WO2010054530A1

WO2010054530A1 - Method for preparing genetically engineered n-terminal acetylated thymosin alpha 1

Info

Publication number: WO2010054530A1
Application number: PCT/CN2009/001167
Authority: WO
Inventors: 吴军; 刘波; 巩新; 唱韶红; 马清钧
Original assignee: 中国人民解放军军事医学科学院生物工程研究所
Priority date: 2008-11-13
Filing date: 2009-10-21
Publication date: 2010-05-20
Also published as: CN101736008B; CN101736008A

Abstract

Provided is a method for preparing genetically engineered N-terminal acetylated thymosin α1, which includes the following steps: 1) preparing precursor proteins or polypeptides comprising N-terminal acetylated thymosin α1 polypeptide sequence by use of genetically engineered Escherichia coli; and 2) cleaving precursor proteins or polypeptides comprising N-terminal acetylated thymosin α1 polypeptide sequence of step 1) by endopeptidase, then purifying the resulting mixture to obtain N-terminal acetylated thymosin α1.

Description

Method for preparing genetically engineered N-acetylated thymosin ct 1

The present invention relates to a method of preparing genetically engineered N-acetylated thymosin α 1 .

Background technique

Thymosin alpha is a family of immunomodulatory polypeptides having the same or similar Ν-terminal sequences, including thymosin alpha, thymosin alpha 1 and thymosin alpha 1 1 . Among them, thymosin α 1 and thymosin α 1 1 are products of degradation of thymosin α in vivo. The Ν-end of the natural source of thymosin α has a Ν-acetylation modification, and the Ν-acetylation modification plays an important role in the in vivo stability of thymosin α 1 . The chemically synthesized Ν-acetylated thymosin α 1 has been marketed, and the trade name is “Ri Daxian”, which is used for the treatment of viral hepatitis. However, the chemical synthesis of Ν-acetylated thymosin α 1 is costly and polluting, which limits the widespread use of the drug. The use of genetically engineered E. coli to prepare polypeptides has the advantages of low cost, good safety, and suitable for large-scale production, but the polypeptide produced by using Escherichia coli generally has no oxime-acetylation modification, so the thymosin prepared by the genetic engineering method has been reported so far. Alpha 1 is all non-acetylated. It has been found that genetically engineered Escherichia coli can produce Ν-acetylated thymosin α ( Wu J, Chang S, Gong X, Liu D, Ma. Q.

Identification of N-terminal acetylation of recombinant human prothymosin alpha in Escherichia coli. Biochim Biophys Acta. 2006; 1760(8): 1241 -7. ), and found that N-acetylated thymosin alpha is cleaved by hydroxylamine to obtain Ν- An analog of acetylated thymosin α 1 , but the C-terminus of the Ν-acetylated thymosin α 1 analog is hydroxylamine-modified, unlike the free carboxy terminal of the native Ν-acetylated thymosin α 1 , which Differently, when Ν-acetylated thymosin α 1 is used as a drug, it may cause problems such as immunogenicity and biological activity.

Because thymosin alpha originally promotes normal cell transformation and abnormal proliferation, it has potential tumorigenicity (Rodriguez P, Vinnuela JE. Overexpression of prothymosin a accelerates proliferation and retards differentiation in HL-60 cells. Biochem J, 1998, 33 1 : 753- 761. ), this tumorigenicity is mediated by the nuclear localization sequence of the thymosin alpha C-terminal (TKKQKTDEDD). After deletion or replacement of the C-terminal nuclear localization sequence, thymosin a is no longer It is tumorigenic (Freire J, Covelo G, Sarandeses C, et al. Identification of nuclear-import and cell-cycle regulatory proteins that bind to prothymosin alpha. Biochem Cell Biol, 2001, 79: 123- 3 1; Steven A, Enkemann, RH Wang. Functional Discontinuities in Prothymosin a Caused by Caspase Cleavage in Apoptotic Cells. Journal of Cellular Physiology, 2000 182:256-68).

Invention disclosure

It is an object of the present invention to provide a method of preparing genetically engineered N-acetylated thymosin α 1 .

The method for preparing Ν-acetylated thymosin α 1 provided by the invention comprises the following steps:

1) preparing a precursor protein or polypeptide comprising a Ν-acetylated thymosin α 1 polypeptide sequence using genetically engineered E. coli;

2) Endopeptidase cleaves the precursor egg of the guanidine-acetylated thymosin α 1 polypeptide sequence of the above step 1) White or polypeptide, purified to obtain N-acetylated thymosin α 1.

In the above method, the precursor protein or polypeptide containing the Ν-acetylated thymosin α 1 polypeptide sequence may be a fusion protein or polypeptide containing a Ν-acetylated thymosin α 1 polypeptide sequence, or may be ruthenium-acetylated. Thymosin alpha 1 sequence of thymosin alpha or its mutated body.

The precursor protein comprising the Ν-acetylated thymosin α 1 polypeptide sequence may specifically be a fusion protein of Ν-acetylated thymosin α 1 and glutathione transferase.

By maintaining the sequence of the Ν-acetylated thymosin α 1 unchanged, the expression of other moieties can be altered to enhance expression, facilitate purification, and reduce potential side effects of these proteins after entering the human body. For convenience

The expression and purification of Ν-acetylated thymosin α 1 can be fused to a polyhistidine tag (Hi s tag), Myc tag, HA tag on the above protein or polypeptide containing the Ν-acetylated thymosin α 1 polypeptide sequence. , glutathione transferase (GST) or maltose binding protein (MBP). The coding sequences of these tag sequences can be prepared synthetically or obtained from commercial vectors, the coding sequences of these tag sequences and the coding sequences of the above-mentioned proteins or polypeptides containing the N-acetylated thymosin α 1 polypeptide sequence. It can be ligated using conventional molecular biological methods, such as ligase ligation or PCR methods.

In the above method, the thymosin alpha protuberance containing the Ν-acetylated thymosin α 1 sequence is a polypeptide which at least satisfies one of the following conditions:

1) deleting the amino acid residue of the sequence 3 from the amino terminus at positions 100-109 in the sequence listing;

2) replacing at least one amino acid residue of the 10 amino acid residues from the amino terminal at positions 100-109 of the sequence 3 in the sequence listing;

3) replacing the 36th and 43rd positions of the amino acid terminus of the sequence 3 in the sequence table from glycine to alanine;

4) replacing or deleting at least one of the 5 positions of Asn from the amino terminal at the 35th, 37th, 39th, 42nd, and 49th positions of the amino terminal;

5) deleting amino acid residues at position 32-52 from the amino terminus of sequence 3 in the sequence listing;

6) deleting the amino acid residues at position amino acids 69-109 of SEQ ID NO: 3 in the sequence listing;

7) deleting the amino acid residues at position 35-79 of the amino terminus of SEQ ID NO: 3 in the sequence listing, and replacing the 31st position from the amino terminus of sequence 3 in the sequence table from aspartic acid to a basic amino acid;

The basic amino acid is lysine or arginine.

The above N-acetylated thymosin alpha variant is one of the following polypeptides:

1) is a polypeptide obtained by deleting amino acid residues 100 to 109 from the amino terminus of SEQ ID NO: 3, and the amino acid sequence thereof is shown in SEQ ID NO: 4 in the Sequence Listing;

2) a polypeptide obtained by substituting at least one amino acid residue of the 10 amino acid residues from the amino acid at positions 100 to 109 of the sequence 3 in the sequence listing;

3) is a polypeptide obtained by replacing the 36th and 43rd positions of the amino terminus of the sequence 3 from glycine with alanine, and the amino acid sequence thereof is shown in the sequence 5 in the sequence listing;

4) is a polypeptide obtained by replacing or deleting at least one of the 5 positions of Asn from the amino terminal 35th, 37th, 39th, 42nd, and 49th positions of the amino acid sequence in the sequence table; 5) is a polypeptide obtained by deleting the amino acid residue at position 32-52 of the amino terminus of SEQ ID NO: 3 in the sequence listing;

6) is a polypeptide obtained by deleting the amino acid residue at position amino acid positions 69 to 109 of SEQ ID NO: 3 in the sequence listing, the amino acid sequence of which is shown in SEQ ID NO: 9 in the Sequence Listing;

7) is obtained by deleting amino acid residues 35 to 79 from the amino terminus of sequence 3 in the sequence listing, and replacing the amino acid terminus 31 of the sequence 3 from aspartic acid to a basic amino acid. Polypeptide

The basic amino acid is lysine or arginine.

