WO2010009905A1 - Cancer treatment and test - Google Patents

Abstract

Provided is a colon cancer treatment comprising downregulating or suppressing Thymosin Beta4 expression, as well a test for identifying Colon Cancer Stem Cells.

Description

CANCER TREATMENT AND TEST

The cytoskeletal organization of cancer cells is different from that of normal cells from which they are derived (Pollack et al., 1975; Gabbiani et al., 1979). Cell transformation is accompanied by a loss of growth regulation, changes in cell morphology, reduced cell-cell contact and substrate adhesion. These steps, leading to tumourigenesis, are associated with both reorganization and loss of actin filaments (Decloitre et al., 1991). Even tough the role of actin in tumorigenesis transformation is not well defined, the involvement of a myriad of actin-binding proteins, governing the organization of the actin structures, is becoming evident. One family of actin-binding proteins comprises the beta-thymosins, a class of small peptides with thymosin beta4 (Tbeta4) representing the most abundant member.

Tbeta4, a small (43 aa) acidic peptide originally isolated from calf thymus, was initially believed to be a thymic hormone (Low and Goldestein, 1982). Later on, along with other members of the family, Tbeta4 was identified as an intracellular G-actin sequestering molecule, ubiquitously expressed. Thus, Tbeta4 plays a pivotal role in modulating actin dynamics and, depending on the cell type, its over-expression can induce either polymerization of stress fibres or a decrease in the number of actin fibres (Sanders et al., 1992; Sanger et al., 1995; Golla et al., 1997). In addition, Tbeta4 has been shown to be involved in tissue remodelling, cell differentiation and wound healing (Goldestein et al., 2005). In fact, although it is a typical intracellular peptide, it plays numerous roles, both intracellularly and extracellularly. Several observations indicate that Tbeta4 is involved in adhesion and spreading of fibroblasts (Golla et al., 1997; Kobayashi et al., 2002), differentiation of endothelial cells (Grant et al., 1995; Grant et al., 1999), directional migration of endothelial cells and keratinocytes (Malinda et al., 1999; Philp et al., 2004), angiogenesis (Grant et al., 1995; Koutrafouri et al., 2001; Cha et al., 2003), wound healing (Malinda et al., 1999; Sosne et al., 2001; Sosne et al., 2002), hair follicle growth (Philp et al., 2004) and apoptosis ( Iguchi et al., 1999; Muller et al., 2003; Wang et al. 2004). The mechanism by which Tbeta4 influences cell proliferation, migration and differentiation is generally believed to be linked to the maintenance of the dynamic equilibrium between G-actin and F-actin, critical for the rapid reorganization of the cytoskeleton. However, recent observations indicate that Tbeta4 can express its activity also by influencing signalling cascades or directly acting in the nucleus as a transcription factor (Bednarek et al., 2007; Brieger et al., 2007; Huff et al., 2004). Participation of Tbeta4 in carcinogenesis was postulated years ago because of its aberrant expression, along with the other family member Thymosin betalO, in malignant renal tumours (Hall 1991). Later on, overexpression of these proteins has been observed also in human colon carcinomas and a variety of malignant cell lines and tumours (Hall, 1991; Yamamoto et al., 1993; Xie et al., 2002; Santelli et al., 1999). In addition, elevated Tbeta4 expression has been associated with increased tumourigenicity and metastatic potential (Clark et al., 2000; Kobayashi et al., 2002). In fact, high levels of Tbeta4 correlate with increased invasive capability of tumour cells, the degree of morphologic transformation and disintegration of actin filaments (Paasinen- Sohns, et al., 2000), with potentiated cell growth (Wang et al., 2004; Wang et al., 2003) although the latter observation is not general (Kobayashi et al., 2002; Cha et al., 2003).

Surprisingly, we have found that down-regulation of Thymosin-beta4 decreases the growth of colon cancer stem cells in vitro and in vivo. In particular, we have shown that the down- regulation of Tbeta4 reduces in vivo tumour growth by instructing cells towards a differentiative, rather than a proliferative, pathway.

Colorectal carcinoma (CRC) is one of the leading causes of cancer death in western world. Genetically, CRC tumorigenesis appears to be the result of a progressive transformation of colorectal epithelial cells due primarily to the accumulation of mutations in a number of oncogenes as well as tumour suppressor genes (Fearon and Vogelstein, 1990). Aberrant expression of Tbeta4 has been recently found to be associated with CRC progression by inducing a reduction of E-cadherin expression, accumulation of beta-Catenin in the nucleus and activation of the Tcf/LEF-mediated transcription (Wang et al., 2003; Wang et al., 2004.

Increasing evidences indicates that cancer could be a stem cell disease. This is based on the identification of a subpopulation of tumour cells with self-renewal ability, which has a great propensity to accumulate carcinogenic mutations. Colon Cancer Stem Cells (CCSCs) have been recently identified (Ricci-Vitiani et al., 2007; O'Brien et al., 2007), but molecular characterization of CCSCs is in its infancy.

