoter.

The expression construct, or another, separate expression construct, may comprise a selectable marker gene to allow the selection of transformed host cells.

Such selectable marker genes allow selective propagation of crop plant cells in the presence of paromomycin sulphate, hygromycin, Geneticin® (G418), kanamycin, bialaphos, and streptomycin.

Neomycin Phosphotransferase II (nptll) gene is a preferred selectable marker gene that confers resistance to aminoglycosides, preferably, kanamycin, paromycin, neomycin, and G418 for selection of positively transformed host cells.

Typically, the expression construct may also comprise other gene regulatory elements, such as a 3 '-non-translated sequence. A 3 '-non-translated sequence refers to that portion of a gene that contains a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression. Non-limiting examples of suitable 3 '-non-translated sequences are the

3 '-transcribed non-translated regions containing a polyadenylation signal from the nopaline synthase (nos) gene of Agrobacterium tiimefaciens and the terminator for the T7 transcript from the octopine synthase (pes) gene of Agrobacterium tumefaciens.

Preferably, a nopaline synthase (nos) polyadenylation signal is utilized. Optionally, the expression construct may also include a fusion partner

(typically provided by the expression vector) so that a recombinant protein is expressed as a fusion protein with the fusion partner. An advantage of fusion partners is that they assist identification and/or purification (e.g., via affinity chromatography) of the fusion protein. Well known examples of fusion partners include: green fluorescent protein

(GFP), hexahistidine (6X-HIS)-tag, N-Flag, Fc portion of human IgG, glutathione-S-transferase (GST), and maltose binding protein (MBP).

Fusion partners may also include within their scope "epitope tags", which are usually short peptide sequences for which a specific antibody is available. Genetic constructs of the invention may be introduced to crop plant by any of a number of non-limiting methods, generally referred to as "transformation".

Transformation may be by methods that include microprojectile bombardment (e.g., of callus cells or axillary meristems), Agrobacterium- mediated transformation, liposome-mediated transformation, laser-mediated transformation, silicon carbide or tungsten whiskers, virus-mediated transformation, polyethylene-glycol-mediated transformation, as well as transformation by microinjection and electroporation of protoplasts.

A preferred transformation method for crop plant is microprojectile bombardment, such as described by Franks & Birch (1991) and Bower et at. (1996).

Particular, non-limiting examples of crop plant cells or tissues into which one or more genetic constructs may be introduced include callus, leaf disk, meristem, root, leaf spindle or whorl, leaf blade, stem, shoot, petiole, axillary bud, shoot apex, internode, or inflorescence tissue. Preferably, the tissue is callus.

Genetically-modified crop plant, cells and/or tissues may be analyzed for PHA enzyme expression by nucleic acid-based and/or protein-based detection methods. Protein expression can conveniently be performed using antibodies specific for a particular PHA enzyme, such as in an enzyme-linked immunosorbent assay (ELISA) or by Western blotting and/or immunoprecipitation, and/or immunolocalization. Protein can also be detected by doing enzyme assays on proteins extracted from whole plants or from fractions thereof such as leaf, stalk or root tissue and/or on subcellular fractions such as, peroxisomes, mitochondria, plastids, vacuoles, endoplasmic reticulum, and/or cytosol.

Nucleic acid based detection may by performed by Southern hybridization and PCR may be employed. Southern hybridization may be particularly useful to verify integration of a nucleic acid encoding a PHA enzyme into a crop plant genome.

To measure mRNA expression, RT-PCR and/or Northern hybridization may be employed. Biochemical analysis of PHA polymer or copolymer production may also be undertaken to determine the status of genetically-modified crop plant cells and/or tissues.

For example, high performance liquid chromatography (HPLC), gel permeation chromatography (GPC) or gas chromatography-mass spectrometry (GC-MS) may be used to identify PHA polymers/copolymers.

It will be appreciated from the foregoing that the invention provides genetically- modified crop plant from which may be extracted PHA polymers or copolymers, preferably PHB polymers.

In certain embodiments, said PHA polymer is selected from the group consisting of: poly-3-hydroxypropionate, poly-3-hydroxybutyrate (PHB), poly-3- hydroxyvalerate, poly-3-hydroxyhexanoate (or hydroxycaproate), poly-3 - hydroxyheptanoate, poly-3-hydroxyoctanoate, poly-3-hydroxynonanoate, poly-3 - hydroxydecanoate, poly-3 -hydroxyundecanoate, poly-3 -hydroxydodecanoate, poly-4-hydroxybutyrate, poly-4-hydroxyvalerate, poly-5-hydroxybutyrate, poly-3- hydroxy-4-pentenoate, and poly-3 -hydroxy-2-butenoate.

The chain length of constituent monomers of the PHA polymer is preferably three (3), four (4) or five (5) carbons.

Advantageously, said PHA polymer is poly-3-hydroxybutyrate (PHB). In embodiments relating to PHA co-polymers, it is preferred that constituent monomers have chain lengths of ten (10) to sixteen (16) carbons, or more preferably ten (10) to twelve (12) carbons.

In a particularly preferred form, the invention provides genetically- modified crop plants having sufficient biomass to make production of PHA polymers or copolymers potentially viable on a commercial scale. Examples of high biomass crop plants include sugarcane, switchgrass, elephantgrass sorghum and corn, although without limitation thereto.

PHA polymers or copolymers (e.g., PHB polymers) may be extracted and substantially purified from genetically-modified crop plant plants on an industrial scale by methods known in the art in sufficient quantities to make production of PHA polymers or copolymers in plants commercially feasible. The term "substantially purified (or pure) PHA polymers or copolymers" as used herein refers to a PHA polymer or copolymer that is substantially free of other cellular material with which it is naturally associated in a genetically-modified crop plant. In one embodiment, the PHA polymer or copolymer is at least 50%, for example at least 60%, at least 70% or at least 80% free of other cellular material with which it is naturally associated in a genetically-modified crop plant. In another embodiment, the PHA polymer or copolymer is at least 90% free of other cellular material with which it is naturally associated in a genetically-modified crop plant. In yet another embodiment, the PHA polymer or copolymer is at least 95% free of other cellular material with which it is naturally associated in a genetically- modified crop plant.

A preferred HPLC-based method of PHB polymer quantification is provided in the Examples.

So that the invention may be readily understood and put into practical effect, the following non-limiting Examples are provided.

EXAMPLES EXAMPLE 1

PHB production

MATERIALS AND METHODS Genetic Constructs Constructs used in this study all contain the nopaline synthase terminator (NOS 3') and the maize polyubiquitin (Ubi) promoter, including the first intron, for expression in sugarcane. The PHB biosynthetic enzymes were targeted to peroxisomes with the addition of a C-terminal type I peroxisomal targeting signal (PTSl) to the original phaA, phaB and phaC genes from Ralstonia eutropha. A three amino acid PTSl (ARL; SEQ ID NO: 2) was fused to the C-terminus of phaB and a six amino acid signal (RAVARL; SEQ ID NO:1) was used for phaA and phaC to ensure sufficient targeting of each enzyme to the peroxisomes (Tilbrook et ah, 2009). The previously made phaA-RAVARL gene was cut out of vector pATS, whilst phaB-ARL and phaC-RAVARL genes were PCR amplified (template constructs containing phaB and phaC genes kindly provided by Yves Poirier, The University of Lausanne, Switzerland) with forward primers 5'- NNNNNNGGATCCATGACTCAGCGCATTGCG-3' (SEQ ID NO:8) and 5'- NNNNNNGGATCCATGGCGACCGGCAAAGGC-3' (SEQ ID NO:9) and reverse primers 5'-

CCCGGGTTATAATCTGGCGCCCATATGCAGGCCGCCGT-S' (SEQ ID NO: 10) and 5'-

GATCGTCCCGGGTTATAATCTGGCAACAGCACGTGCCTTGGCTTTGAC GTA-3' (SEQ ID NO: 11), respectively. For expression in sugarcane, phaA- RAVARL, phaB-ARL and phaC-RAVARL genes were cut out of intermediate cloning vectors and ligated between BamHI and Smal sites of vector pU3Z-MCS- NOS (McQualter et ah, 2005). The resulting constructs were named pUbi-PhaA- PTS, pUbi-PhaB-PTS, pUbi-PhaC-PTS, (Figure IA, B and C, respectively).

Plant growth and transformation

Biolistic transformation and regeneration of transgenic sugarcane was conducted as described in Bower et al. (1996). Embryogenic callus created from cultivar Ql 17 was cobombarded with the plasmid pEMU-Kn (Last et α/.,1991), containing nptll as a selectable marker, together with the three constructs Ubi-PhaA- RAVARL, Ubi-PhaB-ARL, Ubi-PhaC-RAVARL. Following transformation, callus was maintained in darkness on callus inducing medium containing 50mg/mL Geneticin (Invitrogen) for two to three months. Emerging transgenic embryonic callus clumps were periodically transferred onto a shoot inducing medium, still containing 50mg/mL Geneticin, and moved into the light. Developing shoots were maintained in this manner for another two months until established seedlings were formed. One seedling per transgenic callus clump was transferred to soil under glasshouse conditions and plants were allowed to establish for two months prior to screening for PHB accumulation using HPLC. PHB measurements were periodically repeated for lines with the highest levels of polymer until the plants had reached maturity at approximately nine months after transfer to soil, at which time a more in depth, whole plant analysis of PHB production was undertaken.

HPLC measurement of PHB production in Sugarcane

PHB concentration was assayed by high performance liquid chromatography (HPLC) essentially as described by Karr et al. (1983), with the following modifications. Sugarcane tissue was either freeze dried overnight or incubated in a drying oven at 7O⁰C for one week. Once completely dried, lOmg (approximately) samples were weighed (weight recorded) and placed into 2mL screw capped tubes.

Tissue was processed for PHB accumulation following the protocol described in Petrasovits et al. (2007). This procedure disrupts plant cells to release water insoluble PHB granules, which are then acid hydrolysed and dehydrated to form water soluble crotonic acid (CA). CA was then quantified using HPLC.

