CN1706947A - Construction, expression and purification method of recombinant human parathyroid hormone in colibacillus - Google Patents

Abstract

The present invention relates to medicine biological engineering technology, and is cDNA of small peptide encoding human parathyroid hormone and the method of preparing human parathyroid hormone with its expression vector. Through PCR amplification of chemically synthesized recombinant human human parathyroid hormone (1-34) gene and cloning to expression vector pET-35b(+), recombinant human human parathyroid hormone (1-34) is fused to the carboxyl end of cellulose combining structure domain (CBDclose) and efficient expressed. The fusion protein is treated through cellulose resin affinity chromatographic purification, Factor Xa schizolysis to release rhPTH(1-34), the second cellulose resin affinity chromatography, and C4 reverse efficient liquid chromatographic purification to obtain pure rhPTH(1-34). The sample is tested to have molecular weight of 4117.0 Da.

Description

Structure, the expression and purification method of recombinant human parathyroid hormone in intestinal bacteria

Technical field

The present invention relates to the medical bioengineering technical field, is to comprise relating to cDNA of small peptide encoding human parathyroid hormone and utilizing its expression vector to prepare the method for human parathyroid hormone.

Background technology

(parathyroid hormone PTH) is a kind of straight-chain polypeptide of being synthesized justacrine by parathyroid chief cell to Rat parathyroid hormone 1-34 ^[1]Initial synthetic is to contain 115 amino acid whose pre-proparathyroid hormones (prepro-PTH), in rough surfaced endoplasmic reticulum, remove 25 amino-acid residues of N-end and form preparathyroid hormone (pro-PTH), the latter removes one six peptide from the N-end again in golgi body, form to contain 84 amino acid whose PTH.

PTH is the important hormone of regulating calcium level, and its secretion mainly is subjected to the adjusting of blood calcium concentration, and the slight reduction of blood calcium concentration directly stimulates pth secretion PTH, and the PTH secretion then reduced when blood calcium concentration raise.PTH can stimulate bone resorption, makes calcium, phosphorus be released into blood from bone; Promote uriniferous tubules that calcium is heavily absorbed, suppresses phosphorus and heavily absorb that to 1,25-(OH) 2D3 transforms promotion 25-(OH) D3 in kidney; And 1,25-(OH) 2D3 promotes the heavily absorption of enteron aisle to calcium, phosphorus, more than Zuo Yong common result is the rising blood calcium and reduces serium inorganic phosphorus.On the other hand, except that promoting the osteoclast bone resorption, PTH can also cause the increase of scleroblast number, stimulates bone forming, and these characteristics make PTH receive publicity as osteoporosis treatment and preventive medicine ^[2]

The receptor binding domain of PTH is from His14 to Phe34 ^[3,4], aminoterminal is active end, and causes a series of biological effects after the target tissue receptors bind, carboxyl terminal does not have activity.Studies show that in vivo, N-terminal 1 to 34 amino acid fragment of PTH promptly has biological activity completely ^[5]People such as Oldenburg KR once reported ^[6]RhPTH (1-34) variant is connected into eight aggressiveness high expression level in E.coli, for eight aggressiveness being cut into monomer with CNBr, they can be sported Leu by CNBr effect Met residue with what the wild sequence of hPTH (1-34) comprised, the 35th of normal people hPTH is the hPTH variant for people such as Glu thereby Oldenburg KR development, and reaction conditions acutely has severe toxicity again.Zhaoyang X and companion thereof have reported ^[7]RhPTH (1-34) is cloned into GST amalgamation and expression system, and fusion rotein uses prolyl endopeptidase (PEPase) to remove the unnecessary residue of aminoterminal after zymoplasm (thrombin) cutting again, can obtain rhPTH (1-34).Repair the GST-PTH expressing fusion protein system of (2002) structures such as Chaoyang, its GST-PTH Expression of Fusion Protein efficient is 25%, suitable with our expression efficiency of expression strain, but because PTH only accounts for 1/9 (molecular weight of GST is 26kd) in the GST-PTH fusion rotein, and PTH is at CBD _ColsAccount for 1/5 in the-PTH fusion rotein, so in fact the PTH expression efficiency of our expression bacterium is higher than the bacterial strain of repairing structures such as Chaoyang.Suzuki etc. (1998) have made up the expressing fusion protein system that PTH and galactoside enzyme fragment form, and with Kex2 protease hydrolysis fusion rotein.Its Expression of Fusion Protein efficient only is 20%, and the fusion rotein of expressing mainly is that form with inclusion body exists, and needs handle through renaturation.In addition, for keeping the solvability of fusion rotein, the enzymolysis of fusion rotein and the purifying of PTH must carry out in the urea of 3M.Because the Kex2 protease price is expensive and its active decline 50% when 3M urea exists, therefore, the cost of production technique is than higher.Because PHT is exposed in preparation process in the urea-containing solution for a long time, is subjected to chemically modified and activity change that free radical causes easily.Compare the CBD that we make up with the production technique of Suzuki etc. _ClosThe expression efficiency of-PTH bacterial strain surpasses 25%, and CBD _Clos-PTH fusion rotein mainly exists with soluble form, has avoided the renaturation step.In addition, the cracking of fusion rotein is to carry out under the optimum hydrolysising condition of Factor Xa, therefore, and the enzymolysis efficiency height, and enzyme dosage is low.We adopt two step affinity chromatographys purifying CBD respectively in the preparation process of rhPTH _Clos-PTH fusion rotein and rhPTH, purification step is simple.