In the above method, the N-acetylated thymosin α 1 means a polypeptide having at least one immunomodulatory function identical or similar to that of the natural or chemically synthesized purine-acetylated thymosin α 1 , and the sequence is homologous thereto. The sequences of Ν-acetylated thymosin α 1 from different mammals are slightly different, and even human thymosin α 1 has a certain sequence polymorphism, such as most human thymosin α 1 has a sequence listing. The amino acid sequence of Sequence 1 (Goodal l, GJ, Dominguez, F., and Horecker, BL Molecular cloning of cDNA for human prothymosin. Proc Natl Acad Sci

USA. (1986), 83 : 8926-8928. ), but the 13th threonine of the thymosin a 1 is replaced by isoleucine (Rubtsov IuP, Vartapetian AB. New intronless members of human prothymosin alpha genes (1995) Mol Biol (Mosk) 29 (6): 1320-5), ie the amino acid sequence of SEQ ID NO: 2 in the Sequence Listing. However, these sequences differ slightly in that thymosin α 1 has the same or similar immunomodulatory function. The thymosin α 1 includes these thymosin α 1, preferably a polypeptide having 90% or more homology with SEQ ID NO: 1 or SEQ ID NO: 2 in the sequence listing, and more preferably 95% with SEQ ID NO: 1 or SEQ ID NO: 2 in the Sequence Listing. The above homologous polypeptide may specifically be the polypeptide of SEQ ID NO: 1 or SEQ ID NO: 2.

The amino acid sequence of the above Ν-acetylated thymosin α original or a variant thereof is shown in the sequence 3-9, and the nucleotide sequence of the coding gene is shown in the sequence 10-18 of the sequence listing.

These variants have the following advantages:

1) The amino acid residue at position 100-109 from the amino terminus of SEQ ID NO: 3 is the C-terminal nuclear localization sequence of thymosin alpha. Since thymosin alpha has a role in promoting normal cell transformation and abnormal proliferation, it has potential carcinogenicity. This cytogenetic dysplasia is caused by nuclear localization mediated by the thymosin alpha C-terminal nuclear localization sequence, and the thymosin alpha originally removed or altered from the C-terminal nuclear localization sequence is no longer tumorigenic, and Does not affect the preparation of Ν-acetylated thymosin α 1 , so even if there is a trace amount of thymosin α in the final Ν-acetylated thymosin α 1 preparation, there is no safety hazard, thus significantly improving the product of the method of the present invention. Clinical applicability.

2) In addition to the asparagine (Ν28) site at position 28, there are multiple asparagine sites such as Ν35, Ν37, Ν39, Ν42 and Ν49, which can be used by the thymosin alpha pro-sequence. The asparagine endopeptidase cleaves, so the cleavage product is complicated and difficult to purify. The present invention provides mutations or deletions at these positions (such as deletion of amino acid residues 32 to 52 from the amino terminus of SEQ ID NO: 3 in the sequence listing or amino acid positions 35-79 of SEQ ID NO: 3 in the sequence listing The method of preparing sputum-acetylated thymosin α 胸 from the thymosin α original of the deletion of the residue, etc., significantly reduces the complexity of the cleavage product and facilitates purification. And the lack of amino acid residues Loss reduces the molecular weight of the thymosin alpha variant and increases the ratio of Ν-acetylated thymosin alpha 1 contained therein; the basis of amino acid residues 35 to 79 from the amino terminus of sequence 3 in the deleted sequence listing In the sequence, the Asp of the amino acid at position 31 of the sequence 3 was replaced with a basic amino acid, and the isoelectricity of the polypeptide other than N-acetylated thymosin _α 1 in the N-acetylated thymosin _α variant was improved. This facilitates the separation of this portion of the polypeptide from the Ν-acetylated thymosin α 1 in the product at the time of cleavage.

3) G36A and G43A mutations can increase the expression level of thymosin α, thereby increasing the production efficiency of Ν-acetylated thymosin α 1 .

4) Remove the sequence of the non-thymosin α 1 part of the partial thymosin α, and increase the ratio of Ν-acetylated thymosin α 1 in the expressed protein or polypeptide (such as the amino terminal of sequence 3 in the sequence listing) Deletion of amino acid residues after 69).

The gene encoding the above-described Ν-acetylated thymosin α or its variant can be obtained by PCR, RT-PCR, artificial synthesis or construction of a cDNA library, and the PCR template and the mRNA or cDNA used for constructing the cDNA library can be derived. Any tissue, cell or library containing the corresponding mRNA or cDNA, such as obtained from the human embryonic thymus; can also be obtained by artificial synthesis, and the host-preferred codon can be used for artificial synthesis, which can improve the expression of the product. The polynucleotide may be mutated, deleted, inserted or ligated with other polynucleotides by an existing PCR, restriction enzyme ligation or the like.

In the method for producing N-acetylated thymosin α 1 of the present invention, the Ν-acetylated thymosin α original or a variant thereof is a gene encoding a gene encoding Ν-acetylated thymosin α or a variant thereof A recombinant expression vector is constructed in the vector, and the constructed recombinant expression vector is transferred into a host cell for expression; the expression vector may have a replication site, a selection marker, etc., and specifically may be a ρΕΤ series, a PBV220 vector, or the like. The expression vector may also carry various inducible or constitutive promoters, specifically an inducible promoter, which is advantageous for improving the stability of recombinant Escherichia coli. The inducible promoter may specifically be a chemically-induced promoter such as T7, Lac, Tac, Trp, etc. and a temperature-sensitive promoter such as PJV3⁄4 mover. The host cell is a mammalian cell or a prokaryotic cell, and specifically may be an Escherichia coli cell such as DH5a, BL21 (DE3) or the like. Recombinant E. coli cells have the advantages of rapid growth, low culture cost, easy mass production, and successful use in the production of a large number of recombinant pharmaceutical proteins, and thus have obvious advantages in industrial production. The above recombinant bacteria can be cultured in a shake flask or a bioreactor, and a bioreactor can be specifically used in the production; the medium should provide various nutrients required for cell growth and product expression, including nitrogen source, carbon source, and PH. Buffering ingredients, etc. The culture of the recombinant bacteria is divided into two stages, the first stage is mainly used for the growth of the bacteria, and the second stage is mainly used for the synthesis of the product. The method for isolating a protein or polypeptide containing the N-acetylated thymosin α 1 polypeptide sequence from the culture can be carried out by various protein separation methods such as sterilizing, extraction, precipitation, ultrafiltration, liquid chromatography, and the like. A combination of technologies. Liquid chromatography can be performed by ion exchange, gel exclusion, affinity, hydrophobic, and anti-equal layering techniques.

In the method for preparing genetically engineered Ν-acetylated thymosin α 1 provided by the present invention, the endopeptidase is an asparaginase, specifically a human asparagine endopeptidase.

Asparagine endopeptidase is a class of endopeptidases widely found in the biological world. It is also known as legumain or VPE (vacuolar processing enzyme), which specifically cleaves the asparagine C in a polypeptide or protein. End, found in plants and animals, Abe, Y (JBC1993, 3525-3529) reported from the beans

(. cana valia ensiformis) Method for extracting asparagine endopeptidase from seeds and nucleotide and amino acid sequences of concanavalin asparaginase (GenBank L05515).

Dal ton, JP (Paras i to logy, 1995, 1 1 1: 575-580) and others reported Schistosoma mansoni

(as Schis tosoma mansoni) The asparagine endopeptidase, chen JM (JBC 1997, 272: 8090-8098) reports human asparaginase. The coding sequence of the asparagine endopeptidase of each species and its corresponding amino acid sequence can be directly obtained from the published gene or protein database of GenBank of the National Institutes of Health or European EMBL (in human, mouse, and in GenBank). The asparagine endopeptidase gene numbers of the rats were NM_005606, 匪_01 1 175, NM-022226, respectively. Alternatively, the asparagine endopeptidase sequence of a species such as human, Schistosoma mansoni, and concanavalin is obtained by homologous alignment in the above database. The asparaginase endopeptidase can be genetically engineered or extracted from various species, preferably by genetic engineering methods, including preparation with genetically engineered yeast, insect cells, E. coli or mammalian cells, and the like. Among them, the preparation of asparagine endopeptidase by genetically engineered yeast has the advantages of high expression level, protein solubility, no need for renaturation, low preparation cost, and suitable for scale production. The asparaginase endopeptidase can be prepared in the form of a zymogen to improve its stability during expression and preparation, and is self-activated by adjusting the pH to acidity of the solution before use. In order to improve enzyme activity, expression, stability and facilitate enzyme purification, asparagine endopeptidase can also be modified, deleted and fused.

The N-terminally acetylated modified thymosin α 1 produced by the present invention may also have various derivatives, and these derivatives may be, but are not limited to, salts or modified products of different forms thereof. The modifying agent may be, but not limited to, polyethylene glycol, dextran or a derivative thereof and the like.

The Ν-terminal acetylated modified thymosin α 1 prepared by the present invention can be used for the preparation of a medicament for treating and/or preventing various infectious diseases and tumors, such as treating and/or preventing viral hepatitis, influenza or liver cancer.

The method for preparing genetically engineered Ν-acetylated thymosin α 1 of the invention has the advantages of low cost and suitable for scale production, and the prepared genetically engineered Ν-acetylated thymosin α 1 has broad clinical application prospects. DRAWINGS

Figure 1 shows the results of SDS-PAGE analysis of crude Ν-acetylated thymosin α crude product.