Determination of phaA, pluiB and phaC copy number in PHB producing transgenic sugarcane lines Copy number was determined for each of the three Ralstonia eutropha

PHB genes by southern analysis using DIG labelled RNA probes (Roche Diagnostics). RNA probe templates were created using primers Fd- CTGAATTCGCGGCCATGACCATC (SEQ ID NO:12) and Rv- CTCCCGGGGTTGATCTCCATCAG (SEQ ID NO: 13) for phaA, Fd- CTGAATTCCGGCCATGGGTGGTAT (SEQ ID NO: 14) and Rv- CTCCCGGGCGCCGTTGAGCGAGA (SEQ ID NO: 15) for phaB and Fd- CTGAATTCCTTCGAGAACGAGTA (SEQ ID NO: 16) and Rv- CTCCCGGGCGTTCTGCAGGTAGG (SEQ ID NO: 17) for phaC. From these templates, probes were made using a Roche DIG RNA Labelling Kit (SP6/T7) following manufacturer's instructions. For the five highest peroxisomal PHB producing sugarcane lines, genomic DNA was extracted and digested to completion with either Sphl or Mfel. Genomic DNA from both Ql 17 (wild type) and pUKN (a transgenic line containing the selection gene only) were included as negative controls. 15ug of Sphl or Mfel digested DNA was run per sugarcane line per lane on a 1% gel in TAE buffer. Separate gels were created and run for eventual hybridisation with each of the phaA, phaB and phaC Dig labelled riboprobes. DNA was transferred to nitrocellulose membranes and hybridised with 30ng/mL of DIG labelled RNA probe. Hybridisation, membrane washes and signal detection were all carried out using Roche products and following manufacturer's instructions.

RESULTS AND DISCUSSION

The three PHB biosynthetic. enzymes (Figure 2), contained in the expression constructs depicted in Figure 1, were effectively targeted to sugarcane peroxisomes in multiple independent transgenic lines. Peroxisomal targeting of PhaB was facilitated by a C-terminal ARL signal whilst peroxisomal targeting of PhaC and PhaA required the C-terminal signal RAVARL (Tilbrook et al, 2009) (Table 1). Following an initial screen for the presence of PHB, Southern analysis was performed on the top five PHB producing lines (Figure 9). Southern analysis both confirmed the presence of all three Ralstonia eutropha PhaA, PhaB and PhaC genes in each line and also revealed a range of gene copy numbers, ranging from arbitrarily set low copy number (0 to 4 copies) up to high copy number (more than 10 copies; Figure 9). In the majority of cases, PhaA and PhaC genes were present in a low copy number whilst there was a slightly higher abundance of the PhaB gene (Figure 9).

PHB production levels varied between each independent transgenic sugarcane line. In the five highest producing lines, PHB production in older leaf tissue, such as in sections of the oldest green leaf and in the extreme tips of the oldest leaves, was measured up to and greater than 1% dry weight (Figure 6). In one instance, PHB was found as high as 1.6% dry weight in leaf tips from a six month old plant (Figure 6). Measurements of PHB contained in quadruple sections of the oldest green leaf as well as pooled young, middle aged and old leaf tissue consistently demonstrated that older leaf tissue contained more polymer than younger tissue (Figure 6). This indicates that PHB accumulates continuously in the living leaf tissue of these peroxisomal PHB sugarcane lines.

To determine distribution of PHB throughout leaf tissue, thin cross sections from peroxisomal PHB producing sugarcane lines were stained Nile blue A (Figure 7A). Small stained granules were observed throughout the leaf tissue, apparent in most cell types. Although PHB biosynthesis was targeted to peroxisomes of these sugarcane lines, aggregations of polymer were observed in the vacuoles (Figure 7B). This is indicative of a selective autophagic mechanism known as pexophagy whereby peroxisomes are ultimately engulfed by the vacuole and degraded. Whilst pexophagy is currently undocumented in plants (Lingard et al. 2009) and well characterised in the model yeast species Pichia pastoris (Sakai et al. 2006), it does provide some explanation as to why PHB accumulates in the vacuole following biosynthesis in the peroxisomes. In addition to finding PHB in the storage vacuoles, large PHB granules were also observed in lipid inclusions. One PHB particle in a lipid inclusion was almost the size of a plastid, which is many times the size of a peroxisome (Figure 7C).

In summary, the present invention has shown that PHA biosynthetic enzymes can be successfully targeted to crop plant peroxisomes, specifically sugarcane, resulting in peroxisomal PHA biosynthesis. In mature leaf tissue, the level of PHB production was as high as 1.6% dry weight. PHB granules ultimately accumulate in the vacuole most likely due to a process well documented in other organisms known as pexophagy (Platta and Erdmann, 2007: Sakai et al. 2006). Accumulation of PHB in the vacuole allows the plant cell to contain an amount of PHB previously thought not possible when considering peroxisomal PHB production. In addition, large PHB granules were also observed in lipid inclusions. These may form because of the hydrophobic nature of the PHB particle. These results paint peroxisomal PHA biosynthesis in a new light and remove the initial doubt that arose when this organelle was first considered, alongside plastids and the In summary, the present invention has shown that an appropriate 3 amino acid (ARL: SEQ ID NO:2) or 6 amino acid (RAVARL; SEQ ID NO:1) peroxisomal targeting sequence successfully targets the PHA biosynthetic enzymes to crop plant peroxisomes (Table 1; Figure 4). The level of PHB production was as high as 1.6% dry weight, with PHB particles accumulating in sugarcane storage vacuoles (Figure 6). As with animal and yeast peroxisomes, we demonstrate that plant that plant peroxisomes are recycled through the vacuole and that PHB producing peroxisomes transfer or otherwise move their PHB content into the vacuole or into lipid inclusions (Figure 5, 7). Because to our knowledge this has not been demonstrated in plants before the unexpected "dumping" into the vacuole and into lipid inclusions results in plant cells that accumulate PHB at levels not achievable if the plant cell relied solely on accumulating PHB in peroxisomes (which are organelles of much smaller volume) (Figure 5). It has also been observed that the PHB particles in the leaf storage vacuoles and lipid inclusions fuse together to make larger PHB particles, which will facilitate extraction and purification of PHB from genetically-modified plants (Figure 7B, C).

The present invention therefore provides a PHA biosynthetic system applicable particularly to high biomass crop plants which include but are not limited to elephant grass, Erianthus sp., Maize, Miscanthus sp., sorghum, sugarcane and switchgrass and will allow for highly efficient production of PHA polymers (Figure 3) which accumulate in the vacuoles of plant cells on a scale suitable for industrial production of these bio-based plastics and other end- products that utilize PHA polymers.

EXAMPLE 2 PHA COPOLYMER PRODUCTION

MATERIALS AND METHODS Genetic constructs

All transformation vectors were based on the pU3Z-mcs-nos vector (McQualter et al, 2005) which is a modification of pAHC20 (Christensen and Quail, 1996) that contains the maize ubi-1 promoter and nos terminator. Transgenes were amplified using the primers listed in Table 5 from plasmids containing the genes. The plasmids were kindly provided by: Prof. Yves Poirier, University of Lausanne, Switzerland (phaA and phaB); Dr. Phil Green, The Proctor and Gamble Company, Cincinnati, Ohio, USA (phaC2); Dr. Priya Joyce, BSES Limited (aphA-2); Dr. Mary Slabaugh, Oregon State University, Corvallis, Oregon, USA (FatB2 and KasAl); Prof. Y. Doi, RIKEN Institute, Saitama, Japan (phaJ2). The amplification products were digested with Bamffl/Sacl, except for the phaC2 and KasAl products, which were digested with BcW Sad and BgtWSacI, respectively. The digested transgene amplification products were cloned into pU3Z-mcs-nos digested with BamfflJSacl. To construct pJ2K, phaJ2 was inserted into pU3Z-mcs-nos to create an intermediate vector, pJ2. pJ2 was linearised with Hindϊll and ligated to the amplified Ubi-1 pτomoter.:aphA-2::nos terminator cassette with compatible ends produced by digestion with Hindϋl. A clone with the phaJ2 and aphA-2 cassettes oriented in the same direction to each other and the amp^R gene was selected as the transformation vector p J2K.

Sugarcane transformation

Embryogenic callus cultures of commercial sugarcane cultivar Ql 17 were initiated and maintained as described by Bower et at. (1996). Essentially, 4 days following subculture, nodular embryogenic callus pieces of 3 to 5 mm diameter were arranged to cover a circle of approximately 3 cm diameter on MSC₃ medium supplemented with 0.2 M mannitol and 0.2 M sorbitol as an osmotic treatment for 4 hours prior to bombardment and 4 hours after bombardment. Calli were bombarded with 1 μm DNA-coated gold microprojectiles (Bio-Rad Laboratories, Hercules, CA, USA) using the Bio-Rad PDS-1000 system (Bio-Rad Laboratories) at 1200 psi. Microprojectile preparation and bombardment were carried out according to the manufacturer's instructions. Following bombardment, embryogenic calli were cultured on MSC₃ medium in darkness without selection for 3 days. They were then transferred to MSC₃ medium containing 50 mg/L Geneticin® (Life Technologies Corporation, Carlsbad, California) in darkness and subcultured every 2 weeks to provide escape-free selection. After 8-10 weeks, actively growing calli were placed on MSC₀ medium (MSC₃ medium without 2,4- D) containing 50 mg/L Geneticin^®. Regeneration of plants from callus occurred 8- 12 weeks after transfer to MSC₀. Only one shoot was recovered from each antibiotic-resistant callus clump to ensure that each transgenic line was derived from an independent transformation event. Regenerating plants were maintained at 28 °C under fluorescent lights until ready for establishment in pots in glasshouse. Samples were taken from fully expanded, non-senescing leaves of mature plants.