However, we found that transduced CCSCs with reduced Tbeta4 expression levels have a lower capacity to grow in culture, and, when intradermally injected in SCID mice, produced tumours of reduced size when compared with tumours generated by the injection of CCSCs transduced with the empty vector. Moreover, Tbeta4 down-regulation in CCSCs is associated with a decreased expression of Integrin-Linked Kinase (ILK) and of the phosphorylation state of its downstream effector Akt.

Accordingly, Tbeta4 down-regulation induces colon cancer stem cells to differentiate into other colon cell types, for instance goblet cells.

Thus, in a first aspect, the invention provides a method of treating colon cancer comprising administering an agent capable of reducing Thymosin Beta 4 (TB4 or Tbeta4) expression in colon cells.

The cells may be cancerous colon or colorectal cancer cells, colon carcinoma cells or CCSCs. CCSCs may be identified by the presence of CD 133, as taught in Ricci-Vitiani et al. 2007, for instance.

What is particularly surprising and useful is that cells that are resistant to chemotherapy can be targeted for treatment. Accordingly, it is particularly preferred that the colon cancer stem cells are (a population) resistant to common chemotherapeutic treatments (Dean M, Fojo T, Bates S. Tumour stem cells and drug resistance. Nat Rev Cancer. 2005 Apr;5(4):275-84. Review.). For instance, it is preferred that the colon cancer has proven not to be susceptible to previous treatments.

The agent, when administered or delivered to the cells, as described below, reduces expression of TB4. Where TB4 is overexpressed, it is preferred that the agent suppresses the expression of TB4. Where TB4 is not expressed or is at least not overexpressed, then an increase in expression of TB4 is preferably suppressed by the agent. The agent may be considered as a modulator that acts on the TB4 protein, the TB4 gene or promoter or enhancer therefor, or TB4 RNA to thereby reduce or suppress levels of the protein expressed in the cell.

The agent is preferably a TB4 binding agent, being an agent capable of recognising, and binding to, the TB4 RNA or peptide, but more preferably the TB4 protein, for instance in its folded state. The binding agent is most preferably an antibody (Ab) specific for TB4 or a TB4-binding fragment of such an antibody. The reduction in TB4 expression can be achieved by removing or destroying the protein itself, for instance by using an anti-TB4 antibody, or by suppressing its expression, for instance by suppressing the expression of the gene encoding it. This may be achieved using, for instance, interfering nucleotides. In other words, TB4 is downregulated, preferably leading to the induction of differentiation in the targeted cells and/or the inhibition of proliferation in the targeted cells.

In a further aspect, the invention provides a method of inducing differentiation in colon cancer cells by downregulating TB4 expression, hi a still further aspect, the invention provides a method of inhibiting proliferation in colon cancer cells by downregulating TB4 expression. Preferably, said cells are CCSCs.

Preferably, the methods induce or imitate a differentative pathway in the targeted cells, with a concomitant inhibition of proliferation. Preferably, the induced differentiative pathway leads to a goblet cell phenotype.

In all aspects, the cells are preferably at least partially, and more preferably completely, resistant to chemotherapeutic treatments. It will be appreciated that resistance to such treatments is apparent by a failure to respond to therapeutic doses of the chemotherapeutic treatment.

Suitable agents will be readily apparent to the skilled person, for instance by using high throughput screening. Suitable treatments may comprise the use of miRNA and/or siRNA to silence or reduce expression of Tβ4 by interfering with the Tβ4 mRNA, and these RNAs may be encoded by a suitable expression vector, hi addition these miRNA and/or siRNA may be conjugated with appropriate molecules (such as cholesterol) to enter the cell. Antibodies, and fragments thereof, may also be used, but it is generally preferred to use nucleic acid sequences.

Alternatively, it is envisaged that an agonist or antagonist of TB4 could be targeted, for instance molecules that act on TB4 function (for instance Ku80 which has been identified as an intracellular TB4 receptor and mediates intracellular TB4 activity), although such molecules may affect other cellular pathways.

Preferably, treatment may involve any suitable method to suppress expression of Tβ4. We exemplify the use of antisense polynucleotides, especially antisense DNA herein, and this may be introduced by the use of a suitable expression plasmid or, most preferably a lentivirus, for example. Equally, antisense RNA or an RNA/DNA mixture may be used. It is preferred not to use a retrovirus, although it is possible, as only low levels of transduction are generally observed with retroviruses. Expression vectors and lentiviridae will generally become attenuated and eventually disappear from the system.

Murine thymosin beta 4 cDNA has been deposited and is available at GenBank accession number: NM 021278 (on chromosome X). Its sequence is preferably that provided in SEQ ID NO. 1.

5'-ATGTCTGACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAGTTGA AGAAAACAGAAACGCAAGAGAAAAATCCTCTGCCTTCAAAAGAAACAATTGAACA AGAGAAGC AAGCTGGCGAATCGTAA-3 '

It will be appreciated that human Tβ4 has a very similar structure and can be readily elucidated using antibodies to the murine protein.