Summary of the invention

Purpose of the present invention is exactly in order to address the above problem, and proposes structure, the expression and purification method of a kind of recombinant human parathyroid hormone in intestinal bacteria.

Technical solution of the present invention:

Structure, the expression and purification method of a kind of recombinant human parathyroid hormone in intestinal bacteria is characterized in that:

A. the structure of recombinant human parathyroid hormone: with following gene order is template, CCGCGGGT TCCGTTTCTGAAATCCAGCTGATGCACAACCTGGGTAAACACCTGAACTCTATGGA ACGTGTTGAATGGCTGCGTAAGAAACTGCAGGACGTACACAACTTCTAA CTCGAG, the solid line place is respectively the restriction enzyme site of SacII, XhoI, dotted line place sequence encoding Factor Xa recognition site Ile-Glu-Gly-Arg ↓ and, with GGACTG CCGCGGGTATTGAGGGTCGCTCCGTTTC is the upstream primer sequence, and the solid line place is the restriction enzyme site of SacII, by polymerase chain reaction synthesizing recombined human parathyroid hormone plain gene;

B. is connected with expression plasmid pET-35b (+) behind SacII, XhoI double digestion by polymerase chain reaction synthetic recombinant human parathyroid hormone gene, the recombinant plasmid transformed E.coli DH5 α host bacterium after the connection is carried out the expression of recombinant human parathyroid hormone through SacII, XhoI double digestion;

C. the recombinant human parathyroid hormone of Biao Daing is with celluosic resin (CB _IND 200 Resin) affinity chromatography separation and purification.

Described recombinant human parathyroid hormone gene order comprise the restriction enzyme site of SacII, XhoI and coding Factor Xa recognition site Ile-Glu-Gly-Arg ↓.

The recombinant human parathyroid hormone of described expression comes enzymolysis to prepare monomer with Factor Xa, enteropeptidase, and wherein the feature of enteropeptidase is to discern DDDDK-(Asp-Asp-Asp-Asp-Lys-) sequence that GACGACGATGACAAG encodes by specific performance.

A kind of medicinal use of recombinant human parathyroid hormone is mainly used in the not enough disease of treatment osteoporosis and Rat parathyroid hormone 1-34.

It is carrier that the present invention adopts pET35b (+), makes recombinant human parathyroid hormone (1-34) be blended in cellulose binding domain (CBD _Clos) carboxyl terminal, and efficiently expressed, and CBD _Clos-PTH fusion rotein mainly exists with soluble form, has avoided the renaturation step.In sequence, introduce Factor Xa restriction enzyme site again, cut and only need through two step CB by Factor Xa enzyme _IND 200 Resin affinity chromatographys, just can obtain purity more than 80% and N end do not have amino acid whose rhPTH (1-34) crude product of any vector encoded, simplified purifying process greatly, the output that improves PTH greatly reduces the cost of technology simultaneously again.For the research of the industrialization of this polypeptide provides great help and accumulation active data.

