WO2007112676A1

WO2007112676A1 - A human parathyroid hormone 1-34 fusion protein and expression vectors thereof

Info

Publication number: WO2007112676A1
Application number: PCT/CN2007/001024
Authority: WO
Inventors: Renhuai Zhang; Liming Yang; Yong Yang; Sheji Liu; Bilian Huang; Kai He; Delin Liu
Original assignee: Shenzhen Watsin Genetech Ltd.
Priority date: 2006-03-31
Filing date: 2007-03-29
Publication date: 2007-10-11
Also published as: CN100484958C; CN1900120A; HK1098489A1

Abstract

Provided are a fusion protein which comprises an amino acid sequence of thioredoxin and a downstream parathyroid hormone 1-34 from thioredoxin, and expression vectors thereof. The fusion protein may further comprises a linker peptide with a recognition site of proteolytic enzyme between thioredoxin and parathyroid hormone 1-34. The fusion protein can be useful for producing human parathyroid hormone 1-34.

Description

Fusion protein containing human parathyroid hormone 1-34 and expression vector thereof

The invention relates to the field of genetic engineering technology, in particular to a fusion protein containing human parathyroid hormone 1-34 and an expression vector thereof. Background technique

Parathyroid Hormone (PTH) is synthesized by parathyroid hormone master cells and consists of 84 amino acids. It is increasingly recognized that PTH can increase the number of very active osteoblasts in the synthesis of new bone matrix and can alter gene expression in bone in vivo. PTH also has the effect of lowering blood pressure, regulating vitamin D receptor (VDR) expression, and modulating alkaline phosphatase activity. Tregear et al. (Tregear GW et al., Endocrinology, 1973, 93: 1349) demonstrated that PTH exerts a calcium-phosphorus regulatory molecule with only an amino-terminal 1-34 amino acid residue [ΡΊΉ(1-34)]. However, ΡΤΗ(1-34) does not contain cysteine and is less stable in the body.

基因 Genetic engineering research began in the 1980s. At present, there are mainly two types of genetic engineering methods for preparing lanthanum (1-34), one is prepared in the form of inclusion bodies, and the other is prepared in the form of soluble proteins. In 1997, Japanese scientist Yuji Suzuki et al. fused human parathyroid hormone (hPTH(l-34)) with β-galactosidase, but the fusion protein existed as inclusion bodies. Chinese Patent Publication No. CN1417231A also discloses a method of preparing hPTH (1-34) in the form of inclusion bodies. In this type of method, the expressed fusion protein needs to be purified by inclusion body digestion, dilution and renaturation, and then subjected to ion exchange and reversed phase HPLC chromatography to obtain hPTH (l-34). Therefore, the preparation steps of this type of method are complicated.

Chinese Patent Application Publication No. CN1424325A discloses a process for preparing a recombinant human parathyroid hormone precursor peptide and a recombinant human parathyroid hormone 1-34 peptide. In order to prepare the parathyroid hormone 1-34 peptide, it is necessary to first express the fusion protein GST-Gly-Ser-Pro-PTH(l-34), and then use thrombin and proline endopeptidase. The obtained fusion protein was digested and purified to obtain the desired parathyroid hormone 1-34 peptide. Due to the need to make The preparation process disclosed in the patent application is also complicated by double enzyme digestion.

It has long been known that Thiroedoxin (hereinafter sometimes abbreviated as "Trx") is a protein commonly found in yeast, bacteria, animals, and plants. This protein is also a commonly used ΡΤΗ(1-34) expression host. Yeast or E. coli endogenous protein, but so far no one has used this protein to fuse with ΡΤΗ(1-34) to easily prepare hPTH(l-34). Summary of the invention