Figure 2 shows the results of RP-HPLC analysis of crude Ν-acetylated thymosin α crude product.

Figure 3 is a human asparagine endopeptidase activation assay.

Figure 4 is an analysis of the effect of human asparagine endopeptidase on thymosin alpha cleavage.

Figure 5 is a chromatogram of the purification of Ν-acetylated thymosin α 1 .

Figure 6 shows the RP-HPLC analysis of Ν-acetylated thymosin α 1 .

Figure 7 is a mass spectrometric molecular weight analysis of Ν-acetylated thymosin α 1 prepared by the method of the present invention. Figure 8 is an engineering strain of a natural gene and a synthetic gene expressing a C-terminal deletion or a G36A and G43A replacement thymosin α original variant. SDS-PAGE analysis.

Figure 9 is an SDS-PAGE analysis of an engineered strain of a thymosin alpha variant that was replaced with G36A and G43A replaced by a deletion or truncation of the amino-terminal 32-52 segment by an artificial synthetic gene.

Figure 10 is a Ν-acetylated thymosin α 1 prepared from the de l 53/G68 thymosin α variant. Purified chromatogram.

Figure 11 is a RP-HPLC analysis of Ν-acetylated thymosin α 1 prepared from del53/G68 thymosin α variant.

Figure 12 is a mass spectrometric analysis of the molecular weight of the genetically engineered Ν-acetylated thymosin α 1 prepared by the method of the present invention.

Figure 13 is a mass spectrometric analysis of the genetically engineered Ν-acetylated thymosin α 1 amino acid sequence prepared by the method of the present invention.

The best way to implement the invention

The present invention is further described in conjunction with the specific embodiments, which are not intended to limit the invention. The embodiments of the present invention are not limited thereto according to the prior art known in the art, and therefore equivalent in the field according to the disclosure of the present invention. Substitutes are all within the scope of protection of the present invention.

Example 1. Preparation of Ν-acetylated thymosin α original Ν-acetylated thymosin α 1

The pfu enzyme, endonuclease, ligase, and kit in the experiment were purchased from Shanghai Shenggong Bioengineering Technology Service Co., Ltd. and Beijing Bodatek Biogene Technology Co., Ltd.

1. Construction of genetically engineered bacteria expressing N-acetylated thymosin alpha

Taking the aborted human fetal thymus, using the total RNA preparation kit, preparing total RNA according to the method provided by the kit; using RT-PCR kit, reverse transcription of mRNA into cDNA according to the method provided by the kit; using the cDNA as a template, The cDNA of thymosin was PCR-amplified with Protl : 5 ' -CCCATATGTCTGATGCAGCTGTAGATACC-3 ' Wo P Prot2 : 5, - CGGGATCCCTAGTCATCCACGTCGGTCTTCTG-3 ' as a primer. ΙμΙ cDNA was added to the ΙΟΟμΙ reaction system, and the Protl and Prot2 primers of 20μπιο1/1 were each 3μ1.

2mmol/L dNTP 10ul, 10X reaction buffer lOul, pfu DNA polymerase 5U. Using Perk-Elmer's 9600 PCR machine, the PCR conditions were: denaturation at 94 °C for 1 minute, then annealing at 52 °C for 30 seconds, and finally extension at 72 °C for 1 minute for 35 cycles. The PCR product was purified and recovered, and then digested with Ndel and BamH I. The digested product was ligated with the similarly cut vector PET22b (purchased from Novagen), and the ligated product was transformed into E. coli BL21 (DE3) competent cells. Positive clones were screened from LB plates containing ampicillin from Beijing Boda Tektronix Biogene Technology Co., Ltd. The positive clones were digested and sequenced, and the sequencing results showed that the amplified thymosin gene and the natural human thymosin alpha (the deoxyribonucleotide nucleic acid sequence is shown in sequence 10 in the sequence listing, the encoded amino acid residues The sequence of the base sequence is as shown in SEQ ID NO: 3 in the Sequence Listing. The resulting recombinant plasmid was named pET-NproT, and the resulting positive clone was named BL21 (DE3) (pET-NproT).

Single colonies of BL21 (DE3) (pET-NproT) were inoculated into 100 ml of LB liquid medium, incubated at 37 ° C overnight, and then transferred to 3 L medium (yeast extract 10 g / L, tryptone 10 g / L, sodium dihydrogen phosphate 20 mM, disodium hydrogen phosphate 30 mM, glucose 10 g / L) B5 fermentor (purchased from Berenger, Germany), cultured at 37 ° C, controlled dissolved oxygen greater than 20% by stirring and aeration. After 4 hours of culture, 3 ml of 0.2 mol/L IPTG was added for induction, and the culture was continued for 4-8 hours. The fermentation broth was centrifuged to collect the cells.

The collected cells were resuspended in water (10 ml of water per gram of bacteria), the walls were sonicated, and the supernatant was collected by centrifugation. The supernatant was added to the supernatant to adjust the pH to 4.5, and allowed to stand for 30 minutes. The supernatant was collected by centrifugation. , that is A crude extract containing N-acetylated thymosin alpha. The crude extract was purified by DEAE FF 2. 5X 30 cm column (media purchased from GE Corporation, USA, and empty column purchased from Huamei Experimental Instrument Factory). The specific conditions are: liquid A (20 mM sodium acetate and acetic acid buffer, pH 4.5), liquid B (A liquid + 1 M NaCl), DEAE FF column is first equilibrated with liquid A, and then the above contains N- from the A channel. The crude extract of acetylated thymosin alpha is loaded onto the DEAE FF column, and the unbound protein is washed away with solution A, and finally at 0 → 30 minutes: A from 100% → 0%; B from 0% → 100 % linear gradient elution, fractionate collection of eluent. The collected fractions of the eluate were sampled for SDS-PAGE analysis, and the eluate containing 12KDa thymosin alpha (30% _60% 洗脱 eluent) was combined to obtain Ν-acetylated thymosin alpha. The crude product was sampled for SDS-PAGE and RP-HPLC analysis, and the results are shown in Figures 1 and 2. Figure 1 shows the results of SDS-PAGE, in which 1 is a crude product of N-acetylated thymosin alpha and 2 is a molecular weight standard. RP-HPLC analysis using HP1090 high pressure liquid chromatography, C18 column (4.6 X 250mm, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, A liquid is 0.1% TFA (volume percent) of pure water; B liquid is containing 0. 1% TFA (volume percent) of chromatographically pure acetonitrile, gradient elution: 0 min, A solution 100%, B solution 0%; → 30 min, A solution 10%, B solution 90%), RP-HPLC results as shown in picture 2. Among them, the A peak is non-acetylated thymosin α, and the peak is Ν-acetylated thymosin α (Wu J, Chang S, Gong X, Liu D, Ma II. Identification of N-terminal acetylation of recombinant human Prothymosin alpha in Escherichia col i. Biochim Biophys Acta. 2006 ; 1760 (8) : 1241-7. As a result, it was revealed that more than 70% of the crude thymosin α crude product obtained above was Ν-acetylated thymosin α.

2. Preparation of asparagine endopeptidase

The human hepatoma cell HepG2 (purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences) was used to prepare total RNA using the total RNA preparation kit, and the mRNA was reverse-transcribed into a RT-PCR kit according to the method provided in the kit. cDNA, using the cDNA as a template, and legl: 5 '-AGAGTCGACAAAAGAGTTCCTATAGATGATCCTGAAG-3, and leg2: 5, -TATGTCGACGCGGCCGCTTAGTAGTGACCAAGGCACACGTG-3, PCR-amplified the cDNA of human asparagine endopeptidase gene. The 50 μl reaction system was added with Ιμΐ cDNA, 20 μπιο1/1 legl, leg2 primers each Ιμΐ, 2. 5 mmol/L dNTP 4 ul, 10X reaction buffer 5 ul, pfu DNA polymerase 5 U. Using a 9600 PCR machine from Perk-Elmer, the PCR conditions were: denaturation at 94 ° C for 1 minute, then annealing at 52 ° C for 30 seconds, and finally extension at 72 ° C for 2 minutes for 35 cycles. The PCR product was purified and recovered, and then digested with Xhol and Not I. The digested product was ligated with the same digested vector PPIC9 (purchased from Invitrogen), and the ligated product was transformed into E. coli BL21 (DE3) competent cells. Ampicillin was used to screen for resistant colonies, and the positive clone extraction plasmid was sequenced. The plasmid whose result of sequencing was identical to the nucleotide sequence of the human asparagine endopeptidase gene (sequence 19 in the sequence listing) was transformed into Pichia pastoris GS115 (purchased from Invitrogen) using MD medium (1. 34 % YNB). (mass percentage), 4 X 10 - ⁵ % biotin (mass percentage), 2 % glucose (mass percentage), 1. 5 % agar (mass percentage)) plate for screening; then The transformants were transferred to YPD medium (1% yeast extract (mass percentage), 2% peptone (mass percentage), 2% glucose (mass percentage)), cultured at 30 ° C for 24 h at 250 rpm. Then inoculated with 25% BMGY (1% yeast extract (mass percentage) with 4% (volume percent) inoculum Content), 2% peptone (mass percentage), 1% glycerol (mass percentage), 1. 34% YNB (mass percentage), 4 X 10 - ⁵ % biotin (mass percentage), lOOmMpB, pH6. 0) In the medium, cultured at 30 ° C, 250 rpm for 24 h, then added methanol to the medium, so that the volume percentage in the medium reached 0. 05%, adaptive induction; 12h later The methanol content in the medium was raised to 0.5% to induce, and then 5 ml of methanol was added per liter of the medium every 12 hours; after 72 hours of induction, the supernatant was centrifuged, and the expression was compared by SDS-PAGE electrophoresis. High clones serve as genetically engineered yeast for the preparation of human asparagine endopeptidase.