Description of drawings

Fig. 1 is rhPTH (1-34)/pET-35b (+) construction of recombinant expression plasmid synoptic diagram.

Fig. 2 is a pcr amplification product double digestion rear clone to (A) pcr amplification rhPTH (1-34) gene of pET-35b (+); (B) the recombinant plasmid double digestion is identified collection of illustrative plates.

Wherein, (A) be the pcr amplification collection of illustrative plates of rhPTH (1-34) gene, 1, DNA markers; 2, the PCR product.(B) be recombinant plasmid through SacII/XhoI double digestion collection of illustrative plates, 1, enzyme section is disconnected; 2, the contrast of PCR fragment.

Fig. 3 is fusion rotein CBD _ClosThe expression and purification collection of illustrative plates of-rhPTH (1-34).

Wherein, 1, albumen markers; 2, non-inductive whole bacterial protein; 3, the inductive whole bacterial protein; 4, the ultrasonic supernatant of thalline; 5, the thalline ultrasound precipitation; 6, through CB _INThe human parathyroid hormone recombinant protein of D 200 Resin affinitive layer purifications.

Fig. 4 is the enzymolysis of fusion rotein and the purifying collection of illustrative plates of rhPTH (1-34).

Wherein, 1, albumen markers; 2, contrast; 3, the enzyme of recombinant protein is cut; 4, the rhPTH monomer of purifying.

Fig. 5 is C4RP-HPLC purifying rhPTH (1-34) monomer spectral line.

Fig. 6 is the mass spectrometric detection spectral line of rhPTH (1-34) sample.

Embodiment

The present invention has selected the preference codon of E.coli for use, so that target protein efficiently expresses, synthetic rhPTH (1-34) gene, and the ATTGAGGGTCGC sequence has been inserted in the upstream at rhPTH (1-34) gene, the amino acid Ile-Glu-Gly-Arg of this sequence encoding ↓ and be the recognition site of Factor Xa ^[8], therefore rhPTH (1-34) is discharged from fusion rotein.

Because low molecular weight polypeptide expression efficiency in thalline lowly and easily is degraded, the normal at present method of gene series connection or fusion rotein that adopts prepares active polypeptide.We select pET-35b (+) as expression vector, with rhPTH (1-34) gene clone to support C BD _ClosThe downstream of gene order, fusion rotein discharges rhPTH (1-34) monomer through Factor Xa effect.CBD _ClosCellulose binding domain from the conjugated protein A of Clostridium cellulovorans Mierocrystalline cellulose (CbpA) ^[9]CBD _ClosUnder neutral pH, combine with Mierocrystalline cellulose by hydrophobic interaction, be widely used in proteic separation and purification.Utilize CBD _ClosThe advantage of purifying protein has: (1) is except can be with CBD combines, Mierocrystalline cellulose not with other most of protein binding, improved the specificity of affinity chromatography, (2) purified material Mierocrystalline cellulose low price, physico-chemical property is stable, and safe, (3) chromatography condition gentleness, wash-out 100% ethylene glycol, harmless to most of polypeptide.CBD _ClosMake fusion rotein can pass through the affinity chromatography efficiently purifying, simultaneously, also convenient with rhPTH (1-34) monomer and the CBD that discharge behind the Factor Xa enzymolysis _ClosAnd the CBD that still contains on a small quantity _ClosUncracked fusion rotein separate.