One aspect of the invention provides a novel fusion protein having: (1) a Trx sequence and (2) a parathyroid hormone 1-34 peptide located downstream of said Trx. More preferably, the fusion protein further has (3) a linker peptide containing a proteolytic enzyme recognition site between the Trx sequence and the parathyroid hormone 1-34 peptide. The proteolytic enzyme may be thrombin, Kex2-600, proline endopeptidase, enterokinase. Enterokinase is preferred because the proteolytic enzyme cleaves the fusion protein at the C-terminus of the recognition site, so that the complete and accurate parathyroid hormone 1-34 peptide can be obtained after enzymatic hydrolysis is completed. For ease of purification, the fusion protein of the present invention also preferably has an optional (His) ₆ -Tag located in the linker peptide or at the C-terminus or N-terminus of Trx. Therefore, the Trx, His-Tag coding region, enterokinase recognition site and parathyroid hormone 1-34 peptide coding region can be sequentially linked by genetic recombination techniques well known in the art to obtain Trx-(His) ₆ - Enterokinase recognition site - parathyroid hormone 1-34 peptide. The gene encoding the parathyroid hormone 1-34 peptide can also be directly inserted into a commercially available suitable expression vector containing the Trx and His-Tag coding sequences [e.g., pET32a(+)]. In a specific embodiment of the present invention, the coding sequence of said (His) ₆ -Tag and proteolytic enzyme (specifically enterokinase) is located in said linker peptide, and the sequence of the obtained fusion protein is from N-terminal to The C-terminus is: Trx-linked peptide-parathyroid hormone 1-34 peptide containing (His) ₆ and a protease recognition site.

In another aspect of the invention there is provided a recombinant DNA sequence encoding a fusion protein of the invention and an expression vector comprising the same. In a specific embodiment, the recombinant DNA sequence of the present invention comprises the following nucleotide sequence encoding an enterokinase recognition site-parathyroid hormone 1-34 peptide: GACGACGACGACAAGTCCGTTTCCGAAAT C. DRAWINGS

Figure 1 is a restriction map of the recombinant expression plasmid pET-PTH (l-34). In Figure 1, the contents of each lane are: M, DNA molecular weight standard (λ DNA/Hand III, molecular weight is shown on the left); 1. Recombinant plasmid pET-PTH (l-34) _; 2. Recombinant plasmid pET- PTH(l-34) was digested with EcoR 1; 3. pET32a(+) plasmid DNA was digested with Pst I; 4. Recombinant plasmid pET-PTH (l-34) was digested with Pst I.

Figure 2 shows the results of forward sequencing of the recombinant plasmid pET-PTH (l-34).

Figure 3 shows the results of reverse sequencing of the recombinant plasmid pET-PTH (l-34).

Figure 4 is a SDS-PAGE electropherogram of expression screening of recombinants. In Figure 4, M is the protein molecular weight standard (molecular weight size is shown on the left); lane 1 shows the pre-induction sampling results; lanes 2-9 show the induced expression results of recombinants 1-8, respectively.

Figure 5 shows the SDS-PAGE electrophoresis analysis of the engineered bacteria after fermentation. In Fig. 5, M is the molecular weight standard of the protein, and the molecular weight of each band (kDa) is shown on the left; 1 shows the collected fermentation cells; 2 shows the cells before IPTG induction.

Figure 6. SDS-PAGE electrophoresis analysis of purified samples of each step of rhPTH (l-34). In Fig. 6, 1, fermenting bacteria; 2, centrifugation supernatant after sterilizing; 3. nickel ion chelate affinity chromatography; 4, fusion protein enterokinase digestion; 5, Q Sepharose High Performance column chromatography; 6. Reversed-phase column chromatography; 7. SP Sepharose Fast Flow column chromatography; M, is the molecular weight standard of the protein, and the molecular weight of each band (kDa) is shown on the right.

Figure 7 is a RP-HPLC analysis of rhPTH (l-34).

Figure 8 is a mass spectrometry spectrum of rhPTH (l-34).

Figure 9 is a map showing the commercially available pET32a(+) plasmid.

Figure 10 is a synthetic DNA sequence containing the coding sequence for rhPTH (l-34). Among them, 5'-CTG and AAG-3' are enzymatically protected bases, GGTACC is a Kpn I restriction site, and GACGACGACGACAAG is a enterokinase restriction site coding sequence. GACGTTCACAACTTC is a sequence encoding PTH, TAA is a stop codon, and GTCGAC is a Sal I restriction site. detailed description

In order to obtain the fusion protein of the present invention, it is necessary to first construct an expression vector capable of expressing the fusion protein. The expression vector can be constructed by inserting a DNA sequence encoding hPTH(l-34) downstream of the Trx gene under the control of a promoter. As described in the background section, Trx is a protein commonly found in yeast, bacteria, animals, and plants. This protein is also an endogenous protein of the currently used hPTH (l-34) expression host such as yeast or Escherichia coli. This protein regulates the balance of protein folding and aggregation processes in cells. Trx interacts with many proteins to enhance the solubility of fusion proteins, thereby reducing the formation of inclusion bodies (Thomas, JG et al, Appl Biochem Biotechnol. 66 (3): 197-238). In the present invention, a complete Trx may be used, or a part of Trx or a mutant thereof may be used, and the selected portion or mutant has the same or similar spatial structure and function as Trx.