The monoclonal of the above genetically engineered yeast was inoculated into 5 ml of YPD medium and cultured at 30 ° C for 250 h at 25 ° C; then inoculated in 200 mL of YPD medium with 2% inoculum, cultured at 30 ° C and 250 rpm for 24 h _; The inoculation amount is inoculated in 4 L of BMGY medium, and cultured at 30 ° C, 250 rpm for 24 hours; finally, methanol is added to the medium, and the volume percentage in the medium is 0.5%, and induction is performed; After 5 h of liters of medium, 5 ml of methanol was added; after 72 h of induction, the supernatant was centrifuged, and the pH was adjusted to 5.5 with glacial acetic acid, and SP FF 5. 0X30 cm column was used (medium was purchased from GE Corporation of the United States, and the empty column was purchased from Huamei The experimental instrument factory was purchased from GE Company) and purified. The specific conditions are as follows: A solution (20 mM sodium acetate and acetic acid buffer, pH 5. 0), B solution (A solution + 1 M NaCl), 2 L each, SP FF column is first equilibrated with solution A, and then the above is from A channel. The culture supernatant containing human asparagine endopeptidase was loaded onto the SP FF column, and the unbound protein was washed away with the A solution, and finally at 0 → 30 minutes: A from 100% → 0%; B from 0 %→100% linear gradient elution, collecting the main peak of UV absorption (50-70% B) is human asparagine endopeptidase. The above collected concentration of human lutein endopeptidase 1 ml of lmg / ml, added 0. lml lmol / L pH4. 5 sodium citrate solution, Ιμ ΐ lmol / L DTT, 37 ° C incubation, SDS-PAGE analysis was performed at 0.25, 1 and 2 hours, respectively, and the results are shown in Fig. 3. Among them, human asparagine endopeptidase consists of 416 amino acids, has 4 N-glycosylation sites, molecular weight of about 56KDa; and activated human asparagine endopeptidase consists of 298 amino acids, molecular weight is about 46KDa. The results showed that with the increase of incubation time, the human asparagine endopeptidase of 56KDa gradually decreased, the human asparagine endopeptidase of 46KDa gradually increased, and the human asparagine endopeptidase was basically converted into activity after 2 hours. Form of human asparagine endopeptidase.

3. Preparation of N-acetylated thymosin α 1 by N-acetylated thymosin α

The above-mentioned step 2 of the activation of 2 hours of 1 ml of human asparagine endopeptidase was added to 50 ml of the above-mentioned step 1 Ν-acetylated thymosin α crude product solution, plus 5 ml lmol / L pH4. 5 sodium citrate and 50 μl lmol/L DTT, incubated N-acetylated thymosin α at 37 ° C, and samples were taken at 0.25, 1 and 4 hours for SDS-PAGE analysis. The results are shown in Fig. 4. Among them, 1, 2, and 3 were samples of incubation for 0.25, 1 and 4 hours, respectively, and Μ was the molecular weight standard. The remaining samples were incubated overnight. The results showed that as the incubation time increased, the Ν-acetylated thymosin α was gradually reduced, and Ν-acetylated thymosin α 1 was produced.

4. Purification and identification of Ν-acetylated thymosin α 1

The 1% by volume of the liquid was added to the solution of the solution of the above-mentioned step 3, which was subjected to the asparagine endopeptidase digestion, and was purified by a column of 8 Φ 2. 0X20 cm (purchased from the Dalian Institute of Chemical Physics). TFA, B solution is 50% by volume of acetonitrile + 0.1% by volume of aqueous solution of TFA. First, equilibrate with solution A, then load at a flow rate of 5 ml/min. After the sample is completed, equilibrate with solution A, and then perform linear gradient elution. The procedure is 0→5 minutes: A solution is from 100% to 70%. B liquid from 0% → 30%; 5 → 20 minutes: A liquid from 70% → 40%, B liquid from 30% → 60%. UV detection at 214 nm, the chromatogram is shown in Figure 5. 40-45% of the B component was collected as the prepared N-acetylated thymosin α 1.

C18 Φ 4. 6X250mm column (purchased from Dalian Institute of Chemical Physics), liquid A (water + 0.1% by volume of trifluoroacetic acid), solution B (acetonitrile + 0.1% by volume of trifluoroacetic acid) ). HP1090 chromatograph, gradient elution: 0→5min, B solution: 0%→15%, A solution 100%→85%; 5→20min, B solution 15%→ 30%, A solution 85%→70%; 20 →25min, B liquid 30%→100%, A liquid 70%→0%; 25→26min, B liquid 100%. The reference product is chemically synthesized N-acetylated thymosin α 1 (trade name Zadaxin, purchased from Jiefangjun 302 Hospital) at a concentration of 160 g/ml, and the loading is 10 ul.

The result is shown in Figure 6. Among them, A is a chromatogram of N-acetylated thymosin α 1 reference product with a retention time of 15.4 minutes, and Β is the purified Ν-acetylated thymosin α 1 in the above step 3. The retention time on HPLC was also 15.4 minutes, indicating that the purified N-acetylated thymosin α 1, and the component was a uniform single peak (the peak before 5 minutes was the salt and acetic acid in the purified component). Absorption peak). Further, the ruthenium solution was mixed at a volume ratio of 1:1 and analyzed by HPLC. As a result, it was found to be a uniform single peak (C), indicating that the two were the same substance.

The N-acetylated thymosin α 1 prepared in the above step 3 was sequenced by Edman degradation method, and the degraded amino acid peak was not detected, indicating that the N-terminus of the sample had been modified. The mass spectrometry molecular mass of N-acetylated thymosin α 制备 prepared in the above step 3 was measured (analysis by the National Center for Biomedical Analysis), and the results are shown in Fig. 7. The results showed that the molecular weight was 3107.66, which was consistent with the theoretical molecular weight of Ν-acetylated thymosin α 1 of 3107.33 (the difference was less than the instrument error IDa), which was 42 Da larger than the theoretical molecular weight of non-acetylated thymosin α 1 of 3065 Da (acetyl group). Modified molecular weight). It was shown that the above step 3 was prepared as N-acetylated thymosin α 1 .

Example 2. Preparation of Ν-acetylated thymosin a l (I lel3) (sequence 2 in the sequence listing)

The recombinant plasmid pET-NproT constructed in the above Example 1 was used as a template, and Prot3: 5 ' - cccatatgtctgatgcagctgtagataccagctccgaaatcaccatcaaggactta-3 ' and Prot2 were used as primers for PCR amplification, and the amino acid residues encoded by the obtained deoxyribonucleotide sequence were Thymosin alpha from the amino acid at position 13 of the amino terminal isoleucine, the gene is named

NproT (I lel3).

In the same manner as in the above Example 1, NproT (Ilel3) was inserted between the Ndel and BamHI restriction sites of the vector PET22b to obtain the recombinant plasmid pET_NproT (I lel3); and the recombinant plasmid pET-NproT (I lel3) was transferred. Into E. coli BL21 (DE3) competent cells, recombinant E. coli BL21 (DE3) (pET-NproT (I lel3) ) was obtained by the same screening method as in the above Example 1.

BL2KDE3) (pET-NproT (Ilel3)), expressed as N-acetylated thymosin α originally derived from the 13th position of the amino terminal isoleucine.

The obtained guanidine-acetylated thymosin α from the amino terminal position 13 is isoleucine was digested with the asparagine endopeptidase prepared in the second step of the above Example 1, and purified to obtain Ν-acetylated thymosin. α 1 ( I lel3 ). The specific method is the same as in the first embodiment.

Example 3: Expression of a C-terminal deletion with a native gene and a synthetic gene and/or a thymosin alpha pro-reform from the amino terminus at position 36, replaced by G to A, and from position 43 of the amino terminus, replaced by G to A, preparation N-acetylated thymosin alpha 1

1. Construction of engineered bacteria expressing C-terminal deletion of thymosin α original variant

Using the recombinant plasmid pET-NproT constructed in the above Example 1 as a template, Prot l and Prot4: 5 '-gtggatccttaATCGACATCGTCATCCTCATC-3 ' were used as primers, and the gene for the C-terminal deletion of the thymosin α provariant was obtained by PCR amplification (NproT). -C), whose deoxyribonucleotide sequence is as shown in SEQ ID NO: 11 in the Sequence Listing, and the encoded amino acid sequence is shown in SEQ ID NO: 4 in the Sequence Listing.

