WO2010015899A2 - Nouvelle méthode pour générer des méganucléases ayant des caractéristiques modifiées - Google Patents

Nouvelle méthode pour générer des méganucléases ayant des caractéristiques modifiées Download PDF

Info

Publication number
WO2010015899A2
WO2010015899A2 PCT/IB2009/000486 IB2009000486W WO2010015899A2 WO 2010015899 A2 WO2010015899 A2 WO 2010015899A2 IB 2009000486 W IB2009000486 W IB 2009000486W WO 2010015899 A2 WO2010015899 A2 WO 2010015899A2
Authority
WO
WIPO (PCT)
Prior art keywords
meganuclease
target
variants
altered
seq
Prior art date
Application number
PCT/IB2009/000486
Other languages
English (en)
Other versions
WO2010015899A3 (fr
Inventor
Frédéric PAQUES
Sylvestre Grizot
Philippe Duchateau
Original Assignee
Cellectis
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/IB2008/002999 external-priority patent/WO2009019614A2/fr
Priority claimed from PCT/IB2008/003744 external-priority patent/WO2009074873A1/fr
Application filed by Cellectis filed Critical Cellectis
Priority to EP09785836A priority Critical patent/EP2329017A2/fr
Priority to US13/057,528 priority patent/US20110207199A1/en
Publication of WO2010015899A2 publication Critical patent/WO2010015899A2/fr
Publication of WO2010015899A3 publication Critical patent/WO2010015899A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1058—Directional evolution of libraries, e.g. evolution of libraries is achieved by mutagenesis and screening or selection of mixed population of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a novel method to engineer and generate meganuclease enzymes with altered specificity for their DNA target, in particular the present invention uses a sequential combinatorial approach to generate engineered meganuclease enzymes.
  • meganucleases essentially comprise homing endonucleases, a family of very rare-cutting endonucleases. This enzyme family was first characterized by the use in vivo of the protein I-Scel (Omega nuclease), originally encoded by a mitochondrial group I intron of the yeast Saccharomyces cerevisiae. Homing endonucleases encoded by intron ORPs, independent genes or intervening sequences (inteins) present striking structural and functional properties that distinguish them from "classical" restriction enzymes which generally have been isolated from the bacterial system R/MII.
  • Homing endonucleases have recognition sequences that span 12-40 bp of DNA, whereas "classical" restriction enzymes recognize much shorter stretches of DNA, in the 3-8 bp range (up to 12 bp for a so called rare-cutter). Therefore homing endonucleases have a very low frequency of cleavage, even in a genome as large and complex as that of a human.
  • LAGLIDADG the largest of the homing endonucleases families. This family is characterized by a conserved tridimensional structure (see below), but displays very poor conservation at the primary sequence level, except for a short peptide above the catalytic center. This family has been called LAGLIDADG, after a consensus sequence for this peptide, found in one or two copies in each LAGLIDADG protein.
  • Homing endonucleases with one LAGLIDADG (L) are around 20 kDa in molecular mass and act as homodimers. Those with two copies (LL) range from 25 kDa (230 amino acids) to 50 kDa (HO, 545 amino acids) with between 70 to 150 residues in each motif and act as a monomer. Cleavage of the target sequence occurs inside the recognition site, leaving a 4 nucleotide staggered cut with 3 'OH overhangs.
  • I-Cewl and I-Crel ⁇ 163 amino acids are homing endonucleases with one LAGLIDADG motif (mono-LAGLIDADG).
  • I-Dmol (194 amino acids, SWISSPROT accession number P21505 (SEQ ID NO: 29)), l-Scel, PI- Pful and PI-SceI are homing endonucleases with two LAGLIDADG motifs.
  • residue numbers refer to the amino acid numbering of the wild type meganuclease, for instance for I-Dmol sequence SWISSPROT number P21505 (SEQ ID NO: 29) or the structure PDB code Ib24; or for I-Crel the sequence of pdb accession code Ig9y, corresponding to the sequence SEQ ID NO: 1.
  • LAGLIDADG proteins with a single motif, such as I-Crel form homodimers and cleave palindromic or pseudo-palindromic DNA sequences, whereas the larger, double motif proteins, such as I-Scel are monomers and cleave non- palindromic targets.
  • Several different LAGLIDADG proteins have been crystallized and they exhibit a striking conservation of the core structure that contrasts with a lack of similarity at the primary sequence level (Jurica et al., MoI Cell. 1998; 2:469-76, Chevalier et al., Nat Struct Biol. 2001; 8:312-6, Chevalier et al., J MoI Biol.
  • LAGLIDADG proteins are central and form two packed ⁇ -helices where a 2-fold (pseudo-) symmetry axis separates two monomers or apparent domains.
  • the LAGLIDADG motif corresponds to residues 13 to 21 in I-Crel, and to positions 14 to 22 and 110 to 1 18, in I-Dmol.
  • a four ⁇ -sheet provides a DNA binding interface that drives the interaction of the protein with the half site of the target DNA sequence.
  • I-Dmol is similar to I-Crel dimers, except that the first domain (residues 1 to 95) and the second domain (residues 105 to 194) are separated by a linker (residues 96 to 104) (Epinat et al., Nucleic Acids Res, 2003, 31: 2952-62).
  • I-Scel was the first homing endonuclease used to stimulate homologous recombination in mammalian cells, wherein it did so to over 1000-fold at a genomic target (Choulika et al., MoI Cell Biol. 1995; 15:1968-73, Cohen-Tannoudji et al., MoI Cell Biol. 1998; 18:1444-8, Donoho et al., MoI Cell Biol. 1998; 18:4070-8, Alwin et al., MoI Ther. 2005; 12:610-7, Porteus., MoI Ther. 2006; 13:438-46, Rouet et al., MoI Cell Biol. 1994; 14:8096-106).
  • I-Scel has also been used to stimulate targeted recombination in the mouse liver in vivo where recombination could be observed in up to 1% of hepato- cytes (Gouble et al., J Gene Med. 2006; 8:616-22).
  • An inherent limitation of such a methodology is that it requires the prior introduction of the natural I-Scel cleavage site into the locus of interest.
  • homing endonucleases represent ideal scaffolds for engineering tailored endonucleases and several studies have shown that the DNA binding domain from LAGLIDADG proteins, (Chevalier et al., Nucleic Acids Res. 2001; 29:3757-74) can be engineered.
  • LAGLIDADG proteins including Pl-Scel (Gimble et al., J MoI Biol. 2003; 334:993-1008), I-Crel (Seligman et al., Nucleic Acids Res. 2002; 30:3870-9, Sussman et al., J MoI Biol. 2004; 342:31-41, Rosen et al., Nucleic Acids Res. 2006; Arnould et al., J MoI Biol. 2006; 355:443-58), I-Scel (Doyon et al., J Am Chem Soc. 2006; 128:2477-84) and I-Msol (Ashworth et al., Nature. 2006; 441:656-9) have been modified by rational or semi-rational mutagenesis and screening to acquire new sequence binding or cleavage specificities.
  • K28, N30 and Q38, or N30, Y33 and Q38 or K28, Y33, Q38 and S40 of l-Crel were mutagenized and a collection of variants with altered specificity at positions ⁇ 8 to 10 of the I-Crel DNA target (10NNN DNA target) were identified by screening (Smith et al, Nucleic Acids Res., 2006, 34, el 49; International
  • I-Crel can target two different variants each comprising a set of mutations have been combined and assembled in a functional heterodimeric endonuclease able to cleave a chimeric target resulting from the fusion of a different half of each variant DNA target sequence
  • residues 28 to 40 and 44 to 77 of I-Crel were shown to form two separable functional subdomains, able to bind distinct parts of a homing endonuclease half-site (Smith et al. Nucleic Acids Res., 2006, 34, el 49; International PCT Applications WO 2007/049095 and WO
  • the meganuclease variants obtained with said semi-rational approach and high throughout screening have altered specificity and cleave new DNA targets; however, even though said approach works well, certain DNA targets remain difficult to generate altered meganucleases for.
  • the inventors have developed a new method which addresses the limitations of the prior art. In particular the inventors have developed a method based upon the sequential selection and combination of mutations which allows a meganuclease to be altered in the desired way.
  • the concept of the sequential combinatorial approach is to fix one mutation set before looking for a further mutation set(s) using the first fixed mutation set as the basis for the subsequent selection.
  • a method to generate and select a meganuclease having at least two altered characteristics in comparison to a parent meganuclease comprising the steps: a. constructing from a parent meganuclease, a first series of variants which differ from said parent meganuclease by at least one acid amino substitution; b. screening the variants from said first series of step a. and selecting those which have a first altered characteristic; c. constructing from the selected variants of step b. a second series of variants having a least one other amino acid substitution; d. screening the variants from said series of step b. and selecting those which have said first altered characteristic and a second altered characteristic.
  • - Amino acid residues in a polypeptide sequence are designated herein according to the one-letter code, in which, for example, Q means GIn or Glutamine residue, R means Arg or Arginine residue and D means Asp or Aspartic acid residue.
  • - Amino acid substitution means the replacement of one amino acid residue with another, for instance the replacement of an Arginine residue with a Glutamine residue in a peptide sequence is an amino acid substitution.
  • the cleavage activity of the variant according to the invention may be measured by any well-known, in vitro or in vivo cleavage assay, such as those described in the International PCT Application WO 2004/067736; Epinat et al, Nucleic Acids Res., 2003, 31, 2952-2962; Chames et al, Nucleic Acids Res., 2005, 33, el78; Arnould et al, J. MoI. Biol., 2006, 355, 443-458, and Arnould et al, J. MoI. Biol., 2007, 371, 49-65.
  • the cleavage activity of the variant of the invention may be measured by a direct repeat recombination assay, in yeast or mammalian cells, using a reporter vector.
  • the reporter vector comprises two truncated, non-functional copies of a reporter gene (direct repeats) and the genomic (non-palindromic) DNA target sequence within the intervening sequence, cloned in a yeast or a mammalian expression vector.