The expression vector of the present invention may be an expression vector for yeast or an expression vector for Escherichia coli. The hPTH (l-34) may be a completely synthetic new DNA sequence or a DNA sequence encoding hPTH (l-34) which has been disclosed. In order to insert a DNA sequence encoding hPTH(l-34) downstream of the Trx gene, it is preferred to use a cloning vector which already contains the Trx gene or a partial sequence thereof. This carrier is also available for purchase. For example, pET32a(+) is such a vector. pET32a(+) can efficiently express a 109 amino acid Trx-Tag polypeptide. After the foreign gene is inserted into its multiple cloning site, the fusion protein contains a cleavable His-Tag and S-Tag sequence for easy detection. purification.

In order to release hPTH(l-34) from the fusion protein in a subsequent step, it is preferred to introduce a proteolytic enzyme recognition site nucleotide sequence at the 5' end of the DNA sequence encoding hPTH (1-34). The proteolytic enzyme may be thrombin, Kex2-600, proline endopeptidase, enterokinase. Enterokinase is preferred because it is capable of hydrolyzing the fusion protein at the C-terminus of the recognition site. Therefore, it is more preferred to directly follow the coding sequence of hPTH(l-34) at the nucleotide sequence encoding the enterokinase recognition site, such that enterokinase can completely and accurately release the final desired hPTH (l-34). come out. If artificially encoded hFTH (l-34) is used For the purpose of cloning, in order to facilitate cloning, it is also necessary to introduce appropriate restriction sites at the 5' and 3' ends of the sequence when artificially synthesizing the DNA sequence. For the convenience of purification in the future, a sequence which facilitates purification can be inserted at a suitable position of the fusion protein, for example, a His-Tag is preferably inserted at the N-terminus or C-terminus of the Trx used. The commercially available vector pET32a(+) not only has a Trx gene, but also has a His-Tag downstream of the gene.

The present invention also provides a large-scale, high-efficiency hPTH (l-34) expression method. In order to prepare hPTH(l-34) in large quantities, it is necessary to transform the constructed recombinant expression vector into a susceptible host cell, such as yeast cells or E. coli cells, and ferment in a suitable medium to harvest the fusion protein. The host cell used in a specific embodiment of the present invention is commercially available E. coli BL21 (DE3). Both the intracellular and intercellular periplasmic proteases of the cells have been inactivated, so that when the soluble expression of the foreign protein is carried out, it is not easily hydrolyzed by the protease of the host bacteria, and thus can be stably present.

For efficient control during fermentation, an inducible expression vector is recommended. The pET series vector is such a type of E. coli expression vector. The vector is an E. coli expression vector constructed using the T7 bacteriophage RNA polymerase/promoter system, ie, the T7 RNA polymerase gene is integrated on the chromosome of E. coli BL21 (DE3) or JM109 (DE3), and is manipulated by lac Sub-regulation. Therefore, when induced by IPTG, it leads to the synthesis of T7 RNA polymerase, thereby inducing the expression of the target gene on the pET vector. The T7 phage RNA/promoter has strong priming activity and a strong ribosome binding sequence (rbs) upstream of the vector multiple cloning site sequence, so the pET vector can efficiently express foreign proteins.

The fermentation medium described will vary from host to host. In the case where Escherichia coli is used as a host and the pET series vector is used as an expression vector, the fermentation medium may be LB, TB, M9CA or the like, preferably TB medium. The fermentation temperature is 30-40 ° C, preferably 37 ° C; ρ Ηό. 5-7.5, preferably ρ Η 7.0; dissolved oxygen DO ≥ 30%, the final concentration of IPTG for induction is

0.3-1.0 mM, preferably 0.5 mM; induction time is 3-5 h, preferably 3.5 h. Under the above suitable conditions, the concentration of the fermentation broth can reach 30 g of the bacterial wet weight / L fermentation broth, and the target fusion protein expression is more than 25%.