The NproT-C was inserted into the BamHI and Ndel restriction sites of the vector PET22b in the same manner as in the above Example 1, to obtain the recombinant plasmid pET-NproT-C; and the recombinant plasmid pET-NproT-C was transferred into Escherichia coli BL21. (DE3) Competent cells, recombinant Escherichia coli BL21 (DE3) (pET-NproT-C) was obtained by the same screening method as in the above Example 1.

2. Construction of engineered bacteria expressing G36A and G43A substitutions (the thymosin α original variant of thymosin α from the amino terminal 36th and 43rd glycine (G) replaced by alanine (Α))

The recombinant plasmid pET-NproT constructed in the above Example 1 was used as a template, and a nucleic acid fragment of about 150 bp containing the coding sequences of G36A and G43A was amplified by PCR using Prot l and Prot 5 : 5 ' -ATTGTCAGCCTCCTGCTCagcATTTTCCTCATTAGCATTagcGTTAGCAGGGGCGTCTCT-3 ' as primers; The nucleic acid fragment is megprimer, using Prot2 as a reverse primer, and pET-NproT as a template, PCR amplification of the thymosin alpha pro-variant gene (NproT G36A, G43A) containing G36A and G43A replacement, and its deoxyribonucleotide sequence As shown in SEQ ID NO: 12 in the Sequence Listing, the encoded amino acid sequence is shown in SEQ ID NO: 5 in the Sequence Listing.

NproT G36A, G43A were inserted into the carrier PET22b in the same manner as in the above Example 1.

The recombinant plasmid pET-NproT G36A, G43A was obtained between the Ndel and BamHI restriction sites; the recombinant plasmids pET-NproT G36A, G43A were transferred into E. coli BL21 (DE3) competent cells, and the same screening as in the above Example 1 was used. Methods Recombinant Escherichia coli BL21 (DE3) (pET-NproT G36A, G43A) was obtained.

3. Construction of engineered bacteria expressing C-terminal deletion and G36A and G43A replacement of thymosin α original variant. Using pET-NproTG36A and G43A obtained in the above step 2 as a template, Prot l and Prot4 were used as primers, and PCR amplification of G36A. The thymosin alpha pro-variant gene (NproT G36A, G43A-C), which is replaced with G43A and deleted at the C-terminus, has a deoxyribonucleotide sequence as shown in SEQ ID NO: 13 in the sequence listing, and the encoded amino acid sequence is in the sequence listing. Sequence 6 is shown.

NproT G36A, G43A-C was inserted into the Ndel and BamHI restriction sites of the vector PET22b in the same manner as in the above Example 1, to obtain the recombinant plasmids pET-NproT G36A, G43A-C; and the recombinant plasmid pET-NproT G36A G43A-C was transferred into E. coli BL21 (DE3) competent cells, and recombinant Escherichia coli BL21 (DE3) (pET-NproT G36A, G43A-C) was obtained by the same screening method as in the above Example 1.

4. Construction of an engineered strain of a thymosin α original variant replaced by a synthetic gene expression G36A and G43A

According to the E. coli preference code, optimize the secondary structure of mRNA, reduce the hairpin structure, and design the DNA sequence encoding the G36A and G43A replacement thymosin alpha variant (sequence 14 in the sequence listing). For To synthesize this gene, we used a method of segmentation synthesis and PCR splicing. That is, the DNA forward fragment of sequence 3 was first synthesized, each segment was 58 bp, and its reverse complement sequence was 58 bp each, and each inverted fragment was complementary to 29 bp in each of the preceding segment and the latter segment of the forward sequence. All DNA fragments were lpmol and mixed as a template, and the spliced genes were PCR amplified using Prot6 _: 5 '-CCCATATGTCTGACGCTGCTGTTGAC-3 'W P proT7 _: 5 ' - cgggatccTTAGTCGTCTTCGTCAGTTTTCTG-3 ' as forward and reverse primers. The PCR reaction system was: template lpmol, Prot6 and proT7 each lOOpmol, 10mmol/L dNTP 1μ1, 10X reaction buffer 5μ1, pfu DNA polymerase 5U, and water to 50μ1. The PCR conditions were: first denaturation at 94 ° C for 30 seconds, then annealing at 54 ° C for 30 seconds, and finally at 72 ° C for 30 seconds for a total of 35 cycles. The gene for the preparation of the G36A and G43A-substituted thymosin alpha variant (SproT G36A, G43A) having the deoxyribonucleotide sequence as shown in SEQ ID NO: 14 in the sequence listing, the encoded amino acid sequence such as the sequence in the sequence listing 5 is shown.

In the same manner as in the above Example 1, SproT G36A, G43A was inserted between the Ndel and BamHI restriction sites of the vector PET22b to obtain the recombinant plasmid pET-SproT G36A, G43A; and the recombinant plasmid pET-SproT G36A, G43A was transferred. Escherichia coli BL21 (DE3) competent cells were obtained by the same screening method as in Example 1 above to obtain recombinant Escherichia coli BL21 (DE3) (pET-SproT G36A, G43A).

5. Construction of engineered bacteria expressing synthetic thymosin α original variants with C-terminal deletion and G36A and G43A substitution

Using pET-SproT G36A, G43A obtained in the above step 4 as a template, Prot6 and Prot8: 5, - cgggatccTTAGTCAACGTCGTCGTCTTCGTC-3, for PCR amplification of G36A and G43A replacement and C-terminal deletion of thymosin alpha The variant gene (SproT G36A, G43A-C) has a deoxyribonucleotide sequence as shown in SEQ ID NO: 18 in the Sequence Listing, and the encoded amino acid sequence is shown in SEQ ID NO:6 in the Sequence Listing.

The SproT G36A, G43A-C was inserted into the Ndel and BamHI restriction sites of the vector PET22b in the same manner as in the above Example 1, to obtain the recombinant plasmid pET-SproT G36A, G43A-C; and the recombinant plasmid pET-SproT G36A , G43A-C was transferred into E. coli BL21 (DE3) competent cells, and the same screening method as in the above Example 1 was used to obtain recombinant Escherichia coli BL21 (DE3) (pET-SproT)

G36A, G43A-C).

6. Preparation of N-acetylated thymosin α 1

The BL21 (DE3) (pET-NproT) constructed in the above Example 1 and the engineering bacteria BL21 (DE3) (pET_NproT_C), BL21 (DE3) (pET-NproT G36A, G43A) and BL21 constructed in the above steps 1 to 5 were respectively taken. Single colonies of DE3) (pET-NproT G36A, G43A-C), BL21 (DE3) (pET-SproT G36A, G43A) and BL21 (DE3) (pET-SproT G36A, G43A-C) were inoculated into 5 ml LB In liquid medium, shake overnight at 37 °C; then transfer to 100 ml medium (yeast extract 10 g/L, tryptone 10 g/L, sodium dihydrogen phosphate 20 mM, disodium hydrogen phosphate 30 mM, glucose 2g/L), cultured at 37 °C for 4h, respectively added ΙΟΟμ Ι 0. 2mol / L IPTG (isopropyl _D_ thiogalactoside, purchased from Shanghai Shenggong Bioengineering Technology Service Co., Ltd.) continued cultivation 4-8h, take lml of each bacterial solution, collect the cells by centrifugation, resuspend with 50μ1 water, mix with 50μ1 2XSDS-PAGE loading buffer, and lyse the cells in boiling water bath. The supernatant was centrifuged and subjected to SDS-PAGE analysis. The results are shown in Fig. 8. Among them, 1 is

SDS-PAGE results of BL21 (DE3) (pET-NproT), SDS-PAGE results of 2 3⁄4 BL21 (DE3) (pET-SproTG36A, G43A), SDS- of 3 3⁄4 BL21 (DE3) (pET-NproT-C) PAGE results, 4 are SDS-PAGE results of BL21 (DE3) (pET-NproT G36A, G43A), SDS-PAGE results of 5 3⁄4 BL21 (DE3) (pET-SproT G36A, G43A), 6 3⁄4 BL21 (DE3) ( The SDS-PAGE results of pET-SproT G36A, G43A-C), M is the molecular weight standard.

