WO2011021062A1 - Variants de méganucléase clivant une séquence d’adn cible du gène d’acide lysosomique alpha-glucosidase humain et utilisations de ceux-ci - Google Patents

Variants de méganucléase clivant une séquence d’adn cible du gène d’acide lysosomique alpha-glucosidase humain et utilisations de ceux-ci Download PDF

Info

Publication number
WO2011021062A1
WO2011021062A1 PCT/IB2009/006832 IB2009006832W WO2011021062A1 WO 2011021062 A1 WO2011021062 A1 WO 2011021062A1 IB 2009006832 W IB2009006832 W IB 2009006832W WO 2011021062 A1 WO2011021062 A1 WO 2011021062A1
Authority
WO
WIPO (PCT)
Prior art keywords
positions
gaa
sequence
variant
nucleotide triplet
Prior art date
Application number
PCT/IB2009/006832
Other languages
English (en)
Inventor
Jean-Pierre Cabaniols
Original Assignee
Cellectis
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cellectis filed Critical Cellectis
Priority to PCT/IB2009/006832 priority Critical patent/WO2011021062A1/fr
Priority to PCT/IB2010/053751 priority patent/WO2011021166A1/fr
Publication of WO2011021062A1 publication Critical patent/WO2011021062A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand

Definitions

  • the invention relates to meganuclease variants which cleave a DNA target sequence from the human lysosomal acid ⁇ -glucosidase gene, to vectors encoding such variants, to a cell, an animal or a plant modified by such vectors and to the use of these meganuclease variants and products derived therefrom for genome therapy, ex vivo (gene cell therapy) and genome engineering.
  • Lysosomal acid ⁇ -glucosidase gene or lysosomal acid maltase gene encodes an enzyme that hydrolyzes linear ⁇ 1-4 and ⁇ 1-6 glucosidic linkages ranging from large polymers (glycogen) to maltose and the artificial substrate 4-MU- ⁇ -D-glucoside (Palmer, T.N., Biochem. J., 1971, 124, 701-711). Its activity leads to the production of monosaccharides such as glucose, preventing the accumulation of glycogen in the organism.
  • the GAA gene (SEQ ID NO: 3) is located on Chromosome 17 at the position 17q25.2-25.3, spans approximately 20kb and contains 20 exons (Accession number GenBank NC_000017.9 or NT_024871.11).
  • the first exon is non-coding.
  • the size of the mRNA is about 3.6 kb.
  • the promoter has features characteristic of a "housekeeping" gene.
  • the coding sequence is 2859 base pairs long and gives rise to a protein 953 amino acids long with a molecular weight of 105 kD.
  • the name of the gene product is acid ⁇ -glucosidase or acid maltase.
  • GAA glycogen storage disease type II, GAADII; or acid maltase deficiency, AMD
  • GAADII acid maltase deficiency
  • AMD acid maltase deficiency
  • Pompe's disease is characterized by symptoms including hypotonia with a massive accumulation of glycogen in skeletal and heart muscle with death due to cardiorespiratory failure. Patients with the slowly progressive later onset forms die due to respiratory failure. In all cases, affected subjects accumulate progressively higher amounts of non degraded glycogen in their lysosomes and autophagosomes, leading to distension of the organelles and subsequent cellular and tissue dysfunction.
  • the enzyme deficiency in Pompe's disease is caused by mutations in the acid ⁇ -glucosidase gene (GAA).
  • GAA acid ⁇ -glucosidase gene
  • the nature of the mutations in the acid ⁇ - glucosidase gene and the combination of mutant alleles determine the level of residual lysosomal acid ⁇ -glucosidase activity and primarily the clinical phenotype of Pompe's disease.
  • exceptional cases have been described, in general a combination of two alleles with fully deleterious mutations leads to the virtual absence of acid ⁇ - glucosidase activity and to the severe classic infantile phenotype.
  • a severe mutation in one allele and a milder mutation in the other result in a slower progressive phenotype with residual activity up to 23% of average control activity.
  • Pompe's disease is an untreatable disorder, for which only supportive care is available, namely dietary and physiotherapy to reduce the incidence and severity of the disease although in general such supportive care will only temporarily improve the symptoms and not alter the final outcome for the disease which in general is mortality in infant onset type Pompe's disease.
  • Myozyme the first treatment for patients with Pompe disease, received marketing authorization in the European Union, followed in April 2006 by FDA approval in the United States.
  • Myozyme is manufactured by Genzyme and is an 'enzyme replacement therapy' (ERT). The rationale for this therapy is to treat the disease by intravenous administration of the deficient enzyme.
  • Homologous gene targeting strategies have been used to knock out endogenous genes (Capecchi M.R., Science, 1989, 244, 1288-1292; Smithies 0., Nat Med, 2001, 7, 1083-1086) or knock-in exogenous sequences into the genome. It can as well be used for gene correction, and in principle, for the correction of mutations linked with monogenic diseases.
  • gene correction is difficult to achieve clinically, due to the low efficiency of the process (10 ⁇ 6 to 10 "9 events per transfected cell).
  • several methods have been developed to enhance this yield. For example, chimeraplasty (de Semir D.
  • Another strategy to enhance the efficiency of recombination is to deliver a DNA double-strand break in the targeted locus ( Figure IA), using an enzymatically induced double strand break at or around the locus where recombination is required.
  • the most accurate way to correct a genetic defect is to use a repair matrix with a non mutated copy of the gene, resulting in a reversion of the mutation.
  • the efficiency of gene correction decreases as the distance between the mutation and the DSB grows, with a five-fold decrease by 200 bp of distance. Therefore, a given DNA cleaving enzyme can be used to correct only mutations in the vicinity of its DNA target.
  • exon knock-in An alternative, termed “exon knock-in” is featured in Figure IB.
  • a meganuclease cleaving in the 5' part of the gene can be used to knock-in functional exonic sequences upstream of the deleterious mutation.
  • this method places the transgene in its regular location, it also results in exons duplication, whose long term impact remains to be seen.
  • this alteration to the gene environment could also lead to further unwanted effects such as over or under expression of the altered gene.
  • this method has a tremendous advantage in that a single DNA cleaving enzyme could be used to correct any mutation affecting a patient.
  • Meganucleases have been identified as a suitable enzyme to induce the required double strand break.
  • Meganucleases are by definition sequence-specific endonucleases recognizing large sequences (Thierry, A. and B. Dujon, Nucleic Acids Res., 1992, 20, 5625-5631). They can cleave unique sites in living cells, thereby enhancing gene targeting by 1000-fold or more in the vicinity of the cleavage site (Puchta et al, Nucleic Acids Res., 1993, 21, 5034-5040 ; Rouet et al, MoI. Cell. Biol., 1994, 14, 8096-8106 ; Choulika et al, MoI. Cell.
  • ZFPs Zinc-Finger Proteins
  • Fokl a class IIS restriction endonuclease
  • functional sequence-specific endonucleases Smith et al, Nucleic Acids Res., 1999, 27, 674-681; Bibikova et al, MoL Cell. Biol., 2001, 21, 289-297; Bibikova et al, Genetics, 2002, 161, 1169-1175; Bibikova et al, Science, 2003, 300, 764; Porteus, M.H. and D.
  • ZFPs have serious limitations, especially for applications requiring a very high level of specificity, such as therapeutic applications. It was recently shown that Fokl nuclease activity in ZFP fusion proteins can act with either one recognition site or with two sites separated by variable distances via a DNA loop (Catto et al, Nucleic Acids Res., 2006, 34, 1711-1720). Thus, the specificities of these ZFP nucleases are degenerate, as illustrated by high levels of toxicity in mammalian cells and Drosophila (Bibikova et al, Genetics, 2002, 161, 1169-1175; Bibikova et al., Science, 2003, 300, 764-.).
  • HEs Homing Endonucleases
  • proteins families Cholier, B. S. and B. L. Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774.
  • proteins are encoded by mobile genetic elements which propagate by a process called "homing”: the endonuclease cleaves a cognate allele from which the mobile element is absent, thereby stimulating a homologous recombination event that duplicates the mobile DNA into the recipient locus.
  • homologous recombination event that duplicates the mobile DNA into the recipient locus.
  • LAGLIDADG The LAGLIDADG family, named after a conserved peptidic motif involved in the catalytic center, is the most widespread and the best characterized group. Seven structures are now available. Whereas most proteins from this family are monomeric and display two LAGLIDADG motifs, a few ones have only one motif, but dimerize to cleave palindromic or pseudo-palindromic target sequences.
  • LAGLIDADG peptide is the only conserved region among members of the family, these proteins share a very similar architecture ( Figure 2A).
  • the catalytic core is flanked by two DNA-binding domains with a perfect twofold symmetry for homodimers such as l-Crel (Chevalier, et al, Nat. Struct. Biol., 2001, 8, 312-316) and I-Afeol (Chevalier et al, J. MoL Biol, 2003, 329, 253-269) and with a pseudo symmetry for monomers such as l-Scel (Moure et al, J. MoI.
  • residues 28 to 40 and 44 to 77 of I-Crel were shown to form two separable functional subdomains, able to bind distinct parts of a homing endonuclease half-site (Smith et al Nucleic Acids Res., 2006, 34, el49; International PCT Applications WO 2007/049095 and WO 2007/057781).
  • the combination of the two former steps allows a larger combinato- rial approach, involving four different subdomains.
  • the different subdomains can be modified separately and combined to obtain an entirely redesigned meganuclease variant (heterodimer or single-chain molecule) with chosen specificity, as illustrated on figure 2D.
  • couples of novel meganucleases are combined in new molecules ("half-meganucleases") cleaving palindromic targets derived from the target one wants to cleave. Then, the combination of such "half-meganuclease" can result in a heterodimeric species cleaving the target of interest.
  • XPC gene (WO2007093918), RAG gene (WO2008010093), HPRT gene (WO2008059382), beta-2 microglobulin gene (WO2008102274), Rosa26 gene (WO2008152523) and Human hemoglobin beta gene (WO200913622).
  • GAA Human Lysomal Acid ⁇ -Glucosidase Gene
  • an l-Crel variant characterized in that at least one of the two l-Crel monomers has at least two substitutions, one in each of the two functional subdomains of the LAGLIDADG core domain situated from positions 26 to 40 and 44 to 77 of I- Crel, said variant being able to cleave a DNA target sequence from GAA and being obtainable by a method comprising at least the steps of:
  • step (c) selecting and/or screening the variants from the first series of step (a) which are able to cleave a mutant l-Crel site wherein at least one of (i) the nucleotide triplet in positions -10 to -8 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions -10 to -8 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions +8 to +10 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in positions -10 to -8 of said DNA target sequence from GAA,
  • step (d) selecting and/or screening the variants from the second series of step (b) which are able to cleave a mutant 1-OeI site wherein at least one of (i) the nucleotide triplet in positions -5 to -3 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions -5 to -3 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions +3 to +5 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in position -5 to -3 of said DNA target sequence from GAA,
  • step (e) selecting and/or screening the variants from the first series of step (a) which are able to cleave a mutant I-Crel site wherein at least one of (i) the nucleotide triplet in positions +8 to +10 of the 1-OeI site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions -10 to -8 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in positions +8 to +10 of said DNA target sequence from GAA,
  • step (f) selecting and/or screening the variants from the second series of step (b) which are able to cleave a mutant 1-OeI site wherein at least one of (i) the nucleotide triplet in positions +3 to +5 of the 1-OeI site has been replaced with the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions -5 to -3 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA,
  • step (g) combining in a single variant, the mutation(s) in positions 26 to 40 and 44 to 77 of two variants from step (c) and step (d), to obtain a novel homodimeric I-Crel variant which cleaves a sequence wherein (i) the nucleotide triplet in positions -10 to -8 is identical to the nucleotide triplet which is present in positions -10 to -8 of said DNA target sequence from GAA, (ii) the nucleotide triplet in positions +8 to +10 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions -10 to -8 of said DNA target sequence from GAA, (iii) the nucleotide triplet in positions -5 to -3 is identical to the nucleotide triplet which is present in positions -5 to -3 of said DNA target sequence from GAA and (iv) the nucleotide triplet in positions +3 to +5 is identical to the reverse complementary sequence of the nucleotide triplet which is
  • step (e) and step (f) to obtain a novel homodimeric I-Crel variant which cleaves a sequence wherein (i) the nucleotide triplet in positions +8 to +10 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions -10 to -8 is identical to the reverse complementary sequence of the nucleotide triplet in positions +8 to +10 of said DNA target sequence from GAA, (iii) the nucleotide triplet in positions +3 to +5 is identical to the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA, (iv) the nucleotide triplet in positions -5 to -3 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from G
  • step (J) selecting and/or screening from the heterodimers of step (i) those heterodimers which are able to cleave a sequence wherein (i) the nucleotide triplet in positions +8 to +10 of the I-Crel site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions -10 to -8 is identical to the sequence of the nucleotide triplet in positions +8 to +10 of said DNA target sequence from GAA and (iii) the nucleotide triplet in positions +3 to +5 is identical to the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA and (iv) the nucleotide triplet in positions -5 to -3 is identical to the sequence of the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA and (v) wherein the nu
  • step (k) selecting and/or screening from those selected heterodimers from step (j), those heterodimers which are able to cleave said DNA target sequence from GAA.
  • meganuclease(s) and variant (s) and variant meganuclease(s) will be used interchangeably herein.
  • step (c), (d), (e), (f), (i) or (k) may be omitted.