In order to obtain a pure rhPTH(l-34) polypeptide, the intracellular secreted fusion protein was first dissolved in the lysate by high-pressure homogenization, and then subjected to nickel ion chelate affinity chromatography. Purification, the preliminary purified sample is digested with enterokinase, and the digested sample is chromatographed with an anion exchange column to collect the penetrating protein solution, the penetrating protein solution is passed through the reverse phase chromatography column, and finally the sample is cationized. The organic solvent was removed from the exchange column to obtain a stock solution of rhPTH(l-34) protein. Using this method, about 2000 g of wet weight bacteria can be obtained in 70 liters of fermentation broth, and about 3.5 g of rhPTH (l-34) protein stock solution can be obtained by purification.

Preclinical pharmacodynamic tests, toxicological tests and studies have shown that: subcutaneous injection of sputum (1-34) prepared by the present invention has a significant effect on osteogenic bone formation, and its safe dose is 15 g/kg. Therefore, the rhPTH (l-34) prepared by the present invention is safe and effective for human body treatment.

In summary, the present invention fuses hPTH(l-34) with hydrophilic Trx, and the fusion protein is expressed in a soluble form in the cell, thereby avoiding the renaturation step of the inclusion body which is complicated in process and low in yield. The N-terminal of the fusion protein contains His-Tag, which can be quickly, easily and efficiently purified by Ni ²⁺ and affinity chromatography, which greatly improves the recovery rate. In a preferred embodiment of the invention, an enterokinase cleavage site is present between Trx and hPTH (l-34) to ensure that the purified fusion protein is cleaved by enterokinase to release intact hPTH (1-34). The proteolytic enzyme is used to decompose the expressed fusion protein, and the target protein hPTH (l-34) is purified by a series of column chromatography, and the purity can reach 99% or more, even 100%.

The present invention will be exemplified by the following examples in the case of Escherichia coli as a host, but it should be understood that these examples do not limit the scope of the invention in any way. Example 1 Design and Synthesis of DNA Sequences Expressing hPTH(l-34) According to the amino acid sequence of hPTH(l-34) (see Table 1), artificially optimized for E. coli expression based on E. coli codon preference DNA sequence. When the hPTH(l-34) gene was synthesized, the Kpn l restriction site GGTACC was introduced at the 5' end of the gene, and the stop codon ΤΑΑ and the Sal I restriction site GTCGAC were introduced at the 3' end, and introduced at the 5' end. The coding sequence GACGACGACGACAAG of the enterokinase digestion site was added after the Kpn I restriction site to obtain sequence 1 (see Figure 10). To facilitate subsequent subcloning, the synthetic gene was cloned into pUC18 for preservation of the synthesized DNA sequence. Plasmid pUC 18 contains the same Kpn l and Sal I restriction sites as plasmid pET32a ( + ). hPTH(l-34) codon usage table

No. Amino Selected secret Optional codons Not selectable Codes Codons

1 Ser TCC TCT, TCA, TCG, AGT, AGC

2 Val GTT GTC, GTA, GTG

3 Ser TCC TCT, TCA, TCG, AGT, AGC

4 Glu GAA GAG

5 lie ATC ATT ATA

6 Gin CAG CAA

7 Leu CTG TTA, TTG, CTT, CTC CTA

8 MET ATG

9 His CAC CAT

10 Asn AAC AAT

11 Leu CTG TTA, TTG, CTT, CTC CTA

12 Gly GGT GGC, GGG GGA

13 Lys AAA AAG

14 His CAC CAT

15 Leu CTG TTA, TTG, CTT, CTC CTA

16 Asn AAC AAT

17 Ser TCC TCT, TCA, TCG, AGT, AGC

18 Met ATG

19 Glu GAA GAG

20 Arg CGT CGC CGA,

CGG, AGA, AGG

21 Val GTT GTC, GTA, GTG

22 Glu GAA GAG 23 ' Trp TGG

24 Leu CTG TTA, TTG, CTT, CTC CTA

25 Arg CGT CGC CGA,

CGG, AGA, AGG

26 Lys AAA AAG

27 Lys AAA AAG

28 Leu CTG TTA, TTG, CTT, CTC CTA

29 Gin CAG CAA

30 Asp GAC GAT

31 Val GTT GTC, GTA, GTG

32 His CAC CAT

33 Asn AAC AAT

34 Phe TTC TTT

Note: The amino acid sequence is labeled from the N-terminus of the hPTH polypeptide. Example 2 Construction Process of Recombinant Plasmid

The following molecular cloning techniques are described, unless otherwise stated, in the literature: Molecular Cloning Experimental Guide (translated by Huang Peitang et al., [US] Sambrook et al., Science Press, 2002).