  • the genomic DNA target sequence comprises one different half of each (palindromic or pseudo-palindromic) parent homodimeric meganuclease target sequence. Expression of the heterodimeric variant results in a functional endonuclease which is able to cleave the genomic DNA target sequence.
  • This cleavage induces homologous recombination between the direct repeats, resulting in a functional reporter gene (LacZ, for example), whose expression can be monitored by an appropriate assay.
  • the specificity of the cleavage by the variant may be assessed by comparing the cleavage of the (non-palindromic) DNA target sequence with that of the two palindromic sequences cleaved by the parent homodimeric meganucleases or compared with wild type meganuclease.
  • nucleosides are designated as follows: one-letter code is used for designating the base of a nucleoside: a is adenine, t is thymine, c is cytosine, and g is guanine.
  • r represents g or a (purine nucleotides)
  • k represents g or t
  • s represents g or c
  • w represents a or t
  • m represents a or c
  • y represents t or c (pyrimidine nucleotides)
  • d represents g, a or t
  • v represents g, a or c
  • b represents g, t or c
  • h represents a, t or c
  • n represents g, a, t or c.
  • - by "meganuclease" is intended an endonuclease having a double- stranded DNA target sequence of 12 to 45 bp.
  • Said meganuclease is either a dimeric enzyme, wherein each domain is on a monomer or a monomelic enzyme comprising the two domains on a single polypeptide.
  • “meganuclease domain” is intended the region which interacts with one half of the DNA target of a meganuclease and is able to associate with the other domain of the same meganuclease which interacts with the other half of the DNA target to form a functional meganuclease able to cleave said DNA target.
  • parent meganuclease it is intended to mean a wild type meganuclease or a variant of such a wild type meganuclease with identical properties or alternatively a meganuclease with some altered characteristic in comparison to a wild type version of the same meganuclease.
  • the parent meganuclease can refer to the initial meganuclease from which the first series of variants are derived in step a. or the meganuclease from which the second series of variants are derived in step c.
  • meganuclease variant or “variant” is intented a meganuclease obtained by replacement of at least one residue in the amino acid sequence of the parent meganuclease (natural or variant meganuclease) with a different amino acid.
  • - by "functional variant” is intended a variant which is able to cleave a DNA target sequence, preferably said target is a new target which is not cleaved by the parent meganuclease.
  • such variants have amino acid variation at positions contacting the DNA target sequence or interacting directly or indirectly with said DNA target.
  • first/second series of variants it is intended a collection of variant meganucleases, each of which comprises one or more amino acid substitution in comparison to a parent meganuclease from which all the variants in the series are derived.
  • first/second altered characteristic it is intended to mean a measurable or observable characteristic of a meganuclease enzyme which can be compared and hence determined to be altered in comparison to another meganuclease for the same characterisitic.
  • characterisitics include DNA target speci- ficity, activity and enzymatic structure.
  • derived from it is intended to mean a meganuclease variant which is created from a parent meganuclease and hence the peptide sequence of the meganuclease variant is related to (primary sequence level) but derived from (mutations) the sequence peptide sequence of the parent meganuclease.
  • I-Cref is intended the wild-type I-Crel having the sequence of PDB accession code Ig9y corresponding to the sequence SEQ ID NO:1 in the sequence listing.
  • 1-OeI functions as a dimer, which is made of two I-Crel monomers.
  • I-Crel variant with novel specificity is intended a variant having a pattern of cleaved targets different from that of the parent meganuclease.
  • the terms "novel specificity”, “modified specificity”, “novel cleavage specificity”, “novel substrate specificity” which are equivalent and used indifferently, refer to the specificity of the variant towards the nucleotides of the DNA target sequence.
  • I-Crel variants described comprise an additional Alanine after the first Methionine of the wild type I-Crel sequence. These variants also comprise two additional Alanine residues and an Aspartic Acid residue after the final Proline of the wild type I-Crel sequence. These additional residues do not affect the properties of the enzyme and to avoid confusion these additional residues do not affect the numeration of the residues in I-Crel or a variant referred in the present Patent Application, as these references exclusively refer to residues of the wild type I-Crel enzyme (SEQ ID NO: 1) as present in the variant, so for instance residue 2 of I-Crel is in fact residue 3 of a variant which comprises an additional Alanine after the first Methionine.
  • I-Crel site is intended a 22 to 24 bp double-stranded DNA sequence which is cleaved by I-Crel.
  • I-Crel sites include the wild-type (natural) non- palindromic I-Crel homing site and the derived palindromic sequences such as the sequence 5'- L 12 C -1 ia -1 oa-9a -8 a -7 c-6g- 5 t-4C-3g -2 t-ia + ic +2 g + 3a +4 c + 5g+ 6 U 7 t+8t+9t+ 1 og+i ia + i 2 (SEQ ID NO: 2), also called C1221 ( Figure 1).
  • domain or “core domain” is intended the “LAGLIDADG homing endonuclease core domain” which is the characteristic ⁇ i ⁇ i ⁇ 2 ⁇ 2 ⁇ 3 ⁇ 4 ⁇ 3 fold of the homing endonucleases of the LAGLIDADG family, corresponding to a sequence of about one hundred amino acid residues. Said domain comp ⁇ ses tour beta-strands ( ⁇ i ⁇ 2 ⁇ 3 ⁇ 4 ) folded in an antiparallel beta-sheet which interacts with one half of the DNA target.
  • This domain is able to associate with another LAGLIDADG homing endonuclease core domain which interacts with the other half of the DNA target to form a functional endonuclease able to cleave said DNA target.
  • the LAGLIDADG homing endonuclease core domain corresponds to the residues 6 to 94.
  • subdornain is intended the region of a LAGLIDADG homing endonuclease core domain which interacts with a distinct part of a homing endo- nuclease DNA target half-site.
  • beta-hairpin is intended two consecutive beta-strands of the antiparallel beta-sheet of a LAGLIDADG homing endonuclease core domain (( ⁇ i ⁇ 2 or, ⁇ 3 ⁇ 4 ) which are connected by a loop or a turn,
  • single-chain meganuclease is intended a meganuclease comprising two LAGLIDADG homing endonuclease domains or core domains linked by a peptidic spacer.
  • the single-chain meganuclease is able to cleave a chimeric DNA target sequence comprising one different half of each parent meganuclease target sequence.
  • DNA target DNA target sequence
  • target sequence target sequence
  • target-site "target” , "site”; “site of interest”; "recognition site”, “recognition sequence”, “homing recognition site”, “horning site”, “cleavage site” is intended a 20 to 24 bp double-stranded palindromic, partially palindromic (pseudo-palindromic) or non-palindromic polynucleotide sequence that is recognized and cleaved by a LAGLIDADG homing endonuclease such as l-Crel, or a variant, or a single-chain chimeric meganuclease derived from I-Crel.
  • LAGLIDADG homing endonuclease
  • the DNA target is defined by the 5' to 3' sequence of one strand of the double-stranded polynucleotide, as indicated for C 1221 (see Figure 1). Cleavage of the DNA target occurs at the nucleotides at positions +2 and -2, respectively for the sense and the antisense strand. Unless otherwiwe indi- cated, the position at which cleavage of the DNA target by an l-Cre I meganuclease variant occurs, corresponds to the cleavage site on the sense strand of the DNA target.
  • DNA target half-site by "DNA target half-site", "half cleavage site” or half-site” is intended the portion of the DNA target which is bound by each LAGLIDADG homing endonuclease core domain.
  • chimeric DNA target or “hybrid DNA target” is intended the fusion of a different half of two parent meganuclease target sequences.
  • at least one half of said target may comprise the combination of nucleotides which are bound by at least two separate subdomains (combined DNA target).
  • - by "human IL2RG gene” is intended the normal (wild-type) IL2RG located on chromosome X (XqI 3.1; Gene ID: 3561) and the mutated IL2RG genes (mutant IL2RG; IL2RG allele), in particular the mutants responsible for SCID-Xl.
  • the human IL2RG gene (4145 bp) corresponds to positions 70243984 to 70248128 on the reverse complement strand of the sequence accession number GenBank NC 000023.9. It comprises eight exons (Exon 1: positions 1 to 129; Exon 2: positions 504 to 657; Exon 3: positions 866 to 1050; Exon 4: positions 1259 to 1398; Exon 5: positions 2164 to 2326; Exon 6: positions 2859 to 2955; Exon 7: positions 3208 to 3277; Exon 8: positions 3633 to 4145).
  • the ORF which is from position 15 (Exon 1) to position 3818 (Exon 8), is flanked by short and long untranslated regions, respec- tively at the 5' and 3' end.
  • the wild-type IL2RG gene sequence corresponds to SEQ ID NO: 3 in the sequence listing; the mRNA sequence corresponds to GenBank NM 000206 (SEQ ID NO: 4) and the gamma C receptor amino acid sequence to GenBank NP_000197 (SEQ ID NO: 5).
  • the mature protein (347 amino acids) is derived from a 369 amino acid precursor comprising a 22 amino acid N-terminal signal peptide.
  • - by "DNA target sequence from the IL2RG gene” it is intended a 20 to 24 bp sequence of a primate (simian) IL2RG gene locus, for example the human IL2RG gene locus, which is recognized and cleaved by a meganuclease variant or a single-chain chimeric meganuclease derivative.
  • - by "beta-2-microglobulin gene” is intended the beta-2- microglobulin gene of a mammal.
  • the human beta-2-microglobulin gene (B2M, 6673bp (SEQ ID NO: 83) is situated from positions 42790977 to 42797649 of the sequence corresponding to accession number NC OOOO 15.
  • the B2M gene comprises four exons (Exon 1 : positions 1-127; Exon 2: positions 3937 to 4215; Exon 3: 4843 to 4870; Exon 4: positions 6121 to 6673).