  • step (d) is performed with a mutant l-Crel target wherein both nucleotide triplets at positions -10 to -8 and -5 to -3 have been replaced with the nucleotide triplets which are present at positions -10 to -8 and -5 to -3, respectively of said genomic target, and the nucleotide triplets at positions +3 to +5 and +8 to +10 have been replaced with the reverse complementary sequence of the nucleotide triplets which are present at positions -5 to -3 and -10 to -8, respectively of said genomic target.
  • the (intramolecular) combination of mutations in steps (g) and (h) may be performed by amplifying overlapping fragments comprising each of the two subdomains, according to well-known overlapping PCR techniques.
  • the (intermolecular) combination of the variants in step (i) is performed by co-expressing one variant from step (g) with one variant from step (h), so as to allow the formation of heterodimers.
  • host cells may be modified by one or two recombinant expression vector(s) encoding said variant(s). The cells are then cultured under conditions allowing the expression of the variant(s), so that heterodimers are formed in the host cells, as described previously in the International PCT Application WO 2006/097854 and Arnould et al, J. MoI. Biol., 2006, 355, 443- 458.
  • the selection and/or screening in steps (c), (d), (e), (f), Q) and/or (k) may be performed by measuring the cleavage activity of the variant according to the invention by any well-known, in vitro or in vivo cleavage assay, such as those described in the International PCT Application WO 2004/067736; Epinat et al, Nucleic Acids Res., 2003, 31, 2952-2962; Chames et al, Nucleic Acids Res., 2005, 33, el78; Arnould et al, J. MoI. Biol., 2006, 355, 443-458, and Arnould et al, J. MoI. Biol., 2007, 371, 49-65.
  • the cleavage activity of the variant of the invention may be measured by a direct repeat recombination assay, in yeast or mammalian cells, using a reporter vector.
  • the reporter vector comprises two truncated, non-functional copies of a reporter gene (direct repeats) and the genomic (non-palindromic) DNA target sequence within the intervening sequence, cloned in yeast or in a mammalian expression vector.
  • the genomic DNA target sequence comprises one different half of each (palindromic or pseudo-palindromic) parent homodimeric l-Crel meganuclease target sequence.
  • heterodimeric variant results in a functional endonuclease which is able to cleave the genomic DNA target sequence. This cleavage induces homologous recombination between the direct repeats, resulting in a functional reporter gene, whose expression can be monitored by an appropriate assay.
  • the cleavage activity of the variant against the genomic DNA target may be compared to wild type l-Crel or l-Scel activity against their natural target.
  • steps (c), (d), (e), (f), Q) and/or (k) are performed in vivo, under conditions where the double-strand break in the mutated DNA target sequence which is generated by said variant leads to the activation of a positive selection marker or a reporter gene, or the inactivation of a negative selection marker or a reporter gene, by recombination- mediated repair of said DNA double-strand break.
  • the homodimeric combined variants obtained in step (g) or (h) are advantageously submitted to a selection/screening step to identify those which are able to cleave a pseudo-palindromic sequence wherein at least the nucleotides at positions -11 to -3 (combined variant of step (g)) or +3 to +11 (combined variant of step (h)) are identical to the nucleotides which are present at positions -11 to -3 (combined variant of step (g)) or +3 to +11 (combined variant of step (h)) of said genomic target, and the nucleotides at positions +3 to +11 (combined variant of step (g)) or -11 to -3 (combined variant of step (h)) are identical to the reverse complementary sequence of the nucleotides which are present at positions -11 to -3 (combined variant of step (g)) or +3 to +11 (combined variant of step (h)) of said genomic target.
  • step (g) or step (h) undergoes an additional selection/screening step to identify the variants which are able to cleave a pseudo-palindromic sequence wherein :
  • nucleotides at positions -11 to -3 (combined variant of step g)) or +3 to +11 (combined variant of step (h)) are identical to the nucleotides which are present at positions -11 to -3 (combined variant of step (g)) or +3 to +1 1 (combined variant of step h)) of said genomic target, and
  • nucleotides at positions +3 to +11 (combined variant of step (g)) or -11 to -3 (combined variant of step (h)) are identical to the reverse complementary sequence of the nucleotides which are present at positions -11 to -3 (combined variant of step (g)) or +3 to +11 (combined variant of step (h)) of said genomic target.
  • This additional screening step increases the probability of isolating heterodimers which are able to cleave the genomic target of interest (step (k)).
  • Steps (a), (b), (g), (h) and (i) may further comprise the introduction of additional mutations at other positions contacting the DNA target sequence or interacting directly or indirectly with said DNA target, at positions which improve the binding and/or cleavage properties of the variants, or at positions which either prevent or impair the formation of functional homodimers or favor the formation of the heterodimer, as defined above.
  • the additional mutations may be introduced by site-directed mutagenesis and/or random mutagenesis on a variant or on a pool of variants, according to standard mutagenesis methods which are well-known in the art, for example by using PCR.
  • random mutations may be introduced into the whole variant or in a part of the variant, in particular the C-terminal half of the variant (positions 80 to 163) to improve the binding and/or cleavage properties of the variants towards the DNA target from the gene of interest.
  • Site-directed mutagenesis at positions which improve the binding and/or cleavage properties of the variants may also be combined with random-mutagenesis.
  • the mutagenesis may be performed by generating random/site-directed mutagenesis libraries on a pool of variants, according to standard mutagenesis methods which are well-known in the art.
  • Site-directed mutagenesis may be advantageously performed by amplifying overlapping fragments comprising the mutated position(s), as defined above, according to well-known overlapping PCR techniques.
  • multiple site- directed mutagenesis may advantageously be performed on a variant or on a pool of variants.
  • the mutagenesis is performed on one monomer of the heterodimer formed in step (i), step Q) or step (k), advantageously on a pool of monomers, preferably on both monomers of the heterodimer of step (i), (j) or (k).
  • at least two rounds of selection/screening are performed according to the process illustrated Arnould et al, J. MoI. Biol., 2007, 371, 49-65.
  • one of the monomers of the heterodimer is mutagenised, co-expressed with the other monomer to form heterodimers, and the improved monomers Y + are selected against the target from the gene of interest.
  • the other monomer (monomer X) is mutagenised, co-expressed with the improved monomers Y + to form heterodimers, and selected against the target from the gene of interest to obtain meganucleases (X + Y + ) with improved activity.
  • the mutagenesis may be random-mutagenesis or site-directed mutagenesis on a monomer or on a pool of monomers, as indicated above. Both types of mutagenesis are advantageously combined. Additional rounds of selection/screening on one or both monomers may be performed to improve the cleavage activity of the variant.
  • the variant may be obtained by a method comprising the additional steps of:
  • step (k) selecting heterodimers from step (k) and constructing a third series of variants having at least one substitution in at least one of the monomers in said selected heterodimers,
  • step (1) (m) combining said third series variants of step (1) and screening the resulting heterodimers for altered cleavage activity against said DNA target from GAA.
  • step (1) at least one substitution is introduced by site directed mutagenesis in a DNA molecule encoding said third series of variants, and/or by random mutagenesis in a DNA molecule encoding said third series of variants.
  • steps (1) and (m) are repeated at least two times and wherein the heterodimers selected in step (1) of each further iteration are selected from heterodimers screened in step (m) of the previous iteration which showed altered cleavage activity against said DNA target from GAA.
  • Target sequences can be chosen in any region of the GAA, but in particular are best positioned as close as possible to the locations of known disease causing mutations wherein the variant is for use in a gene repair therapy using a DNA repair matrix. Or alternatively the target sequence may be chosen at the beginning of
  • GAA if the variant is for use in an "exon knock-in" method.
  • the Inventors have identified a series of DNA targets in the human lysosomal acid ⁇ -glucosidase gene that are cleavable by l-Cre ⁇ variants (Table 1).
  • Table 1 list of DNA target within the GAA gene cleavable by I-Crel variants. l-Crel variants to these targets were created using a combinatorial approach, to entirely redesign the DNA binding domain of the l-Crel protein and thereby engineer novel meganucleases with fully engineered specificity for the desired GAA target.
  • step (i) The combinatorial approach, as illustrated in Figure 2D was used to entirely redesign the DNA binding domain of the 1-OeI protein and thereby engineer novel meganucleases with fully engineered specificity, to cleave one DNA target named GAA2.
  • the heterodimer of step (i) may comprise monomers obtained in steps (g) and (h), with the same DNA target recognition and cleavage activity properties.
  • the heterodimer of step (i) may comprise monomers obtained in steps (g) and (h), with different DNA target recognition and cleavage activity properties.
  • first series of I-Crel variants of step (a) are derived from a first parent meganuclease.
  • step (b) are derived from a second parent meganuclease.
  • first and second parent meganucleases are identical.
  • first and second parent meganucleases are different.
  • the variant may be obtained by a method comprising the additional steps of:
  • step (k) selecting heterodimers from step (j) and constructing a third series of variants having at least one substitution in at least one of the monomers of said selected heterodimers,
  • step (k) (1) combining said third series variants of step (k) and screening the resulting heterodimers for enhanced cleavage activity against said DNA target from the GAA.
  • said substitution(s) in the subdomain situated from positions 44 to 77 of l-Crel are at positions 44, 68, 70, 75 and/or 77.
  • said substitution(s) in the subdomain situated from positions 28 to 40 of l-Crel are at positions 28, 30, 32, 33, 38 and/or 40.
  • said variant comprises one or more mutations at positions of other amino acid residues that contact the DNA target sequence or interact with the DNA backbone or with the nucleotide bases, directly or via a water molecule; these residues are well-known in the art (Jurica et al , Molecular
  • residues are involved in binding and cleavage of said DNA cleavage site.
  • said residues are at positions 138, 139, 142 or 143 of ⁇ -Crel.
  • Two residues may be mutated in one variant provided that each mutation is in a different pair of residues chosen from the pair of residues at positions 138 and 139 and the pair of residues at positions 142 and 143.
  • the mutations which are introduced modify the interaction(s) of said amino acid(s) of the final C-terminal loop with the phosphate backbone of the I-Crel site.
  • the residue at position 138 or 139 is substituted by a hydrophobic amino acid to avoid the formation of hydrogen bonds with the phosphate backbone of the DNA cleavage site.
  • the residue at position 138 is substituted by an alanine or the residue at position 139 is substituted by a methionine.
  • the residue at position 142 or 143 is advantageously substituted by a small amino acid, for example a glycine, to decrease the size of the side chains of these amino acid residues.
  • said substitution in the final C-terminal loop modify the specificity of the variant towards the nucleotide at positions ⁇ 1 to 2, ⁇ 6 to 7 and/or ⁇ 11 to 12 of the 1-OeI site.
  • said variant comprises one or more additional mutations that improve the binding and/or the cleavage properties of the variant towards the DNA target sequence from the GAA gene.
  • the additional residues which are mutated may be on the entire I- Crel sequence, and in particular in the C-terminal half of l-Crel (positions 80 to 163). Both l-Crel monomers are advantageously mutated; the mutation(s) in each monomer may be identical or different.
  • the variant comprises one or more additional substitutions at positions: 2, 19, 43, 80 and 81. Said substitutions are advantageously selected from the group consisting of: N2S, Gl 9S, F43L, E80K and 18 IT. More preferably, the variant comprises at least one substitution selected from the group consisting of: N2S, G19S, F43L, E80K and I81T.
  • the variant may also comprise additional residues at the C-terminus. For example a glycine (G) and/or a proline (P) residue may be inserted at positions 164 and 165 of l-Crel, respectively.
  • said additional mutation in said variant further impairs the formation of a functional homodimer.
  • said mutation is the Gl 9S mutation.
  • the Gl 9S mutation is advantageously introduced in one of the two monomers of a heterodimeric l-Crel variant, so as to obtain a meganuclease having enhanced cleavage activity and enhanced cleavage specificity.
  • the other monomer may carry a distinct mutation that impairs the formation of a functional homodimer or favors the formation of the heterodimer.
  • said substitutions are replacement of the initial amino acids with amino acids selected from the group consisting of: A, D, E, G, H, K, N, P, Q, R, S, T, Y, C, V, L, M, F, I and W.
  • the variant is selected from the group consisting of SEQ ID NO: 19 to 46, 66 to 103 and 106.
  • the variant of the invention may be derived from the wild-type I- Cr el (SEQ ID NO: 1) or an I-Crel scaffold protein having at least 85 % identity, preferably at least 90 % identity, more preferably at least 95 % identity with SEQ ID NO: 1, such as the scaffold called l-Crel N75 (167 amino acids; SEQ ID NO: 107) having the insertion of an alanine at position 2, and the insertion of AAD at the C- terminus (positions 164 to 166) of the l-Crel sequence.
  • SEQ ID NO: 1 wild-type I- Cr el
  • an I-Crel scaffold protein having at least 85 % identity, preferably at least 90 % identity, more preferably at least 95 % identity with SEQ ID NO: 1, such as the scaffold called l-Crel N75 (167 amino acids; SEQ ID NO: 107) having the insertion of an alanine at position 2, and the insertion of AAD at the C- terminus (positions 164