DNA extraction kit (UNIQ-10), DNA gel recovery kit (UNIQ-10) and connection kit used in DNA manipulation were purchased from Shanghai Shenggong Bioengineering Technology Service Co., Ltd. The cloning vector pUC18, a restriction enzyme, was purchased from Fermentas Life Science. The expression vector pET32a(+), E. coli TOP10 and BL21 (DE3) were purchased from Novagen. The cloning E. coli host was TOP10, and the expression E. coli host was BL21(DE3) o BL21(DE3) genotype: hsdS gal (λ dts857 indl Sam7 nin5 lacUV5-T7 genel). BL21(DE3) carries the T7 RNA polymerase gene, and the T7 RNA polymerase is produced in large quantities under the induction of IPTG, thus opening up the expression of the foreign gene and enabling the efficient expression of the foreign gene.

1. Prepare the target gene fragment The pUC18 plasmid DA containing the hPTH(l-34) coding sequence was extracted with a DNA extraction kit, and digested with Kpn l /Sal l, and the small fragment was separated by electrophoresis on a 1% agarose gel, and the fragment containing about 130 bp was excised. The gel was recovered by a gel DNA recovery kit to a fragment of about 130 bp, which was verified by electrophoresis.

2. Prepare the expression vector fragment

The pET32a(+) plasmid DNA was extracted with DNA extraction kit, digested with Kpn I /Sal I, and the large fragment was separated by 1% agarose gel electrophoresis. The gel containing the large fragment was excised and recovered by gel DNA. The kit recovers large fragments and is ready for electrophoresis.

3. Construction of recombinant plasmid pET-PTH (l-34)

The DNA fragments prepared in 1, 2 were ligated with T4 DNA ligase at 16 ° C for 30 min, and the ligated product was transformed into E. coli TOP10 competent cells, and plated on LB agarose plate (1% peptone, containing 100 g/ml Amp, 0.5% yeast extract, 1% NaCl, 2% agar)), cultured overnight at 37 °C.

4. Recombinant screening

Ten colonies were picked and cultured in 5 ml of LB medium containing 100 g/ml of Amp at 37 ° C overnight, and plasmid DNA was extracted using a DNA extraction kit. The extracted DNA was digested with EcoR I and Pst I, respectively, and then subjected to 1% agarose gel electrophoresis to identify recombinants. Since EcoR I is a single restriction site in pET32a (+), the recombinant was constructed by double digestion with Kpn I /Sal I, so the recombinant could not be cleaved by EcoR I; and Pst I in pET32a (+) The single-site point is not in the polyclonal region, and the rhPTH(l-34) gene contains a Pst Ϊ site, so when the pET32a(+) vector plasmid is digested with Pst I, a single DNA fragment with a molecular weight of 5.9 kb is obtained, and the recombinant plasmid is recombined. The plasmid was digested with Pst I and two DNA fragments of 1.2 kb and 4.7 kb should be present (see Figure 1). The results of enzyme digestion showed that all 10 colonies were correct recombinants, and the correct recombinant plasmid was named pET-PTH (l-34).

5. Sequencing of plasmid pET-PTH (l-34):

The recombinant plasmid pET-PTH (l-34) was sequenced and verified. The results of forward sequencing are shown in Figure 2, and the results of reverse sequencing are shown in Figure 3. The nucleotide sequence of the linker peptide-parathyroid hormone 1-34 peptide encoding the fusion protein Trx-containing (ms) ₆ and the enterokinase recognition site is as follows - GCTAACCTGGCCggttctggttctggccatatgcacgafeQ/c^tcfltcflfrtcttctggtctggtgc cacgcggttctggtatgaaagaaaccgctgctgctaaattcgaacgccagcacatggacagcccagatctg ggtaccgaceacgacgacaagTCCGTTTCCGAAATCCAGCTGATGCACAA CCTGGGTAAACACCTGAACTCCATGGAACGTGTTGAATGGCT GCGTAAAAAACTGCAGGACGTTCACAACTTC7 4. Wherein, the sequence consisting of non-blackface uppercase letters is a Trx coding sequence, and the sequence consisting of lowercase letters is a linker peptide coding sequence containing a Trx-containing (His) ₆ and a protease recognition site coding region, and the underlined italicized portion is ( His) ₆ coding region, the double-lined portion is the coding region of the enterokinase recognition site, the sequence consisting of uppercase letters in bold is the hPTH(l-34) DNA sequence, and the TAA in italics is the stop codon. The sequencing confirmed that the hPTH(l-34) DNA sequence in the constructed engineering bacteria was completely consistent with the theoretical design. In addition, it should be noted that in the coding sequence of the above fusion protein, the (His) _6- Tag and enterokinase coding regions in the coding sequence of the linker composed of lowercase letters are necessary for obtaining pure hPTH (l-34). Sequence, so other sequences in lowercase letters are optional, and can be replaced with other functional sequences. Example 3 Induced expression of engineering bacteria