Human Thymosin beta 4 (X-linked) may have GenBank accession number: NM 021109 and the sequence of SEQ ID NO.2.

5'-ATGTCTGACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAACTGA

AGAAGACAGAGACGCAAGAGAAAAATCCACTGCCTTCCAAAGAAACGATTGAACA

GGAGAAGCAAGCAGGCGAATCGTAA-3'

Murine Thymosin beta 4 protein sequence (also conserved in human) may have the GenBank accession number: NP_067253. The sequence is preferably that in SEQ ID NO.3.

MSDKPDMAEI EKFDKSKLKK TETQEKNPLP SKETIEQEKQ AGES

In general, the sequence of Tβ4 is not important, save that interfering nucleotide sequences will generally have a whole or partial antisense sequence to either of the above sequences. An antisense sequence to the murine sequence will generally also be effective in humans, despite mismatches, as it is not necessary for an antisense sequence to be completely complementary to the coding sequence to have a suppressive effect. Indeed, there are only 9 mismatches on 136 bases between the murine and human coding sequences, and the protein sequence is identical.

The DNA antisense sequence used in the accompanying Examples was based on the above sequence, and was that shown in SEQ ID NO.4, although any suitable antisense sequence may be used, as described hereinbelow. 5 ' -TTACGATTCGCCAGCTTGCTTCTCTTGTTCAATTGTTTCTTTTGAAGGCAGAGGAT TTTTCTCTTGCGTTTCTGTTTTCTTCAACTTCGACTTATCGAATTTCTCGATCTCAGCC ATATCGGGTTTGTCAGACAT -3'

Suitable treatment may also comprise the use of miRNA and/or siRNA to silence or reduce expression of Tβ4 by interfering with the Tβ4 mRNA, and these RNAs may be encoded by a suitable expression vector.

Antibodies, both monoclonal and/or polyclonal, and fragments thereof, may also be used. The antibodies are preferably raised against the protein sequence given above.

It is generally preferred, however, to use nucleic acid sequences to reduce expression of TB4. Such sequences need only interfere with expression, and will generally be antisense to the Tβ4 coding sequence, whether on the genome or RNA. As it is only necessary to recognise the sense sequence, it is not essential that the antisense sequence match the sense sequence base for base. The antisense sequence may vary from full length antisense, to shorter sequences of 10 to about 40, more preferably about 15 to about 30 bases, and particularly preferably herein, about 22-23 nucleotide siRNA, which serves to guide cleavage of target Tbeta4 mRNA. The RNA may comprise one sense sequence and one antisense sequence (complementary) separated by a nonsense sequence so that a loop is created. This miRNA, which after base pairing between the mature miRNA and its target Tbeta4 mRNA, thereby leads to Tbeta4 mRNA cleavage or to Tbeta4 mRNA translation inhibition.

Preferred miRNAs are : miR-1/206 (SEQ ID NO. 5 and MIMAT 0000462); UGGAAUGUAAGGAAGUGUGUGG miR-148/152 (SEQ ID NO. 6 and MIMAT0000438); UCAGUGCAUGACAGAACUUGG miR-217 (SEQ ID NO. 7 and MIMAT0000274); UACUGCAUCAGGAACUGAUUGGA and miR-183 (SEQ ID NO. 8 and MIMAT0000261). UAUGGCACUGGUAGAAUUCACU

Where reference is made to a particular sequence herein, it will be appreciated that this may preferably also encompass functional variants having at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 99% and more preferably at least 99.5% sequence homology to said sequence, where appropriate given the number of nucleotides or amino acids. It will also be appreciated that reference to any polynucleotide sequence herein also includes the complimentary sequence thereof or a functional variant having the above-mentioned percentage homologies thereto. It is preferred that the complimentary sequence is capable of binding to the reference sequence under highly stringent conditions, for instance 6 x SSC at about 45⁰C, followed by one or more washes in Ix SSC, 0.1% SDS at 5O⁰C, preferably at 55⁰C, more preferably at 60⁰C and even more preferably at 65⁰C.

Highly stringent conditions include incubations at 42°C for a period of several days, such as 2-4 days, using a labelled DNA probe, such as a digoxigenin (DIG)-labelled DNA probe, followed by one or more washes in 2x SSC, 0.1% SDS at room temperature and one or more washes in 0.5x SSC, 0.1% SDS or 0.1 x SSC, 0.1% SDS at 65-68°C. In particular, highly stringent conditions include, for example, 2 h to 4 days incubation at 42°C using a DIG-labelled DNA probe (prepared by e.g. using a DIG labelling system available from Roche).

Expression vectors and plasmids may contain promoters that are selectively active in colon cells (especially colon carcinoma or CCSCs) so as not to reduce expression in other cells, should the vector transfect another cell type, but this is generally unlikely in vivo.