  • the variants of the invention may include one or more residues inserted at the NH 2 terminus and/or COOH terminus of the sequence.
  • a tag epitopope or polyhistidine sequence
  • the variant may also comprise a nuclear localization signal (NLS); said NLS is useful for the importation of said variant into the cell nucleus.
  • the NLS may be inserted just after the first methionine of the variant or just after an N-terminal tag.
  • the variant according to the present invention may be a homodimer which is able to cleave a palindromic or pseudo-palindromic DNA target sequence.
  • said variant is a heterodimer, resulting from the association of a first and a second monomer having different substitutions at positions 28 to 40 and 44 to 77 of I-Crel, said heterodimer being able to cleave a non- palindromic DNA target sequence from the GAA gene.
  • the DNA target sequences are situated in the GAA ORF and these sequences cover all the GAA ORF (Table 1).
  • each I-Crel variant is defined by the mutated residues at the indicated positions.
  • the positions are indicated by reference to l-Crel sequence (SEQ ID NO: 1) ;
  • I-Crel has N, S, Y 5 Q, S, Q, R, R 3 D, I and E at positions 30, 32, 33, 38, 40, 44, 68, 70, 75, 77 and 80 respectively.
  • Each monomer (first monomer and second monomer) of the heterodimeric variant according to the present invention may also be named with a letter code, after the eleven residues at positions 28, 30, 32, 33, 38, 40, 44, 68 and 70, 75 and 77 and the additional residues which are mutated, as indicated above.
  • 2S/28K30G32S33Y38A40S/44K68A70S75N77I/81T (SEQ ID NO: 41).
  • the heterodimeric variant as defined above may have only the amino acid substitutions as indicated above. In this case, the positions which are not indicated are not mutated and thus correspond to the wild-type l-Crel (SEQ ID NO:
  • the invention encompasses l-Crel variants having at least 85 % identity, preferably at least 90 % identity, more preferably at least 95 % (96 %, 97 %, 98 %, 99 %) identity with the sequences as defined above, said variant being able to cleave a DNA target from the GAA gene.
  • the heterodimeric variant is advantageously an obligate heterodimer variant having at least one interesting pair of mutations corresponding to residues of the first and the second monomers which make an intermolecular interaction between the two l-Crel monomers, wherein the first mutation of said pair(s) is in the first monomer and the second mutation of said pair(s) is in the second monomer and said pair(s) of mutations prevent the formation of functional homodimers from each monomer and allow the formation of a functional heterodimer, able to cleave the genomic DNA target from the GAA gene.
  • the monomers have advantageously at least one of the following pairs of mutations, respectively for the first monomer and the second monomer:
  • the first monomer may further comprise the substitution of at least one of the lysine residues at positions 7 and 96, by an arginine,
  • the first monomer may further comprise the substitution of at least one of the lysine residues at positions 7 and 96, by an arginine,
  • the first monomer may further comprise the substitution of the phenylalanine at position 54 by a tryptophane and the second monomer may further comprise the substitution of the leucine at position 58 or lysine at position 57, by a methionine, and
  • the first monomer may have the mutation D137R and the second monomer, the mutation R51D.
  • the obligate heterodimer meganuclease comprises advantageously, at least two pairs of mutations as defined in a), b), c) or d), above; one of the pairs of mutation is advantageously as defined in c) or d).
  • one monomer comprises the substitution of the lysine residues at positions 7 and 96 by an acidic amino acid (aspartic acid (D) or glutamic acid (E)), preferably a glutamic acid (K7E and K96E) and the other monomer comprises the substitution of the glutamic acid residues at positions 8 and 61 by a basic amino acid (arginine (R) or lysine (K); for example, E8K and E61R).
  • the obligate heterodimer meganuclease comprises three pairs of mutations as defined in a), b) and c), above.
  • the obligate heterodimer meganuclease consists advantageously of a first monomer (A) having at least the mutations (i) E8R, E8K or E8H, E61R, E61K or E61H and L97F, L97W or L97Y; (ii) K7R, E8R, E61R, K96R and L97F, or (iii) K7R, E8R, F54W, E61R, K96R and L97F and a second monomer (B) having at least the mutations (iv) K7E or K7D, F54G or F54A and K96D or K96E; (v) K7E, F54G, L58M and K96E, or (vi) K7E, F54G, K57M and K96E.
  • A first monomer having at least the mutations (i) E8R, E8K or E8H, E61R, E61K or E61H and L97F, L97W or
  • the first monomer may have the mutations K7R, E8R or E8K, E61R, K96R and L97F or K7R, E8R or E8K, F54W, E61R, K96R and L97F and the second monomer, the mutations K7E, F54G, L58M and K96E or K7E, F54G, K57M and K96E.
  • the obligate heterodimer may comprise at least one NLS and/or one tag as defined above; said NLS and/or tag may be in the first and/or the second monomer
  • the subject-matter of the present invention is also a single-chain chimeric meganuclease (fusion protein) derived from an l-Crel variant as defined above.
  • the single-chain meganuclease may comprise two ⁇ -Crel monomers, two I- Crel core domains (positions 6 to 94 of l-Cre ⁇ ) or a combination of both.
  • the two monomers /core domains or the combination of both are connected by a peptidic linker.
  • the subject-matter of the present invention is also a polynucleotide fragment encoding a variant or a single-chain chimeric meganuclease as defined above; said polynucleotide may encode one monomer of a homodimeric or heterodimeric variant, or two domains/monomers of a single-chain chimeric meganuclease.
  • the subject-matter of the present invention is also a recombinant vector for the expression of a variant or a single-chain meganuclease according to the invention.
  • the recombinant vector comprises at least one polynucleotide fragment encoding a variant or a single-chain meganuclease, as defined above.
  • said vector comprises two different polynucleotide fragments, each encoding one of the monomers of a heterodimeric variant.
  • a vector which can be used in the present invention includes, but is not limited to, a viral vector, a plasmid, a RNA vector or a linear or circular DNA or RNA molecule which may consists of a chromosomal, non chromosomal, semisynthetic or synthetic nucleic acids.
  • Preferred vectors are those capable of autonomous replication (episomal vector) and/or expression of nucleic acids to which they are linked (expression vectors). Large numbers of suitable vectors are known to those skilled in the art and commercially available.
  • Viral vectors include retrovirus, adenovirus, parvovirus (e. g. adeno- associated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e. g., influenza virus), rhabdovirus (e. g., rabies and vesicular stomatitis virus), paramyxovirus (e. g. measles and Sendai), positive strand RNA viruses such as picor- navirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus (e. g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.
  • orthomyxovirus e. g., influenza virus
  • rhabdovirus e. g., rabies and vesicular stomatitis virus
  • paramyxovirus e. g. measles and Sendai
  • viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example.
  • retroviruses include: avian leukosis- sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV-BLV group, lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields, et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996).
  • Preferred vectors include lentiviral vectors, and particularly self inactivacting lentiviral vectors.
  • Vectors can comprise selectable markers, for example: neomycin phosphotransferase, histidinol dehydrogenase, dihydrofolate reductase, hygromycin phosphotransferase, herpes simplex virus thymidine kinase, adenosine deaminase, Glutamine Synthetase, and hypoxanthine-guanine phosphoribosyl transferase for eukaryotic cell culture; TRPl, URA3 and LEU2 for S. cerevisiae; tetracycline, rifampicin or ampicillin resistance in E. coli.
  • selectable markers for example: neomycin phosphotransferase, histidinol dehydrogenase, dihydrofolate reductase, hygromycin phosphotransferase, herpes simplex virus thymidine kinase, adeno
  • said vectors are expression vectors, wherein the sequence(s) encoding the variant/single-chain meganuclease of the invention is placed under control of appropriate transcriptional and translational control elements to permit production or synthesis of said variant.
  • said polynucleotide is comprised in an expression cassette. More particularly, the vector comprises a replication origin, a promoter operatively linked to said polynucleotide, a ribosome- binding site, an RNA-splicing site (when genomic DNA is used), a polyadenylation site and a transcription termination site. It also can comprise an enhancer. Selection of the promoter will depend upon the cell in which the polypeptide is expressed.
  • Suitable promoters include tissue specific and/or inducible promoters.
  • inducible promoters are: eukaryotic metallothionine promoter which is induced by increased levels of heavy metals, prokaryotic lacZ promoter which is induced in response to isopropyl- ⁇ -D-thiogalacto- pyranoside (IPTG) and eukaryotic heat shock promoter which is induced by increased temperature.
  • tissue specific promoters are skeletal muscle creatine kinase, prostate-specific antigen (PSA), ⁇ -antitrypsin protease, human surfactant (SP) A and B proteins, ⁇ -casein and acidic whey protein genes.
  • PSA prostate-specific antigen
  • SP human surfactant
  • said vector includes a targeting construct comprising sequences sharing homologies with the region surrounding the genomic DNA cleavage site as defined above.
  • said sequence sharing homologies with the regions surrounding the genomic DNA cleavage site of the variant is a fragment of the human
  • the vector coding for an l-Crel variant/single-chain meganuclease and the vector comprising the targeting construct are different vectors.
  • the targeting DNA construct comprises:
  • homologous sequences of at least 50 bp, preferably more than 100 bp and more preferably more than 200 bp are used. Therefore, the targeting DNA construct is preferably from 200 pb to 6000 pb, more preferably from 1000 pb to 2000 pb. Indeed, shared DNA homologies are located in regions flanking upstream and downstream the site of the break and the DNA sequence to be introduced should be located between the two arms.
  • the sequence to be introduced may be any sequence used to alter the chromosomal DNA in some specific way including a sequence used to repair a mutation in the GAA gene, restore a functional GAA gene in place of a mutated one, modify a specific sequence in the GAA gene, to attenuate or activate the GAA gene, to inactivate or delete the GAA gene or part thereof, to introduce a mutation into a site of interest or to introduce an exogenous gene or part thereof.
  • Such chromosomal DNA alterations are used for genome engineering (animal models/recombinant cell lines) or genome therapy (gene correction or recovery of a functional gene).
  • the targeting construct comprises advantageously a positive selection marker between the two homology arms and eventually a negative selection marker upstream of the first homology arm or downstream of the second homology arm.
  • the marker(s) allow(s) the selection of cells having inserted the sequence of interest by homologous recombination at the target site.
  • the sequence to be introduced is a sequence which repairs a mutation in the GAA gene (gene correction or recovery of a functional gene), for the purpose of genome therapy (figure IA and IB).
  • cleavage of the gene occurs in the vicinity of the mutation, preferably, within 500 bp of the mutation ( Figure IB).
  • the targeting construct comprises a GAA gene fragment which has at least 200 bp of homologous sequence flanking the target site (minimal repair matrix) for repairing the cleavage, and includes a sequence encoding a portion of wild-type GAA gene corresponding to the region of the mutation for repairing the mutation ( Figure IB).
  • the targeting construct for gene correction comprises or consists of the minimal repair matrix; it is preferably from 200 pb to 6000 pb, more preferably from 1000 pb to 2000 pb.
  • the repair matrix includes a modified cleavage site that is not cleaved by the variant which is used to induce said cleavage in the GAA gene and a sequence encoding wild-type GAA that does not change the open reading frame of the GAA gene.
  • the targeting DNA construct comprises a GAA gene fragment which has at least 200 bp of homologous sequence flanking the target site of the l-Crel variant for repairing the cleavage, the sequence of an exogenous gene of interest included in an expression cassette and eventually a selection marker such as the neomycin resistance gene.
  • DNA homologies are generally located in regions directly upstream and downstream to the site of the break (sequences immediately adjacent to the break; minimal repair matrix).
  • shared DNA homologies are located in regions upstream and downstream the region of the deletion.
  • cleavage of the gene occurs upstream of a mutation.
  • said mutation is the first known mutation in the sequence of the gene, so that all the downstream mutations of the gene can be corrected simultaneously.
  • the targeting construct comprises the exons downstream of the cleavage site fused in frame (as in the cDNA) and with a polyadenylation site to stop transcription in 3'.
  • the sequence to be introduced is flanked by introns or exons sequences surrounding the cleavage site, so as to allow the transcription of the engineered gene (exon knock-in gene) into a mRNA able to code for a functional protein (Figure IB).
  • the exon knock-in construct is flanked by sequences upstream and downstream of the cleavage site, from a minimal repair matrix as defined above.
  • the subject matter of the present invention is also a targeting DNA construct as defined above.
  • the subject-matter of the present invention is also a composition characterized in that it comprises at least one meganuclease as defined above (variant or single-chain chimeric meganuclease) and/or at least one expression vector encoding said meganuclease, as defined above.
  • composition it comprises a targeting DNA construct, as defined above.
  • said targeting DNA construct is either included in a recombinant vector or it is included in an expression vector comprising the polynucleotide(s) encoding the meganuclease according to the invention.
  • the subject-matter of the present invention is further the use of a meganuclease as defined above, one or two polynucleotide(s), preferably included in expression vector(s), for reparing mutations of the GAA gene.