Escherichia coli BL21 (DE3) was transformed with the recombinant plasmid pET-PTH(l-34) DNA, and the obtained genetically engineered strain for expressing the rhPTH(l-34) fusion protein was obtained. Eight single colonies were picked and cultured in 5 ml of LB medium (1% peptone, 0.5% yeast extract, 1% NaCl) containing 100 g/ml Amp overnight at 37 ° C, and transferred to 50 ml at a volume of 1/100. The LB medium containing 100 μ _§ /ιη1 Amp was cultured at 37 ° C, and the remaining bacterial solution was frozen in 15% glycerol. OD ₆ o. When 0.5 was reached, IPTG was added to a final concentration of 0.5 mM for induction expression, and after 4 hours, samples were taken for SDS-PAGE electrophoresis. Compared with the uninduced control, the recombinants after induction had an expression band with an expected molecular weight of about 20 kDa, and the expression level was more than 25% of the total bacterial protein. Take the highest yield of No. 6 as an engineering bacteria, named BL21(DE3)-PTH(l-34), stored in glycerin. The protein expression screening electrophoresis pattern is shown in Figure 4. Example 4 Fermentation of engineering bacteria BL21(DE3)-PTH(l-34)

Take Trx-hPTH-engineered strain BL21(DE3)-PTH(l-34) glycerol strain 1 (lmL), inoculate 400mL LB medium (1% peptone, 0.5% yeast extract, 1

In the %NaCl), the seeds were incubated at 37 ° C, 200 rpm shake flask for 14-16 h to obtain activated seeds. Activated seeds were seeded in 3.5 L TB medium (1.2% peptone, 2.4% yeast extract, 0.4% glycerol, 17 mM KH ₂ P0 ₄ , 72 mM K ₂ HPO ₄ ) at 10% inoculum (5L B. Braun fermentation) Can), cultured at 37 ° C for 3-4 h. Then, the culture solution was fermented in a 70 L TB medium (lOOLB. Bmun fermentor) at a 5% inoculum, and the temperature was 37 ° C, pH 7.0,

DO>30%, cultured to OD _6Q . Induction was induced at =4.0, and the final concentration of IPTG for induction was 0.5 mM, and the induction time was 3-4 h. Under these conditions, the concentration of the fermentation broth can reach 30g bacterial wet weight / L fermentation broth, and the target fusion protein expression level is above 25%. See Figure 5 for the results.

Example 5 Purification of rhPTH (l-34)

The fermenting cells of Example 4 were collected using a continuous flow centrifuge (CEPAZ41, B. Braun, Germany) using buffer A (10 mM PBS (phosphate buffer), 500 mM NaCl, 30 mM imidazole, pH 8.0). The suspension was then disrupted with an APV-1000 high pressure homogenizer (APVCo. Denmark), and the intracellular secreted fusion protein was dissolved in buffer A and centrifuged at 9000 rpm for 30 min. The supernatant was taken and the rhPTH (l-34) was purified by the following method:

Nickel ion chelate affinity chromatography

The high-pressure homogenized supernatant was placed on a column of Chelting Sepharose Fast Flow (GE Healthcare) equilibrated with buffer A, buffer A was thoroughly washed, and buffer B (10 mM PB) was used. , 500 mM NaCl, 200 mM imidazole, pHS. O) eluted, and the eluted peaks were collected to obtain a fusion protein sample.