PHA extractions and GC-MS analysis

The PHA extraction method for initial screening of transgenic lines was adapted from Arai et al. (2002). Approximately 100 mg of freeze dried leaf blade tissue was pulverised for 20 min at 30 Hz in a Retsch MM300 ball mill (Retsch GmbH, Haan, Germany). Ground powder was transferred to glass centrifuge tubes (Corning #8142-10 with #9998 phenolic/PTFE seal cap, Corning, NY, USA, supplemented with custom-made 1 mm thick PTFE seal) and weighed. To remove lipids and other contaminants, the powder was extracted with 8 mL «-hexanes at 55 ⁰C, centrifuged at 3000^χg, and the supernatant discarded. This extraction was repeated six times over 24 h, followed by an identical extraction protocol with methanol, then evaporated to dryness. PHA was extracted from the dried powder with 4 mL chloroform overnight at 55 ⁰C. All extractions were performed at 55 ⁰C with constant mixing in a Hybaid rotary hybridisation oven (ThermoElectron Corp. Waltham, MA, USA). The PHA-containing chloroform was extracted twice with 4 mL water to remove solids, then evaporated to a volume of 0.5 mL. The chloroform extract was subjected to ethanolysis by adding 1.7 mL ethanol, 0.2 mL concentrated HCl, and incubating at 100 ⁰C for 4 h. Following ethanolysis, 2 μg of methyl 3-hydroxypentanoate was added as an extraction standard for the remaining steps. The chloroform phase was recovered by extraction with 7 mL 0.9 M NaCl and neutralised by extraction with 2 mL saturated Na₂CO₃. Methyl 3- hydroxybutyrate was added as an internal standard and the purified chloroform phase analysed on an Agilent 6890 gas chromatograph (Agilent HP-5MS 30 m column, 250 μm internal diameter, 0.25 μm film) coupled to an Agilent 5973 mass spectrometer (Agilent Technologies, Santa Clara, CA, USA). Methyl 3- hydroxybutyrate and the target standards ethyl-3-hydroxybutyrate and ethyl-3- hexanoate were purchased from Sigma Aldrich (St Louis, Missouri); methyl 3- hydroxypentanoate from Fluka AG (Buchs, Switzerland). A modified version of this method was used for final analyses of PHA- producing lines, with the following modifications: (1) Methyl 3-hydroxybutyrate and methyl 3-hydroxypentanoate were replaced by methyl benzoate, which was added prior to methanolysis, acting as an extraction standard for subsequent steps and an internal standard for GC-MS analysis; (2) The chloroform extract was subjected to methanolysis rather than ethanolysis using the same procedure, by replacing ethanol with methanol. Methyl benzoate and the target standard methyl 3-hydroxyhexanoate were purchased from Sigma Aldrich. Additional target standards methyl 3-hydroxyoctanoate, methyl 3 -hydroxy decanoate, methyl 3- hydroxy dodecanoate, methyl 3-hydroxytetradecanoate and methyl 3- hydroxyoctadecanoate were purchased from Larodan Fine Chemicals AB (Malmδ, Sweden). Quantitation of targets was performed in selective ion monitoring mode using ions with m/z ratios 71, 74, and 103 for methyl 3- hydroxyesters and 77, 105, and 136 for methyl benzoate.

Gel permeation chromatography

PHA was extracted from approximately 2.5 g of freeze dried leaf blade tissue using the same method as for GC-MS samples, but without the derivatization and purification steps. The chloroform extract was concentrated to a final volume of 300 μL, and 100 μL used for injection. Separations were performed on a Shimadzu 1OA HPLC equipped with four columns in series: Phenogel™ guard, Phenogel™ Linear-2 mixed bed column (100-10,000 KDa), Phenogel™ 10^"4 A (5-500 KDa), Phenogel™ 10^"3 A (1-75 KDa) (all 5 μm bore, 300 x 7.8 mm; Phenomenex, Torrance, CA, USA; order as listed; chloroform mobile phase at 1 niL/min). Peaks were observed with a refractive index detector. ReadyCal™ polystyrene standards (Fluka AG, Buchs, Switzerland) were used for M_w calibration.

Transgene expression analysis Total RNA was extracted from 100 mg of leaf blade tissue using an

RNeasy kit (QIAGEN GmbH, Hilden, Germany) including optional on-column DNase treatment according to manufacturer's instructions. Reverse transcription was performed using 2 μg total RNA with an Omniscript kit and random hexamers (QIAGEN GmbH, Hilden, Germany) according to manufacturer's instructions. Competitive PCR and Mass Array™ (Sequenom Inc., San Diego, CA) was carried out by the Australian Genome Research Facility (The University of Queensland, QId, Australia) according to the methodology of Ding and Cantor (2003). Primers used are listed in Table 6.

Transmission electron microscopy

Transmission electron microscopy was conducted with the assistance of the Analytical Electron Microscopy Facility, Queensland University of Technology, QLD, Australia. Samples were prepared according to Bohmert et al.

(2000), except that leaves were fixed in 3% glutaraldehyde. Electron microscopy was performed with a JEOL 1200 EX electron microscope (JEOL, Tokyo, Japan).

RESULTS

Production and selection of PH A-accumulating transgenic sugarcane plants

The phaA, phaB, phaC2 andphaJ2 genes were modified to include the C- terminal peroxisomal type 1 targeting sequence, RAVARL, which efficiently targets heterologous proteins to peroxisomes in tobacco (Volokita, 1991) and maize (Hahn et al, 1999). The FatB2 and KasAl coding sequences contain native putative plastid-transit peptides (Leonard et al, 1997; Slabaugh et al, 1998). All transgenes were placed under the control of the maize Ubi-1 promoter (Christensen et al, 1992) and nopaline synthase terminator in direct gene transfer vectors. To facilitate the recovery of transgenic lines expressing phaJ2, the 3'- aminoglycoside transferase II (aphA-2) selectable marker and phaJ2 cassettes were combined in tandem on a single vector, while expression cassettes for all other transgenes were contained in separate vectors. Sugarcane embryogenic callus was co-transformed with a total of six vectors. Leaf blade samples from glasshouse-grown sugarcane plants for 143 independent transgenic lines were screened by GC-MS analysis of ethanol trans-esterified chloroform extracts, and six lines with multiple ethyl 3-hydroxyester peaks were identified (~4% of total lines). Synthesis of SCL-MCL PHA copolymers

To enable conclusive identification and quantitative analysis of monomer content, the six lines were re-analysed using methanol trans-esterification. GC- MS analysis of derivatised extracts revealed a number of peaks containing the characteristic m/z 103 ion corresponding to the methyl 3-hydroxypropionic acid fragment, which is common to all methyl esters of saturated 3-hydroxyalkanoic acids and unsaturated 3-hydroxyalkanoic acids with double bonds beyond the third carbon. The six lines produced low yields of PHA copolymers that consisted primarily of saturated 3-hydroxyacid monomers with even-numbers of carbons ranging from C₄ - C₁₆ (as shown for line J41 in 13A and 13B). Small amounts of H5:0 (Figure 13A) and traces of 3-hydroxyoctadecanoic acid (Hl 8:0) were also present in some samples (13B).

No methyl 3 -hydroxy esters were detected in samples from leaves of wild type or transformed control plants (transformed with the vector pUKN, containing only the selectable marker cassette), with the exception of methyl 3- hydroxybutyrate, which was detected at very low levels (equivalent to 1.43 μg/g DW H4:0, SE = 0.35, n=3; Table 2). Ethanolysis of wild type and transformed control leaf samples produced similar levels of the corresponding ethyl ester (data not shown), indicating that the 3-hydroxyesters originated from the transesterification reaction. Only lines J41 and Jl 71 had H4:0 yields significantly higher than wild type and untransformed controls (P=O.00091 and 0.01769, respectively; Table 2). Hence, low level H4:0 background is probably present in all lines, and may comprise a substantial proportion of the H4:0 content in lines J2, J40, J72 and J142. The composition of PHA copolymers obtained was consistent among replicate samples and broadly similar across the six lines, with H8:0 predominant in all cases. Conversely, H5:0 and Hl 6:0 comprised the smallest and second smallest molar proportions in most lines. Mean total PHA yields ranged from 17 μg/g DW (J40) to 87 μg/g DW (J41), while the highest total PHA yield for an individual sample was 155 μg/g DW (0.0155%) for line J41 (Table 2). Since recovery of PHB standard applied to the ground sample matrix through the entire extraction and analysis process averaged 16.5% (SE = 0.78%, n - 5; Table 2), the measured yields are likely to be -six-fold underestimates of actual PHA contents, assuming similar recoveries for each monomer species.

The PHA copolymer compositions contrast with the MCL PHA copolymers obtained by Mittendorf et ah (1998) from Arabidopsis seedlings expressing P. aeruginosa PhaCl, which contained substantial proportions of unsaturated 3-hydroxyalkanoic acids, as well as trace amounts of some saturated 3-hydroxyalkanoic acids with uneven numbers of carbons. However, close inspection of the GC-MS chromatograms revealed a number of minor peaks for the m/z 103 ion that were not present in wild type or transformed controls. Due to the small size of the peaks relative to background, identification of the mass spectra with total ion chromatograms was not possible. Based on the m/z value and comparison with the elution order under similar conditions presented by Mittendorf et ah (1998), we putatively assigned these as methyl esters of unsaturated 3-hydroxyalkanoic acids or saturated 3-hydroxyalkanoic acids with uneven numbers of carbons (Figure 13 B) .