  • a meganuclease as defined above, one or two polynucleotide(s), preferably included in expression vector(s), for reparing mutations of the GAA gene.
  • it is for inducing a double-strand break in a site of interest of the GAA gene comprising a genomic DNA target sequence, thereby inducing a DNA recombination event, a DNA loss or cell death.
  • said double-strand break is for: repairing a specific sequence in the GAA gene, modifying a specific sequence in the GAA gene, restoring a functional GAA gene in place of a mutated one, attenuating or activating the GAA gene, introducing a mutation into a site of interest of the GAA gene, introducing an exogenous gene or a part thereof, inactivating or deleting the GAA gene or a part thereof, translocating a chromosomal arm, or leaving the DNA unrepaired and degraded.
  • the subject-matter of the present invention is also a method for making a GAA knock-out or knock-in recombinant cell, comprising at least the step of:
  • a meganuclease as defined above (I-Crel variant or single-chain derivative), so as to induce a double stranded cleavage at a site of interest of the GAA gene comprising a DNA recognition and cleavage site for said meganuclease, simultaneously or consecutively,
  • step (b) introducing into the cell of step (a), a targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies to the region surrounding the cleavage site and (2) DNA which repairs the site of interest upon recombination between the targeting DNA and the chromosomal DNA, so as to generate a recombinant cell having repaired the site of interest by homologous recombination,
  • step (c) isolating the recombinant cell of step (b), by any appropriate means.
  • the subject-matter of the present invention is also a method for making a GAA knock-out or knock- in animal, comprising at least the step of:
  • step (a) introducing into a pluripotent precursor cell or an embryo of an animal, a meganuclease as defined above, so as to induce a double stranded cleavage at a site of interest of the GAA gene comprising a DNA recognition and cleavage site for said meganuclease, simultaneously or consecutively, (b) introducing into the animal precursor cell or embryo of step (a) a targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies to the region surrounding the cleavage site and (2) DNA which repairs the site of interest upon recombination between the targeting DNA and the chromosomal DNA, so as to generate a genomically modified animal precursor cell or embryo having repaired the site of interest by homologous recombination,
  • step (c) developing the genomically modified animal precursor cell or embryo of step (b) into a chimeric animal
  • step (d) deriving a transgenic animal from the chimeric animal of step (c).
  • step (c) comprises the introduction of the genomically modified precursor cell generated in step (b) into blastocysts so as to generate chimeric animals.
  • the targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest.
  • the DNA which repairs the site of interest comprises sequences that inactivate the GAA gene.
  • the DNA which repairs the site of interest comprises the sequence of an exogenous gene of interest, and eventually a selection marker, such as the neomycin resistance gene.
  • said targeting DNA construct is inserted in a vector.
  • the subject-matter of the present invention is also a method for making a GAA-deficient cell, comprising at least the step of:
  • the subject-matter of the present invention is also a method for making a GAA knock-out animal, comprising at least the step of:
  • step (b) developing the genomically modified animal precursor cell or embryo of step (a) into a chimeric animal
  • step (c) deriving a transgenic animal from a chimeric animal of step (b).
  • step (b) comprises the introduction of the genomically modified precursor cell obtained in step (a), into blastocysts, so as to generate chimeric animals.
  • the cells which are modified may be any cells of interest.
  • the cells are pluripotent precursor cells such as embryo-derived stem (ES) cells, which are well-known in the art.
  • ES embryo-derived stem
  • the cells may advantageously be PerC ⁇ (Fallaux et al.,
  • the animal is preferably a mammal, more preferably a laboratory rodent (mice, rat, guinea-pig), or a cow, pig, horse or goat.
  • a laboratory rodent mice, rat, guinea-pig
  • cow, pig, horse or goat preferably a cow, pig, horse or goat.
  • Said meganuclease can be provided directly to the cell or through an expression vector comprising the polynucleotide sequence encoding said meganuclease and suitable for its expression in the used cell.
  • the targeting DNA comprises a sequence encoding the product of interest (protein or RNA), and eventually a marker gene, flanked by sequences upstream and downstream the cleavage site, as defined above, so as to generate genomically modified cells having integrated the exogenous sequence of interest in the GAA gene, by homologous recombination.
  • the sequence of interest may be any gene coding for a certain protein/peptide of interest, included but not limited to: reporter genes, receptors, signaling molecules, transcription factors, pharmaceutically active proteins and peptides, disease causing gene products and toxins.
  • the sequence may also encode an RNA molecule of interest including for example a siRNA.
  • the expression of the exogenous sequence may be driven, either by the endogenous GAA gene promoter or by a heterologous promoter, preferably a ubiquitous or tissue specific promoter, either constitutive or inducible, as defined above.
  • the expression of the sequence of interest may be conditional; the expression may be induced by a site-specific recombinase such as Cre or FLP (Akagi K, Sandig V, Vooijs M, Van der VaIk M, Giovannini M, Strauss M, Berns A (May 1997). " Nucleic Acids Res. 25 (9): 1766-73.; Zhu XD, Sadowski PD (1995). J Biol Chem 270).
  • sequence of interest is inserted in an appropriate cassette that may comprise an heterologous promoter operatively linked to said gene of interest and one or more functional sequences including but not limited to (selectable) marker genes, recombinase recognition sites, polyadenylation signals, splice acceptor sequences, introns, tag for protein detection and enhancers.
  • an appropriate cassette may comprise an heterologous promoter operatively linked to said gene of interest and one or more functional sequences including but not limited to (selectable) marker genes, recombinase recognition sites, polyadenylation signals, splice acceptor sequences, introns, tag for protein detection and enhancers.
  • the subject matter of the present invention is also a kit for making GAA knock-out or knock-in cells/animals comprising at least a meganuclease and/or one expression vector, as defined above.
  • the kit further comprises a targeting DNA comprising a sequence that inactivates the GAA gene flanked by sequences sharing homologies with the region of the GAA gene surrounding the DNA cleavage site of said meganuclease.
  • the kit includes also a vector comprising a sequence of interest to be introduced in the genome of said cells/animals and eventually a selectable marker gene, as defined above.
  • the subject-matter of the present invention is also the use of at least one meganuclease and/or one expression vector, as defined above, for the preparation of a medicament for preventing, improving or curing a pathological condition caused by a mutation in the GAA gene as defined above, in an individual in need thereof.
  • said pathological condition is Pompe's disease.
  • the use of the meganuclease may comprise at least the step of (a) inducing in somatic tissue(s) of the donor/ individual a double stranded cleavage at a site of interest of the GAA gene comprising at least one recognition and cleavage site of said meganuclease by contacting said cleavage site with said meganuclease, and (b) introducing into said somatic tissue(s) a targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies to the region surrounding the cleavage site and (2) DNA which repairs the GAA gene upon recombination between the targeting DNA and the chromosomal DNA, as defined above.
  • the targeting DNA is introduced into the somatic tissues(s) under conditions appropriate for introduction of the targeting DNA into the site of interest.
  • said double-stranded cleavage may be induced, ex vivo by introduction of said meganuclease into somatic cells from the diseased individual and then transplantation of the modified cells back into the diseased individual.
  • the subject-matter of the present invention is also a method for preventing, improving or curing a pathological condition caused by a mutation in the
  • the meganuclease can be used either as a polypeptide or as a polynucleotide construct encoding said polypeptide. It is introduced into mouse cells, by any convenient means well-known to those in the art, which are appropriate for the particular cell type, alone or in association with either at least an appropriate vehicle or carrier and/or with the targeting DNA.
  • the meganuclease (polypeptide) is associated with:
  • the sequence of the variant/single-chain meganuclease is fused with the sequence of a membrane translocating peptide (fusion protein).
  • the meganuclease (polynucleotide encoding said meganuclease) and/or the targeting DNA is inserted in a vector.
  • Vectors comprising targeting DNA and/or nucleic acid encoding a meganuclease can be introduced into a cell by a variety of methods (e.g., injection, direct uptake, projectile bombardment, liposomes, electroporation).
  • Meganucleases can be stably or transiently expressed into cells using expression vectors. Techniques of expression in eukaryotic cells are well known to those in the art.
  • a nuclear localization signal into the recombinant protein to be sure that it is expressed within the nucleus.
  • the meganuclease and if present, the vector comprising targeting DNA and/or nucleic acid encoding a meganuclease are imported or translocated by the cell from the cytoplasm to the site of action in the nucleus.
  • the meganucleases and a pharmaceutically acceptable excipient are administered in a therapeutically effective amount.
  • Such a combination is said to be administered in a "therapeutically effective amount” if the amount administered is physiologically significant.
  • An agent is physiologically significant if its presence results in a detectable change in the physiology of the recipient.
  • an agent is physiologically significant if its presence results in a decrease in the severity of one or more symptoms of the targeted disease and in a genome correction of the lesion or abnormality.
  • the meganuclease is substantially non-immunogenic, i.e., engender little or no adverse immunological response.
  • a variety of methods for ameliorating or eliminating deleterious immunological reactions of this sort can be used in accordance with the invention.
  • the meganuclease is substantially free of N-formyl methionine.
  • Another way to avoid unwanted immunological reactions is to conjugate meganucleases to polyethylene glycol (“PEG”) or polypropylene glycol (“PPG”) (preferably of 500 to 20,000 daltons average molecular weight (MW)). Conjugation with PEG or PPG, as described by Davis et al.
  • the invention also concerns a prokaryotic or eukaryotic host cell which is modified by a polynucleotide or a vector as defined above, preferably an expression vector.
  • the invention also concerns a non-human transgenic animal or a transgenic plant, characterized in that all or a part of their cells are modified by a polynucleotide or a vector as defined above.
  • a cell refers to a prokaryotic cell, such as a bacterial cell, or an eukaryotic cell, such as an animal, plant or yeast cell.
  • the subject-matter of the present invention is also the use of at least one meganuclease variant, as defined above, as a scaffold for making other meganucleases. For example, further rounds of mutagenesis and selection/screening can be performed on said variants, for the purpose of making novel meganucleases.
  • the different uses of the meganuclease and the methods of using said meganuclease according to the present invention include the use of the I-Crel variant, the single-chain chimeric meganuclease derived from said variant, the polynucleotide ⁇ ), vector, cell, transgenic plant or non-human transgenic mammal encoding said variant or single-chain chimeric meganuclease, as defined above.
  • the subject matter of the present invention is also an ⁇ -Crel variant having mutations at positions 28 to 40 and/or 44 to 77 of I-Crel that is useful for engineering the variants able to cleave a DNA target from the GAA gene, according to the present invention.
  • the invention encompasses the ⁇ -Crel variants as defined in step (c) to (f) of the method for engineering ⁇ -Crel variants, as defined above, including the variants at positions 28, 30, 32, 33, 38 and 40, or 44, 68, 70, 75 and 77 presented in Tables 3 and 4.
  • the invention encompasses also the 1-OeI variants as defined in step (g) and (h) of the method for engineering I-Crel variants, as defined above including the combined variants of Tables 5 and 6.
  • Single-chain chimeric meganucleases able to cleave a DNA target from the gene of interest are derived from the variants according to the invention by methods well-known in the art (Epinat et al., Nucleic Acids Res., 2003, 31, 2952-62; Chevalier et al., MoI. Cell, 2002, 10, 895-905; Steuer et al., Chembiochem., 2004, 5,
  • polynucleotide sequence(s) encoding the variant as defined in the present invention may be prepared by any method known by the man skilled in the art. For example, they are amplified from a cDNA template, by polymerase chain reaction with specific primers. Preferably the codons of said cDNA are chosen to favour the expression of said protein in the desired expression system.
  • the recombinant vector comprising said polynucleotides may be obtained and introduced in a host cell by the well-known recombinant DNA and genetic engineering techniques.
  • the l-Crel variant or single-chain derivative as defined in the present invention are produced by expressing the polypeptide(s) as defined above; preferably said polypeptide(s) are expressed or co-expressed (in the case of the variant only) in a host cell or a transgenic animal/plant modified by one expression vector or two expression vectors (in the case of the variant only), under conditions suitable for the expression or co-expression of the polypeptide(s), and the variant or single-chain derivative is recovered from the host cell culture or from the transgenic animal/plant.
  • - Amino acid substitution means the replacement of one amino acid residue with another, for instance the replacement of an Arginine residue with a Glutamine residue in a peptide sequence is an amino acid substitution.