The results showed that BL21 (DE3) (pET-NproT-C) (sample 3 in the figure) and BL21 (DE3) (pET-NproT) (sample 1 in the figure) expressed similar levels, BL2 KDE3) (pET-NproT G36A, G43A) (sample 4 in the figure) is expressed at a higher level than BL21 (DE3) (pET-NproT) (sample 1 in the figure), and BL21 (DE3) (pET-SproT G36A, G43A) (sample 2 and sample 5 in the figure) ) with

BL2 KDE3) (pET-SproT G36A, G43A-C) (sample 6 in the figure) has the highest expression level, that is, the deletion of the C-terminal nuclear localization sequence does not affect the expression of thymosin alpha, and G36A and G43A substitution can significantly increase thymosin. The expression of α-pro-synthesis, the synthetic gene is more favorable to the expression of thymosin α than the natural gene.

Each of the above-mentioned engineering bacteria was cultured in the same manner as in the above Example 1, and a thymosin α original variant was expressed. Each of the obtained thymosin α original variants was digested with the asparagine endopeptidase prepared by the method of the first step of Example 1, to obtain Ν-acetylated thymosin α 1 . The specific method is the same as in the first embodiment.

Due to BL21 (DE3) (pET-SproT G36A, G43A) (sample 5 in the figure)

The expression level of BL2 KDE3) (pET-SproT G36A, G43A-C) (sample 6 in the figure) is high, so that N-acetylated thymosin α 1 prepared per unit volume of culture is also more.

Example 4. Preparation of Ν-acetylated thymosin α 1 by partial asparagine endopeptidase cleavage of thymosin α original variant or truncated thymosin α original variant

1. Construction of an engineered strain expressing a thymosin α original variant with a synthetic amino acid sequence deleted from amino acid residues 32-52

The pET-SproT G36A and G43A-C constructed in the above Example 3 were used as a template to Prot lO : 5 ' - ggcatATGTCTGACGCTGCTGTTGAC-3 ' and the mouth Prot9 : 5 ' -

ACCACCTTCTTCCTCTTCTTCGTCACGACCGTTTTCAGCTTC-3 ' is a primer, PCR amplification of a nucleic acid fragment encoding about 1 lObp from the amino acid sequence 32-52 amino acid sequence deletion (containing multiple asparagine sites); using the l lObp nucleic acid fragment as a megprimer, Using Prot8 as a reverse primer, pET-SproT G36A, and G43A-C as a template, PCR amplification of the thymosin alpha variant gene encoding a deletion of amino acid sequence 32-52 from the amino terminus and deletion of the C-terminal nuclear localization sequence (del53-C), the deoxyribonucleotide sequence thereof is shown in SEQ ID NO: 17 in the sequence listing, and the encoded amino acid sequence is shown in SEQ ID NO: 8 in the Sequence Listing.

The amplified del53-C gene was digested with Ndel and BamHI, and ligated with the similarly digested vector PET-22b (purchased from Novagen), and the ligated product was transformed into E. coli BL21 (DE3) competent cells. Recombinant E. coli BL21 (DE3) (PET-del53-C) was obtained. In the same manner, Prot ll : 5, - cgggatccTTAACCTTCTTCCTCTTCTTCCTC-3 ' was used instead of Prot8 to amplify a thymosin alpha-derived variant encoding amino acid sequence 32-52 deleted from the amino terminus and truncated to G68 at the C-terminus. The gene (del53/G68), whose deoxyribonucleotide sequence is shown in SEQ ID NO: 16 in the sequence listing, encodes The amino acid sequence is shown in SEQ ID NO:9 in the Sequence Listing.

The amplified del53/G68 gene was digested with Ndel and BamHI, and ligated with the similarly digested vector PET-22b (purchased from Novagen), and the ligated product was transformed into E. coli BL21 (DE3) competent cells. Recombinant E. coli BL21 (DE3) (PET-del53/G68) was obtained.

The pET-SproT G36A and G43A constructed in the above Example 3 were used as templates to Prot lO and

Prot ll is a primer, and the C-terminal truncated to G68 thymosin α progener gene (G68 gene) is amplified by PCR. The deoxyribonucleotide sequence is shown in SEQ ID NO: 15 in the sequence listing, and the encoded amino acid sequence is as follows. Sequence 7 is shown in the sequence listing.

The amplified G68 gene was digested with Ndel and BamHI, respectively, and ligated with the similarly digested vector PET22b (purchased from Novagen), and the ligated product was transformed into E. coli BL21 (DE3) competent cells to obtain a recombinant large intestine. Bacillus BL21 (DE3) (PET-G68).

2. Preparation of N-acetylated thymosin α 1

The above recombinant Escherichia coli BL21 (DE3) (PET-G68), BL21 (DE3) (PET-del53/G68), BL21 (DE3) (PET-del53_C) and BL21 (DE3) constructed in Example 3 (PET- Sprot) Single colonies of G36A, G43A), BL21 (DE3) (PET-Sprot G36A, G43A_C) were inoculated into 100 ml of LB liquid medium, shaken at 37 °C overnight, and then inoculated to 3 L medium (yeast pumping). Extract 10g / L, tryptone 10g / L, sodium dihydrogen phosphate 20mM, disodium hydrogen phosphate 30 mM, glucose 10g / L) B5 fermenter (purchased from Berenger, Germany), cultured at 37 °C, passed Stirring and aeration control the dissolved oxygen to greater than 20%. After culture 4, the dissolved oxygen suddenly rises, indicating that the glucose has been depleted. Each liter of culture is added with 1 ml of O.2mol/L IPTG for induction, and the culture is continued for 4_8 and hours, 50 μl of each bacterial solution is taken, and the cells are collected by centrifugation, and 50 μl of water is added. Resuspend, mix with 50μ1 2XSDS-PAGE loading buffer, and lyse the cells in a boiling water bath. The supernatant was lysed for SDS-PAGE analysis and the results are shown in Fig. 9. Among them, Μ is the molecular weight standard, 1 is the SDS-PAGE result of engineering bacteria BL21 (DE3) (PET- Sprot G36A, G43A) expressing G36A and G43A replacement thymosin α variant, 2 is the expression C-terminal truncation to G68 The SDS-PAGE results of the engineered strain BL21 (DE3) (PET-G68) of the thymosin alpha pro-variant, 3 are the thymus expressed from the amino acid sequence 32-52 deleted from the amino terminus, and the C-terminus is truncated to G68 SDS-PAGE results of the engineered strain BL21 (DE3) (PET-del53/G68) of the pro-alpha pro-variant, 4 are the thymus expressed from the amino acid sequence of amino acid residues 32-52, and the C-terminal nuclear localization sequence is deleted. Engineered bacteria

SDS-PAGE results of BL21 (DE3) (PET-del53-C), 5 engineering bacteria BL21 (DE3) (PET-Sprot G36A, G43A-C) expressing the thymosin alpha variant deleted from the C-terminal nuclear localization sequence ) SDS-PAGE results.

Figure 9 shows that BL21 (DE3) (PET-Sprot G36A, G43A), BL21 (DE3) (PET- Sprot G36A, G43A _C), BL21 (DE3) (PET-G68) and BL21 (DE3) (PET- The expression of del53/G68) was higher, while the expression of BL21 (DE3) (PET-del53-C) was lower. Since del53/G68 has the smallest molecular weight, it contains the highest proportion of thymosin α 1 .

In order to further compare the yields of the Ν-acetylated thymosin α 1 of these engineered bacteria, 1 L of the culture product of the above engineered bacteria was taken, and the asparagine endopeptidase prepared in the second step of the above Example 1 was used for enzyme digestion. N-acetylated thymosin al. The specific method is the same as in the first embodiment.

The obtained Ν-acetylated thymosin α 1 was subjected to RP-HPLC analysis in the same manner as in Example 1. The analysis results of Ν-acetylated thymosin α 1 obtained by each engineering strain are shown in Table 1.

Table 1 Content of Ν-acetylated thymosin α 1

It can be seen that the engineering strain BL21 (DE3) (PET_del53/G68) has the highest yield of N_acetylated thymosin a 1, and the chromatogram of the purification process is shown in Fig. 10. Comparing Fig. 10 with Fig. 5, it can be found that when N-acetylated thymosin a 1 is produced by using the engineered strain BL21 (DE3) (PET-del53/G68) to express thymosin a variant, the peak is significantly reduced, so it is easier to purify. Convenient for large-scale production. Figure 11 is an RP-HPLC analysis of the N-acetylated thymosin a 1 prepared therefrom, and the retention time is consistent with the chemically synthesized N-acetylated thymosin a 1 reference product in Figure 6, and the purity is good.