Influence of expressed transgenes on PHA composition

Expression levels of the six transgenes for the peroxisome strategy were determined in cDNA populations of all PHA-producing lines except Jl 71, which was lost under glasshouse conditions. We selected competitive PCR and MassARRAY™ technology for transgene expression analysis for high sensitivity and amenability for multiplexing (Ding and Cantor, 2003; Oeth et ah, 2004). This methodology quantifies endogenous transcript using a synthetic oligonucleotide differing from the target amplicon at one base position as an internal control ('the competitor'). Competitor and target PCR products are subjected to a primer extension reaction and detected by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI TOF MS). Since known quantities of the competitor are used, absolute quantities of a transcript can be determined within a sample without reference to an external standard. From expression data for actin, 18S RNA and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes, the latter two were selected and used for normalisation with the geNORM algorithm (Vandesompele et ah, 2002) to obtain final transcript levels (Table 3). No transcripts for the any of the six transgenes were detected in wild type or transformed control lines. As expected, phaC2 transcripts were present in all five PHA-producing lines analysed, all at similar levels ranging from 3.0 to 6.7 fM. Despite inclusion of the aphA-2 selectable marker on the same vector, phaJ2 expression was only detected in lines J72 and J 142 at very low levels. Transcripts for phaA and phaB were absent in lines J2 and J40, respectively, but present in all others. However, all phaA levels were at or below 2.7 fM, whereas phaB transcripts were expressed at levels up to 13.4 fM. Line J41, the only line profiled for transgene expression that showed H4:0 content significantly higher than the wild type, had both the lowest level of phaA transcripts and the highest level of phaB transcripts of any line that co-expressed phaA. Four lines showed FatB2 transcript expression with the highest level in

J 142, while all five lines tested showed varying levels of KasAl transcript expression (Table 3). When expressed in transgenic Arabidopsis, FatB2 elevates wild type 16:0 and generates novel 14:0, 12:0 and 10:0 (Leonard et al, 1998). Superimposed on the wild type profile of beta-oxidation intermediates, we expected FatB2 to elevate H10:0-H16:0 proportions. While line J2 provided an ideal FatB2-negative control, the closest approximation to a FatB2-positive, KasAl -negative line obtained was J72, which had the second highest FatB2 and lowest KasAl transcript levels. Although J2 also expressed KasAl transcripts, this is not expected to significantly change the fatty acid profile in the absence of FatB2 (Leonard et al, 1998). Molar proportions of H10:0, H12:0, H14:0 and H16:0 in J72 were all greater than in J2, with H10:0 and H12:0 significantly different at P = 0.0042 and 9.76E-06, respectively (Figure 14A). This remains the case when MCL molar proportions (H6:0 - Hl 6:0) alone are considered to eliminate bias from SCL components (P = 0.00555 for H10:0, P = 0.00014 for H12:0; data not shown). As expected, the Fα£B2-expressing lines J40 and J142 also had larger combined H10:0-H16:0 proportions than J2 (Figure 14A). However, line J41 did not, possibly due to dilution by large H4:0 and H8:0 proportions.

Moreover, line J72, as well as J40, J41 and J 142 provide evidence for a combined effect of FatB2 and KasAl on PHA composition. Given the results of

Leonard et al. (1998), co-expression of FatB 2 and KasAl would be expected to increase H10:0 and H12:0 at the expense of H14:0 and H16:0 when compared as proportions of the H10:0-H16:0 total. Accordingly, all lines expressing both FatB2 and KasAl have molar proportions shifted towards Hl 0:0 and Hl 2:0 relative to J2. The shift is significant for H12:0 in J40, J41, J72 and J142 (P values of 0.03215, 0.00029, 0.00452 and 0.00702, respectively), and also for H10:0 in J142 (P = 0.00059), the line with the highest KasAl expression level.

J41 SCL-MCL PHA copolymer has a moderate molecular weight with a narrow distribution

The molecular weight distributions of copolymers produced by lines J2, J40, J41, J72 and J 142 were investigated by gel permeation chromatography (GPC) using scaled up PHA extractions. Chloroform extracts of line J41 showed a single peak that was not present in wild type or transformed control samples (data not shown). Although a chloroform extract of line J2 also contained a single peak at the same retention time, it was not sufficiently large for analysis. No peaks were observed for lines J40, J72 or J 142, probably due to their very low PHA yields. Based on chloroform solubility and absence from wild type and transformed control extracts, we concluded that the peaks identified for lines J2 and J41 represented PHA. The PHA copolymer in line J41 showed a weight- average molecular weight (M_w) of 112 KDa and a polydispersity index (PDI) of 1.8 (Table 4). Non-extracted standards of bacterial origin for PHB and PHB-PHH (poly[3-hydroxybutyrate-co-3-hydroxyhexanoate]) had larger molecular weights of 2.92 x 10⁵ and 6.41 x 10⁵, respectively, and broader distributions as indicated by PDI values of 5.8 and 5.4, respectively. Extraction of the PHB standard spiked onto the wild type sugarcane leaf matrix resulted in a ~12% reduction in M_w. It is known that the molecular weight distribution of PHB extracted from bacteria can be influenced by the extraction process used (Poirier et al, 1995b), and hence the data for line J41 are probably a small underestimate of actual M_w and PDI.

Compared to PHA copolymer of line J41, PHB extracted from leaves of the transgenic sugarcane line TA4 (Petrasovits et al, 2007) showed an ~l l-fold higher molecular weight of 1.24 x 10⁶ and an ~8-fold higher PDI of 14.8 (Table 4). Poirier et al. (1995a) reported a similarly a high molecular weight and PDI for PHB produced by transgenic Arabidopsis suspension cells (Table 4). In both cases, PHB biosynthesis involved R. eutropha PhaC. Using other PHA synthases, Mittendorf et al. (1998) reported a lower M_w and broader distribution for MCL PHA copolymers produced in transgenic Arabidopsis compared to line J41 PHA copolymer, while Nakashita et a (1999) reported a lower M_w but almost identical PDI for PHB produced in transgenic tobacco (Table 4).

Accumulation of PHA in peroxisomes and lipid droplets

To investigate the subcellular localisation of the PHA copolymers, we examined leaf sections of the PHA-producing lines by transmission electron microscopy. Characteristically, peroxisomes are (1) bounded by a single membrane, (2) typically spheroid in shape, ranging from 0.2 - 1.7 μm in diameter, and (3) contain a coarsely granular or fibrillar matrix, occasionally with amorphous or paracrystalline inclusions (Huang et al, 1983; Figure 15A). Mesophyll and bundle sheath cell peroxisomes of line J41 contained electron-lucent, globular inclusions that occupied the majority of the organelle volume (Figure 15B, C). The inclusions formed large and small globules, surrounded by granular peroxisomal matrix. Based on the cellular location, absence from wild type and transformed control samples, and similar appearance to previous examples of PHAs accumulated in plants, we conclude that the inclusions consist of PHA. Although some peroxisomes of other PHA-producing lines appeared to contain inclusions, these were not clearly identifiable (Figure 15D), possibly due to the low levels of PHA in these lines. Additionally, PHA inclusions were observed within darkly stained lipid droplets in line J41 mesophyll and bundle sheath cells. No inclusions were found in wild type and transformed control lines, which commonly contained lipid droplets in the plastids (Figure 151), vacuole (Figure 151) and cytoplasm (data not shown) of both mesophyll and bundle sheath cells. Unlike the peroxisomal inclusions, the inclusions formed single globules within each lipid droplet, and were more rounded in shape. While the lipid droplet inclusions appeared to be contained within the cytoplasm, they were typically closely associated with plastids (Figure 15E-H), and in some cases appeared to be within plastids (15G).

DISCUSSION

Evaluation of mechanisms for regulating PHA copolymer composition

We aimed to produce PHA copolymers with regulated monomer content in sugarcane peroxisomes using three mechanisms. The first mechanism drew on peroxisomal acetyl Co-A using 3-ketothiolase and acetoacetyl-CoA reductase activities to increase H4:0. The combination of low-level expression of phaA and high-level phaB expression in line J41 was associated with a modest but statistically significant increase (~1.5-fold) in the H4:0 proportion compared to lines J2 and J40, which lacked expression of one of the genes (Figure 14A, Table 3). It is likely that the actual increase was greater, being obscured by the combination of endogenous H4:0 background and low PHA yields. The fact that lines J72 and J 142 expressed both genes but showed no obvious H4:0 increase may indicate that limited phaA expression combined with higher phaB expression is required to increase H4:0 content. This situation could occur if high-level phaA expression in peroxisomes is detrimental, as it is in plastids (Bohmert et al, 2002; Ruiz and Daniell, 2005). Overall, the results indicate that PHB biosynthesis enzymes can be incorporated into a peroxisomal PHA accumulation strategy to boost H4:0 content.

The second mechanism used FatB2 and KasAl to supply unusual MCL fatty acids from plastid fatty acid biosynthesis. The PHA composition and transgene expression data provided evidence that FatB2 increased H10:0-H16:0 contents, and in combination with KasAl, shifted the distribution within Hl 0:0- H16:0 towards H12:0 and H10:0 (Figure 14A, 3). These results are consistent with the expected activities for each enzyme. To our knowledge, this is the first time a ketoacyl-ACP synthase has been used to influence the composition of PHA produced in transgenic plants. Since MCL monomer side group chain length in SCL-MCL PHA copolymers profoundly affects flexibility characteristics (Noda et al, 2005b), ketoacyl-ACP synthases may provide a useful tool for fine-tuning PHA composition to match specific functional requirements. An increased supply of MCL fatty acids may have increased PHA yield in line J 142, which had the second highest mean PHA yield of confirmed Fαtj32-expressing lines. Compared with the 18-fold PHA yield increase achieved using the FatB3 acyl-ACP thioesterase in Arάbidopsis seeds by Poirier et al (1999), any effect on yield here is small. A lower potential for yield enhancement is to be expected in sugarcane leaves, which are not engaged in fatty acid biosynthesis to the extent of oil- accumulating Arabidopsis seeds. Although modest, such gains could potentially be used in combination with other technologies to attain commercially viable yields. Finally, the third mechanism attempted to enhance diversion of MCL β- oxidation intermediates with an i?-specific enoyl-CoA hydratase. No conclusions could be made about this mechanism due to the lack of any substantial phaJ2 expression (Table 3). This was unexpected since phaJ2 was contained on the same vector as the selectable marker, and all five other genes for the strategy were expressed at 10-fold or greater levels in at least some lines. A possible explanation is that expression of PhaJ2 is lethal, and that only lines with low or no expression were recovered through the somatic embryogenesis and selection process.

Interestingly, some Arabidopsis double mutant for genes encoding core β- oxidation enzymes have embryo lethal phenotypes (Goepfert and Poirier, 2007).