  • - Altered/enhanced/increased cleavage activity refers to an increase in the detected level of meganuclease cleavage activity, see below, against a target DNA sequence by a second meganuclease in comparison to the activity of a first meganuclease against the target DNA sequence.
  • the second meganuclease is a variant of the first and comprise one or more substituted amino acid residues in comparison to the first meganuclease.
  • nucleosides are designated as follows: one-letter code is used for designating the base of a nucleoside: a is adenine, t is thymine, c is cytosine, and g is guanine.
  • r represents g or a (purine nucleotides)
  • k represents g or t
  • s represents g or c
  • w represents a or t
  • m represents a or c
  • y repre- sents t or c pyrimidine nucleotides
  • d represents g, a or t
  • v represents g, a or c
  • b represents g, t or c
  • h represents a, t or c
  • n represents g, a, t or c.
  • meganuclease is intended an endonuclease having a double- stranded DNA target sequence of 12 to 45 bp.
  • Said meganuclease is either a dimeric enzyme, wherein each domain is on a monomer or a monomeric enzyme comprising the two domains on a single polypeptide.
  • “meganuclease domain” is intended the region which interacts with one half of the DNA target of a meganuclease and is able to associate with the other domain of the same meganuclease which interacts with the other half of the DNA target to form a functional meganuclease able to cleave said DNA target.
  • meganuclease variant or “variant” is intended a meganuclease obtained by replacement of at least one residue in the amino acid sequence of the wild-type meganuclease (natural meganuclease) with a different amino acid.
  • meganuclease variant or “variant” it is intended a meganuclease obtained by replacement of at least one residue in the amino acid sequence of the parent meganuclease (natural or variant meganuclease) with a different amino acid.
  • peptide linker it is intended to mean a peptide sequence of at least 10 and preferably at least 17 amino acids which links the C-terminal amino acid residue of the first monomer to the N-terminal residue of the second monomer and which allows the two variant monomers to adopt the correct conformation for activity and which does not alter the specificity of either of the monomers for their targets.
  • subdomain it is intended the region of a LAGLIDADG homing endonuclease core domain which interacts with a distinct part of a homing endonuclease DNA target half-site.
  • targeting DNA construct/minimal repair matrix/repair matrix it is intended to mean a DNA construct comprising a first and second portions which are homologous to regions 5' and 3' of the DNA target in situ.
  • the DNA construct also comprises a third portion positioned between the first and second portion which comprise some homology with the corresponding DNA sequence in situ or alternatively comprise no homology with the regions 5' and 3' of the DNA target in situ.
  • a homologous recombination event is stimulated between the genome containing the GAA gene and the repair matrix, wherein the genomic sequence containing the DNA target is replaced by the third portion of the repair matrix and a variable part of the first and second portions of the repair matrix.
  • - by "functional variant” is intended a variant which is able to cleave a DNA target sequence, preferably said target is a new target which is not cleaved by the parent meganuclease.
  • such variants have amino acid variation at positions contacting the DNA target sequence or interacting directly or indirectly with said DNA target.
  • selection or selecting it is intended to mean the isolation of one or more meganuclease variants based upon an observed specified phenotype, for instance altered cleavage activity.
  • This selection can be of the variant in a peptide form upon which the observation is made or alternatively the selection can be of a nucleotide coding for selected meganuclease variant.
  • screening it is intended to mean the sequential or simultaneous selection of one or more meganuclease variant (s) which exhibits a specified phenotype such as altered cleavage activity.
  • derived from it is intended to mean a meganuclease variant which is created from a parent meganuclease and hence the peptide sequence of the meganuclease variant is related to (primary sequence level) but derived from (mutations) the sequence peptide sequence of the parent meganuclease.
  • I-Crel variant with novel specificity is intended a variant having a pattern of cleaved targets different from that of the parent meganuclease.
  • the terms “novel specificity”, “modified specificity”, “novel cleavage specificity”, “novel substrate specificity” which are equivalent and used indifferently, refer to the specificity of the variant towards the nucleotides of the DNA target sequence.
  • all the I-Crel variants described comprise an additional Alanine after the first Methionine of the wild type I-Crel sequence (SEQ ID NO: 1).
  • These variants also comprise two additional Alanine residues and an Aspartic Acid residue after the final Proline of the wild type I-Crel sequence.
  • 1-OeI sites include the wild-type (natural) non- palindromic 1-OeI homing site and the derived palindromic sequences such as the sequence 5'- t-i 2 c. ⁇ a -1 oa.9a -8 a -7 c -6 g -5 t -4 c -3 g-2t-ia + ic + 2g+ 3 a +4 c +5 g +6 t +7 t +8 t +9 t +1 og +1 ia +12 (SEQ ID NO: 2), also called C1221 ( Figure 4).
  • domain or “core domain” is intended the "LAGLIDADG homing endonuclease core domain” which is the characteristic ⁇ 1 ⁇ 1 ⁇ 2 ⁇ 2 ⁇ 3 ⁇ 4 ⁇ 3 fold of the homing endonucleases of the LAGLIDADG family, corresponding to a sequence of about one hundred amino acid residues.
  • Said domain comprises four beta-strands ( ⁇ i ⁇ 2p3 ⁇ 4) folded in an anti-parallel beta-sheet which interacts with one half of the DNA target.
  • This domain is able to associate with another LAGLIDADG homing endonuclease core domain which interacts with the other half of the DNA target to form a functional endonuclease able to cleave said DNA target.
  • the LAGLIDADG homing endonuclease core domain corresponds to the residues 6 to 94.
  • subdomain is intended the region of a LAGLIDADG homing endonuclease core domain which interacts with a distinct part of a homing endonuclease DNA target half-site.
  • chimeric DNA target or “hybrid DNA target” it is intended the fusion of a different half of two parent meganuclease target sequences.
  • at least one half of said target may comprise the combination of nucleotides which are bound by at least two separate subdomains (combined DNA target).
  • beta-hairpin is intended two consecutive beta-strands of the antiparallel beta- sheet of a LAGLIDADG homing endonuclease core domain ( ⁇ i ⁇ 2 or, ⁇ 3 ⁇ 4 ) which are connected by a loop or a turn,
  • single-chain meganuclease is intended a meganuclease comprising two LAGLIDADG homing endonuclease domains or core domains linked by a peptidic spacer.
  • the single-chain meganuclease is able to cleave a chimeric DNA target sequence comprising one different half of each parent meganuclease target sequence.
  • cleavage site is intended a 20 to 24 bp double-stranded palindromic, partially palindromic (pseudo-palindromic) or non-palindromic polynucleotide sequence that is recognized and cleaved by a LAGLIDADG homing endonuclease such as ⁇ -Crel, or a variant, or a single-chain chimeric meganuclease derived from ⁇ -Crel.
  • the DNA target is defined by the 5' to 3' sequence of one strand of the double-stranded polynucleotide, as indicate above for C 1221. Cleavage of the DNA target occurs at the nucleotides at positions +2 and -2, respectively for the sense and the antisense strand. Unless otherwise indicated, the position at which cleavage of the DNA target by an I-Cre I meganuclease variant occurs, corresponds to the cleavage site on the sense strand of the DNA target.
  • DNA target half-site by "DNA target half-site", "half cleavage site” or half-site” is intended the portion of the DNA target which is bound by each LAGLIDADG homing endonuclease core domain.
  • chimeric DNA target or “hybrid DNA target” is intended the fusion of different halves of two parent meganuclease target sequences.
  • at least one half of said target may comprise the combination of nucleotides which are bound by at least two separate subdomains (combined DNA target).
  • GAA gene is intended a Lysosomal acid ⁇ -glucosidase gene, preferably the GAA gene of a vertebrate, more preferably the GAA gene of a mammal such as human.
  • GAA gene sequences are available in sequence databases, such as the NCBI/GenBank database.
  • the human GAA gene sequence (20kb) is available under accession number NCJ)OOOl 7.9 (positions 75689950 to 75708274).
  • Figure 3 illustrates the 20 exons of the human GAA gene (Exon 1 (position 1 to 408) Exon 2 (positions 3073 to 3650 ), Exon 3 (positions 4267 to 4412), Exon 4 (positions 6075 to 6240), Exon 5 (positions 6318 to 6414), Exon 6 (positions 6808 to 6927), Exon 7 (positions 7007 to 7125), Exon 8 (positions 7215 to 7346), Exon 9 (positions 8463 to 8573), Exon 10 (positions 9245 to 9358), Exon 11 (positions 9459 to 9543), Exon 12 (positions 10501 to 10618), Exon 13 (positions 11096 to 11229), Exon 14 (positions 11394 to 11545), Exon 15 (positions 11736 to 11884), Exon 16 (positions 15486 to 15627), Exon 17 (positions 16118 to 16267), Exon 18 (positions 16711 to 16875), Exon 19 (position
  • the ORP which is from position 3105 of Exon 2 to position 17849 of Exon 2O.
  • the human GAA gene is transcribed into a 3782 bp mRNA (GenBank NM_000152.3) containing the GAA ORP from positions 368 to 3228 .
  • DNA target sequence from the GAA gene is intended a 20 to 24 bp sequence of a GAA gene as defined above, which is recognized and cleaved by a meganuclease variant or a single-chain chimeric meganuclease derivative.
  • parent meganuclease it is intended to mean a wild type meganuclease or a variant of such a wild type meganuclease with identical properties or alternatively a meganuclease with some altered characteristic in comparison to a wild type version of the same meganuclease.
  • the parent meganuclease can refer to the initial meganuclease from which the first series of variants are derived in step a. or the meganuclease from which the second series of variants are derived in step b., or the meganuclease from which the third series of variants are derived in step k.
  • vector a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • homologous is intended a sequence with enough identity to another one to lead to homologous recombination between sequences, more particularly having at least 95 % identity, preferably 97 % identity and more prefera- bly 99 %.
  • identity refers to sequence identity between two nucleic acid molecules or polypeptides. Identity can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base, then the molecules are identical at that position. A degree of similarity or identity between nucleic acid or amino acid sequences is a function of the number of identical or matching nucleotides at positions shared by the nucleic acid sequences.
  • Various alignment algorithms and/or programs may be used to calculate the identity between two sequences, including FASTA, or BLAST which are available as a part of the GCG sequence analysis package (University of Wisconsin, Madison, Wis.), and can be used with, e.g., default setting.
  • - by mutation is intended the substitution, deletion, insertion of one or more nucleotides/amino acids in a polynucleotide (cDNA, gene) or a polypeptide sequence.
  • Said mutation can affect the coding sequence of a gene or its regulatory sequence. It may also affect the structure of the genomic sequence or the structure/stability of the encoded mRNA.
  • the invention further comprises other features which will emerge from the description which follows, which refers to examples illustrating the I-Crd meganuclease variants and their uses according to the invention, as well as to the appended drawing in which:
  • FIG. 1 Two different strategies for restoring a functional gene with meganuclease-induced recombination.
  • FIG. 1 Modular structure of homing endonucleases and the combinatorial approach for custom meganucleases design
  • A. Tridimensional structure of the I-Crel homing endonuclease bound to its DNA target. The catalytic core is surrounded by two ⁇ folds forming a saddle-shaped interaction interface above the DNA major groove.
  • B. Different binding sequences derived from the I-Crel target sequence (top right and bottom left) to obtain heterodimers or single chain fusion molecules cleaving non palindromic chimeric targets (bottom right).
  • C. The identification of smaller independent subunit, i.
  • Genomic locus of GAA gene Human GAA gene ( sequence ref: NC 000017.9). Exons sequences are indicated as black boxes with their junctions. The GAA2 target (SEQ ID NO: 8) is indicated with its sequence and position.
  • GAA2 (SEQ ID NO: 8) is the DNA sequence located in the human GAA gene at position 1889-1910 ( Figure 3).
  • GAA2.2 (SEQ ID NO: 9) differs from GAA2 at positions -2;-l;+l ;+2 where l-Crel cleavage site (GTAC) was inserted.
  • GAA2.3 (SEQ ID NO: 10) is the palindromic sequence derived from the left part of GAA2, and GAA2.4 (SEQ ID NO: 11) is the palindromic sequence derived from the right part of GAA2.
  • the boxed motives from 10TTC_P, 10GTC_P, 5CCTJP and 5CTG_P are found in the GAA2 series of targets.
  • FIG. 5 Cleavage of GAA2.3 (SEQ ID NO: 10) by combinatorial mutants.
  • the figure displays an example of primary screening of ⁇ -Crel combinatorial mutants with the GAA2.3 (SEQ ID NO: 10) target.
  • the sequences of positive mutants at position Al, B 12, C2, DI l and E5 are 28K30G32S33Y38G40S/44R68Y70S75N77Q (SEQ ID NO: 22), 2S/28R30N32S33N38R40Q/44K68Y70S75D77R (SEQ ID NO: 21), 28R30N32S33N38R40Q/44D68A70S75K77R (SEQ ID NO: 20), 28K30G32S33Y38G40S/44D68A70S75K77R (SEQ ID NO: 24) and 28K30G32S33Y38A40S/44K68S70S75Y77N (SEQ ID NO: 23), respectively (same nomen
  • FIG. 6 Cleavage of GAA2.4 (SEQ ID NO: 11) by combinatorial mutants.
  • the figure displays an example of primary screening of 1-OeI combinatorial mutants with the GAA2.4 target.
  • the sequences of positive mutants at positions A3, B2, F12, GlO and H9 are 28K30K32S33P38Q40S/44N68Y70S75Y77N (SEQ ID NO: 30), 28K30K32S33R38Q40S/44T68Y70S75Y77V (SEQ ID NO: 31), 28K30K32S33A38Q40S/44N68Y70S75Y77N (SEQ ID NO: 29), 28K30R32Q33Y38Q40S/44A68Y70S75Y77V (SEQ ID NO: 33) and 28K30R32Q33Y38Q40S/44T68Y70S75Y77V (SEQ ID NO: 32) respectively (same nomenclature as for Table 2).
  • FIG. 7 Cleavage of GAA2.2 (SEQ ID NO: 9) and GAA2 targets by heterodimeric combinatorial mutants.
  • FIG. 8 Improved cleavage of the GAA2 target (SEQ ID NO: 8).
  • Circled spots in position al, a4, alO and j3 correspond to functional GAA2 mutants obtained from combination with GAA2.4 mutant sequences 19S/28K30K32S33R38Q40S/44T68Y70S75Y77V (SEQ ID NO: 45) (mutant 4A6), 19S/28K30K32S33R38Q40S/44N68Y70S75Y77N, (SEQ ID NO: 43), 19S/28K30K32S33A38Q40S/44N68Y70S78Y77N (SEQ ID NO: 44) and 28K30K32T33A38Q40S/43L/44N68Y70S75Y77N (SEQ ID NO: 46), respectively.