Preferably, TB4 overexpression is measured compared to the controls, preferably BerEP4+ normal epithelial cells. We have Real Time PCR data showing an average of a 60 fold increase of TB4 mRNA in colon cancer stem cells as compared to normal epithelial cells. The TB4 protein is undetectable in control cell lines by Western Blot analysis. Accordingly, it is preferred that the TB4 expression is reduced or returned towards normal levels, preferably by between about 50% and 100% of the amount of expression usually observed in CCSCs not so treated. It is generally preferred to reduce expression to very low levels, such as less than 10%, and preferably less than 5%, and levels of substantially 0%, where Tbeta4 is not detectable, as illustrated hereinbelow, are preferred.

Elevated levels of TB4 may be, preferably, at least a 20 fold increase of TB4 mRNA in colon cancer stem cells as compared to normal epithelial cells, more preferably at least a 30 fold increase of TB4 mRNA, more preferably at least a 40 fold increase, more preferably at least a 50 fold increase, more preferably at least a 70 fold increase, more preferably at least a 80 fold increase, more preferably at least a 90 fold increase, more preferably at least a 100 fold increase, more preferably at least a 150 fold increase, more preferably at least a 200 fold increase, more preferably at least a 250 fold increase, but most preferably at least a 60 fold increase of TB4 mRNA in colon cancer stem cells as compared to normal epithelial cells Western blot analyses showed that in CCSCs with reduced Tbeta4 levels, ILK expression is significantly decreased (70% decrease). Meanwhile, the decreased ILK expression is paralleled by a decreased phosphorylation state of Akt in Ser473, whereas total Akt protein was unchanged. Interestingly, no significant modifications were found for the expression of cyclin-dependent kinase inhibitor IA (p21), which is involved in the regulation of cell cycle checkpoints and repair, or beta-Catenin, whose genetic mutations have been correlated with CRC, see Figure 7.

Accordingly, the reduced TB4 expression can also be measured by suitable assays for a reduction in ILK expression and/or a decreased phosphorylation state of Akt in Ser473. Similarly, the increased TB4 expression is detectable by assaying for an increase in ILK expression and/or an increased phosphorylation state of Akt at Ser473 or a position corresponding thereto.

In a further aspect, there is provided a CCSC or colon cancer cell for implanting in a patient, wherein the cell has been treated to reduce Thymosin beta4 (TB4) expression, or displays reduced TB4 expression. Preferably, the cell also expresses an anti-cancer agent, such as a toxin able to kill cancerous cells. Transplantation of CCSCs engineered to express both reduced levels of TB4 and said anti-cancer agent would be useful for treating the tumour by delivering the toxin in situ and, at the same time, would be a source of new colon cells, for instance to replace those which have been damaged by any cancer or anti-cancer treatment.

Preferably, the implanted cells have been transformed by a suitable plasmid or vector comprising anti-cancer agent under control of suitable promoter and preferably a suitable marker.

In particular, it is envisaged that the administered CCSCs are instructed into a differentiative pathway by the reduction of expression in Tbeta4, thereby allowing new colon cells, preferably goblet cells, to form. It is preferred that these cells are non-cancerous.

CCSC or colon cancer cells for use in accordance with the present invention are preferably homologous in the sense that they are from the same species as the patient, or even the same patient having been extracted and modified. It will be appreciated that, while reference is commonly made herein to CCSC or colon cancer cells in the plural, this includes reference to a CCSC or colon cancer cell in the singular, where appropriate. The patient is preferably human, and the CCSC or colon cancer cells are preferably obtained from a blood relative of the patient or a close serological match therefor and, more preferably, from the patient him- or her- self.

How the CCSC or colon cancer cells are obtained is not important to the present invention. It is preferred to culture the CCSC or colon cancer cells in a manner common to the cultivation of other cells or stem cells in general in order to obtain the required cells for implantation. The CCSC or colon cancer cells may be cultured in a medium containing epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF). They may then be treated to reduce Tbeta4 expression. Such treatment may involve any suitable method to suppress expression of Tbeta4, as discussed elsewhere.

Administration of the CCSC or colon cancer cells to the desired area may be in combination with a suitable nutrient, carrier or structural framework to encourage growth and differentiation, since suitable conditions will not often be present in situ. The CCSC or colon cancer cells of the invention may also be grown and started down the differentiation pathway prior to implantation, but it is preferred only to start the process for a short while prior to implantation, as it is preferred that the growing cell adapts to its environment.

It will also be appreciated that CCSC or colon cancer cells may be implanted directly in the patient and treated in situ to suppress TB4 expression, or the cells may be prepared with the treatment in a syringe prior to injection. It will also be appreciated that pre-existing, or endogenous, CCSC or colon cancer cells may be treated in situ to suppress TB4 expression, and that such treatment forms a part of the present invention. The present invention contemplates such methods, but it is generally preferred to incubate the CCSC or colon cancer cells, with the treatment to reduce expression of Tβ4 in order to stabilise incorporation of the treatment. This may be done in the presence of EGF and/or bFGF, preferably both, in order to prevent differentiation, with removal of these growth factors being achieved by the simple expedient of implantation in the patient with the subsequent resulting dilution and removal by the patient's circulation.