While the transcript profiles for FatB2 and KasAl were largely consistent with the H10:0-H16:0 contents of the PHA copolymers, they do not explain the predominance of H8:0 in all cases (Figure 14A). A similar prevalence of H8:0 and 3-hydroxyoctenoic acid (H8:l) was observed by Mittendorf et al (1998) in MCL PHA copolymers produced by Arabidopsis seedlings expressing peroxisome- targeted P. aeruginosa PhaCl PHA synthase. H8:0 was also dominant in PHA accumulated in Arabidopsis seeds using the same PHA synthase, and did not change substantially with co-expression of the FatB3 thioesterase despite a 4-fold increase in H10:0 (Poirier et al, 1999). Mittendorf et al. (1998) concluded that their results were consistent with trienoic and dienoic fatty acids with cis double bonds at an even carbon undergoing β-oxidation via an epimerase pathway, which involves direct production of i?-3-hydroxyoctenoyl-CoA and R-3- hydroxyoctanoyl-CoA intermediates, respectively. In contrast, we did not detect any H8:l and putatively identified only trace peaks for other unsaturated PHA monomers (Figure 13B), probably reflecting the differences in fatty acid metabolism between sugarcane leaves and Arabidopsis seedlings. Therefore β- oxidation via an epimerase pathway cannot account for the H8:0 content in our case. It is also unlikely that the substrate specificities of PhaC2 are responsible, since the enzyme is capable of producing PHAs with a broad range of MCL contents depending on the fatty acid supplied (Noda et al, 2005b). An alternative explanation for the predominance of H8:0 is that eight-carbon β-oxidation intermediates are present at higher steady state levels compared to intermediates of other chain lengths. This might be caused by differing chain-length specificities of enzymes catalysing any of the four core β-oxidation reactions. For example, plants contain a family of acyl-CoA oxidases with partially overlapping substrate specificities that catalyse the first step of the β-oxidation cycle (Arent et al, 2008). Interestingly, the three acyl CoA oxidases with known SCL or MCL activities all have comparatively low specific activities for octanoyl-CoA, which forms the overlap point for their specific activity profiles (Froman et al, 2000).

The presence of H5:0 in PHA copolymers produced in plant peroxisomes has been noted previously (Arai et al, 2002; Matsumoto et al, 2006). The trace amounts of putative H7:0, H9:0, Hl 1:0 and H13:0 (Figure 13B) we detected are not consistent with the H5:0 originating from β-oxidation of fatty acids with uneven numbers of carbons. Similarly, Matsumoto et al. (2006) did not detect H7:0 or higher odd-numbered 3-hydroxyalknanoic acids despite producing a polymer containing up to 49 mol% H5:0. Arai et al (2002) found that feeding PHA synthase-expressing transgenic plants with Tween-20 did not change the molar composition of the H4:0/H5:0/H6:0 PHA copolymer as expected, and suggested the existence of an unknown metabolic flow producing R-3- hydroxypentanoyl-CoA. One possible pathway is condensation of propanoyl-CoA and acetyl-CoA to yield 3-ketopentanoyl-CoA, and subsequent reduction to 3- hydroxypentanoyl-CoA (Matsumoto et al, 2006).

Physical properties of SCL-MCL PHA copolymer produced

The substantial MCL monomer content of the PHA copolymer produced by line J41 (~65 mol%; Figure 14A) would be expected to exhibit very elastomeric properties, and considerably higher H4:0 content would probably be required for commercial applications. This might be achieved in two ways. The first is to increase the availability of i?-3~hydroxybutyryl-CoA, as we have demonstrated in this study using PhaA and PhaB. The second is to use an alternate PHA synthase with substrate specificity characteristics that will produce PHA with the required H4:0 content from the available i?-3-hydroxyacyl-CoAs in the peroxisome. For example, Pseudomonas sp. 61-3 PhaCl expressed in Arάbidopsis peroxisomes produced PHA copolymers with an average of 40 mol% H4:0 (Matsumoto et al, 2006). Interestingly, an engineered version of PhaCl with greater specific activity for i?-3-hydroxybutyryl-CoA was tested in the same study and did not change the PHA composition, presumably due to substrate limitation (Matsumoto et ah, 2006). Due to the order in which β-oxidation intermediates become available for polymerisation, PHA synthases with not only high specific activity for i?-3-hydroxybutyryl-CoA, but also low specific activities for MCL i?-3-hydroxyacyl-CoAs may be required to achieve high 4:0 content. PHA copolymer from line J41 showed a relatively low molecular weight and uniform polymer chain length distribution compared to non-extracted bacterial PHB and PHB-PHHx standards, but similar to some previous examples of PHAs produced in plants. The narrow chain length distribution of J41 PHA copolymer is not uncommon in biological systems. For example, P. sp. 61-3 PhaCl was expressed in E. coli produced SCL-MCL PHA copolymer with a PDI of 1.5 (Takase, 2004). Higher molecular weights of 500,000-700,000 are typically required for commercial applications (Noda et al, 2005b). This may be achieved using PHA synthases engineered for production of higher molecular weight PHA, of which there have been several examples (Nomura and Taguchi, 2007).

Opportunities for increasing PHA yield in plant peroxisomes

The maximum PHA yield of 0.0155% we obtained is lower but comparable to several previous examples of PHA copolymer production in Arabidopsis peroxisomes in vegetative leaves using other PHA synthases. It is approximately 3 -fold less than for A. caviae PhaC (Arai et ah, 2002); three- quarters of the yield obtained with P. aeruginosa PhaCl (Mittendorf, 1998); and two thirds that for P. sp.61-3 PhaCl (Matsumoto et ah, 2006). These low yields are consistent with expectations for leaf peroxisomes, which are principally engaged with photorespiration and are not expected to have high carbon flux through fatty acid β-oxidation. A substantially higher level of 0.4% DW PHA was achieved by expression of P. aeruginosa PhaCl in 7-day-old germinating seedlings, in which β-oxidation is strongly induced for mobilization of seed lipid reserves (Mittendorf et ah, 1999). Nonetheless, the maximum yield of PHA achieved in plant peroxisomes of 2% DW in maize suspension cells (Hahn et ah, 1999) indicates that peroxisomes may have potential for substantially higher yields. It has been suggested that the high PHA yields that occur in bacteria from β-oxidation may be enabled by a 3-hydroxyacyl-CoA epimerase or other activity that is not present in plants, and that metabolic channelling of intermediates in plant peroxisomes may also limit yields (van Beilen and Poirier, 2008). If this is the case, i?-specific enoyl-CoA hydratases may hold potential for yield improvement if expression can be achieved. PHA yield might also be improved by increasing the activities of the PHA synthase and other enzymes, either through optimisation of transgene expression or the use of engineered enzymes. As noted earlier, increased supply of MCL fatty acids due to FatB2 and KasAl probably contributed to the yields we obtained. The plastid targeting efficiency and activity of these enzymes in the monocot plastid environment is unknown, and alternate acyl-ACP thioesterases or ketoacyl-ACP synthases may be more effective. Our observation that PHA produced within peroxisomes accumulates within lipid droplets (Figure 15) may also have implications for yield improvement. It has been shown in transgenic Arabidopsis that expression of PHB biosynthetic enzymes in the cytoplasm results in PHB inclusions in the cytoplasm, nucleus and vacuole (Poirier et al, 1992), while expression of a PHA synthase in the peroxisome produces both peroxisomal and vacuolar inclusions (Mittendorf et al, 1998). Mittendorf et al. (1998) attributed this fluidity of subcellular location to the ability of PHAs to move through single membrane-bound organelles, rather than to mis-targeting of synthesis enzymes. Interestingly, the vacuolar inclusions they reported were contained within darkly stained bodies similar to the lipid droplets we observed, although the bodies were not identified. Recent studies have shown that peroxisomes associate closely with lipid droplets and can extend processes into the droplet cores that may promote coupling of lipolysis and β- oxidation of fatty acids (Binns et al, 2006; Goodman, 2008). The transfer of PHA to lipid droplets may mean that yields are not limited by storage space within the organelle and disruption of essential organelle functions, as is the case with plastids.

Throughout the specification the aim has been to describe the preferred embodiments of the invention without limiting the invention to any one embodiment or specific collection of features. It will therefore be appreciated by those of skill in the art that, in light of the instant disclosure, various modifications and changes can be made in the particular embodiments exemplified without departing from the scope of the present invention. All computer programs, algorithms, patent and scientific literature referredn is incorporated herein by reference.

Table 1. Physical analysis of C-terminal twelve amino acids from peroxisomal targeted proteins

Protein ID C-terminus Pl Charge at pH 7 Hydrophilic/ Positive/ Targeting Accumulation Species Tested Hydrophobic Negative Prediction of Transient residues* Residues* Classification GFP

Spinach WDGPSSRAVARL Targeted glycolate 10.00 +0.9 5/4 1/1 N/A N/A oxidase (SEQ ID NO:3) (Score:12.671)

THGMDELYKARL Targeted

GFP-ARL 7.19 +0.2 6/3 3/2 Peroxisomes Sugarcane, tobacco & Arabidopsis (SEQ ID NO:4) (Score:10.620)

SLNGGLHMGARL Targeted

PhaB- ARL 10.00 +1.1 8/1 3/0 Peroxisomes Sugarcane, tobacco & Arabidopsis (SEQ ID NO:5) (Score:7.652)

LAVERKRAVARL Targeted

PhaA-RAVARL 11.69 +2.9 5/4 4/1 Peroxisomes Sugarcane, tobacco & Arabidopsis (SEQ ID NO:6) (Score:9.679)

YVKAKARAVARL Targeted

PhaC-RAVARL 11.12 +3.9 4/5 3/0 Peroxisomes Sugarcane, tobacco & Arabidopsis (SEQ ID NO:7) (Score:7.704)

* contained in the nine residues upstream from the PTSl tripeptide

Table 2. Yields of chloroform-extractable PHA from wild type, spiked wild type,

Line (n) ^{WT (2)}' ^{WT + 5} ^ _J2 (3) J40 (4) J41 (5) J72 (5) J142 (5) J171 (4)

__ ' UKN (I) PHB (5)

Total PHA Mean 1.43 6.74 27.05 16.70 86.73 22.49 67.53 80.43

(μg/g DW) SE 0.35 0.24 3.47 0.62 17.06 2.25 20.93 18.21

Max. total PHA (μg/g DW) 2.12 7.18 33.80 18.51 154.77 30.03 121.96 113.29

Mean H4:0 Mean 1.43 6.74 3.19 1.61 15.70 1.64 1.89 3.23

(μg/g DW) SE 0.35 0.24 0.58 0.15 1.58 0.07 0.07 0.30 transgenic leaf samples.

WT, wild type; UKN, transformed control; + 5 ug PHB, spiked with 5 ug PHB. The number of replicate extractions (n) is indicated in brackets.

Table 3. Absolute transcript expression levels for five PHA-producing lines determined using competitive PCR and MassARRAY™ technology.