  • the ORF which is from position 61 (Exon 1) to positions 4856 (Exon 3), is flanked by a short and a long untranslated region, respectively at its 5' and 3' ends.
  • DNA target sequence from the beta-2-microglobulin gene it is intended a 20 to 24 bp sequence of the beta-2-microglobulin gene of a mammal which is recognized and cleaved by a meganuclease variant.
  • vector a nucleic acid molecule capable of trans- porting another nucleic acid to which it has been linked.
  • homologous is intended a sequence with enough identity to another one to lead to a homologous recombination between sequences, more particularly having at least 95 % identity, preferably 97 % identity and more preferably 99%.
  • identity refers to sequence identity between two nucleic acid molecules or polypeptides. Identity can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base, then the molecules are identical at that position. A degree of similarity or identity between nucleic acid or amino acid sequences is a function of the number of identical or matching nucleotides at positions shared by the nucleic acid sequences. Various alignment algorithms and/or programs may be used to calculate the identity between two sequences, including FASTA, or
  • mutant is intended the substitution, deletion, insertion of one or more nucleotides/amino acids in a polynucleotide (cDNA, gene) or a polypeptide sequence.
  • Said mutation can affect the coding sequence of a gene or its regulatory sequence. It may also affect the structure of the genomic sequence or the structure/stability of the encoded mRNA.
  • This new method has a number of advantages over prior art methods and in particular a major advantage of the method according to the present invention is that synergistic mutations can be found, these are mutations which do not generate the desired characteristic by themselves but instead act with other mutations to elicit the desired characteristic. Such synergistic mutations cannot be found using prior art methods, as the selection at different times of the two or more desired characteristics means that mutations which give rise to both characterisitics simultaneously are not selected for and hence cannot be found.
  • a further advantage of this method is that it can be used to generate meganuclease enzymes to targets for which previous attempts with prior art methods have failed. Examples of this are set out in the detailed description below.
  • this method is useful for generating and selected an altered meganuclease, starting with a parent meganuclease which is a member from the LAGLIDADG family.
  • this method involves the construction in steps a. and c. of a first and a second series of variants which differ from their respective parent meganuclease by at least one amino acid substitution in at least one of the functional domains or subdomains of said first and/or second series of variants.
  • the parent meganuclease is either a wildtype meganuclease or a functional variant of a wild type meganuclease.
  • the selected meganuclease from step a. or c. is a single- chain meganuclease.
  • Single-chain chimeric meganucleases able to cleave a DNA target from the gene of interest are derived from the variants according to the invention by methods well-known in the art (Epinat et al, Nucleic Acids Res., 2003, 31, 2952-62; Chevalier et al, MoI, Ce]I, , 2002, 1O 5 895-905: Steuer et ⁇ /., Chembiochem., 2004, 5, 206-13; International PCT Applications WO 03/078619 and WO 2004/031346).
  • any of such methods may be applied for constructing single-chain chimeric mega- nucleases for use either as the parent meganuclease in the method according to the present invention or so as to combine two monomers from the same or different meganucleases generated using the present method into a single chain chimeric meganuclease.
  • such methods can also be used to convert any of the specific varitants detailed in the present Patent Application into a single chain meganuclease.
  • the parent meganuclease is selected from the group comprising: I-Sce I, I-Chu I, I-Cre I, I-Csm I, Pl-Sce I, PI-TU I, PI-Mtu I, I-Ceu I, I- Sce II, I-Sce III, HO, Pi-Civ I, PI-Ctr I, PI-Aae I, PI-Bsu I, PI-Dha I, PI-Dra I, PI- Mav I, PI-Mch I, PI-Mfu I, PI-Mfl I, PI-Mga I, PI-Mgo I, PI-Mm I, PI-Mka I, PI-MIe I, PI-Mma I, PI-Msh I, PI-Msm I, PI-Mth I, PI-Mtu I, PI-Mxe I, PI-Npu I, PI-P
  • the inventors have shown that their new sequential combinatorial method works with a number of meganucleases and therefore this same method can be used to engineer the characteristics of any other meganuclease selected from the above list.
  • This list is not exhaustive and other meganuclease are encompassed by the present invention as are known variants of for instance I-Crel, I-Dmol and I-Msol.
  • the parent meganuclease comprises at least one I-Crel monomer.
  • I-Crel is amongst the most studied and characterised of all the meganucleases. Extensive structural and biochemical information is available for this enzyme as are a vast array of existing variants which show various characterisitics. Therefore using this existing store of information, a meganuclease comprising one 1-
  • Crel monomer such as a chimeric fusion protein or a homo or hetero-dimeric I-Crel enzyme, is a preferred starting point for the method according to the present invention.
  • the at least one I-Crel monomer is modified in step a. and/or step c. of said method, such that at least one of the residues in positions 19, 24, 28, 30, 32, 33, 37, 38, 40, 44, 50, 54, 66, 68, 70, 75, 77, 79, 80, 81, 105, 129, 132 of said I-Crel monomer is substituted.
  • the substitution of at least one of these residues in step a. and/or step c. can be used as the starting point for the present method.
  • the parent meganuclease is chimeric comprising a first domain from a first meganuclease and a second domain from a second meganuclease.
  • workers have also combined enzymatic domains from different meganucleases, such as E-Drel (Chevalier et al, MoI Cell. 2002; 10:895-905).
  • E-Drel consists of the fusion of the N-terminal domain of I-Dmol to a single subunit of the I-Crel homodimer linked by a flexible linker to create the initial scaffold for the enzyme.
  • DmoCre I-CreIII-DmoI hybrids
  • the first domain and/or second domain can comprise in the case of a dimeric meganuclease, the complete monomer for instance of I-Crel.
  • the first and/or second domain can comprise a portion of the enzyme, this portion comprising the essential enzymatic domains, as discussed above, so as to allow the chimeric enzyme to function.
  • the first domain is from I-Dmol.
  • the I-Dmol domain consists of residues 1 to 95 of the wild type l-Dmol protein (SEQ ID NO: 29).
  • I-Dmol domain may also comprise the l-Dmol linker, located at positions 96 to 104 and the beginning of the second l-Dmol domain located at positions 105 to 109 of the wild type l-Dmol protein (SEQ ID NO: 29).
  • this method involves the selection of at least one meganuclease which has at least two altered characteristics which are selected from the group comprising: altered DNA target specificity for at least one nucleotide in said DNA target; altered enzymatic activity levels; altered kinetics; altered domain-domain structure.
  • this new sequential combinatorial method can also be used to select for other alterations in meganuclease activity such as increased activity, activity at a selected temperature for instance 37°C or the selection of a meganuclease which has more stable domain - domain structures either within a monomeric or hetero/homo- dimeric meganuclease.
  • the first series of variants and/or the second series of variants are obtained by constructing a nucleic acid library encoding said parent meganuclease of step a. or encoding the selected variants of step b. respectively; and mutating said nucleic acid libraries so as to introduce a mutation into the sequence encoded therein; and expressing the first series of variants and/or the second series of variants from each of said respective libraries for screening in steps b. and d. respectively.
  • one or both of the libraries of nucleic acid molecules are created by random mutagenesis of a nucleic acid molecule encoding said parent meganuclease from step a. or encoding the selected variants of step b.
  • Random mutagenesis of the coding sequences of the meganuclease forms one aspect of the present invention. Random mutagenesis is attractive as it is possible to obtain unexpected mutations which have characteristic altering properties. Conversely, random mutagenesis requires that a larger pool of mutants to be sampled as on a per mutation basis the chance of obtaining a valuable mutant is smaller than using a site-directed mutagenesis approach.
  • one or both of the libraries of nucleic acid molecules are created by site directed mutagenesis.
  • site directed mutagenesis has previously been used in the re-engineering of meganucleases, for instance specific mutations of an amino acid residue thought or known to contact a particular nucleotide often lead to an alteration in specificity of the mutant meganuclease for this particular nucleotide.
  • Site directed mutagenesis can therefore be used to increase the chances that a desired alteration will occur in the mutant library.
  • the present invention also encompasses methods involving a combination of these two approaches, that is a method involving the site directed mutagenesis of one or more selected amino acid residues as well as a background level of mutagenesis across all the residues of the meganuclease.
  • steps c. and d. of the method can be repeated a number of times ('n') to generate a meganuclease with a number of additional altered charac- teristic(s) ('n').
  • the present invention relates to a method to generate a meganuclease which has at least two altered characteristics in comparison to the parent meganuclease.
  • the present invention can also however be used to generate a meganuclease which comprises additional altered characteristics.
  • steps c. and d. of the method are repeated and the selection of meganuclease mutants showing the required combination of altered characteristics are made in each iteration of step d.
  • Steps c. and d. can be repeated a number of times 'n' so as to generate a meganuclease with a number of altered characteristics n (plus the original two altered characteristics).