2. Enzymatic digestion of the fusion protein

The digestion reaction solution was prepared as follows: lmg/mL fusion protein, 50 mM Tris-HCl (pH 8.0), 1 mM CaCl ₂ , enterokinase (1 unit (U) enterokinase cleavage 5 mg fusion protein ratio Enterokinase). The enzyme was digested at 25 ° C for 20 hours.

π 3. Anion exchange column chromatography

The digested protein solution was applied to a Q Sepharose High Performance (GE Healthcare) column equilibrated with buffer C (50 mM Tris-HCl, pH 8.0). The theoretical isoelectric point of rhPTH(l-34) is 8.29, which is positively charged at pH 8.0 and does not bind to the anion exchange column. The heteroprotein is bound to the anion exchange column due to its negative charge. By collecting the penetrating liquid, a rhPTH(l-34) protein sample having a purity of 95% or more can be obtained.

4. Reversed phase column chromatography

The rhPTH(l-34) protein sample purified by ion exchange column chromatography as described above was finely purified using a reverse phase column Source 15RPC (GE Healthcare), and eluted with a gradient of 24-64% ethanol at 40 The elution peak of rhPTH(l-34) protein appeared in -60% ethanol, and the purity reached 98% or more.

5. Cation exchange column chromatography

The sample eluted from the reverse phase column was diluted with buffer D (10 mM PB, pH 7.0) and applied to a SP Sepharose Fast FlowC GE Healthcare column equilibrated with buffer D. After buffer D was thoroughly washed, Elution with buffer D containing 400 mM NaCl yielded a rhPTH(l-34) protein with a purity greater than 99%.

The purification results of each step were analyzed by SDS-PAGE electrophoresis (see Figure 6). Example 6 Calibration of rhPTH (l-34)

1, SDS-PAGE purity analysis

非Using the Tris-Tricine SDS-PAGE system (Guo Junjun, Protein Electrophoresis Experimental Technology, Science Press, 1999) for non-reducing electrophoresis, scanning with Bio-Rad Gel Doc 2000 gel imaging system, rhPTH (l-34) purity It is 100% (see the seventh lane in Figure 6).

2, RP-HPLC purity analysis

The purity of proteins and peptides is determined by HPLC, and the accuracy is high and the retention time can also be used as an indicator of qualitative. The column was Delta-Pak C 18 5μιη 3.9 X 150 (Waters Co.), buffer A (0.1% trifluoroacetic acid (TFA) in 95% dH ₂ O and 5% acetonitrile) to buffer B (0.1 %TFA, in 95% and 5% dH ₂ O) Linear gradient elution for 70 min, flow rate 1 ml/min, 220 nm UV detection. The analysis results show that the HPLC chromatogram of rhPTH(l-34) prepared by the above process is a single peak with purity 100%. The results of the RP-HPLC analysis are shown in Figure 7.

3, N, C terminal amino acid sequence analysis

The 15 amino acid sequence of the N-terminal end of rhPTH(l-34) was purified by the Edman degradation method as follows: Ser-Val-Ser-Glu-Ile-Gln-Leu-Met-His-Asn-Leu-Gly- Lys-His-Leu; The C-terminal 3 amino acid sequence of rhPTH(l-34) was determined by carboxypeptidase Y method: His-Asn-Phe. The results of the N- and C-terminal amino acid sequence analysis were identical to the theoretical sequences, indicating that the rhPTH(l-34)-level structure we prepared was correct.

4. Mass spectrometry analysis of rhPTH (l-34)

The purified rhPTH (l-34) was subjected to mass spectrometry using a Finnigan LCQ-Classic mass spectrometer, and the molecular weight of rhPTH (l-34) was determined to be 4117.5 Da (see Figure 9). Contrary to the theoretical value of rhPTH(l-34) (4118.8 Da).