The present invention has manually synthesized the gene of coding human parathyroid hormone rhPTH (1-34), the sequence that has added coding specificity proteolytic ferment Factor-Xa recognition site at the upstream region of gene of rhPTH (1-34), be inserted into expression vector pET-35b (+), obtain being blended in cellulose binding domain (CBD _Clos) rhPTH (1-34) of carboxyl terminal.CBD _Clos-PTH fusion rotein mainly exists with soluble form, has avoided the renaturation step, can pass through celluosic resin (CB _IND 200 Resin) affinitive layer purification.In addition, the cracking of fusion rotein is to carry out under the optimum hydrolysising condition of Factor Xa, therefore, and the enzymolysis efficiency height, and enzyme dosage is low, though also come enzyme to cut with enteropeptidase, specificity is relatively good, and it costs an arm and a leg, the cost height.Proteolytic ferment Factor Xa can be under the condition of gentleness specific hydrolysis substrate, and fusion rotein can obtain not having at the N end the amino acid whose rhPTH (1-34) of any vector encoded after Factor Xa cracking.Fusion rotein behind the purifying discharges rhPTH (1-34) through the Factor-Xa cracking, again through celluosic resin (CB _IND 200 Resin) affinitive layer purification separates, and concentrates after the RP-HPLC purifying can obtain the pure product of rhPTH (1-34), and purity is more than 95%.By the double CB that crosses _IND 200 Resin affinity chromatographys with compare with different filler pillar purifying, obviously have the advantage that more can remove uncracked human parathyroid hormone recombinant protein, reduce for the pillar infringement in work-ing life of later HPLC purifying greatly.Purifying prepares rhPTH (1-34) with this kind method, and step is simple, mild condition, and cost is low, the yield height, the purity height, product sequence and wild-type are in full accord.

Material and source

Bacterial strain and plasmid: E.coli clone strain DH5 α, E.coli expression strain BL21 (DE3) is the applicant laboratory and preserves.PET-35b (+) is available from Novagen company.

Enzyme and test kit: the T4 dna ligase, restriction enzyme SacII, XhoI, Taw enzyme are all available from Takara company; Proteolytic ferment Factor Xa is available from Novagen company; Plasmid extraction test kit and DNA glue recovery test kit is Shanghai China Shun bio-engineering corporation product in a small amount.

Other reagent: celluosic resin (CB _RND 200 Resin) available from Novagen company; CM-Sepharose is available from Pharmacia company; Preparation type C4 RP-HPLC chromatographic column is available from Waters company; Acetonitrile and trifluoroacetic acid are Fisher company product.

Pcr template and primer: synthetic by Invitrogen company.

RhPTH (1-34) template sequence is: CCGCGGGT

TCCGTTTCTGAAATCCAGCTGATGCACAACCTGGGTAAACACCTGAACTCTATGGA ACGTGTTGAATGGCTGCGTAAGAAACTGCAGGACGTACACAACTTCTAA CTCGAG(draw the restriction enzyme site that the solid line place is respectively SacII, XhoI, stroke dotted line place sequence encoding Factor Xa recognition site Ile-Glu-Gly-Arg ↓.) the upstream primer sequence is: GGACTG CCGCGG(line place is the restriction enzyme site of SacII to GTATTGAGGGTCGCTCCGTTTC.)

The downstream primer sequence is: GCACAT CTCGAG(line place is the restriction enzyme site of XhoI to TTAGAAGTTGTGTACGTCC.)

Embodiment

1. the gene constructed process of structure (Fig. 1) of recombinant expression plasmid rhPTH (1-34)/pET-35b (+).

RhPTH (1-34) template sequence is: CCGCGGGT TCCGTTTCTGAAATCCAGCTGATGCACAACCTGGGTAAACACCTGAACTCTATGGA ACGTGTTGAATGGCTGCGTAAGAAACTGCAGGACGTACACAACTTCTAA CTCGAG(draw the restriction enzyme site that the solid line place is respectively SacII, XhoI, stroke dotted line place sequence encoding Factor Xa recognition site Ile-Glu-Gly-Arg ↓.) the upstream primer sequence is: GGACTG CCGCGG(line place is the restriction enzyme site of SacII to GTATTGAGGGTCGCTCCGTTTC.)

The downstream primer sequence is: GCACAT CTCGAGTTAGAAGTTGTGTACGTCC (line place is the restriction enzyme site of XhoI).Pcr amplification obtains rhPTH (1-34) gene, gets rhPTH (1-34) the gene template 0.1 μ L of synthetic respectively, and upstream primer, downstream primer respectively add to final concentration 1 μ mol/L, add 25mmol/L MgCl again ₂5 μ L, 10 * PCR reaction buffer, 5 μ L, 10mmol/L dNTP MIX 1 μ L, Taq enzyme 0.3 μ L, make up water to 50 μ L.The PCR reaction conditions is: 94 ℃ of pre-sex change 2min; 94 ℃, 30s, 53 ℃, 1min, 72 ℃, 1min, 28 circulations; 72 ℃ are extended 6min.Pcr amplification product is used the SacII/XhoI double digestion behind 2% agarose gel electrophoresis purifying, 2% agarose gel electrophoresis reclaims the fragment after enzyme is cut, and is connected with the same big fragment of pET-35b (+) that obtains with the SacII/XhoI double digestion.Get the product that has connected and be converted in the E.coli DH5 α host bacterium, with SacII/XhoI double digestion screening positive clone, after measured, enzyme cuts product and PCR contrast fragment is onesize, the rhPTH that inserts in the plasmid (1-34) gene sequencing correct (Fig. 2).