  • the I-Dmol domain is modified in step a. and/or step c.
  • the present invention also relates to a polypeptide which comprises or consists of any one of SEQ ID NO: 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 89, 90, 91, 92, 93, 94, 94, 95, 96, 97, 105, 106, 107, 108, 109, 110, 112; said polypeptide being able to be obtained according to the method defined above.
  • polypeptide is a functional meganuclease in vitro and in vivo.
  • polypeptide is an I-Crel variant.
  • polypeptide according to this aspect of the present invention may comprise a detectable tag at its NH 2 and/or COOH terminus.
  • the present invention also relates to a polynucleotide, this polynucleotide being characterized in that it encodes a polypeptide according to the present invention.
  • the present invention also relates to a vector, characterized in that it comprises a polynucleotide according to the present invention.
  • the present invention also relates to a host cell, characterized in that it is modified by a polynucleotide or a vector according to the present invention.
  • the recombinant vectors comprising said polynucleotide may be obtained and introduced in a host cell by the well-known recombinant DNA and genetic engineering techniques.
  • the polypeptide of the invention may be obtained by culturing the host cell containing an expression vector comprising a polynucleotide sequence encoding said polypeptide, under conditions suitable for the expression of the polypeptide, and recovering the polypeptide from the host cell culture.
  • the present invention also relates to a non-human transgenic animal, characterized in that all or part of its constituent cells is modified by a polynucleotide or a vector according to the present invention.
  • the present invention also relates to a transgenic plant, characterized in that all or part of its constituent cells is modified by a polynucleotide or a vector according to the present invention.
  • the present invention also relates to the use of a meganuclease according to the present invention in a therapeutic method, in particular a meganuclease according to the present invention can be used for genome therapy ex vivo (gene cell therapy) and genome engineering. Most particularly the described meganucleases could be used to insert, delete or repair an endogenous or exogenous coding sequence.
  • the meganuclease (or a polynucleotide encoding said meganuclease) and/or the targeting DNA are contained within a vector.
  • Vectors comprising targeting DNA and/or nucleic acid encoding a meganuclease can be introduced into a cell by a variety of methods (e.g., injection, direct uptake, projectile bombardment, liposomes, electroporation).
  • Meganucleases can be stably or transiently expressed into cells using expression vectors. Techniques of expression in eukaryotic cells are well known to those in the art. (See Current Protocols in Human Genetics:
  • the meganuclease and if present, the vector comprising targeting DNA and/or nucleic acid encoding the meganuclease are imported or translocated by the cell from the cytoplasm to the site of action in the nucleus.
  • the meganuclease Whilst within the nucleus the meganuclease will cut any targets present in the genome and the vector resulting in double strand breaks which will be repaired by the endogenous repair mechanisms of the host cell and when a repair occurs between the genome and vector sequence this will result in a genome engineering event such as an insertion, deletion or repair.
  • the meganucleases and a pharmaceutically acceptable excipient are administered in a therapeutically effective amount.
  • Such a combination is said to be administered in a "therapeutically effective amount” if the amount administered is physiologically significant.
  • An agent is physiologically significant if its presence results in a detectable change in the physiology of the recipient.
  • an agent is physiologically significant if its presence results in a decrease in the severity of one or more symptoms of the targeted disease and in a genome correction of the lesion or abnormality.
  • Figure 1 represents the IL2RG3 target sequences and its derivatives. All targets are aligned with the C 1221 target (SEQ ID NO: 8), a palindromic sequence cleaved by 1-Crel. 10GAC_P, 10GAA_P, 5CTG_P and 5AGG_P (SEQ ID NO: 79-82) are close derivatives found to be cleaved by 1-OeI mutants. They differ from C 1221 by the boxed motives.
  • IL2C_P (SEQ ID NO: 9) differs from 5AGG_P by the bases at position ⁇ 11 and ⁇ 7.
  • the IL2RG3.6 target (SEQ ID NO: 7) differs from IL2RG3.4 by the boxed four central bases.
  • IL2RG3 (SEQ ID NO: 86) is the DNA sequence located in the human IL2RG gene at position 1686.
  • IL2RG3.2 target (SEQ ID NO: 87) the TCTC sequence in the middle of the target is replaced with GTAC, the bases found in C1221.
  • IL2RG3.3 (SEQ ID NO: 88) is the palindromic sequence derived from the left part of IL2RG3.2
  • IL2RG3.4 (SEQ ID NO: 6) is the palindromic sequence derived from the right part of IL2RG3.2.
  • the motives from 10GAC_P, 10GAA_P, 5CTG_P and 5AGG_P are found in the IL2RG3 series of targets.
  • Figure 2 represents yeast screening of 5AGG P cutters against the IL2C P target. Mutants are in the upper left dot of the cluster. The two right dots are experiment internal controls. The three clones that were chosen for further studies are circled.
  • Figure 3 represents an example of primary screening of mutants belonging to the SeqLibl library against the IL2RG3.4 target (SEQ ID NO:6). Columns and rows are respectively noted from 1 to 12 and from A to H. In each 6 dots yeast cluster, four SeqLibl mutants are screened against the IL2RG3.4 target. The two right dots are cluster internal controls. HlO, HI l and Hl 2 are also experiment controls. A positive clone is circled.
  • Figure 4 represents cleavage activity of the three mutants Amell to Amel3 (SEQ ID NO:26 to 28) toward the IL2RG3.4 (SEQ ID NO:6) and IL2RG3.6 (SEQ ID NO:7) targets.
  • yeast cluster the same mutant is screened four times against the same target (four left dots).
  • the upper right dot is the Seq4 mutant and the bottom right dot is an experiment internal control.
  • Figure 5 Schematic Restriction map of pCLS0542
  • Figure 6 The figure displays an example of primary screening of DmoCre2 mutants from the SeqDC10NNN4ACT library against the combined DC10TGG4ACT target. In each yeast cluster, the two right dots are experiment internal controls. For the other four dots, one dot corresponds to one mutant from the SeqDC10NNN4ACT library. Three positives clones are black circled.
  • Figure 7 Example of primary screening of the SeqIL2RG3-2 mutant library toward both IL2RG3.3 (SEQ ID NO:88) and IL2RG3.5 targets.
  • yeast cluster the two right dots are experiment internal controls while each other dot is a mutant from the library.
  • Some very strong IL2RG3.3 cutters that cleave also the IL2RG3.5 target have been black circled.
  • Figure 8 The figure displays the secondary screening of the improved IL2RG3.5 cutters after addition of single mutation by site directed mutagenesis. In each four dots yeast cluster, the two left dots are an improved
  • the right bottom dot is an experiment internal control and the upper right dot is the SeqC mutant.
  • Figure 9 Yeast screening of heterodimers resulting from co- expression of mutants obtained by the sequential combinatorial method.
  • the I12RG3.4 mutants are in lines A to G (mutants SeqIL2RG4-l to IL2RG4-7 (SEQ ID NO: 72 to 78)) and the IL2RG3.5 mutants are in columns 1 to 9 (mutants SeqIL2RG5-l to SeqIL2RG5-9 (SEQ ID NO:63 to 71)).
  • yeast cluster the two left dots are a heterodimer and the two right dots, experiment internal controls.
  • Figure 10 Gene correction activity of the IL2RG3 meganuclease composed of the two SeqIL2RG5-l and SeqIL2RG4-7 mutants.
  • the frequency of LacZ positive cells is represented in function of the amount of transfected expression plasmid (for example, 250 ng represents 250 ng of each expression vector).
  • Figure 11 a. Some 22bp DNA targets are represented. As shown in the Figure, the boxed motifs from 10CTG_P and 5TTTJP are found in the B2M11.4 target, b. Yeast screening toward the B2M11.4 target of the SeqB2M1 1.4 mutant carrying single mutations. In each four dots yeast cluster, the two left dots are the mutant, the bottom right dot is an experiment internal control and the upper right dot is the SeqB2Ml 1.4 mutant (cleavage almost not detectable in this experiment).
  • Figure 12 represents the pCLSl 107 vector map.
  • Figure 13 represents the pCLS1055 vector map.
  • Figure 14 represents the pCLS1088 vector map.
  • Figure 15 represents the pCLS0404 vector map
  • the IL2RG3.6 target DNA sequence (SEQ ID NO: 7) differs from
  • IL2RG3.4 (SEQ ID NO: 6) only by the four central base pairs that are called 2NN 2NN.
  • IL2RG3.4 carries GTAC as the C1221 target (SEQ ID NO: 8) while
  • IL2RG3.6 has a TCTC sequence like the IL2RG3 target (SEQ ID NO: 86, Figure 1) and is therefore more difficult to cleave by an l-Crel derived mutant.
  • SEQ ID NO: 86, Figure 1 The Inventors have previously observed that the association of a mutant cleaving a palindromic target with a wild-type 2NN 2NN sequence with a mutant cleaving the other palindromic target will increase the probability of cleavage of the target of interest.
  • the concept of the sequential combinatorial approach is to fix one mutation set (here mutations allowing for IL2C P cleavage) before looking for the second mutation set.
  • site-directed mutagenesis was performed on the IL2RG3.4 proteins obtained so as to obtain an I-Crel enzyme with cleavage activity toward the IL2RG3.6 target.
  • step a Construction of the sequential mutant libraries SeqLibl and SeqLib2 Using the method according to the present invention, in step a. experiments were conducted to screen 36 I-Crel mutants able to cleave the 5AGG P target for activity also against the IL2C P target, this gave some positive clones ( Figure 2). Three positive mutants were isolated and it is these which were used to generate the SeqLibl and SeqLib2 mutant libraries as detailed below.
  • the two mutant libraries SeqLibl and SeqLib2 were generated from the DNA of a pool of the three IL2C P cutters.
  • SeqLibl which contains mutations at positions 30 and 33