  • the two right spots of each four spot clusters are positive controls of different strength.
  • A shows a schematic representation of a gene repair assay in which a single-copy LacZ gene driven by the CMV promoter is interrupted by the GAA2 target sequence and is thus non-functional.
  • the transfection of the cell line with plasmids coding for GAA2 meganucleases and a LacZ repair plasmid allows the restoration of a functional LacZ gene by homologous recombination; and
  • B shows the results of this assay for GAA2 mutants 3A5/4A6 (respectively, SEQ ID NO:42 and SEQ ID NO:45) which induces high level of gene targeting in CHO cells.
  • Example 1 Strategy for engineering novel meganucleases cleaving a target from the human lysosomal acid ⁇ -glucosidase gene
  • GAA2 is a 22 bp (non-palindromic) target (SEQ ID NO: 8) located in the coding sequence of human lysosomal acid ⁇ -glucosidase gene.
  • the target sequence corresponds to positions 1889-1910 of the human lysosomal acid ⁇ - glucosidase gene (accession number NC_000017.9; Figure 3).
  • the GAA2 sequence is partly a patchwork of the 10TTC_P (SEQ ID O: 4), 10GAC_P (SEQ ID NO: 5), 5CCTJP (SEQ ID NO: 6) and 5CAG_P (SEQ ID O: 7) ( Figure 4) which are cleaved by previously identified meganucleases, obtained as described in International PCT Applications WO 2006/097784 and WO 2006/097853; Arnould et al, J. MoL Biol., 2006, 355, 443-458; Smith et al, Nucleic Acids Res., 2006. Thus, GAA2 could be cleaved by combinatorial variants resulting from these previously identified meganucleases.
  • the 10TTC_P (SEQ ID NO: 4), 10GAC_P (SEQ ID NO: 5), 5CCT_P (SEQ ID NO: 6) and 5CAG_P (SEQ ID NO: 7) target sequences are 24 bp derivatives of C1221 (SEQ ID NO: 2), a palindromic sequence cleaved by 1-OeI (Arnould et al., precited).
  • the structure of l-Crel bound to its DNA target suggests that the two external base pairs of these targets (positions -12 and 12) have no impact on binding and cleavage (Chevalier et al, Nat. Struct.
  • GAA2 (SEQ ID NO: 8) differs from C1221 (SEQ ID NO: 2) in the 4 bp central region.
  • the gtga sequence in -2 to 2 was first substituted with the gtac sequence from C 1221, resulting in target GAA2.2 ( Figure 4). Then, two palindromic targets, GAA2.3 (SEQ ID NO: 10) and GAA2.4 (SEQ ID NO: 11), were derived from GAA2.2 (SEQ ID NO: 9, Figure 4). Since GAA2.3 (SEQ ID NO: 10) and GAA2.4 (SEQ ID NO: 11) are palindromic, they should be cleaved by homodimeric proteins.
  • proteins able to cleave the GAA2.3 (SEQ ID NO: 10) and GAA2.4 (SEQ ID NO: 11) sequences as homodimers were first designed (examples 2 and 3) and then co-expressed to obtain heterodimers cleaving GAA2 (SEQ ID NO: 8, example 4).
  • Heterodimers cleaving the GAA2.2 (SEQ ID NO: 9) and GAA2 (SEQ ID NO: 8) targets could be identified.
  • a series of variants cleaving GAA2.3 (SEQ ID NO: 10) and GAA2.4 (SEQ ID NO: 11) was chosen, and then refined.
  • the chosen variants were subjected to random mutagenesis, and used to form novel heterodimers that were screened against the GAA2 target (SEQ ID NO: 8, example 5). Heterodimers could be identified with an improved cleavage activity for the GAA2 target (SEQ ID NO: 8).
  • Example 2 Making of meganucleases cleaving GAA2.3
  • GAA2.3 (SEQ ID NO: 10) is similar to 5CCT_P (SEQ ID NO: 10)
  • Mutants able to cleave the 1 OTTCJP (SEQ ID NO: 4) target were obtained by mutagenesis on l-Crel N75 and D75 at positions 28, 30, 32, 33, 38, 40 and 70 (Smith, et al 2006). We reasoned that combining such pairs of mutants would allow for the cleavage of the GAA2.3 target (SEQ ID NO: 10).
  • oligonucleotide corresponding to the target sequence flanked by gateway cloning sequence was ordered from Proligo: 5' TGGCATACAAGTTTTGGTCTCCTGTACAGGAGACCAACAATCGTCTGTCA 3' (SEQ ID NO: 12).
  • Double-stranded target DNA, generated by PCR amplification of the single stranded oligonucleotide was cloned using the Gateway protocol (Invitrogen) into yeast reporter vector (pCLS1055, Figure 10).
  • yeast reporter vector was transformed into S. cerevisiae strain FYBL2-7B ⁇ MAT a, ura3 ⁇ 851, trpl ⁇ 63, leu2 ⁇ l, Iys2 ⁇ 202).
  • 1-OeI mutants cleaving 10TTC_P or 5CCT_P were identified in a former study.
  • separate overlapping PCR reactions were carried out that amplify the 5' end (aa positions 1-43) or the 3' end (positions 39-167) of the 1-OeI coding sequence.
  • PCR amplification is carried out using primers specific to the vector (pCLS0542, Figure 9) (GaIlOF 5'-GCAACTTTAGTGCTGACAC AT AC Aces' (SEQ ID NO: 13) or GaIlOR 5'-ACAACCTTGATTGGAGACTTGACC-S' (SEQ ID NO: 14)) and primers specific to the 1-OeI coding sequence for amino acids 39-43 (assF 5'-CTAXXXTTGACCTTT-S ' (SEQ ID NO: 15) or assR 5'- AAAGGTC AAXXXTAG-3' (SEQ ID NO: 16)) where XXX code for residue 40.
  • PCR fragments resulting from the amplification reaction realized with the same primers and with the same coding sequence for residue 40 were pooled. Then, each pool of PCR fragments resulting from the reaction with primers GaIlOF (SEQ ID NO: 13) and assR (SEQ ID NO: 16) or assF (SEQ ID NO: 15) and GaIlOR (SEQ ID NO: 14) was mixed in an equimolar ratio.
  • each final pool of the two overlapping PCR fragments and 75ng of vector DNA (pCLS0542, Figure 9) linearized by digestion with Ncol and Eagl were used to transform the yeast Saccharomyces cerevisiae strain strain FYC2-6A (MAT ⁇ , trpl ⁇ 63, leu2 ⁇ l, his3 ⁇ 200) using a high efficiency LiAc transformation protocol (Gietz and Woods, 2002).
  • An intact coding sequence containing both groups of mutations is generated by in vivo homologous recombination in yeast.
  • filters were transferred to synthetic medium, lacking leucine and tryptophan, with galactose (1%) as a carbon source, and incubated for five days at 37°C, to select for diploids carrying the expression and target vectors. After 5 days, filters were placed on solid agarose medium with 0.02% X-GaI in 0.5 M sodium phosphate buffer, pH 7.0, 0.1% SDS, 6% dimethyl formamide (DMF), 7mM ⁇ - mercaptoethanol, 1% agarose, and incubated at 37°C, to monitor ⁇ -galactosidase activity. Results were analyzed by scanning and quantification was performed using proprietary software.
  • yeast DNA was extracted using standard protocols and used to transform E. coli. Sequence of mutant ORF were then performed on the plasmids by Millegen SA. Alternatively, ORFs were amplified from yeast DNA by PCR (Akada, Murakane et al. 2000), and sequence was performed directly on PCR product by Millegen SA.
  • l-Crel combinatorial mutants were constructed by associating mutations at positions 44, 68, 70, 75 and 77 with the 28, 30, 32, 33, 38 and 40 mutations on the I-Crel N75 or D75 scaffold, resulting in a library of complexity 1480.
  • Example of combinations is displayed on Table 3. This library was transformed into yeast and 2232 clones (1.5 times the diversity) were screened for cleavage against GAA2.3 DNA target (SEQ ID NO: 10). 55 positives clones were found, which after sequencing and validation by secondary screening turned out to correspond to 32 different novel endonucleases (see Table 3). Examples of positives mutants cutting the GAA2.3 target (SEQ ID NO: 10) are shown in Figure 5. 50
  • Table 3 Panel of mutants theoretically present in the combinatorial library used in example 1
  • Example 3 Making of meganucleases cleaving GAA2.4
  • GAA2.4 (SEQ ID NO: 11) sequence derived from the right part of the GAA2 target (SEQ ID NO: 8) in a palindromic form ( Figure 6). All target sequences described in this example are 22 bp palindromic sequences.
  • GAA2.4 (SEQ ID NO: 11) is similar to 5CAG_P (SEQ ID NO: 7) in positions ⁇ 1, ⁇ 2, ⁇ 3, ⁇ 4, ⁇ 5, ⁇ 6, ⁇ 7, ⁇ 9, ⁇ 10 and ⁇ 11 and to 10GAC_P 10 (SEQ ID NO: 5) in positions ⁇ 1, ⁇ 2, ⁇ 6, ⁇ 7, ⁇ 8, ⁇ 9, ⁇ 10 and ⁇ 11.
  • 5CAG_P SEQ ID NO: 7
  • 10GAC_P 10 (SEQ ID NO: 5) in positions ⁇ 1, ⁇ 2, ⁇ 6, ⁇ 7, ⁇ 8, ⁇ 9, ⁇ 10 and ⁇ 11.
  • Mutants able to cleave 5CAG_P were previously obtained by mutagenesis on I-Crel N75 at positions 44, 68, 70 (Amould, Chames et al. 2006), 75 and 77.
  • Mutants able to cleave the 10GAC_P target (SEQ ID NO: 5) were obtained by mutagenesis on l-Crel N75 and D75 at positions 28, 30, 32, 33, 38, 40, 70 (Smith, et al 2006). We reasoned that combining such pairs of mutants would allow for the cleavage of the GAA2.4 target (SEQ ID NO: 11).
  • l-Crel combinatorial mutants were constructed by associating mutations at positions 44, 68, 70, 75 and 77 with the 28, 30, 32, 33, 38 and 40 mutations on the I-Cre ⁇ N75 or D75 scaffold, resulting in a library of complexity 1600. Examples of combinatorial mutants are displayed on table 4. This library was transformed into yeast and 2232 clones (1.4 times the diversity) were screened for cleavage against GAA2.4 DNA target (SEQ ID NO: 11). 184 positives clones were found, which after sequencing and validation by secondary screening turned out to be correspond to 145 different novel endonucleases (see Table 4). Examples of positives mutants cutting the GAA2.4 target (SEQ ID NO: 11) are shown in Figure 6. 52
  • PCR fragment and 75ng of vector DNA are used to transform the yeast Saccharomyces cerevisiae strain FYC2-6A (MAT ⁇ , trpl ⁇ 63, leu2 ⁇ l, his3 ⁇ 200) using a high efficiency LiAc transformation protocol.
  • An intact coding sequence for the 1-CreI mutant is generated by in vivo homologous recombination in yeast.
  • Yeast strain expressing a mutant cutting the GAA2.3 target (SEQ ID NO: 10) was transformed with DNA coding for a mutant cutting the GAA2.4 target (SEQ ID NO: 11) in pCLS1107 ( Figure 11) expression vector. Transformants were selected on -L GIu + G418 medium.
  • Mating was performed using a colony gridder (QpixII, Genetix). Mutants were gridded on nylon filters covering YPD plates, using a low gridding density (about 4 spots/cm 2 ). A second gridding process was performed on the same filters to spot a second layer consisting of different reporter-harbouring yeast strains for each target. Membranes were placed on solid agar YPD rich medium, and incubated at 30°C for one night, to allow mating. Next, filters were transferred to synthetic medium, lacking leucine and tryptophan, adding G418, with galactose (1%) as a carbon source, and incubated for five days at 37 0 C, to select for diploids carrying the expression and target vectors.
  • Example 5 Optimization of meganucleases cleaving GAA2 by random mutagenesis
  • the refinement process described in details in Arnould et al. (J. MoI. Biol., 2007, 371, 49-65) is divided in two steps.
  • the library is transformed into a yeast strain containing the GAA2 target and one of the best GAA2.4 initial mutants.
  • a symmetrical experiment is also performed with a library of randomly mutagenized GAA2.4 mutants, which are screened against GAA2 target (SEQ ID NO: 8) and one of the best GAA2.3 initial mutants.
  • yeast strains containing several best refined GAA2.3 mutants towards the GAA2.3 target were produced. These different strains were screened with the best refined GAA2.4 mutants and checked for an improved cleavage activity on the GAA2 target (SEQ ID NO: 8).
  • Primers used are preATGCreFor (5'- gcataaattactatacttctatagacacgcaaacacaaatacacagcggccttgccacc-3' (SEQ ID NO: 17)) and ICrelpostRev (5'-ggctcgaggagctcgtctagaggatcgctcgagttatcagtcggccgc-3' (SEQ ID NO: 18)).
  • the yeast strain FYBL2-7B (MAT a, ura3 ⁇ 851, trpl ⁇ 63, leu2 ⁇ l, lys2 ⁇ 202) containing the GAA2 target (SEQ ID NO: 8) in the yeast reporter vector (pCLS1055, Figure 10) is transformed with mutants, in the leucine vector (pCLS0542, Figure 9), cutting the GAA2.3 target (SEQ ID NO: 10), using a high efficiency LiAc transformation protocol.
  • Mutant-target yeasts are used as target strains for mating assays as described in example 1. Positives resulting clones were verified by sequencing (Millegen) as described in example 1.
  • Example 6 GAA2 mutants induce high levels of gene targeting in CHO-Kl cells
  • a chromosomal reporter system in CHO cells was used ( Figure 12 A).
  • a single-copy LacZ gene driven by the CMV promoter is interrupted by the GAA2 target sequence (SEQ ID NO: 8) and is thus non-functional.
  • the transfection of the cell line with plasmids coding for GAA2 meganucleases and a LacZ repair plasmid allows the restoration of a functional LacZ gene by homologous recombination. It has previously been shown that double-strand breaks can induce homologous recombination; therefore the frequency with which the LacZ gene is repaired is indicative of the cleavage efficiency of the genomic GAA2 target site (SEQ ID NO: 8).
  • ORF of 1-CVeI mutants 3A5 (SEQ ID NO: 42) and 4A6 (SEQ ID NO: 45) cleaving the GAA2 target (SEQ ID NO: 8) identified in example 5 were re-cloned in pCLS1069 ( Figure 13). ORFs were amplified by PCR on yeast DNA using the here below described attB 1 -ICreIFor and attB2-ICreIRev primers.
  • Primers used are attBl- ICreIFor (5'- ggggacaagtttgtacaaaaagcaggcttcgaaggagatagaaccatggccaataccaaatataacaaagagttcc-3'; SEQ ID NO: 104) and attB2-ICreIRev (5'- ggggaccactttgtacaagaaagctgggtttagtcggccgcggggaggatttcttctctcgc-3'; SEQ ID NO: 105).
  • PCR products were cloned in CHO expression vector pCDNA6.2 from INVITROGEN (pCLS1069, Figure 13) using the Gateway protocol (INVITROGEN). Resulting clones were verified by sequencing (MILLEGEN).
  • CHO-Kl cell lines harbouring the reporter system were seeded at a density of 2x10 5 cells per 10 cm dish in complete medium (Kaighn's modified F-12 medium (F12-K), supplemented with 2 mM L-glutamine, penicillin (100 UI/ml), streptomycin (100 ⁇ g/ml), amphotericin B (Fongizone) (0.25 ⁇ g/ml) (INVITRO GEN-LIFE SCIENCE) and 10% FBS (SIGMA- ALDRICH CHIMIE). The next day, cells were transfected with Polyfect transfection reagent (QIAGEN).
  • lacz repair matrix vector was co-transfected with various amounts of meganucleases expression vectors. After 72 hours of incubation at 37 °C, cells were fixed in 0.5 % glutaraldehyde at 4 0 C for 10 min, washed twice in 100 mM phosphate buffer with 0.02 % NP40 and stained with the following staining buffer (10 mM Phosphate buffer, 1 mM MgCl 2 , 33 mM K hexacyanoferrate (III), 33 mM K hexacyanoferrate (II), 0.1 % (v/v) X-GaI).
  • the frequency of LacZ repair is expressed as the number of LacZ+ foci divided by the number of transfected cells (5x10 5 ) and corrected by the transfection efficiency.
  • Figure 12 B shows that the GAA2 mutants 3A5/4A6 (respectively, SEQ ID NO: 42 and SEQ ID NO: 45) can induce high level of gene targeting in CHO cells. Furthermore, previous works have demonstrated that certain mutations arose more frequently than others in our refinement process for engineered meganucleases. These mutations allow a better cleavage activity in yeast and in mammal cells. Several sets of mutations were therefore introduced in the meganuclease targeting GAA2 target (SEQ ID NO: 8). For instance, the introduction of the 1132V mutation in the 3A5 mutant (3A5I132V; SEQ ID NO: 106) increase the gene correction frequency by a 2.5 fold factor in comparison with the initial 3A5/4A6 heterodimer.