Example 5. Preparation of N-acetylated thymosin a 1 using glutathione transferase fusion protein containing N-acetylated thymosin a 1

1. Construction of a glutathione transferase fusion protein engineering strain expressing N-acetylated thymosin a 1 The pET-SproT G36A, G43A-C constructed in the above Example 3 was used as a template, and Ta5 : 5 ' - GGCATATGTCTGACGCTGCTGTTGAC -3 ' 卩Ta3 : 5 ' - GTTTTCAGCTTCTTCAACAAC -3 ' is a primer, and a DNA fragment encoding tens of bp encoding thymosin α 1 is amplified by PCR, and the fragment is electrophoresed. GST5 : 5 ' - GTTGTTGAAGAAGCTGAAAACGGTATGTCCCCTATACTAGGTTAT-3 ' : Hess GST3 _: 5 ' - AGGGATCCTTAACGCGGAACCAGATCCGATTT-3 ; as a primer, PGEX-4T-1 vector (constructed from American GE) as a template, PCR amplification of about 680bp code A DNA fragment of glutathione transferase was electrophoresed to recover the fragment. These two DNA fragments were used as templates, and Ta5 and GST3 were used as primers to obtain a gene for expressing glutathione transferase fusion protein containing N-acetylated thymosin α 1 by PCR amplification (the deoxyribonucleotides thereof) The sequence is shown as SEQ ID NO: 20 in the Sequence Listing, and the encoded amino acid sequence is as shown in SEQ ID NO: 21 in the Sequence Listing. The gene was digested with Ndel and BamHI, and ligated with the similarly digested vector PET-22b (purchased from Novagen), and the ligated product was transformed into E. coli BL21 (DE3) competent cells to obtain recombinant Escherichia coli BL21 (DE3). ) (PET-TaGST).

A single colony of the above recombinant Escherichia coli BL21 (DE3) (PET-TaGST) was inoculated into 100 ml of LB liquid medium, shaken at 37 ° C overnight, and then inoculated to a medium containing 3 L (yeast extract 10 g / L) , tryptone 10g / L, sodium dihydrogen phosphate 20mM, disodium hydrogen phosphate 30 mM, glucose 10g / L) B5 fermenter (purchased from Berenger, Germany), cultured at 37 °C, controlled by stirring and aeration Oxygen is greater than 20%. After 4-6 hours of incubation, the dissolved oxygen suddenly rises, indicating that the glucose has been depleted, and ImlO. 2mol per liter is added. IPTG (isopropyl-D-thiogalactoside, purchased from Shanghai Shenggong Bioengineering Technology Service Co., Ltd.) was induced, culture was continued for 4-8 hours, and 64 g of the cells were collected by centrifugation.

Resuspend 20 g of the collected cells with water (10 ml of water per gram of bacteria), ultrasonically break the wall, and collect the supernatant by centrifugation to obtain a crude extract containing the N-acetylated thymosin α 1-glutathione transferase fusion protein. . The crude extract was purified by Glutathione Sepharose 4 Fast Flow 2. 5X30 cm column (media purchased from GE Corporation, USA, and empty column purchased from Huamei Experimental Instrument Factory). The specific conditions are: liquid A (20 mM Tri-HC1, pH 7.0), liquid B (liquid A + 10 mM reduced glutathione), the column is first equilibrated with solution A, and then the above-mentioned N-acetyl group is taken from channel A. The crude extract of the thymosin α 1-glutathione transferase fusion protein was loaded, and the unbound protein was washed away with sputum, and finally eluted with 100% B, and 30 ml of the eluate was collected to obtain purified N. - acetylated thymosin alpha 1-glutathione transferase fusion protein. 5。 The use of G25 Φ 2. 5X50cm column (media purchased from the United States GE, the empty column was purchased from the Huamei Experimental Instrument Factory) to change the buffer system, the specific conditions, the mobile phase: 20 mM acetic acid-sodium acetate buffer, pH 4.5. Flow rate 5 ml/min. The fraction of 17_35 min was collected as N-acetylated thymosin α 1-glutathione transferase fusion protein.

The activated asparagine endopeptidase was prepared by the method of the second step of the above Example 1, and 2 ml of the activated asparagine endopeptide was added to the above-mentioned Ν-acetylated thymosin α 1-glutathione transferase fusion protein component. The enzyme was incubated with 40 M lmol/L DTT at 37 °C for 12 hours. The cut product was purified using a C18 Φ 2. 0X20 cm column (purchased from Dalian Institute of Chemical Physics). Liquid A is water +0. 1% by volume of TFA, B is 50% by volume of acetonitrile +0.1% by volume of aqueous solution of TFA. First equilibrate with solution A, then load at a flow rate of 5 ml/min. After loading, equilibrate with solution A, then linear gradient elution from 30% A to 60%. 40-45% of component B (25 ml) was collected to prepare N-acetylated thymosin α 1 (concentration of 0.9 mg/ml). The retention time on the HPLC was the same as in Example 1, and the retention time on the HPLC was 15.4 minutes, which was consistent with the retention time of the chemically synthesized N-acetylated thymosin α 1 .

Example 6. Preparation of Ν-acetylation using a thymosin alpha pro-variant of amino acid residues 35 to 79 from the amino terminus of sequence 3 in the sequence of the deleted sequence, and replacing the amino acid residue from the amino terminus 31 with Asp from a basic amino acid. Thymosin alpha 1

1. A thymosin alpha variant of sequence 3 in which amino acid residues 35-79 of the amino terminus are deleted and amino acid residues 31 are replaced by aspartic acid (Asp) to lysine (Lys). Construction of engineering bacteria

The pET-SproT G36A, G43A constructed in the above Example 3 was used as a template, and Ta507: 5 ' - AATGTCTGACGCTGCTGTTGACACT-3 ' and the mouth Ta307: 5 ' -

TACgagctcGCCGGAGCTTTACGACCGTTTTCAGCTTC-3 ' is a primer, PCR amplification of a l lObp coding initiation codon and a DNA sequence of 34 amino acid residues of the thymosin alpha N-terminus, and replacing the codon encoding the 31st acidic amino acid Asp with The codon encoding the basic amino acid Lys was electrophoretically recovered. The above fragment was digested with Sacl and electrophoresed, and the recovered fragment was named as A; the PET-22b vector (purchased from Novagen) was first digested with Bgl ll, then filled with Klenow enzyme, and electrophoresed after recovery. Then, it was digested with Sacl, digested and then electrophoresed, and the recovered fragment was named B; the above fragment A and fragment B were ligated with T4 ligase and transformed into E. coli DH5a competent cells. Recombinant Escherichia coli DH5a (PET-Ta35). The plasmid was extracted, sequenced, and the recombinant plasmid with the correct sequencing result was named PET-Ta35. The recombinant plasmid PET_Ta35 was digested with Sacl and Sail and then electrophoresed.

Using pET-SproT G36A, G43A as a template, with Del81S: 5, - tacgagctccGAAGCTGAATCTGCTACTGGTAAA-3 ' and PT3Sal _: 5 ' - tacgtcgacTTAGTCGTCTTCGTCAGTTTTCTG-3 ' as primers, PCR amplification of approximately l lObp encoding thymosin α original C-terminal amino acid The DNA sequence of the residue; the fragment was recovered by electrophoresis, and the Sacl and Sail were digested and electrophoresed. The electrophoresis-recovered fragment was ligated with the above-mentioned recombinant plasmid PETTIS digested with Sacl and Sail, and transformed into BL21 (DE3) competent cells, and the plasmid was extracted for sequencing. The results showed that the deoxyribonucleotide sequence was deoxyribonucleotide sequence. As shown by the sequence 23 in the Sequence Listing, the encoded amino acid sequence is shown as the sequence 22 in the Sequence Listing, and the recombinant strain is named BL21 (DE3) (PET_TaD35_79).

2. Preparation of N-acetylated thymosin α 1

A single colony of the above recombinant Escherichia coli BL21 (DE3) (PET-TaD35-79) was inoculated into 100 ml of LB liquid medium, shaken at 37 ° C overnight, and then inoculated to a 3 L medium (yeast extract) 10g/L, tryptone 10g/L, sodium dihydrogen phosphate 20mM, disodium hydrogen phosphate 30 mM, glucose

10 g/L) B5 fermentor (purchased from Berenger, Germany), cultured at 37 ° C, controlled to dissolve oxygen greater than 20% by stirring and aeration. The pH of the fermentation medium was controlled by adding ammonia or 3 mol/L phosphoric acid to 7. 0. After 4-6 hours of culture, the dissolved oxygen suddenly rose, indicating that the glucose had been exhausted, and the mass percentage was 70% glucose solution, control dissolved oxygen is about 20%, continue to culture for 6-9h, to 0D ₆ . . The value is greater than 50, and then 1 ml of 0.2 mg/L of IPTG (isopropyl _D_thiogalactoside, purchased from Shanghai Shenggong Bioengineering Technology Service Co., Ltd.) is added per liter of culture for induction, and culture is continued. The cells were collected by centrifugation at -14 hours. The collected cells were resuspended in water, and 190 g of the cells were resuspended in 1 L of water. The cells were broken by ultrasonic waves, and the supernatant was collected by centrifugation. The supernatant was heated to 80 ° C in a water bath and incubated for 15 min to make most of the bacteria. 5。 The protein was adjusted to pH 4.5 with acetic acid. The supernatant was collected by centrifugation and purified by DEAE 4 Fast Flow Φ 2. 5X30 cm column (media purchased from GE Corporation, USA, and empty column purchased from Huamei Experimental Instrument Factory). The specific purification conditions are: liquid A (20 mM acetic acid-sodium acetate, pH 4.5), liquid B (composed of liquid A and NaCl, the final concentration of acetic acid-sodium acetate in liquid B is 20 mM, and the final concentration of NaCl is 1 mol. /L), the column is first equilibrated with solution A, then the supernatant collected by centrifugation is loaded from channel A, and then mixed with 500 ml of solution A and 200 ml of 10% of solution B (mixed from 180 ml of solution A and 20 ml of solution B). The unbound protein is washed away, and then the fraction containing the thymosin alpha pro-variant is eluted with 30% by volume of B, and the fraction is collected for enzymatic cleavage to prepare Ν-acetylated thymosin α 1 Finally, other miscellaneous proteins are eluted with sputum.