  • two separate overlapping PCR reactions were carried out that amplify the 5' end (aa positions 1-41) or the 3' end (aa positions 34- 166) of the I-Crel derived mutants coding sequence.
  • step c. of the method according to the present invention and generate the second series of variants which in turn were screened for their activity for the second altered characteristic, in this example IL2RG3.4 cleavage.
  • the template was the pCLS0542 vector ( Figure 5).
  • PCR amplification is carried out using a primer specific to the pCLS0542 vector (GaIlOR 5'-acaaccttgattggagacttgacc-3'; SEQ ID NO: 10) and a primer specific to the I-Crel coding sequence for amino acids 34-43 (10RG34For 5'-aagtttaaacatcagctaagcttgaccttt-3'; SEQ ID NO: 11).
  • PCR amplification is carried out using a primer specific to the pCLS0542 vector (GaIlOF 5'-gcaactttagtgctgacacatacagg-3': SEQ ID NO: 12) and a primer specific to the I-Crel coding sequence for amino acids 25-41 (10RG34Revl 5'- caagcttagctgatgtrtaaacttmnnagactgmnntggtttaatctgagc-3'; SEQ ID NO: 13).
  • the MNN code in the oligonucleotide resulting in a NNK codon at positions 30 and 33 allows the degeneracy at these positions among the 20 possible amino acids.
  • the SeqLib2 library that contains mutations at positions 28, 32 and 33 was built using the same method but with the use of the primer 10RG34Rev2 (5'- caagcttagctgatgtttaaacttmbnmbnctggtttggmbnaatctgagc-3'; SEQ ID NO: 14) instead of 10RG34Revl.
  • the MBN code in the oligonucleotide resulting in a NVK codon at positions 28, 32 and 33 allows the degeneracy at these positions among all the 20 possible amino acids but F, L, M, I and V.
  • the 1132V and E80K mutations were introduced on a DNA pool consisting of DNA molecules encoding Seq4, Seq5 and Seq7 I-Crel mutants from Table I below.
  • This further modification of the variants isolated in step d. of the method according to the present invention shows that further iterative steps can be used to introduce further altered characteristics into a meganuclease generated according to the method.
  • Site-directed mutagenesis libraries were created by PCR. For example, to introduce the Il 32V substitution into the coding sequences of the mutants, two separate overlapping PCR reactions were carried out that amplify the 5' end (residues 1-137) or the 3' end (residues 127-167) of the 1-OeI coding sequence.
  • PCR amplification is carried out using a primer with homology to the vector [GaIlOF 5'-gcaactttagtgctgacacatacagg-3' (SEQ ID NO: 12) or GaIlOR 5'-acaaccttgattggagacttgacc-3' (SEQ ID NO: 10) and a primer specific to the 1-OeI coding sequence for amino acids 14-24 that contains the substitution mutation I132VF: 5'-acctgggtggatcaggttgcagctctgaacgat-3'(SEQ ID NO: 22) and I132VR: 5'- atcgttcagagctgcaacctgatccacccaggt-3'(SEQ ID NO: 23).
  • PCR products contain 33 bp of homology with each other.
  • the PCR fragments were purified.
  • approximately 25 ng of each of the two overlapping PCR fragments and 75 ng of vector DNA were linearized by digestion with Dr ⁇ lll and NgoMYV were used to transform the yeast Saccharomyces cerevisiae strain FYC2-6A (MAT ⁇ , trpl ⁇ 63, leu2 ⁇ l, his3 ⁇ 200) using a high efficiency LiAc transformation protocol (Gietz and Woods, Methods Enzymol., 2002, 350, 87-96).
  • Intact coding sequences containing the 1132V substitution are generated by in vivo homologous recombination in yeast.
  • Mating was performed using a colony gridder (QpixII, Genetix). Mutants were gridded on nylon filters covering YPD plates, using a low gridding density (about 4 spots/cm 2 ). A second gridding process was performed on the same filters to spot a second layer consisting of different reporter-harboring yeast strains for each target. Membranes were placed on solid agar YPD rich medium, and incubated at 30 °C for one night, to allow mating.
  • filters were transferred to synthetic medium, lacking leucine and tryptophan, with galactose (2 %) as a carbon source, and incubated for five days at 37°C, to select for diploids carrying the expression and target vectors. After 5 days, filters were placed on solid agarose medium with 0.02 % X-GaI in 0.5 M sodium phosphate buffer, pH 7.0, 0.1 % SDS, 6 % dimethyl formamide (DMF), 7mM ⁇ -mercaptoethanol, 1 % agarose, and incubated at 37°C, to monitor ⁇ -galactosidase activity. Results were analyzed by scanning and quantification was performed using appropriate software. d) Sequencing of mutants
  • yeast DNA was extracted using standard protocols and used to transform E. coli. Sequence of mutant ORF were then performed on the plasmids by MILLEGEN SA. Alternatively, ORFs were amplified from yeast DNA by PCR (Akada et al, Biotechniques, 2000, 28, 668- 670), and sequence was performed directly on PCR product by MILLEGEN SA. Results
  • EXAMPLE 2 Making of new DmoCre derived mutants combining two sets of mutations and cleaving the combined DC10TGG4ACT target Another strategy to broaden the range of targets recognised and cut by meganucleases is to combine domains from distinct meganucleases. This approach has been used to create new meganucleases by domain swapping between I-Crel and I-Dmol, leading to the generation of a meganuclease cleaving the hybrid sequence corresponding to the fusion of the two half parent target sequences (Epinat et al., Nucleic Acids Res. 2003; 31:2952-62, Chevalier et al., MoI. Cell. 2002; 10:895-905).
  • DmoCre is a chimeric molecule built from the two homing endonucleases I-Dmol and I-Crel. It includes the N-terminal portion from I-Dmol linked to an I-Crel monomer. DmoCre could have a tremendous advantage as scaffold: mutation in the I-Dmol moiety could be combined with mutations in the I- Crel domain, and thousands of such variant I-Crel molecules have already been identified and profiled (Smith J et al., Nucleic Acids Res.
  • the target was cloned as follows: an oligonucleotide corresponding to the target sequence flanked by gateway cloning sequence was ordered from Proligo: S'TGGCATACAAGTTTTCCCAGGAAGTTACGACGTTTTGACAATCGTCTGT CA-3' SEQ ID NO: 31. Double-stranded target DNA, generated by PCR amplification of the single stranded oligonucleotide, was cloned using the Gateway protocol (Invitrogen) into yeast reporter vector (pCLS1055, Figure 13). Yeast reporter vector was transformed into S. cerevisiae strain FYBL2-7B (MAT a, ura3_4851, trplzl63, leu2Jl, lysZd202).
  • DmoCre2 SeqDC 10NNN4 ACT mutant library First, the DNA coding for the eight DmoCre2 mutants able to cleave the DC4ACT target were pooled, these eight mutants were isolated according to steps a. and b. of the method according to the present invention. Then, this DNA pool was used as a template for two separate overlapping PCR reactions in order to generate DmoCre2 derived coding sequences containing mutations at positions 29 and 33, these corresponding to step c. of the method according to the present invention.
  • the first PCR reaction amplifies the 5' end of DmoCre2 coding sequence (aa positions 1-40) using the primers GaIlOF (5'-GCAACTTTAGTGCTGACACATACAGG-S' SEQ ID NO: 12) and D10CreRev2 (5'- GATCACAACACGATATTCGCTMNNGTTACC TTTMNNTTTC AGCTTGTA-3' SEQ ID NO: 33) and the second PCR reaction amplifies the 3' end (positions 34-264) of the DmoCre2 coding sequence using the primers specific GaIlOR (5'-ACAACCTTGATTGGAGACTTGACC-S' SEQ ID NO: 10) and D10CreFor2 (5'-AGCGAATATCGTGTTGTGATCACCCAGAAGTCTG-S' SEQ ID NO: 35).
  • the MNN code in the D10CreRev2 oligonucleotide resulting in a NNK codon at positions 29 and 33 allows the degeneracy at these positions among the 20 possible amino acids.
  • 25 ng of each of the two overlapping PCR fragments and 75 ng of overlapping vector DNA (pCLS0542, Figure 5) linearized by digestion with Ncol and Eagl were used to transform the yeast Saccharomyces cerevisiae strain FYC2-6A (MAT a, ura3.d851, t ⁇ lJ63, Ieu2-.11, lys2_d202) using a high efficiency LiAc transformation protocol (Gietz et al., Methods Enzymol. 2002; 350:87-96).
  • Membranes were placed on solid agar YPD rich medium, and incubated at 30°C for one night, to allow mating. Next, filters were transferred to synthetic medium, lacking leucine and tryptophan, with galactose (2%) as a carbon source, and incubated for five days at 37°C, to select for diploids carrying the expression and target vectors. After 5 days, filters were placed on solid agarose medium with 0.02% X-GaI in 0.5 M sodium phosphate buffer, pH 7.0, 0.1% SDS, 6% dimethyl formamide (DMF), 7mM ⁇ -mercaptoethanol, 1% agarose, and incubated at 37°C, to monitor ⁇ -galactosidase activity. Results were analyzed by scanning and quantification was performed using proprietary software. Sequencing of mutants
  • yeast DNA was extracted using standard protocols and used to transform E. coli. Sequencing of mutant ORF were then performed on the plasmids by Millegen SA.
  • ORFs were amplified from yeast DNA by PCR (Akada et al., Biotechniques. 2000; 28:668-70, 672, 674), and sequencing was performed directly on PCR product by Millegen SA.
  • Table HI Sequence (aa 75 to 77) of the eight DC4ACT cutters that were chosen to create the SeqDC10NNN4ACT library
  • the SeqDC10NNN4ACT library was then screened using our yeast screening assay toward the combined DC10TGG4ACT target.
  • the screening assay gave 1 1 positive clones and part of the screening is shown in Figure 6, where three positive clones are black circled.
  • the inventors have shown that it is possible to associate mutations of residues interacting with nucleotides at positions +8 to +10 of the C12D34 target (SEQ ID NO: 34) with mutations of residues interacting with nucleotides at positions +2 to +4 of the C12D34 target in order to cleave a combined target.
  • EXAMPLE 3 Making of meganucleases cleaving the IL2RG3.3 5 and IL2RG3.5 target sequences by using a sequential combinatorial approach
  • IL2RG3.3 cutters To obtain IL2RG3.3 cutters, a sequential combinatorial approach was adopted. In a prior art approach, to cleave such a target, mutations from 5CTG P cutters and 10GAC_P cutters would be combined to cleave the combined IL2RG3.3 target (SEQ ID NO: 88).
  • IL2RG3.3 15 IL2RG3.3 by the four central base pairs that are called 2NN 2NN.
  • IL2RG3.3 carries GTAC as the C 1221 target while IL2RG3.5 has a TCTC sequence like the IL2RG3 target and is therefore more difficult to cleave by an I-Crel derived mutant.
  • Activity toward the IL2RG3.5 target was then enhanced by site directed mutagenesis on proteins obtained by the sequential combinatorial method.