Abstract

La présente invention concerne un variant de I-Crel, dans lequel un des deux monomères de I-Crel a au moins deux substitutions, une dans chacun des deux sous-domaines fonctionnels du domaine de noyau LAGLIDADG situés respectivement à partir des positions 26 à 40 et 44 à 77 de I-Crel, ledit variant étant capable de cliver une séquence d’ADN cible du gène d’acide lysosomique α-glucosidase humain, l’utilisation dudit variant et des produits dérivés pour la prévention et le traitement d’affections pathologiques causées par une mutation dans le gène d’acide lysosomique α-glucosidase humain (maladie de Pompe).
PCT/IB2009/006832 2009-08-21 2009-08-21 Variants de méganucléase clivant une séquence d’adn cible du gène d’acide lysosomique alpha-glucosidase humain et utilisations de ceux-ci WO2011021062A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
PCT/IB2009/006832 WO2011021062A1 (fr) 2009-08-21 2009-08-21 Variants de méganucléase clivant une séquence d’adn cible du gène d’acide lysosomique alpha-glucosidase humain et utilisations de ceux-ci
PCT/IB2010/053751 WO2011021166A1 (fr) 2009-08-21 2010-08-19 Variants de méganucléase clivant une séquence d’adn cible du gène d’acide lysosomique alpha-glucosidase humain et utilisations de ceux-ci