Une phaA phaB phaC2 phaJ2 FatB2 KasAl

J2 - 13.4 3.9 - - 0.8

J40 1.5 - 4.2 - 6.3 1.4

J41 0.4 11.7 3.0 - 5.6 0.6

J72 2.7 3.2 4.0 0.1 7.3 0.5

J 142 1.1 2.2 6.7 0.1 28.5 5.1

The fM values shown represent the mean of two replicate analyses of the same cDNA sample. R² values for all standard curves were > 0.9.

Table 4. Comparison of molecular weight distributions of PHAs from lines J41 and TA4 to standards, and PHAs previously produced in transgenic plants.

PHB-PHH, poly(hydroxybutyrate-co-hexanoate).

Table 5. Sources and primers used for amplification of transgenes.

Vector Gene(s) Source organism Genbank Forward primer (5' - 3') Reverse primer (5' - 3') Amplification accession product length

(bp) pATS phaA Ralstonia eutropha .104987 TGAGGATCCATGACT6ACGTTGTCATCGTATCCG ACTGASCTCTTATAATCTGGCAACAGCACG 1218

TTTGCGCTCGAaGCCAGCG

pBTS phaB Ralstonia eutropha J04987 TGAGGATCCATGACTCAGCGCATTGCGTATG ACTGAGCTCTTATAATCTGGCAACAGCACG 777

GCCCATATGCAGGCCGCCG pC2TS phaC2 Pseudomonas AX105569 CAGTGATCAATGCGAGAGAAACAGGTGTCG ACTGJGJ^KnTATAATCTGGCAACAGCACG 1719 fluoresceins GCGCACGTGCACGTAGGTGC pFB2 FatB2 Cuphea wrightii U56104 AAAGGATCCAAACATGGTGGTGGCTGC TCGgΔgCICTTTCATGTTG ATATCG CC 1251 pKAl KasAl Cuphea wrightii U67316 GGCAGATCTTTGGTGTTTCAATGGCGG TGGgΔgmGGCATTAAGCTACTAACG 1689 pJ2K phaJ2 Pseudomonas . AB040026 CGCGGATCCATGGCGCTCGATCCTGAG ACTGAGCTCTTATAATCTGGCAACAGCACG 908 aeruginosa GTCCGGCCGCTCTGGCGG aphA-2 Escherichia coli E00425 CCGAAGCJTGAATACGAATTCCCGATC CCGAAGCTTGAATACGAATTCCCGATC 3312

Restriction enzyme sites: BaroHI, BcI)₁ Bgl\\, Sad, HJϋΦΛ- Bases encoding the peroxisome targeting signal RAVARL are indicated in bold type.

Table 6 Primer and competitor sequences used for transgene expression analysis (SEQ ID NOS-.28-63). The universal 5' PCR primer tag is indicated in bold type.

Amplicon

Gene Forward PCR primer Reverse PCR primer Extension primer Target sequence [ALLELE/competitor] length (bp)

ACGTTGGAT6TCCGCAT ACGTTGG ATGTTGGTGGAGCGAT TTTGTCTGGTTAATTCC ATGGGTGCATCTTTGCTTGGGGCAGAG ATAACAACCTTCTTG [C/a]CACCAC

18S RNA 90 AGCTAGTTAGCAG TTGTCTG GTTAA CCTTCAGATGCGCAGCAGCCTTGTCCTTGTCAGTGAA

ACGTTGGATGATGGGT ACGTTGGATGTTCACTGACAAGGA GCATCTGAAGGGTGG ATGGGTGCATCTTTGCTTGGGGCAGAGATAACAACC H C 1 1 G[C/a]CACCAC

GAPDH 106 GCATCTITGCTTGG CAAGGC TGC CCTTCAGATGCGCAGCAGCCTTGTCαTGTCAGTGAA

ACGTTGGATGAAAGGC ACGTTGGATGCGTACATGGCAGG ACATTGAAAGTCTCGA CGTACATGGCAGGAACATTGAAAGTCTCGAACATAATCtA/clGGGTCATCTT

Actin 85

CAACAGGGAGAAGA AACATTG ACATAATCC CTCCCTGTTGGCCTTT

CXl

ACGTTGGATGAAATCCA ACGTTGGATGGGATACGATGACA GACAACGTCAGTCATG AMTCCACCCGTCGGCACCTCCGCπCAAGGTCGACTCTAGAGGAfr/alCCA phaA-TS 72

CCCGTCGGCACCT ACGTCAG G TGACTGACGTTGTCATCGTATCC

ACGTTGGATGAATGGC ACGTTGGATGTCGGCACCTCCGCT CTCTAGAGGATCCATG AATGGCGGTTCCGATACCACCCATGCCGCCGGTCACATACGCAATGCGCTG phaB-TS 117 GGTTCCGATACCAC TCAAG AC [A/g]GTCATGGATCCTCTAGAGTCGACGCTAGACAAGTCAGATTCTC

ACGTT6GATGTGC6CGT ACGTT6GATGTCGGCACCTCCGCT TGCGCGTTCATGTAGTTAGCGGGGACCGGCAAGGCTCCCGACACCTGTTTC phaC2-TS 120 CTCCCGACACCTGTTTC

TCATGTAGTTAGC TCAAG [T/cJCTCGCATTGATCCTCTAGAGTCGACCTTGAAGCGGAGGTGCCGA

ACGTTGGATGGTAGTTC ACGTTGGATGTCGGCACCTCCGCT CCCCAGCACCTCAGGA GTAGTTCAGGAGCACCTCAGGATCGAG[CA]GCCATGGATCCTCTAGAGTC phaJ2-TS 94 AGGAGCACCTCAG TCAAG TCGAG GACCTTGAAGCGGAG6TGCC6A

ACGTTGGATGCTAGGTG ACGTTGGATGTCGGCACCTCCGCT TGGAACAGGGAAGAA CTAGGTGCTGGAACAGGGAAGAATGC[A/t]GAACTTGCTGCAGCAGCCACC

FatB2 118

CTGGAACAGGGAA TCAAG TGC ACCATGTTTGGATCCTCTAGAGTCGACCTTGAAGCGGAGGTGCCGA

ACGTTGGATGGTACAGA ACGTTGGATGTCGGCACCTCCGCT GACGCAACCATGGAA GTACAGAATGGGGACGCAACCATGGAAGCtG/clGCGGCCGCCATTGAAAC

KasAl 113

ATGGGGACGCAAC TCAAG GC ACCAAAGATCCTCTAGAGTCGACCTTGAAGCGGAGGTGCCGA

REFERENCES

Arai Y, Nakashita H, Doi Y, Yamaguchi I (2001) Plastid Targeting of Polyhydroxybutyrate Biosynthetic Pathyway in Tobacco. Plant

Biotechnology 18:289-293.

Arai Y, Shikanai T, Doi Y, Yoshida S, Yamaguchi I, Nakashita H (2004) Production of polyhydroxybutyrate by polycistronic expression of bacterial genes in tobacco plastid. Plant and Cell Physiology 45:1176- 1184.

Arai Y, Nakashita H, Suzuki Y, Kobayashi Y, Shimizu T, Yasuda M, Y, Yamaguchi I (2002) Synthesis of a novel class of polyhydroxyalkanoates in Arabidopsis peroxisomes, and their use in monitoring short-chain- length intermediates of beta-oxidation. Plant and Cell Physiology 43: 555- 562

Arent, S., Pye, V.E. and Henriksen, A. (2008) Structure and function of plant acyl-CoA oxidases. Plant Physiol. Biochem. 46, 292-301.

Baker A, Graham IA, M. Holdsworth, Smith SM, Theodolou FL (2006) Chewing the fat: beta-oxidation in signalling and development. Trends in Plant Science 11:124-132

Binns, D., Januszewski, T., Chen, Y., Hill, J., Markin, V.S., Zhao, Y.M.,

Gilpin, C, Chapman, K.D., Anderson, R.G.W. and Goodman, J.M.

(2006) An intimate collaboration between peroxisomes and lipid bodies. J. Cell Biol. 173, 719-731. Bohmert K, Balbo I, Kopka J, Mittendorf V, Nawrath C, Poirier Y, Tischendorf G, Trethewey RN, Willmitzer L (2000) Transgenic Arabidopsis plants can accumulate polyhydroxybutyrate to up to 4% of their fresh weight. Planta 211: 841-845

Bower R, Elliott AR, Potier BAM, Birch RG (1996) High-efficiency, microprojectile-mediated cotransformation of sugarcane, using visible or selectable markers. Molecular Breeding 2: 239-249 Christensen AH, Quail PH (1996) Ubiquitin promoter-based vectors for high- level expression of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic Research 5: 213-218

Christensen, A.H., Sharrock, R.A. and Quail, P.H. (1992) Maize polyubiquitin genes - structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant MoI. Biol. 18, 675-689.

Ding CM, Cantor CR (2003) A high-throughput gene expression analysis technique using competitive PCR and matrix-assisted laser desorption ionization time-of-flight MS. Proceedings of the National Academy of

Sciences of the United States of America 100: 3059-3064

Franks T, Birch RG (1991) Gene-Transfer into Intact Sugarcane Cells Using Microprojectile Bombardment. Australian Journal of Plant Physiology 18: 471-480 Froman BE, Edwards PC, Bursch AG Dehesh K (2000) ACX3 , a novel medium-chain acyl-coenzyme A oxidase from Arabidopsis. Plant Physiol. 123, 733-741.

Hahn JJ, Eschenlauer AC, Sleytr UB, Somers DA, Srienc F (1999) Peroxisomes as Sites for Synthesis of Polyhydroxyalkanoates in

Transgenic Plants. Biotechnol. Prog. 15: 1053-1057

Huang AHC, Trelease RN, Moore TS (1983) Plant peroxisomes. New York: Academic Press.

Igamberdiev AU, Lea PJ (2002) The role of peroxisomes in the integration of metabolism and evolutionary diversity of photosynthetic organisms.

Phytochemistry 60:651-74.