  • Seql0IL2RG3-l SeqIL2RG3-2 and Seql0IL2RG3-3 were generated from the DNA of a pool of three 5CTG P cutters.
  • SeqlOIL2RG3-l which contains mutations at positions 30 and 33, two separate overlapping PCR reactions were carried out that amplify the 5' end (aa positions 1-39) or the 3' end (aa positions 34-166) of the I-Crel derived mutants coding sequence.
  • PCR amplification is carried out using a primer specific to the pCLS0542 vector (GaIlOR 5'-ACAACCTTGATTGGAGACTTGACC-3' (SEQ ID NO: 10)) and a primer specific to the I-Crel coding sequence for amino acids 34-43 (10RG33Forl 5'-aagtttaaacatcagctaagcttgaccttt-3' (SEQ ID NO: 45)).
  • PCR amplification is carried out using a primer specific to the pCLS0542 vector (GaIlOF 5'- GCA ACTTTAGTGCTGACACATACAGG-S' (SEQ ID NO: 12)) and a primer specific to the I-Crel coding sequence for amino acids 25-39 (10RG33Revl 5'- tagctgatgtttaaacttmnnagactgmnntggtttaatctgagc-3' (SEQ ID NO: 46)).
  • the MNN code in the oligonucleotide resulting in a NNK codon at positions 30 and 33 allows the degeneracy at these positions among the 20 possible amino acids.
  • the SeqIL2RG3-2 library that contains mutations at positions 33 and 40 was built using the same method but with the use of the primer 10RG33For2 (5'- aagtttaaacatcagctannkttgaccttt-3' (SEQ ID NO: 47)) instead of 10RG33Forl and primer 10RG33Rev2 (5'-tagctgatgtttaaacttmnnagactggtttggtttaatctgagc-3' (SEQ ID NO: 48)) instead of 10RG33Revl.
  • primer 10RG33For2 5'- aagtttaaacatcagctannkttgaccttt-3' (SEQ ID NO: 47)
  • primer 10RG33Rev2 5'-tagctgatgtttaaacttmnnagactggtttggtttaatctgagc-3' (SEQ ID NO: 48)
  • the primers 10RG33For3 (5'- aagtttaaacatcagctanvkttgaccttt-3' (SEQ ID NO: 49)
  • 10RG33Rev3 5'- tagctgatgtttaaacttmbnagactggtttggmbnaatctgagc-3' (SEQ ID NO: 50)) were used.
  • NVK codon at positions 28, 33 and 40 allows the degeneracy at these positions among all the 20 possible amino acids but F, L, M, I and V.
  • 25ng of each of the two overlapping PCR fragments and 75ng of vector DNA (pCLS0542) linearized by digestion with Ncol and Eagl were used to transform the yeast Saccharomyces cerevisiae strain FYC2-6A (MAT ⁇ , trpl ⁇ 63, leu2 ⁇ l, his3 ⁇ 200) using a high efficiency LiAc transformation protocol (Gietz R D and Woods R A Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Methods Enzymol. 2002; 350:87-96).
  • An intact coding sequence containing mutations at desired positions is generated by in vivo homologous recombination in yeast. 1116 clones were picked for the two first libraries and 2232 for the third library.
  • I-Crel derived mutants were chosen for their ability to cleave the 5CTG P target. They carry respectively the following mutations in comparison to the wild-type I-Crel enzyme: 24V44R68Y70S75E77R (SEQ ID NO: 105), 44K68Y70S75E77V (SEQ ID NO: 106) and 44R68Y70S77N (SEQ ID NO: 107).
  • 24V44R68Y70S75E77R SEQ ID NO: 105
  • 44K68Y70S75E77V SEQ ID NO: 106
  • 44R68Y70S77N SEQ ID NO: 107.
  • three different mutant libraries were then built by degenerating amino acids positions 30 and 33 for the first library (SeqlOIL2RG3- 1), 33 and 40 for the second library (SeqlOIL2RG3-2) and 28, 33 and 40 for the third library (SeqlOIL2RG3-3).
  • EXAMPLE 4 Making of meganucleases cleaving the IL2RG3 target by co-expression of ⁇ L2RG3.3 and IL2RG3.4 mutants obtained both by the sequential combinatorial method.
  • the Inventors decided to test whether the IL2RG3.3 and IL2RG3.4 mutants obtained using the sequential combinatorial approach in examples 1 and 3 above could be coexpressed and whether the resulting heterodimer was able to cleave the combined IL2RG3 target.
  • the IL2RG3.3 and IL2RG3.4 mutants were coexpressed in yeast.
  • the co-expression lead to the formation of heterodimers, whose activity toward the IL2RG3 target was monitored.
  • each mutant must be in a different vector backbone with a different selection marker.
  • IL2RG3.4 mutants were cloned into the pCLS1107, see Figure 12.
  • a PCR was performed using the GaIlOF (SEQ ID NO: 12) and GaIlOR (SEQ ID NO: 10) primers.
  • 25ng of each of the PCR fragment and 75ng of vector DNA (pCLSl 107) linearized by digestion with NgoMIV and DraIII were used to transform the yeast Saccharomyces cerevisiae strain FYC2-6A (MAT ⁇ , trpl ⁇ 63, leu2 ⁇ l, his3 ⁇ 200) using a high efficiency LiAc transformation protocol.
  • IL2RG3.3 cutters nine IL2RG3.5 cutters were coexpressed with seven IL2RG3.4 cutters (three of them cleaving the IL2RG3.6 target).
  • the activity of the 63 resulting heterodimers was monitored on the IL2RG3 target using the yeast screening assay described previously in examples 1, 2 and 3.
  • Table VI IL2RG3.5 mutants that were chosen for co-expression to cleave the IL2RG3 target.
  • Table VII IL2RG3.4 mutants that were chosen for co-expression to cleave the IL2RG3 target.
  • Figure 9 shows that almost all the different 63 heterodimers cleave the IL2RG3 target with different cleavage intensities. Some heterodimers achieve IL2RG3 cleavage with a strong intensity.
  • mutants obtained using the combinatorial approach have led to a wide selection of heterodimeric I-Crel enzymes which exhibit good levels of IL2RG3 cleavage in yeast.
  • EXAMPLE 5 Induction of gene correction activity in CHO cells with the IL2RG3 meganuclease formed by co-expression of mutants obtained by the sequential combinatorial method.
  • This assay is based on the use of a chromosomal reporter system in CHO cells ( Figure 10).
  • a single-copy of the LacZ gene is driven by the CMV promoter is interrupted by the IL2RG3 sequence and is as a result non- functional.
  • the transfection of the CHO cell line with plasmids coding for both partners of the IL2RG3 meganuclease and a LacZ repair plasmid allows the restoration of a functional LacZ gene by homologous recombination. It has previously been shown that double-strand breaks can induce homologous recombination; therefore the frequency with which the LacZ gene is repaired is indicative of the cleavage efficiency of the genomic IL2RG3 target site.
  • Each mutant ORF was amplified by PCR using the primers CCM2For ' (5'- aagcagagctctctggctaactagagaacccactgcttactggcttatcgaccatggccaataccaaatataacaaagagttc c-3': SEQ ID NO: 100) and CCMRev ⁇ O (5'-ctgctctagactaaggagaggactttttcttctcag-3': SEQ ID NO: 101).
  • the PCR fragment was digested by the restriction enzymes Sad and Xbal, and was then ligated into the vector pCLS1088 ( Figure 14) digested also by Sad and Xbal.
  • CHO-Kl cell lines harbouring the reporter system were seeded at a density of 2x10 5 cells per 10cm dish in complete medium (Kaighn's modified F- 12 medium (F12-K), supplemented with 2 mM L-glutamine, penicillin (100 UI/ml), streptomycin (100 ⁇ g/ml), amphotericin B (Fungizone) (0.25 ⁇ g/ml) (INVITROGEN- LIFE SCIENCE) and 10% FBS (SIGMA- ALDRICH CHIMIE).
  • Figure 10 shows that the meganuclease formed by the co-expression of the SeqIL2RG5-l and SeqIL2RG4-7 mutants is able to induce gene correction at a frequency level of 0.3% in CHO cells.
  • This same experiment has been conducted with meganucleases constituted by I-Crel derived mutants issued from the classical combinatorial method but gene correction frequency of only 0.05% could have been obtained. Therefore, the sequential combinatorial method has yielded meganucleases able to cleave the IL2RG3 target and that can induce gene correction in CHO cells at higher levels than the meganucleases obtained by the classical combinatorial method.
  • EXAMPLE 6 Making of meganucleases cleaving the B2M11.4 target sequence by using a sequential combinatorial approach
  • Beta-2-microglobulin is a serum protein found in association with the major histocompatibility complex (MHC) class I heavy chain on the surface of nearly all nucleated cells.
  • MHC major histocompatibility complex
  • the 22bp B2M11 DNA sequence (5'- TGA A ATTAGGTACAAAGTCAGA-S' (SEQ ID NO: 98)) is located in the first intron of the human B2M coding gene.
  • the B2M11.4 target (5'- TCTGACTTTGTACAAAGTCAGA-3' (SEQ ID NO: 99)) is a palindromic target derived from the right part of the B2M11 DNA sequence ( Figure 1 Ia). Using prior art classical methods, the inventors have obtained only one very weak B2M11.4 cutter.
  • the B 2Ml 1.4 target is a combination of the 5TTT P and 10CTG_P targets. Therefore, nine I-Crel mutants able to cleave the 5TTT P target (isolated according to steps a. and b. of the method according to othe present invention) were selected and the SeqlOB2M11.4 mutant library degenerated at positions 33 and 38 was built and screened in the yeast (corresponding to steps c. and d. of the method according to the present invention). The initial B2M11.4 cleavage activity of the selected variants was then further enhanced by site-directed mutagenesis. Material and Methods
  • the SeqlOB2M11.4 mutant library was generated from the DNA of a pool of nine 5TTT P cutters.
  • SeqlOB2M11.4 which contains mutations at positions 33 and 38, two separate overlapping PCR reactions were carried out that amplify the 5' end (aa positions 1-32) or the 3' end (aa positions 27-166) of the I-Crel derived mutants coding sequence.
  • PCR amplification is carried out using a primer specific to the pCLS0542 vector (GaIlOR 5'-
  • PCR amplification is carried out using a primer specific to the pCLS0542 vector (GaIlOF 5'-GCAACTTTAGTGCTGACACATACAGG-S' (SEQ ID NO: 12)) and a primer specific to the I-Crel coding sequence for amino acids 25-32 (SeqlOBMRevl 5'-agactggtttggtttaatctgagc-3' (SEQ ID NO: 103)).
  • the NVK codon at positions 33 and 38 allows the degeneracy at these positions among all the 20 possible amino acids but F, L, M, I and V.
  • SeqlOB2M11.4 mutant library was screened against the B2M11.4 target using our yeast screening assay. Only one very weak cutter (SeqB2M11.4 Mutant) with detectable activity was identified. Its sequence is 31R33G38Y44K70T (SEQ ID NO: 108). It appears to be derived from the KRTDI 5TTT P cutter (SEQ ID NO: 95) with mutations 33G38Y introduced during the library construction and the 3 IR coming probably from a PCR mutation.
  • the sequential combinatorial method is a better alternative to the prior art method to obtain I-Crel mutants with modified specificity and able to cleave the target of interest.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Ecology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