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/IB2009/006832 WO2011021062A1 (fr) 2009-08-21 2009-08-21 Variants de méganucléase clivant une séquence d’adn cible du gène d’acide lysosomique alpha-glucosidase humain et utilisations de ceux-ci

Publications (1)

Publication Number Publication Date
WO2011021062A1 true WO2011021062A1 (fr) 2011-02-24

Family

ID=41692974

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/IB2009/006832 WO2011021062A1 (fr) 2009-08-21 2009-08-21 Variants de méganucléase clivant une séquence d’adn cible du gène d’acide lysosomique alpha-glucosidase humain et utilisations de ceux-ci
PCT/IB2010/053751 WO2011021166A1 (fr) 2009-08-21 2010-08-19 Variants de méganucléase clivant une séquence d’adn cible du gène d’acide lysosomique alpha-glucosidase humain et utilisations de ceux-ci

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/IB2010/053751 WO2011021166A1 (fr) 2009-08-21 2010-08-19 Variants de méganucléase clivant une séquence d’adn cible du gène d’acide lysosomique alpha-glucosidase humain et utilisations de ceux-ci

Country Status (1)

Country Link
WO (2) WO2011021062A1 (fr)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004067736A2 (fr) * 2003-01-28 2004-08-12 Cellectis Meganuclease sur mesure et son utilisation
WO2007093836A1 (fr) * 2006-02-13 2007-08-23 Cellectis Variants de méganucléases coupant une séquence d'adn cible d'un gène xp et leurs utilisations
WO2008010009A1 (fr) * 2006-07-18 2008-01-24 Cellectis Variants de méganucléase clivant une séquence d'adn cible provenant d'un gène rag et leurs utilisations
WO2008059382A2 (fr) * 2006-11-14 2008-05-22 Cellectis Variants de méganucléase clivant une séquence cible d'adn à partir du gène hprt et leurs utilisations
WO2009001159A1 (fr) * 2007-06-25 2008-12-31 Cellectis Procédé permettant d'améliorer l'activité de clivage de méganucléases dérivées de i-crei
WO2009019528A1 (fr) * 2007-08-03 2009-02-12 Cellectis Variants de méganucléases clivant une séquence cible d'adn provenant du gène de la chaine gamma du récepteur d'interleukine-2 humain et ses utilisations
WO2009095742A1 (fr) * 2008-01-31 2009-08-06 Cellectis Nouvelle méganucléase à chaîne unique dérivée de l'i-crei et ses utilisations

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4179337A (en) 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US5006333A (en) 1987-08-03 1991-04-09 Ddi Pharmaceuticals, Inc. Conjugates of superoxide dismutase coupled to high molecular weight polyalkylene glycols
US8206965B2 (en) 2002-03-15 2012-06-26 Cellectis S.A. Hybrid and single chain meganucleases and use thereof
AU2003290518A1 (en) 2002-09-06 2004-04-23 Fred Hutchinson Cancer Research Center Methods and compositions concerning designed highly-specific nucleic acid binding proteins
WO2007034262A1 (fr) 2005-09-19 2007-03-29 Cellectis Méganucléases hétérodimériques et leur utilisation
WO2006097784A1 (fr) 2005-03-15 2006-09-21 Cellectis Variants de meganuclease i-crei presentant une specificite modifiee, leur procede de preparation, et leurs utilisations
ATE466933T1 (de) 2005-03-15 2010-05-15 Cellectis I-crei-meganuklease-varianten mit modifizierter spezifität sowie verfahren zu ihrer herstellung und verwendung
WO2007049095A1 (fr) 2005-10-25 2007-05-03 Cellectis Variants d'endonuclease de liaison a laglidadg comprenant des mutations dans deux sous-domaines fonctionnels et leur utilisation
WO2007060495A1 (fr) 2005-10-25 2007-05-31 Cellectis Variants de l'endonuclease homing i-crei a nouvelle specificite de clivage et leur utilisation
WO2008102199A1 (fr) 2007-02-20 2008-08-28 Cellectis Variants de méganucléase clivant une séquence cible d'adn provenant du gène de la bêta-2-microglobuline et utilisations de ceux-ci
WO2008149176A1 (fr) 2007-06-06 2008-12-11 Cellectis Variants de méganucléase clivant une séquence cible d'adn issue du locus rosa26 de souris et leurs utilisations
WO2009013559A1 (fr) 2007-07-23 2009-01-29 Cellectis Variants de méganucléase clivant une séquence cible d'adn à partir du gène bêta de l'hémoglobine humaine et ses utilisations

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004067736A2 (fr) * 2003-01-28 2004-08-12 Cellectis Meganuclease sur mesure et son utilisation
WO2007093836A1 (fr) * 2006-02-13 2007-08-23 Cellectis Variants de méganucléases coupant une séquence d'adn cible d'un gène xp et leurs utilisations
WO2008010009A1 (fr) * 2006-07-18 2008-01-24 Cellectis Variants de méganucléase clivant une séquence d'adn cible provenant d'un gène rag et leurs utilisations
WO2008059382A2 (fr) * 2006-11-14 2008-05-22 Cellectis Variants de méganucléase clivant une séquence cible d'adn à partir du gène hprt et leurs utilisations
WO2009001159A1 (fr) * 2007-06-25 2008-12-31 Cellectis Procédé permettant d'améliorer l'activité de clivage de méganucléases dérivées de i-crei
WO2009019528A1 (fr) * 2007-08-03 2009-02-12 Cellectis Variants de méganucléases clivant une séquence cible d'adn provenant du gène de la chaine gamma du récepteur d'interleukine-2 humain et ses utilisations
WO2009095742A1 (fr) * 2008-01-31 2009-08-06 Cellectis Nouvelle méganucléase à chaîne unique dérivée de l'i-crei et ses utilisations

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "Meganucleases for Gene Replacement (MenuG); Meetings", 2 September 2007 (2007-09-02), XP002570759, Retrieved from the Internet <URL:http://www.imbb.forth.gr/MenuG/meetings.html> [retrieved on 20100225] *
ARNOULD S ET AL: "Engineering of Large Numbers of Highly Specific Homing Endonucleases that Induce Recombination on Novel DNA Targets", JOURNAL OF MOLECULAR BIOLOGY, LONDON, GB, vol. 355, no. 3, 20 January 2006 (2006-01-20), pages 443 - 458, XP024950505, ISSN: 0022-2836, [retrieved on 20060120] *
EPINAT J-C ET AL: "A novel engineered meganuclease induces homologous recombination in yeast and mammalian cells", NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 31, no. 11, 1 June 2003 (2003-06-01), pages 2952 - 2962, XP002248751, ISSN: 0305-1048 *
GEEL M ET AL.;: "The generation of animal models to design novel gene correction approaches for Pompe disease", HUMAN GENE THERAPY, vol. 19, no. 10, P 52, 28 October 2008 (2008-10-28), pages 1098 - 1202, XP002570760, Retrieved from the Internet <URL:http://www.liebertonline.com/doi/abs/10.1089/hum.2008.1034> [retrieved on 20100225], DOI: 10.1089/hum.2008.1034 *
PÂQUES FRÉDÉRIC ET AL: "Meganucleases and DNA double-strand break-induced recombination: perspectives for gene therapy", CURRENT GENE THERAPY, BENTHAM SCIENCE PUBLISHERS LTD, NL, vol. 7, no. 1, 1 February 2007 (2007-02-01), pages 49 - 66, XP002493370, ISSN: 1566-5232 *
ROSEN LAURA E ET AL: "Homing endonuclease I-CreI derivatives with novel DNA target specificities", NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 34, no. 17, 1 January 2006 (2006-01-01), pages 4791 - 4800, XP002427715, ISSN: 0305-1048 *
SMITH JULIANNE ET AL: "A combinatorial approach to create artificial homing endonucleases cleaving chosen sequences", NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 34, no. 22, 1 December 2006 (2006-12-01), pages E149 - 1, XP002457708, ISSN: 0305-1048 *

Also Published As

Publication number Publication date
WO2011021166A1 (fr) 2011-02-24

Similar Documents

Publication Publication Date Title
EP2167656B1 (fr) Variants de méganucléase clivant une séquence cible d&#39;adn du locus rosa26 de souris et leurs utilisations
EP2046950B1 (fr) Variants de méganucléases clivant une séquence d&#39;ADN cible d&#39;un gène RAG1 et leurs utilisations
US20130183282A1 (en) Meganuclease variants cleaving a DNA target sequence from the rhodopsin gene and uses thereof
US20100146651A1 (en) Meganuclease variants cleaving a dna target sequence from the hprt gene and uses thereof
US20130145487A1 (en) Meganuclease variants cleaving a dna target sequence from the dystrophin gene and uses thereof
EP2121036A2 (fr) Variants de méganucléase clivant une séquence d&#39;adn cible du gène de la bêta-2-microglobuline et leurs utilisations
US20140112904A9 (en) Method for enhancing the cleavage activity of i-crei derived meganucleases
WO2009001159A1 (fr) Procédé permettant d&#39;améliorer l&#39;activité de clivage de méganucléases dérivées de i-crei
EP1989299A2 (fr) Variants de méganucléases coupant une séquence d&#39;adn cible d&#39;un gène de xéroderma pigmentosum et leurs utilisations
WO2009095742A1 (fr) Nouvelle méganucléase à chaîne unique dérivée de l&#39;i-crei et ses utilisations
WO2010026443A1 (fr) Variants de méganucléase clivant une séquence d&#39;adn cible provenant d&#39;un gène de la glutamine synthétase et leurs utilisations
EP2205626A2 (fr) Variants de méganucléase clivant une séquence cible d&#39;adn provenant du gène de la chaîne gamma du récepteur de l&#39;interleukine-2 humain, et leurs utilisations
WO2008059317A1 (fr) Variantes de méganucléases clivant une séquence cible d&#39;adn du gène hprt et leurs utilisations
US20110041194A1 (en) I-msoi homing endonuclease variants having novel substrate specificity and use thereof
WO2012007848A2 (fr) Variants de méganucléase clivant une séquence d&#39;adn cible dans le gène was et leurs utilisations
WO2011021062A1 (fr) Variants de méganucléase clivant une séquence d’adn cible du gène d’acide lysosomique alpha-glucosidase humain et utilisations de ceux-ci

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09786248

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC

122 Ep: pct application non-entry in european phase

Ref document number: 09786248

Country of ref document: EP

Kind code of ref document: A1