2. fusion rotein CBD _ClosThe expression and purification of-rhPTH (1-34) is seeded to LB liquid nutrient medium (containing 50 μ g/mL kantlex), 37 ℃ of overnight incubation after expressing bacterium with the correct plasmid rhPTH (1-34) of dna sequencing/pET-35b (+) Transformed E .coli BL21 (DE3).The bacterium liquid that will spend the night is seeded to fresh LB liquid nutrient medium (containing 50 μ g/mL kantlex) by 1: 50 volume ratio, and OD is worked as in 37 ℃ of joltings ₆₀₀Reach at 0.6～0.8 o'clock, add IPTG, continue to cultivate 4h to final concentration 1mmol/L.It is centrifugal that (4 ℃, 6000r/min 5min) collects thalline.(pH7.5), ice-bath ultrasonic is broken bacterium for 20mmol/L Tris-HCl, 200mmol/LNaCl to add the 10mL lysis buffer by every gram thalline.With the suspension after ultrasonic centrifugal (4 ℃, 10000r/min 30min), collects supernatant, and precipitation is suspended in isopyknic lysis buffer, sampling with 13.5% SDS-PAGE electrophoresis record fusion rotein more than 60% with soluble form in supernatant (Fig. 3).Sample on the supernatant liquor is extremely used 20mmol/L Tris-HCl, pH7.5 equilibrated CB in advance _IND 200 Resin affinity columns are got express developed with level pad, use 20mmol/L Tris-HCl again, 800mmol/L NaCl, 100% ethylene glycol wash-out is used in the pH7.5 washing at last, be in charge of collection, check its purity at (Fig. 3) more than 80% with 13.5% SDS-PAGE electrophoresis.From every liter of fermented liquid, can obtain the fusion rotein of 33mg.

3. the fusion protein sample that the purifying purifying of the enzymolysis of fusion rotein and rhPTH (1-34) is good is to 50mmol/L Tris-HCl, 100mmol/L NaCl, and the pH8.0 dialysed overnight adds CaCl ₂To final concentration 5mmol/L, press the 1mg sample and add 10U Factor Xa, put room temperature (20-21 ℃) enzymolysis 10h after, 16%Tricine SDS-PAGE electrophoresis check enzyme is cut efficient and can be reached more than 85%.Sample on the enzymolysis product is extremely used 20mmol/L Tris-HCl, pH7.5 equilibrated CB in advance _IND 200 Resin affinity columns are collected and are passed the peak.After will passing peak ultrafiltration and concentration (1000MWCO), last sample is to preparation type C4RP-HPLC chromatographic column, with buffer A (100% H ₂O, 0.1% trifluoroacetic acid) and buffer B (95% second eyeball, 0.1% trifluoroacetic acid) carry out linear gradient elution, flow velocity is 1.0mL/min, elution program is: rise to 50% through the concentration of 50min buffer B from 5%, the detection wavelength is 215nm.Collect rhPTH (1-34) absorption peak, its pH is transferred to 5.0, again to the NH of 5mmol/L with rare NaOH ₄HCO ₃Solution is fully dialysed, and reaches pure product (Fig. 4,5) more than 95% through the HPLC purity assay, and the molecular weight of mass spectroscopy show sample is 4117.0 dalton (Fig. 6), and is consistent with rhPTH (1-34) theoretical molecular.