Treatment may be verified by the presence of a suitable marker, such as a fluorescent protein. GFP may be used, and the EGFP reporter gene, optionally under the control of the PGK promoter, may be used, for example. Transfected CCSC or colon cancer cells may then be selected in accordance with whether they fluoresce under the selected conditions. It will be appreciated that the present invention extends to a method for the treatment of a patient requiring treatment for colon cancer or colon regeneration comprising administering an CCSC or colon cancer cell as defined herein to the area of the patient requiring treatment. Preferred conditions for treatment are those identified above.

Also provided is a test for identifying CCSCs by detecting TB4 overexpression in a sample of cells, preferably from a colon cancer patient or a patient considered likely to have colon cancer (for instance in a screening process). Also provided is a method screening said patients, singly or in a population, comprising assaying for the presence of overexpression of TB4, as defined herein.

The invention also provides a method of assaying for the presence of colon cancer cells, particularly CCSCs, comprising detecting the presence of elevated (i.e. overexpressed) TB4 levels in a sample, the elevated levels of TB4 being those described herein.

Where reference to a method of treatment involving an agent is made, it will be appreciated that this also encompasses the use of an agent in the manufacture of a medicament for the treatment and/or prophylaxis of a condition specified herein, as well as the agent for use in the treatment and/or prophylaxis of a condition specified herein.

Thymosin beta4 (Tbeta4) plays a pivotal role in modulating actin dynamics and has been shown to be involved in carcinogenesis. Overexpression of Tbeta4 has been observed in human colon carcinomas and a variety of malignant cell lines and tumours. Colorectal carcinoma (CRC) is one of the leading causes of cancer death in Western world. Recently, a subpopulation of tumour cells with self-renewal abilities have been identified that have a role in the initiation and growth of CRC. This subpopulation is called Colon Cancer Stem Cells (CCSCs). In this study, we have analysed at molecular and biochemical level Tbeta4 expression in different CCSC lines obtained from patients affected by CRC.

We have shown for the first time that CCSCs have an increased Tbeta4 expression when compared with epithelial cells isolated from a normal intestinal mucosa. We then used a lentiviral strategy to down-regulate Tbeta4 expression in CCSCs and analysed in vitro and in vivo the effects of such modulation on proliferation, survival and tumorigenic activity of transduced CCSCs. Interestingly, transduced CCSCs with reduced Tbeta4 expression levels have a lower capacity to grow in culture, and, when intradermically injected in SCID mice, produced tumours of reduced size when compared with tumours generated by the injection of CCSCs transduced with the empty vector. Furthermore, we found that the altered cellular properties observed following Tbeta4 down-regulation in CCSCs are associated with a significantly decreased expression of Integrin-Linked Kinase (ILK), paralleled by a decrease in the phosphorylation state of its downstream effector Akt.

The identification of the effects obtained through the down-regulation of Tbeta4 on CCSC growth represents an important step in the development of novel therapeutic strategies aimed at eradicating the subpopulation of CCSCs and, in particular, CCSCs resistant to chemotherapy. Colon cancers and carcinomas in particular are also treatable.

This was not expected as there are numerous papers that show a heterogeneous distribution of Tbeta4 within tumours [Larsson LI₅ Hoick S. "Localization of thymosin beta-4 in tumours," Ann N Y Acad Sci. 2007 Sep; 1112:317-25; and Larsson LI, Hoick S. "Occurrence of thymosin beta4 in human breast cancer cells and in other cell types of the tumour microenvironment," Hum Pathol. 2007 Jan; 38(1): 114-9]. In particular, these authors demonstrated that different cell types within tumours express Tbeta4 with different intensity. Interestingly, in breast cancer, cancer cells showed low or intermediate reactivity for Tbeta4, whereas leukocytes and macrophages showed intense reactivity. The tumours examined included breast cancer and colorectal carcinoma.

In addition, some colon carcinoma cell lines do not overexpress T beta4. For example, SW480 cells (used by Huang et al.) do not normally overexpress T beta4. Indeed, Huang et al showed that a cell-type transition occurred only in Sw480 cells stably transfected to overexpress T beta4.

The recently-identified Colon Cancer Stem Cells are a subpopulation of tumour cells crucial for tumour initiation and growth, whose molecular properties remain mostly unknown. These cells, therefore, may not have the same features and genetic mutations which are acquired by the cells forming the mass of- solid tumours.