5, endotoxin and pyrogen test

According to the "Chinese Biological Products Regulations" (2000 edition), the "Bacterial Endotoxin Test Procedure for Biological Products", the endotoxin content of the prepared rhFTH (l-34) sample is not higher than 10Ευ/20μ _β by the sputum reagent method. rhPTH (l-34). According to the "Chinese Biological Products Regulations" (2000 edition) "Bioproducts Thermal Test Procedures", the rabbits were used to determine their pyrogens as negative. Example 7 Determination of PTH activity

UMR-106-01 cells (purchased from ATCC) were seeded in 96-well cell culture plates at an inoculum of 1 to 2 X 10 ⁵ cells/mL, incubated at 37 ° C, 5% C0 ₂ overnight. The cells were washed once with serum-free medium and added to the medium (containing 20 mM Hepes, 0.1% bovine serum albumin, 0.2 mM IBMX (3-isobutyl-1-methylxanthine, Sigma), pH 7.4) 18 ( ^L, add 20 L to the medium to dilute to different concentrations of hPTH (l-34) and its standards (purchased from the WHO Biological Products Standards Laboratory (NIBSC)), with and without IBMX control , double wells, incubated at 37 ° C, 5% C0 ₂ for 45 min. Remove the medium, add 200 L 0.1N HCl per well, incubate for 30 min, fully lyse the cells, take the supernatant and use cAMP (low pH) KIT (R&D, Cat No. DE0355) Determine the cAMP value. The data is processed using computer software and the results are calculated as follows: Sample to be tested pre-dilution multiple sample to be tested half-effect dilution multiple test sample titer = standard product titer XX

The half-effect dilution factor of the standard pre-dilution multiples showed that the rhPTH (l-34) we prepared had the same biological activity as the WHO control, and its specific activity was greater than 1.0 X 10 ⁵ U/mg rhPTH (l-34). ). Example 8 Main pharmacodynamic test

The model of primary osteoporosis was established by ovancedomiwd (OVX). After 8 weeks of treatment with rhPTH (l-34), bone mass, bone biomechanics, bone morphometry and bone metabolism related blood were observed. Urine biochemical indicators comprehensively evaluate its therapeutic effect. The results showed that:

1) The wet weight of uterus in the 12-week group was significantly lower than that in the pseudo-ovum group. The bone mass (femur and lumbar spine bone mineral density) and bone biomechanical properties (femoral three-point bending load, lumbar compression load) were more than fake The egg group was significantly reduced, indicating that the rat model of osteoporosis caused by estrogen deficiency was established;

2) rfiPTH (l-34) has obvious therapeutic effects on OVX-induced osteoporosis rats. rhPTH (l-34) treatment for 8 weeks, low dose (10 g / Kg) group for the osteoporosis of the model of femur, lumbar vertebrae (dry weight, gray weight, bone density) biomechanical properties (femur three points The maximum bending load, maximum compression of the lumbar vertebrae, and the trabecular area of the lumbar vertebrae showed a significant improvement and increased with increasing therapeutic dose.

3) In this experiment, rhFTH (l-34) was observed to increase and decrease the fluctuation of blood calcium and phosphorus after 4 hours of injection, and it was normal after 24 hours.

Therefore, rhPTH(l-34) significantly promotes osteoblast formation and has a significant therapeutic effect on osteoporotic rats.

Claims

Rights request:

A fusion protein characterized by having:

(1) a sequence of thioredoxin;

(2) a parathyroid hormone 1-34 peptide located downstream of the thioredoxin.

2. The fusion protein of claim 1, wherein the fusion protein further comprises:

(3) a linker peptide containing a proteolytic enzyme recognition site between the thioredoxin and the parathyroid hormone 1-34 peptide.

3. The fusion protein of claim 2, wherein the proteolytic enzyme recognition site is an enterokinase recognition site.

The fusion protein according to claim 3, wherein the C-terminus of the enterokinase recognition site is directly linked to the N-terminus of the parathyroid hormone 1-34 peptide.

5. The fusion protein of claim 4, wherein the fusion protein further comprises:

(4) An optional (His) ₆ -Tag located in the linker peptide or at the C-terminus or the N-terminus of the thioredoxin.

6. The fusion protein of claim 5, wherein the fusion protein has a sequence from the N-terminus to the C-terminus: a thioredoxin-(His) ₆ -Enterokinase recognition site-parathyroid hormone 1-34 peptide.

A recombinant DNA sequence encoding the fusion protein of any one of claims 1 to 6.

8. The recombinant DNA sequence of claim 7, comprising the following nucleotide sequence encoding an enterokinase recognition site-parathyroid hormone 1-34 peptide in the fusion protein: CGTAAAAAACTGCAGGACGTTCACAACTTC.

An expression vector comprising the recombinant DNA sequence of claim 7 or 8 under the control of a promoter.

10. The expression vector of claim 9, wherein the nucleotide sequence encoding the fusion protein is as follows:

CACAACTTC o