Reference

[1]Kemper?B，Habener?JF，Mulligan?RC.Pre-proparathyroid?hormone：a?directtranslation?product?of?parathyroid?messenger?RNA.Proceedings?of?the?NationalAcademy?of?Sciences?of?USA，1974，71(9)：3731-3735。

[2]Dempster?DW，Cosman?F，Parisien?M，et?al.Anabolic?actions?of?parathyroidhormone?on?bone.Endocrine?Reviews，1993，14(6)：690-709。

[3]Caulfield?MP，McKee?RE，Goldman?ME，et?al.The?bovine?renal?parathyroidhormone(PTH)receptor?has?equal?affinity?for?two?different?amino?acid?sequences：the?receptor?binding?domains?of?PTH?and?PTH-related?protein?are?located?withinthe?14-34?region.Endocrinology，1990，127(1)：83-87。

[4]Lopez-Hilker?S，Martin?KJ，Sugimoto?T，et?al.Biologic?activities?of?parathyroidhormone(1-34)and?parathyroid?hormone-related?peptide(1-34)in?isolatedperfused?rat?femur.Journal?of?Laboratory?and?Clinical?Medicine，1992，119(6)：738-743。

[5]Potts?JT?Jr，Kronenberg?HM，Rosenblatt?M.Parathyroid?hormone：chemistry，biosynthesis，and?mode?of?action.Advanced?Protein?Chemistry，1982，35：323-396。

[6]Oldenburg?KR，D’Orfani?AL，Selick?HE.A?method?for?the?high-level?expressionof?a?parathyroid?hormone?analog?in?Escherichia?coli.Protein?expression?andpurification，1994，5：278-284。

[7]Zhaoyang?X，Min?L，Suijing?Z，et?al.A?new?method?for?the?preparation?of?humanparathyroid?hormone?1-34?peptides.Biotechnology?and?Applied?Biochemistry，2002，36：111-117。

[8]Nagai?K，Perutz?MF，Poyart?C.Oxygen?binding?properties?of?human?mutanthemoglobins?synthesized?in?Escherichia?coli.Proceedings?of?the?NationalAcademy?of?Sciences?of?USA，1985，82(21)：7252-7255。

[9]Peter?T，Al?B，Brad?M，et?al.Characterization?and?affinity?applications?ofcellulose-binding?domains.Journal?of?Chromatography?B，1998，715：283-296。

Claims (4)

1. structure, the expression and purification method of a recombinant human parathyroid hormone in intestinal bacteria is characterized in that:

A. the structure of recombinant human parathyroid hormone: with following gene order is template, CCGCGGGTATTGAGGGTCGCTCCGTTTCTGAAATCCAGCTGATGCACAACCTGGGTAAACACCTGAACTCTATGGA ACGTGTTGAATGGCTGCGTAAGAAACTGCAGGACGTACACAACTTCTAA CTCGAG, the solid line place is respectively the restriction enzyme site of SacII, XhoI, dotted line place sequence encoding Factor Xa recognition site Ile-Glu-Gly-Arg ↓ and, with GGACTG CCGCGGGTATTGAGGGTCGCTCCGTTTC is the upstream primer sequence, and the solid line place is the restriction enzyme site of SacII, by polymerase chain reaction synthesizing recombined human parathyroid hormone plain gene;

B. is connected with expression plasmid pET-35b (+) behind SacII, XhoI double digestion by polymerase chain reaction synthetic recombinant human parathyroid hormone gene, the recombinant plasmid transformed E.coli DH5 α host bacterium after the connection is carried out the expression of recombinant human parathyroid hormone through SacII, XhoI double digestion;

C. the recombinant human parathyroid hormone of Biao Daing is with celluosic resin (CB _IND 200 Resin) affinity chromatography separation and purification.

2. structure, the expression and purification method of recombinant human parathyroid hormone according to claim 1 in intestinal bacteria, it is characterized in that described recombinant human parathyroid hormone gene order comprise the restriction enzyme site of SacII, XhoI and coding Factor Xa recognition site Ile-Glu-Gly-Arg ↓.

3. structure, the expression and purification method of recombinant human parathyroid hormone according to claim 1 in intestinal bacteria, it is characterized in that the recombinant human parathyroid hormone of expressing comes enzymolysis to prepare monomer with Factor Xa, enteropeptidase, wherein the feature of enteropeptidase is to discern DDDDK-(Asp-Asp-Asp-Asp-Lys-) sequence that GACGACGATGACAAG encodes by specific performance.

4. the medicinal use of a recombinant human parathyroid hormone is mainly used in the not enough disease of treatment osteoporosis and Rat parathyroid hormone 1-34.

Images