La présente invention concerne une méthode permettant de générer et de sélectionner une méganucléase ayant au moins deux caractéristiques modifiées par rapport à une méganucléase parente. Ladite méthode comporte les étapes consistant à : a. construire à partir d'une méganucléase parente une première série de variants qui diffèrent de ladite méganucléase parente par au moins une substitution d'acide aminé ; b. cribler les variants issus de ladite première série de l'étape a. et sélectionner ceux qui possèdent une première caractéristique modifiée ; c. construire à partir des variants sélectionnés de l'étape b. une seconde série de variants ayant au moins une autre substitution d'acide aminé ; d. cribler les variants issus de ladite série de l'étape b. et sélectionner ceux qui possèdent ladite première caractéristique modifiée et une seconde caractéristique modifiée. L'invention concerne également le polypeptide obtenu à partir de ladite méthode.
PCT/IB2009/000486 2007-08-03 2009-02-09 Nouvelle méthode pour générer des méganucléases ayant des caractéristiques modifiées WO2010015899A2 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP09785836A EP2329017A2 (fr) 2008-08-04 2009-02-09 Nouvelle méthode pour générer des méganucléases ayant des caractéristiques modifiées
US13/057,528 US20110207199A1 (en) 2007-08-03 2009-02-09 Novel method to generate meganucleases with altered characteristics