Johnson TL, Olsen LJ (2001) Building new models for peroxisome biogenesis. Plant Physiology 127: 731-739

Karr DB, Waters JK, Emerich DW (1983) Analysis of Poly-beta- Hydroxybutyrate in Rhizobium japonicum Bacteroids by Ion-Exclusion High-Pressure Liquid Chromatography and UV Detection. App. Environ. Microbiol. 46: 1339-1344

Kunze M, Pracharoenwattana I, Smith SM, Hartig A (2006)A central role for the peroxisomal membrane in glyoxylate cycle function Biochimica et Biophysica Acta 1763:1441-1452.

Last BI, Brεttell RIS, Chambcrlaine DA, Chaudfiury AM, Larkin PJ, Marsh EL, Peacock WJ Dennis ES (1991) pEmu: an improved promoter for gene expression in cereal cells Theor Appl Genet 81, 581-588. Leonard JM, Knapp SJ, SIabaugh MB (1998) A Cuphea beta-ketoacyl-ACP synthase shifts the synthesis of fatty acids towards shorter chains in Arahidopsis seeds expressing Cuphea FatB thioesterases. Plant Journal 13: 621-628

Leonard JM, SIabaugh MB, Knapp SJ (1997) Cuphea wrightii thioesterases have unexpected broad specificities on saturated fatty acids Plant MoI.

Biol. 34: 669-679.

Lingard MJ, Monroe-Augustus M, Bartel B (2009) Peroxisome-associated matrix protein degradation in Arabidopsis. PNAS 106:4561-4566.

Lδssl A, Eibl C, Harloff HJ, Jung C, Koop HU (2003) Polyester synthesis in transplastomic tobacco (Nicotiana tabacum L.): significant contents of polyhydroxybutyrate are associated with growth reduction. Plant Cell Reports 21:891-899.

Lδssl A, Bohmert K, Harloff H, Eibl C, Miihlbauer S, Koop HU (2005) Inducible trans-activation of plastid transgenes: Expression of the R. eutropha phb operon in transplastomic tobacco. Plant and Cell Physiology.

46:1462-1471.

Matsumoto K, Arai Y, Nagao R, Murata T, Takase K, Nakashita H, Taguchi S, Shimada H, Doi Y (2006) Synthesis of short-chain-length/medium- chain-length polyhydroxyalkanoate (PHA) copolymers in peroxisome of the transgenic Arabidopsis thaliana harboring the PHA synthase gene from Pseudomonas sp 61-3. Journal of Polymers and the Environment 14: 369-374

Matsumoto K, Nagao R, Murata T, Arai Y, Kichise T, Nakashita H, Taguchi S, Shimada H, Doi Y. (2005) Enhancement of poly(3-hydroxybutyrate- co-3-hydroxyvalerate) production in the transgenic Arabidopsis thaliana by the in vitro evolved highly active mutants of polyhydroxyalkanoate (PHA) synthase from Aeromonas caviae. Biomacromolecules, 2005. 6(4): p. 2126-2130.

McQualter RB, Fong Chong B, Baker A, Meyer K, Van Dyk DE, O'Shea MG, Nicholas JW, Viitanen PV, Brumbley SM (2005) Initial evaluation of sugarcane as a production platform for p-hydroxybenzoic acid. Plant Biotechnology Journal 3: 29^41

Mittendorf V, Bongcam V, Allenbach L, Coullerez G, Martini N, Poirier Y

(1999) Polyhydroxyalkanoate synthesis in transgenic plants as a new tool to study carbon flow through beta-oxidation. Plant Journal 20: 45-55

Mittendorf V, Robertson EJ, Leech RM, Kruger N, Steinbuchel A, Poirier Y

(1998) Synthesis of medium-chain-length polyhydroxyalkanoates in Arabidopsis thaliana using intermediates of peroxisomal fatty acid beta- oxidation. Proceedings of the National Academy of Sciences of the United States of America 95: 13397-13402

Nakashita H, Arai Y, Yoshioka K, Fukui T, Doi Y, Usami R, Horikoshi K, Yamaguchi I (1999) Production of biodegradable polyester by a transgenic tobacco. Bioscience Biotechnology and Biochemistry 63: 870- 874 Nakashita H, Arai Y, Suzuki Y, Yamaguchi I (2001a) Molecular breeding of transgenic tobacco plants which accumulate polyhydroxyalkanoates. RIKEN Review. 42: p. 67-70.

Nakashita H, Arai Y, Shikanai T, Doi Y, Yamaguchi I, (2001b) Introduction of bacterial metabolism into higher plants by polycistronic transgene expression. Bioscience Biotechnology and Biochemistry 65:1688-1691. Nawrath C, Poirier Y, Somerville, C. (1994) Targeting of the

Polyhydroxybutyrate Biosynthetic-Pathway to the Plastids of Arabidopsis-

Thaliana Results in High-Levels of Polymer Accumulation. Proceedings of the National Academy of Sciences of the United States of America 91:12760-12764.

Noda I, Green PR, Satkowski MM, Schechtman LA (2005b) Preparation and properties of a novel class of polyhydroxyalkanoate copolymers. Biomacromolecules 6: 580-586

Nomura CT, Taguchi S (2007) PHA synthase engineering toward superbiocatalysts for custom-made biopolymers Appl Microbiol Bitechnol

72:969-979

Oeth P, Correll D, Jurinke C (2004) Multiplexed gene expression analysis using competitive PCR and MassARRAY™. In Sequenom Inc. Application

Note Peoples OP, Sinskey, AJ (1989a) Poly-beta-hydroxybutyrate biosynthesis in Alcaligenes-eutrophus Hl 6 - Characterization of the genes encoding beta- ketothiolase and acetoacetyl-Coa Rreductase. Journal of Biological Chemistry 264:15293-15297.

Peoples OP, Sinskey AJ (1989b) Poly-beta-hydroxybutyrate (PHB) Biosynthesis in Alcaligenes-eutrophus Hl 6 - Identification and Characterization of the

PHB polymerase gene (phbC). Journal of Biological Chemistry 264:15298-15303.

Petrasovits LA, Purnell MP, Nielsen LK, Brumbley SM (2007) Production of polyhydroxybutyrate in sugarcane. Plant Biotechnology Journal 5: 162- 172

Platta HW, Erdmann R (2007) Peroxisomal dynamics Trend Cell Biol 17:474- 484

Poirier, Y. (2002) Polyhydroxyalknoate synthesis in plants as a tool for biotechnology and basic studies of lipid metabolism. Progress in Lipid Research 41:131-155. Poirier Y, Dennis DE, Klomparens K, Somerville C (1992) Polyhydroxybutyrate, a Biodegradable Thermoplastic, Produced in Transgenic Plants. Science 256:520-523.

Poirier, Y., Nawrath, C. and Somerville, C. (1995a) Production of polyhydroxyalkanoates, a family of biodegradable plastics and elastomers, in bacteria and plants. Biotechnol. 13, 142-150.

Poirier Y, Somervϋle C, Schεehtman LA, Satkowski MM, Noda ϊ (1995b) Synthesis of high-molecular-weight poly([i?]-(-)-3-hydroxybutyrate) in transgenic Arabidopsis thaliana plant cells. International Journal of Biological Macromolecules 17: 7-12

Poirier Y, Ventre G, Caldelari D (1999) Increased flow of fatty acids toward beta-oxidation in developing seeds of Arabidopsis deficient in diacylglycerol acyltransferase activity or synthesizing medium-chain- length fatty acids. Plant Physiology 121: 1359-1366 Pracharoenwattana I, Smith SM (2008) When is a peroxisome not a peroxisome? Trends in Plant Science 13: 522-525

Purnell MP, Petrasovits LA, Nielsen LK, Brumbley, SM (2007) Spatio-temporal characterisation of polyhydroxybutyrate accumulation in sugarcane Plant Biotechnology Journal. 5:173-184. Relim BH (2003) Polyester synthases: natural catalysts for plastics Biochem J 376:15-33

Rehm BH, Antonio RV, Spiekemann P, Amara AA, Steinbϋchel A (2002)

Molecular characeterization of the poly(3-hydroxybutyrate)(PHB) synthase from Ralstonia eutropha: in vitro evolution, site specific mutagenesis and development of a PHB synthase protein model Biochim

Biophys Acta 1594:178-190.

Rehm BH, Steinbϋchel A (1999) Biochemical and genetic analysis of PHA synthases and other proteins required for PHA synthesis hitl J Biol Macromol 25:3-19 Sakai Y, Oku M, van der Klei IJ, Kiel JAKW (2006) Pexophagy: Autophagic degradation of peroxisomes Biochimica et Biophysica Acta - Molecular Cell Research 1763:1767-1775

Schubert P, Steinbϋchel A Schlegel HG (1988) Cloning of the Alcaligenes Eutrophus genes for synthesis of poly-beta-hydroxybutyric acid (PHB) and synthesis of PHB in Escherichia coli. Journal of Bacteriology 170:5837- 5847.

Slabaugh MB, Leonard JM and Knapp SJ (1998) Condensing enzymes from

Cuphea wrightii associated with medium chain fatty acid biosynthesis. Plant J. 13, 611-620.

Slater SC, Voige WH, Dennis DE (1988) Cloning and expression in Escherichia coli of the Alcaligenes eutrophus Hl 6 poly-beta-hydroxybutyrate biosynthetic-pathway. Journal of Bacteriology 170:4431-4436.

Somleva M N, Snell KD, Beaulieu JJ, Peoples OP, Garrison BR, Patterson NA (2008) Production of polyhydroxybutyrate in switchgrass, a value- added co-product in an important lignocellulosic biomass crop. Plant Biotechnology Journal 6:663-678.

Sparkes IA, Baker A (2002) Peroxisome biogenesis and protein import in plants, animals and yeasts: enigma and variations? (review). Molecular Membrane Biology 19: 171-185

Steinbϋchel A, Valentin HE (1995) Diversity of Bacterial Polyhydroxyalkanoic Acids. Ferns Microbiology Letters 128: 219-228

Taguchi S, Nakamura H, Hiraishi T, Yamato I, Doi Y (2002) In vitro evolution of a polyhydroxybutryate syntahase by intragenic suppression-type mutatenesis J Biochem (Tokoyo)131:801 -806

Takase K, Matsumoto K, Taguchi S, Doi Y (2004) Alteration of substrate chain-length specificity of type II synthase for polyhydroxyalkanoate biosynthesis by in vitro evolution: in vivo and in vitro enzyme assays. Biomacromolecules 5: 480-485 Tilbrook K, Gnanasambandam A, Schenk PM, Brumbley SM (2009) Efficient targeting of polyhydroxybutyrate (PHB) biosynthetic enzymes to plant peroxisomes requires more than three amino acids in carboxyl-terminal signal J. Plant Physiol (In press). van Beilen JB, Poirier Y (2008) Production of renewable polymers from crop plants. Plant Journal, 2008. 54(4): p. 684-701.