Thus, there is no link between Colon Cancer Stem Cells and the Colorectal tumour cells which may develop from them, particularly as the colon carcinoma population shows varying levels of TB4 expression itself. However, we were the first to show the effects obtained through TB4 downregulation on the growth of a population of chemotherapy-resistant cells. The following references show both over and under-expression of TB4 in Colorectal tumour cells, although the art is largely silent on Thymosin beta4 expression in colorectal carcinoma tumours and cell lines. Some papers show that SW480 colon carcinoma cells have low levels of Thymosin beta 4 and therefore are used for overexpression experiments:

1. Huang HC, Hu CH₅ Tang MC, Wang WS, Chen PM, Su Y. Thymosin beta4 triggers an epithelial mesenchymal transition in colorectal carcinoma by upregulating integrin-linked kinase Oncogene. 2007 Apr 26;26(19):2781-90.

2. Hsiao HL, Wang WS, Chen PM, Su Y. Overexpression of thymosin beta-4 renders SW480 colon carcinoma cells more resistant to apoptosis triggered by FasL and two topoisomerase II inhibitors via downregulating Fas and upregulating Survivin expression, respectively. Carcinogenesis. 2006 May;27(5):936-44. Epub 2005 Dec 19.

3. Wang WS₅ Chen PM, Hsiao HL₅ Wang HS, Liang WY, Su Y. Overexpression of the thymosin beta-4 gene is associated with increased invasion of SW480 colon carcinoma cells and the distant metastasis of human colorectal carcinoma. Oncogene. 2004 Aug 26;23(39):6666-71.

A paper from Santelli et al (Santelli G, Califano D, Chiappetta G, Vento MT, Bartoli PC, Zullo F, Trapasso F₅ Viglietto G, Fusco A. Thymosin beta- 10 gene overexpression is a general event in human carcinogenesis. Am J Pathol. 1999 Sep;155(3):799-804) focuses on Thymosin beta 10 expression where also Thymosin beta 4 expression is showed in several carcinomas.

Conversely, Yamamoto et al. (Yamamoto T₅ Gotoh M, Kitajima M₅ Hirohashi S.Thymosin beta- 4 expression is correlated with metastatic capacity of colorectal carcinomas. Biochem Biophys Res Commun. 1993 Jun 15;193(2):706-10.) observed that Thymosin beta 4 is downregulated in metastatic cells from colorectal carcinomas

Larson and Hoick (Larsson LI, Hoick S. Localization of thymosin beta-4 in tumors, Ann N Y Acad Sci. 2007 Sep;l 112:317-25) revealed an unexpected cellular heterogeneity of thymosin beta 4 expression in breast and colonic carcinomas.

As described in this review (Dean M, Fojo T₅ Bates S._Tumour stem cells and drug resistance. Nat Rev Cancer. 2005 Apr;5(4):275-84. Review.), cancer stem cells are inert to toxic environmental agents due to their resistance to apoptosis. The chemotherapy kills most cells in tumors leaving behind CCSC which dictates the tumor growth.

Therefore, concerning the treatment of colon cancer stem cells, there is just a paper showing that, since CCSC produce and utilize IL-4 to protect themselves from apoptosis, treatment with IL- 4Ralpha antagonist or anti-IL4 neutralizing antibody enhances the antitumor efficacy of standard chemotherapeutic drugs (Todaro M, Alea MP, Di Stefano AB, Cammareri P, Vermeulen L, Iovino F, Tripodo C, Russo A, Gulotta G, Medema JP, Stassi G. Colon cancer stem cells dictate tumor growth and resist cell death by production of interleukin-4. Cell Stem Cell. 2007 Oct l l;l(4):389-402). Other publications include Jain et al The Journal of Pharmacology and Experimental Therapeutics, vol 311, No. 3, 2004 and the Wang et al (2003) paper cited below.

However, we were the first to show the effects obtained through Tbeta4 downregulation on the growth of colon cancer stem cells (CCSC), a population of chemotherapy-resistant cells. We have also shown that the cellular effects mediated by Tbeta4 loss can be "rescued" or at least substantially reversed by the over-expression of an active form of the mediator Akt.

Thus, the invention also provides a method of stimulating proliferation in a cell, preferably a colon cell as described above, where TBeta4 expression has been reduced, said method comprising contacting said cell with Akt and/or overexpressing Akt in said cell, in particular constitutively active Akt (Kohn et al., J Biol Chem. 1996 Dec 6;271(49):31372-8.). Akt may be expressed in said cell by transducing the cell with a suitable vector, for instance a retroviral vector or a lentiviral system such as those described herein, comprising polynucleotides encoding Akt under the control of a suitable promoter. The method is preferably conducted on a sample of cells, for instance ex vivo or in vitro.

Preferably, the sequence for Akt is the amino acid sequence provided in SEQ ID NO. 10 or a polynucleotide sequence encoding it, including that provided in SEQ ID NO. 9. Variants and complementary sequences are also envisaged, as described elsewhere.