The activated asparagine endopeptidase was prepared by the method of the second step of the above Example 1, and added to the fraction containing the thymosin alpha pro-variant collected by eluting with 30% by volume of the B solution. 4 ml of activated asparagine endopeptidase and 170 μl of lmol/L DTT were incubated at 37 ° C for 8 hours to cleave the fusion protein. The cleavage product was purified using a C18 2. 0X20 cm column (purchased from Dalian Institute of Chemical Physics). The specific purification conditions are as follows: a liquid is an aqueous solution of TFA (wherein the volume percentage of TFA is 0.1%), and liquid b is 50%. An aqueous solution of TFA in an amount of acetonitrile + 0.1% by volume. First, equilibrate with solution a, then load at a flow rate of 5 ml/min. After the sample is completed, equilibrate with solution a, and then linearly elute with a volume of 30% to 60% by volume. The fraction eluted with 40%-45% b (about 50 ml) was collected, which was the prepared N-acetylated thymosin α 1 (concentration: 1. lmg/ml). The prepared N-acetylated thymosin α 1 was analyzed in the same manner as in Example 1. The retention time on the HPLC was 15.4 minutes, and the chemically synthesized Ν-acetylated thymosin α 1 was retained. The time is the same. The mass spectrometric analysis of the Ν-acetylated thymosin α 1 prepared above was 3107 Da, which was completely consistent with the chemically synthesized N-acetylated thymosin α 1 , and the specific results are shown in FIG. 12; tandem mass spectrometry sequencing results showed that the above preparation The sequence of the genetically engineered Ν-acetylated thymosin α 1 was correct, and the acetylated modification was at the terminal serine, and the specific results are shown in Fig. 13a and Fig. 13b. Among them, Fig. 13a is a map of genetically engineered N-acetylated thymosin α 1 tandem mass spectrometry, and Fig. 13b is an amino acid sequence according to the map.

The amino acid residues 35-79 from the amino terminus of the sequence 3 in the sequence of the deletion sequence were prepared in the same manner as in the present example by substituting the Ta177Arg: 5'-TACgagctcGCCGGAGCTCTACGACCGTTTTCAGCTTC-3' for the above primer Ta307. At the 31st position, the thymosin α original variant was replaced by Asp, which is a precise amino acid (Arg), and the thymosin α progener was used to prepare Ν-acetylated thymosin α 1 . HPLC and mass spectrometry analysis of the obtained Ν-acetylated thymosin α 1 showed that the retention time of the N-acetylated thymosin α 1 prepared above was 15.4 minutes, and the molecular weight of the mass spectrometry was 3107 Da. It is completely consistent with chemically synthesized N-acetylated thymosin α 1 .

Example 7. Activity analysis of Ν-acetylated thymosin α 1 prepared

The sputum cell-Ε rose flower test was used (for the method, see the State Food and Drug Administration. WS1-XG-042-

2000-2003, Appendix - Cellular Cell Activity Assay - Deamination Receptor Method. National Drug Standards, Volume 16, 2003; Xia Yao et al, Τ Lymphocyte-Ε rose flower test to detect factors affecting the biological activity of thymosin, Drug Biotechnology, 2007, 14 (3): 215-217. The biological activity of the Ν-acetylated thymosin α 1 prepared in the above Examples 1 to 5 was analyzed, and the reference product was a chemically synthesized Ν-acetylated thymosin α 商品 (trade name Zadaxin, purchased from the 302 Hospital of the People's Liberation Army). The test results are shown in Table 2. According to the relevant national regulations, the E-garland formation rate is more than 10%, which is qualified for activity, that is, it has obvious effect of activating T cells.

Activity analysis of N-acetylated thymosin α 1

N-acetylated thymosin α 1 BL21 (DE3) (ρΕΤ- NproT Example 3 24%

G36A, G43A-C)

Ν-acetylated thymosin α 1 BL21 (DE3) (ρΕΤ- Example 3 24%

SproT G36A, G43A )

Ν-acetylated thymosin α 1 BL21 (DE3) (ρΕΤ- Example 3 27%

SproT G36A, G43A-C )

Ν-acetylated thymosin α 1 BL21 (DE3) (PET - Example 4 25% del53-C)

Ν-acetylated thymosin α 1 BL21 (DE3) (PET - Example 4 27% del53/G68)

Ν-acetylated thymosin α 1 BL21 (DE3) (PET-G68) Example 4 25%

Ν-acetylated thymosin α 1 BL21 (DE3) (PET-TaGST) Example 5 25%

Ν-acetylated thymosin α 1 BL21 (DE3) (PET - Example 6 26%

TaD35-79 )

The results showed that the N-acetylated thymosin α 1 prepared in the above Examples 1 to 6 and the reference product all had the action of activating sputum cells, and the biological activities were similar.

Industrial application

The method for preparing genetically engineered Ν-acetylated thymosin α 1 of the invention has the advantages of low cost, can increase the expression of Ν-acetylated thymosin α 1 , simplify cleavage, and facilitate purification of Ν-acetylated thymosin α 1 , Thereby, the production efficiency of Ν-acetylated thymosin α 1 is improved, and the invention has broad clinical application prospects and the like.

Claims

Rights request

1. A method of preparing genetically engineered N-acetylated thymosin alpha 1 comprising the steps of:

2) Endopeptidase The precursor protein or polypeptide containing the Ν-acetylated thymosin α 1 polypeptide sequence of the above step 1) is digested to obtain Ν-acetylated thymosin α 1 .

2. The method according to claim 1, wherein: the precursor protein comprising the Ν-acetylated thymosin α 1 polypeptide sequence is formed by Ν-acetylated thymosin α 1 and glutathione transferase. Fusion protein.

3. The method according to claim 1, wherein: the precursor protein or polypeptide comprising the Ν-acetylated thymosin α 1 polypeptide sequence is Ν-acetylated thymosin α or a variant thereof;

The Ν-acetylated thymosin α progener is a polypeptide that at least satisfies one of the following conditions:

6) missing amino acid residues at position amino acid positions 69-109 of sequence 3 in the sequence listing;

The basic amino acid is lysine or arginine.

4. The method according to claim 3, wherein: the N-acetylated thymosin alpha promutant is one of the following polypeptides:

1) is a polypeptide obtained by deleting the amino acid residue at position 100-109 of the amino terminus of SEQ ID NO: 3;

3) is a polypeptide obtained by replacing the 36th and 43rd positions of the amino terminus of the sequence 3 from glycine with alanine;

4) is a polypeptide obtained by replacing or deleting at least one of the 5 positions of Asn from the amino terminal at the 35th, 37th, 39th, 42nd, and 49th positions in the amino acid sequence;

5) is a polypeptide obtained by deleting amino acid residues at position 32-52 of the amino terminus of SEQ ID NO: 3;

6) is obtained by deleting the amino acid residues at position 69-109 of the amino terminus of sequence 3 in the sequence listing. Peptide

The basic amino acid is lysine or arginine.

The method according to claim 1 or 2, wherein the thymosin α ΐ is a polypeptide having 90% or more homology with SEQ ID NO: 1 or SEQ ID NO: 2 in the sequence listing, preferably with the sequence in the sequence listing 1 or 2 has a polypeptide having more than 95% homology.

The method according to claim 1 or 2, wherein the thymosin α ΐ is a polypeptide of SEQ ID NO: 1 or SEQ ID NO: 2 in the Sequence Listing.

The method according to any one of claims 1 to 6, wherein the endopeptidase is an asparaginase.

8. The method according to claim 7, wherein: said endopeptidase is human asparagine endopeptidase.

9. A method according to any one of claims 1-8, characterized in that the endopeptidase is prepared by a genetic engineering method.

10. The method according to claim 9, wherein: the host used in the genetic engineering method is a yeast.

1 1. The method according to any one of claims 1 to 10, wherein: the amino acid sequence of the Ν-acetylated thymosin alpha or a variant thereof is in sequence 3-9 and sequence 22 of the sequence listing. Any of the described amino acid sequences.

The method according to any one of claims 1 to 10, wherein the nucleotide sequence of the coding gene of the Ν-acetylated thymosin alpha or a variant thereof is the sequence 10-18 in the sequence listing. And the nucleotide sequence of any of SEQ ID NO: 23.