Vandesompεlε J, Dε Prctεr K, Pattyn F, Poppe B, Van Roy N, De Paεpε A, Speleman F (2002) Accurate normalization of real-time quantitative RT- PCR data by geometric averaging of multiple internal control genes. 3:1- 12.

Volokita M (1991) The carboxy-terminal end of glycolate oxidase directs a foreign protein into tobacco leaf peroxisomes. The Plant Journal 1: 361- 366

Wrobεl M, Zεbrowski J, Szopa J. (2004) Polyhydroxybutyrate synthesis in transgenic flax. Journal of Biotechnology 107:41-54.

Claims

1. A method of producing a genetically-modified crop plant capable of biosynthesis of a polyhydroxyalkanoate (PHA) polymer or copolymer, said method including the step of genetically modifying one or more crop plant cells or tissues to thereby produce a genetically-modified crop plant which expresses: (i) a peroxisomal-targeted PhaA; (ii) a peroxisomal-targeted PhaB; and (iii) a peroxisomal-targeted PhaC; and is thereby capable of biosynthesis of a PHA polymer or copolymer, wherein said PHA polymer or copolymer yields are selected from the group consisting of:

(a) at least 0.1% dry weight (DW) accumulated in leaves;

(d) at least 0.8% dry weight (DW) accumulated in leaves; and

(e) about l-2%dry weight (DW) accumulated in leaves.

2. The method of claim 1, wherein said PHA polymer is poly-3- hydroxybutyrate.

3. The method of claim 1, wherein monomer chain length of said PHA polymer is between three (3) and five (5) carbons.

4. The method of claim 1, wherein said peroxisomal-targeted PhaA, PhaB and PhaC are targeted with the peroxisome targeting sequence RAVARL (SEQ

ID NO:1) or a functional fragment thereof.

5. The method of any one of claims 1-4, wherein said PHA polymer or coplymer accumulates in vacuoles in said leaves.

6. The method of any one of Claims 1-5 wherein the crop plant is sugarcane.

7. The method of any one of Claims 1-6, wherein the PhaC is a type I PhaC.

8. The method of Claim 1, further comprising the step of genetically modifying said one or more crop plant cells or tissues to produce a genetically- modified crop plant which expresses

(iii) an acyl-ACP tliioesterase; and/or (iv) a 3-ketoacyl ACP synthase.

9. A method of producing a PHA polymer or coplymer in a crop plant, said method including the step of producing a genetically-modified crop plant which expresses: (i) a peroxisomal-targeted PhaA;

(ii) a peroxisomal targeted-PhaB; and

(iii) a peroxisomal-targeted PhaC; to thereby produce said PHA polymer in said crop plant, wherein said PHA polymer or copolymer yields are selected from the group consisting of: (a) at least 0.1% dry weight (DW) accumulated in leaves;

(b) at least 0.2% dry weight (DW) accumulated in leaves;

(c) at least 0.5% dry weight (DW) accumulated in leaves;

(d) at least 0.8% dry weight (DW) accumulated in leaves; and

(e) about 1-2% dry weight (DW) accumulated in leaves.

10. The method of claim 8, wherein chain length of monomers of said PHA polymer is three (3), four (4) or five (5) carbons.

11. The method of claim 10, wherein said PHA polymer is poly-3- hydroxybutyrate.

12. The method of claim 9, wherein said peroxisomal-targeted PhaA, PhaB and PhaC are targeted with the peroxisome targeting sequence RAVARL (SEQ

ID NO:1) or a functional fragment thereof.

13. The method of any one of claims 9-12, wherein said PHA polymer or copolymer is present in vacuoles of said leaves.

14. The method of any one of Claims 9-13, wherein the crop plant is sugarcane.

15. The method of any one of Claims 9- 14, wherein the PhaC is a type I PhaC.

16. The method of Claim 9, further comprising the step of genetically modifying said one or more crop plant cells or tissues to produce a genetically- modified crop plant which expresses (v) an acyl-ACP thioesterase; and/or

(vi) a 3-ketoacyl ACP synthase.

17. A genetically-modified crop plant capable of biosynthesis of a PHA polymer or copolymer in peroxisomes, wherein the PHA polymer yields are selected from the group consisting of:

(c) at least 0.5% dry weight (DW) accumulated in leaves;

(d) at least 0.8% dry weight (DW) accumulated in leaves; and

(e) about 1-2% dry weight (DW) accumulated in leaves.

18. The genetically modified crop plant of Claim 17 which comprises (i) a peroxisomal-targeted PhaA; (ii) a peroxisomal-targeted PhaB; and (iii) a peroxisomal-targeted PhaC; which facilitate biosynthesis of the PHA polymer.

19. The genetically-modified crop plant of claim 17 or claim 18, wherein chain length of monomers of said PHA polymer is three (3) four (4) or five (5) carbons.

20. The genetically-modified crop plant of claim 19, wherein said PHA polymer is poly-3-hydroxybutyrate.

21. The genetically-modified crop plant of any one of claims 17-19, wherein said peroxisomal-targeted PhaA, PhaB and PhaC are targeted with the peroxisome targeting sequence RAVARL (SEQ ID NO:1) or a functional fragment thereof.

22. The genetically-modified crop plant of any one of claims 17-21, wherein said PHA polymer or copolymer is present in vacuoles in said leaves.

23. The genetically-modified crop plant of Claim 18, which further expresses (vii) an acyl-ACP thioesterase; and/or (viii) a 3-ketoacyl ACP synthase.

24. The genetically-modified crop plant of any one of claims 17-23, which is sugarcane.

25. The genetically-modified crop plant of any one of Claims 17-24, wherein the PhaC is a type I PhaC.

26. A genetic construct for genetic modification of a crop plant, said genetic construct comprising:

(i) a nucleotide sequence encoding a PhaA, a PhaB and/or a PhaC; and

(ii) a nucleotide sequence encoding a peroxisome targeting sequence.

27. The genetic construct of claim 25, wherein said peroxisome targeting sequence is RAVARL (SEQ ID NO:1) or a functional fragment thereof.

28. A crop plant extract, comprising a PHA polymer or copolymer obtainable from a genetically-modified crop plant produced according to the method of any one of claims 1-16 or the genetically-modified crop plant of any one of claims 17- 25.

29. The crop plant extract of Claim 28, wherein chain length of PHA monomers is three (3), four (4) or five (5) carbons.

30. The crop plant extract of claim 29, wherein said PHA polymer is poly-3- hydroxybutyrate.

31. A substantially pure PHA polymer or copolymer obtainable from a genetically-modified crop plant produced according to the method of any one of claims 1-16 or the genetically-modified crop plant of any one of claims 17-25.

32. The substantially pure PHA polymer of Claim 31, wherein chain length of PHA monomers is three (3), four (4) or five (5) carbons.

33. The substantially pure PHA polymer of Claim 32, wherein said PHA polymer is poly-3 -hydroxybutyrate (PHB).

34. A method of producing a genetically-modified crop plant capable of biosynthesis of a polyhydroxyalkanoate (PHA) polymer or copolymer, said method including the step of genetically modifying one or more crop plant cells or tissues to thereby produce a genetically-modified crop plant which expresses: (i) a peroxisomal-targeted PhaA; (ii) a peroxisomal-targeted PhaB; (iii) a peroxisomal-targeted PhaC; (iv) an acyl-ACP thioesterase; and/or

(v) a 3-ketoacyl ACP synthase, and is thereby capable of biosynthesis of a PHA polymer or copolymer.

35. The method of claim 34, wherein the acyl-ACP thioesterase; and/or the 3- ketoacyl ACP synthase are plastid targeted.

36. The method of claim 34 or claim 35, wherein the genetically-modified crop plant is sugarcane.

37. A genetically-modified crop plant capable of biosynthesis of a polyhydroxyalkanoate (PHA) polymer or copolymer, which genetically-modified crop plant expresses: (i) a peroxisomal-targeted PhaA; (ii) a peroxisomal-targeted PhaB; (iii) a peroxisomal-targeted PhaC; (iv) an acyl-ACP thioesterase; and/or (v) a 3-ketoacyl ACP synthase.

38. The genetically-modified crop plant of claim 37, wherein the acyl-ACP thioesterase; and/or the 3-ketoacyl ACP synthase are plastid targeted.

39. The genetically-modified crop plant of claim 37 or claim 38, which is sugarcane.

40. The genetically-modified crop plant of claim 39, wherein PHA polymer or copolymer yields are selected from the group consisting of:

(a) at least 0.1% dry weight (DW) accumulated in leaves;

(b) at least 0.2% dry weight (DW) accumulated in leaves;

(c) at least 0.5% dry weight (DW) accumulated in leaves; (d) at least 0.8% dry weight (DW) accumulated in leaves; and

(e) about l-2%dry weight (DW) accumulated in leaves.

41. A crop plant extract, comprising a PHA polymer or copolymer obtainable from a genetically-modified crop plant produced according to the method of any one of claims 34-36 or the genetically-modified crop plant of any one of claims 37-40.

42. The crop plant extract of claim 41, wherein the PHA copolymer comprises MCL monomers of chain length between ten (10) and sixteen (16) carbons.

43. The crop plant extract of claim 41, wherein the PHA copolymer comprises MCL monomers of chain length between ten (10) and twelve (12) carbons.

44. A substantially pure PHA polymer or copolymer obtainable from a genetically-modified crop plant produced according to the method of any one of claims 34-36 or the genetically-modified crop plant of any one of claims 37-40.

45. The substantially pure PHA copolymer of Claim 44, wherein the PHA copolymer comprises MCL monomers of chain length between ten (10) and sixteen (16) carbons.

46. The substantially pure PHA copolymer of Claim 45, wherein the PHA copolymer comprises MCL monomers of chain length between ten (10) and twelve (12) carbons.