It is particularly preferred that the "rescue" (stimulation of proliferation) after a loss of or reduction in Tbeta4 expression is mediated by a constitutively active form of Akt. Preferably, this Akt protein sequence is myristoylated (see Kohn, 1996 supra), although other similar co- translational or post-translational modifications, particularly N-terminal modification are also preferred. Particularly preferred are modifications such as Acetylation, Carbamylation, Formylation, Glycation, and Methylation.

Kohn describes constructing their Akt Constructs, which are preferred, as follows. An src myristoylation signal sequence:

MetGlySerSerLysSerLysProLysAspProSerGlnArgArg (SEQ ID NO. 11) ATGGGGAGTAGCAAGAGCAAGCCTAAGGACCCCAGCCAGCGCCGG (SEQ ID NO. 12)

was added to Akt D4-129 using the polymerase chain reaction to generate myrAkt D4-129 and A2myrAkt D4-129. The start methionine of Akt D4-129 was removed, and the new start methionine encoded by the myristoylation signal peptide was flanked by the Kozak consensus sequence. A2myrAkt D4-129 differs from myrAkt D4-129 in that A2myrAkt D4-129 encodes an alanine at amino acid position 2, instead of a glycine.

Indeed, other modifications are described in Kohn et al, supra, where they describe having constructed another constitutively active mutant of Akt by fusing the iSH2 domain derived from the p85 PI 3 -kinase regulatory subunit to the amino terminus of Akt. This mutant was found to be associated with a constitutively active PI 3-kinase activity. Such modifications and similar are also preferred.

Thus, the Akt constructs described above and in Kohn et al., J Biol Chem. 1996 Dec 6;271(49):31372-8 are particularly preferred.

We have further shown that Tbeta4 antisense CCSCs have a long term inhibiting effect on proliferation, colony formation and migration which generally correlates well with reduced in vivo tumourigenicity. Example 1

Materials and Methods

Cell culture

Tumour samples were subjected to mechanical and enzymatic dissociation. The resulting cancer cells were cultured in a serum-free medium supplemented with 20Hg HiI^'1 EGF and lO ng ml^"1 FGF-2 as previously described (Ricci-Vitiani et al., 2007).

Lentiviral Production and Transduction

Tbeta4 cDNA in pCDNA3.1 vector was kindly provided by Dr Kleinman. The cDNA was subcloned into a modified pCDNA3 (Kpnl-Xhol sites; provided by Hans F., Grenoble) containing an HA-tag in frame with the coding sequence of Tbeta4. From this plasmid, the HA- Tbeta4 cDNA was subcloned in the antisense orientation, under the CMV promoter of a lentival vector carrying the EGFP reporter gene under the hPGK promoter. Recombinant lentiviruses were derived by the combined transfection of different plasmids as described by Ricci-Vitiani et al., (2004). The infections were monitored by flow cytometry and cells were sorted for their fluorescence (FACS Vantage, Becton and Dickinson) until a virtually pure population of transduced cells expressing EGFP alone (empty vector) or the antisense Tbeta4 was obtained.

Tumour Formation

The subcutaneous injection of approx. 1 x 10⁶ separated transduced CCSCs, resuspended in matrigel, generated visible tumours after 4-12 weeks in the flanks of SCID mice. Tumour size was monitored by caliper several times per week for 12 weeks. After 12 weeks mice were killed by cervical dislocation, tumours were removed, fixed in 10% neutral buffered formalin solution (Sigma) and paraffin embedded. Procedures involving animals and their care were conducted in strict accordance with the Policy on Ethics approved by the European Communities Council Directive for Experimental Procedures. Every efforts was made to minimize the number of animals used and their suffering.

Immunohistochemistry

Haematoxylin-eosin analysis of original tumors (Human) and mouse tumors generated by CCSCs transduced and expanded in culture, was carried out on formalin-fixed paraffin- embedded tissue or frozen tissue. Paraffin sections were dewaxed in xylene and rehydrated with distilled water. The slides were subsequently incubated with the following antibodies: CK20 (Dako), Tbeta4 (ALPCO Diagnostics anti TB4 aa 38-43), anti-MUC2 (NovoCastra), anti Ki67 (Dako). The reaction was performed using Elite Vector Stain ABC systems (Vector Laboratories) and DAB substrate chromogen (DakoCytomation) followed by haematoxylin counterstaining.

Real-Time PCR

Total RNA was transcribed into cDNA using the Superscript II system (Superscript, Invitrogen) and pd(N)6 random nucleotide. Relative quantitative Real-Time PCR was performed in a Real- Time Thermocycler (MX 3000, Stratagene, Milano, Italy) using the Brilliant SYBR Green QPCR Master Mix according to manufacturer's instructions. All PCR reactions were coupled to melting-curve analysis to confirm the amplification specificity. Non-template controls were included for each primer pair to check for any significant levels of contaminants. Specific primers for human Tbeta4 and 18S rRNA were designed in order to amplify short DNA fragments (110-200 bp in length).

Gene-specific primers in the human Tbeta4 coding sequence were; upstream ACAAACCCGATATGGCTGAG (SEQ ID NO. 13); and; downstream,CCTGCTTGCTTCTCCTGTTC (SEQ ID NO. 14).