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
PCT/IB2008/002999 WO2009019614A2 (fr) 2007-08-03 2008-08-04 Variants de méganucléase clivant une séquence cible d'adn provenant du gène de la chaîne gamma du récepteur de l'interleukine-2 humain, et leurs utilisations
IBPCT/IB2008/002999 2008-08-04
PCT/IB2008/003744 WO2009074873A1 (fr) 2007-12-13 2008-12-12 Enzymes améliorées de méganucléase chimère et leurs utilisations
IBPCT/IB2008/003744 2008-12-12

Publications (2)

Publication Number Publication Date
WO2010015899A2 true WO2010015899A2 (fr) 2010-02-11
WO2010015899A3 WO2010015899A3 (fr) 2010-03-25

Family

ID=41566035

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2009/000486 WO2010015899A2 (fr) 2007-08-03 2009-02-09 Nouvelle méthode pour générer des méganucléases ayant des caractéristiques modifiées

Country Status (2)

Country Link
EP (1) EP2329017A2 (fr)
WO (1) WO2010015899A2 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011104382A1 (fr) * 2010-02-26 2011-09-01 Cellectis Utilisation d'endonucléases pour insérer des transgènes dans des locus safe harbor
WO2012149470A1 (fr) 2011-04-27 2012-11-01 Amyris, Inc. Procédés de modification génomique
EP2687605A1 (fr) 2012-07-19 2014-01-22 Biogemma Procédé pour effectuer une recombinaison homologue
WO2015095804A1 (fr) 2013-12-19 2015-06-25 Amyris, Inc. Procédés d'intégration génomique
WO2016073955A3 (fr) * 2014-11-06 2016-07-07 President And Fellows Of Harvard College Cellules ne présentant pas d'expression en surface de b2m et procédés pour l'administration allogène de ces cellules
WO2017112859A1 (fr) * 2015-12-23 2017-06-29 Precision Biosciences, Inc. Méganucléases génétiquement modifiées comportant des séquences de reconnaissance que l'on trouve dans le gène de la microglobuline bêta-2 humaine
US10799535B2 (en) 2015-10-05 2020-10-13 Precision Biosciences, Inc. Engineered meganucleases with recognition sequences found in the human T cell receptor alpha constant region gene
US11053484B2 (en) 2017-06-30 2021-07-06 Precision Biosciences, Inc. Genetically-modified T cells comprising a modified intron in the T cell receptor alpha gene
US11268065B2 (en) 2015-10-05 2022-03-08 Precision Biosciences, Inc. Genetically-modified cells comprising a modified human T cell receptor alpha constant region gene
EP4219731A2 (fr) 2016-05-18 2023-08-02 Amyris, Inc. Compositions et procédés d'intégration génomique d'acides nucléiques dans des tampons d'atterrissage exogènes
US11786554B2 (en) 2018-04-12 2023-10-17 Precision Biosciences, Inc. Optimized engineered nucleases having specificity for the human T cell receptor alpha constant region gene

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050003420A1 (en) * 2003-07-01 2005-01-06 Xu Shuang-Yong Recycled mutagenesis of restriction endonuclease toward enhanced catalytic activity
WO2006097853A1 (fr) * 2005-03-15 2006-09-21 Cellectis Variantes des meganucleases i-crei a specificite modifiee: procede de preparation et d'utilisation correspondants
WO2006097784A1 (fr) * 2005-03-15 2006-09-21 Cellectis Variants de meganuclease i-crei presentant une specificite modifiee, leur procede de preparation, et leurs utilisations
WO2007049095A1 (fr) * 2005-10-25 2007-05-03 Cellectis Variants d'endonuclease de liaison a laglidadg comprenant des mutations dans deux sous-domaines fonctionnels et leur utilisation
WO2007049156A2 (fr) * 2005-10-25 2007-05-03 Cellectis Variants de l'endonuclease homing i-crei a nouvelle specificite de clivage et leur utilisation

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050003420A1 (en) * 2003-07-01 2005-01-06 Xu Shuang-Yong Recycled mutagenesis of restriction endonuclease toward enhanced catalytic activity
WO2006097853A1 (fr) * 2005-03-15 2006-09-21 Cellectis Variantes des meganucleases i-crei a specificite modifiee: procede de preparation et d'utilisation correspondants
WO2006097784A1 (fr) * 2005-03-15 2006-09-21 Cellectis Variants de meganuclease i-crei presentant une specificite modifiee, leur procede de preparation, et leurs utilisations
WO2007049095A1 (fr) * 2005-10-25 2007-05-03 Cellectis Variants d'endonuclease de liaison a laglidadg comprenant des mutations dans deux sous-domaines fonctionnels et leur utilisation
WO2007049156A2 (fr) * 2005-10-25 2007-05-03 Cellectis Variants de l'endonuclease homing i-crei a nouvelle specificite de clivage et leur utilisation

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9290748B2 (en) 2010-02-26 2016-03-22 Cellectis Use of endonucleases for inserting transgenes into safe harbor loci
WO2011104382A1 (fr) * 2010-02-26 2011-09-01 Cellectis Utilisation d'endonucléases pour insérer des transgènes dans des locus safe harbor
US9701971B2 (en) 2011-04-27 2017-07-11 Amyris, Inc. Methods for genomic modification
WO2012149470A1 (fr) 2011-04-27 2012-11-01 Amyris, Inc. Procédés de modification génomique
US8685737B2 (en) 2011-04-27 2014-04-01 Amyris, Inc. Methods for genomic modification
EP2687605A1 (fr) 2012-07-19 2014-01-22 Biogemma Procédé pour effectuer une recombinaison homologue
WO2014013056A1 (fr) 2012-07-19 2014-01-23 Biogemma Procédé pour la mise en œuvre d'une recombinaison homologue
WO2015095804A1 (fr) 2013-12-19 2015-06-25 Amyris, Inc. Procédés d'intégration génomique
WO2016073955A3 (fr) * 2014-11-06 2016-07-07 President And Fellows Of Harvard College Cellules ne présentant pas d'expression en surface de b2m et procédés pour l'administration allogène de ces cellules
US11268065B2 (en) 2015-10-05 2022-03-08 Precision Biosciences, Inc. Genetically-modified cells comprising a modified human T cell receptor alpha constant region gene
US10799535B2 (en) 2015-10-05 2020-10-13 Precision Biosciences, Inc. Engineered meganucleases with recognition sequences found in the human T cell receptor alpha constant region gene
US11266693B2 (en) 2015-10-05 2022-03-08 Precision Biosciences, Inc. Nucleic acids encoding engineered meganucleases with recognition sequences found in the human T cell receptor alpha constant region gene
JP2018538000A (ja) * 2015-12-23 2018-12-27 プレシジョン バイオサイエンシズ，インク． ヒトβ−２ミクログロブリン遺伝子に見られる認識配列を有する操作されたメガヌクレアーゼ
JP2021101704A (ja) * 2015-12-23 2021-07-15 プレシジョン バイオサイエンシズ，インク． ヒトβ−２ミクログロブリン遺伝子に見られる認識配列を有する操作されたメガヌクレアーゼ
WO2017112859A1 (fr) * 2015-12-23 2017-06-29 Precision Biosciences, Inc. Méganucléases génétiquement modifiées comportant des séquences de reconnaissance que l'on trouve dans le gène de la microglobuline bêta-2 humaine
EP3988655A3 (fr) * 2015-12-23 2022-08-03 Precision Biosciences, Inc. Méganucléases génétiquement modifiées comportant des séquences de reconnaissance que l'on trouve dans le gène de la microglobuline bêta-2 humaine
JP7203873B2 (ja) 2015-12-23 2023-01-13 プレシジョン バイオサイエンシズ，インク． ヒトβ－２ミクログロブリン遺伝子に見られる認識配列を有する操作されたメガヌクレアーゼ
EP4219731A2 (fr) 2016-05-18 2023-08-02 Amyris, Inc. Compositions et procédés d'intégration génomique d'acides nucléiques dans des tampons d'atterrissage exogènes
US11053484B2 (en) 2017-06-30 2021-07-06 Precision Biosciences, Inc. Genetically-modified T cells comprising a modified intron in the T cell receptor alpha gene
US11786554B2 (en) 2018-04-12 2023-10-17 Precision Biosciences, Inc. Optimized engineered nucleases having specificity for the human T cell receptor alpha constant region gene

Also Published As

Publication number Publication date
WO2010015899A3 (fr) 2010-03-25
EP2329017A2 (fr) 2011-06-08

Similar Documents

Publication Publication Date Title
US20110207199A1 (en) Novel method to generate meganucleases with altered characteristics
WO2010015899A2 (fr) Nouvelle méthode pour générer des méganucléases ayant des caractéristiques modifiées
EP2126066B1 (fr) Variants d'endonucléase homing laglidadg à une nouvelle spécificité de substrat et leur utilisation
Arnould et al. Engineered I-CreI derivatives cleaving sequences from the human XPC gene can induce highly efficient gene correction in mammalian cells
AU2006314220B2 (en) Laglidadg homing endonuclease variants having mutations in two functional subdomains and use thereof.
US8715992B2 (en) I-CreI meganuclease variants with modified specificity, method of preparation and uses thereof
EP2231697B1 (fr) Enzymes améliorées de méganucléase chimère et leurs utilisations
US20100146651A1 (en) Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof
WO2007034262A1 (fr) Méganucléases hétérodimériques et leur utilisation
US20140112904A9 (en) Method for enhancing the cleavage activity of i-crei derived meganucleases
WO2009001159A1 (fr) Procédé permettant d'améliorer l'activité de clivage de méganucléases dérivées de i-crei
WO2008059317A1 (fr) Variantes de méganucléases clivant une séquence cible d'adn du gène hprt et leurs utilisations
US20110041194A1 (en) I-msoi homing endonuclease variants having novel substrate specificity and use thereof
US20130149786A1 (en) I-crei variants with new specificity and methods of their generation
WO2011021062A1 (fr) Variants de méganucléase clivant une séquence d’adn cible du gène d’acide lysosomique alpha-glucosidase humain et utilisations de ceux-ci

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09785836

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2009785836

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13057528

Country of ref document: US