Primers to detect the exogenous Tbeta4 antisense were; upstream in the HA tag CCCAAGCTTACCATGGACTACCCTTATGATGT (SEQ ID NO. 15); and downstream CCGCTCGAGTTACGATTCGCCAGCTTGCTTC (SEQ ID NO. 16).

Primers to detect the expression of the EGFP were; upstream, AAGCAGAAGAACGGCATCAAGG (SEQ ID NO. 17); and downstream, TCTTTGCTCAGGGCGGACTG (SEQ ID NO. 18).

Primers to detect the expression of 18S were; upstream, GTAACCCGTTGAACCCCATT (SEQ ID NO. 19) and; downstream, CCATCCAATCGGT AGTAGCG (SEQ ID NO. 20).

T beta 4 levels were normalized to expression of 18S rRNA. The relative quantitation was calculated with the analysis software that accompanied the thermal cycler. Northern Blot

The Tbeta4 mRNA levels of human colon carcinoma cell line SW480, and the clones of CCSCs were confirmed by Northern blot analysis. Total RNA (20 μg (micrograms)) was resolved in agorose gels and transferred to Hybond-Nplus nylon membrane (Amersham Pharmacia Biotech) in SSC. After cross-linking (Stratagen), the membrane was washed in 2x SSC and left drying. The hybridization was done at 42°C using a non radioactive probe, psoralen labelled Tbeta4 cDNA (Ambion), and the hybridization revealed by the use of a detection kit (Pierce). Binding of the probe was revealed by chemioluminescence according to manual instructions (Pierce).

Western Blot

Cellular pellets were lysed in RIPA buffer: 150 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA and 1% Triton-XIOO and protease inhibitors (Sigma), ImM PMSF pH7.4. Samples were resolved in SDS-PAGE gels (13% for Tbeta4 detection), and proteins were loaded after measurement with Bradford assay (Biorad). The purified Tbeta4 peptide (10 mM) (kindly provided by Prof. Glodstein) was run as reference for protein migration. For Tbeta4 detection, the acrylamide gel was washed several times in PBS for 1 h and then incubated in 10% glutaraldehyde (Sigma) for 40 min. Then the gel was washed three times in PBS for 20 minutes. Proteins were transferred to nitrocellulose. After blocking, the membrane was incubated overnight at 4⁰C with a polyclonal antibody to Tbeta4 (1 :1000; Tbeta4 1-43, Acris). Then, the membrane was incubated with horseradish peroxidase-conjugated donkey anti-rabbit immunoglobulin antibody (ImmunoJackson Research) for 1 hour at RT. The specific protein-antibody reaction was detected by the Super signal West Pico Chemioluminescent Substrate (Pierce). Western blots for the evaluation of other proteins were carried out without the step of glutaraldehyde and the membranes incubated with a horseradish peroxidase-conjugated donkey anti-rabbit or anti- mouse immunoglobulin antibody. A mouse anti beta-tubulin antibody (Sigma) was used 1 : 1000. Rabbit anti beta-Catenin (Cell Signaling) 1 :1,000. Rabbit anti-ILK 1 : 1,000 (Santa Cruz). Monoclonal anti p21 (Santa Cruz) 1 : 1,000. Anti total Akt (Cell Signaling) 1: 1,000 and anti- Ser473 Akt (Cell Signaling) 1: 1,000. The quantitation of protein expression was determined after normalized to beta-tubulin by measuring the optical density of respective band blots using the Quantity One software (Biorad).

In vitro Growth Curve

Spheres were mechanically dissociated after a short incubation in a non-enzymatic dissociation buffer (Sigma- Aldrich), then counted and kept in culture under proliferating conditions. Samples of cultures were taken, dissociated as described above, and cell vitality was measured using a cell viability kit (Promega) every 3 days for a total of 21 days.

Cell Cycle Analysis by FACS

Spheres were mechanically dissociated followed by a short passage in a non-enzymatic dissociation buffer (Sigma-Aldrich) to obtain a cell suspension that was fixed in cold methanol, followed by washes in PBS and suspended in PBS containing propidium iodide (PI; Sigma) and RNAse (Sigma) as described by (Andreassen et al., 2001). Cell cycle analysis was performed by FACS (FACS Calibur, Beckton and Dickinson) counting 30,000 events per experiment.

Results

Colon Cancer Stem Cells show an increased expression of Tbeta4

The expression level of Tbeta4 has been shown to be abnormal in different types of solid tumors, particularly CRC (Wang et al., 2003; Wang et al., 2004; Hang et al., 2007). Therefore, we first verified the aberrant Tbeta4 expression in tumor tissues resected from CRC patients by immunohistochemical staining, using a specific polyclonal antibody (ALPCO Diagnostics anti TB4 aa 38-43).

Figure 1 shows a higher expression of Tbeta4 in situ, in the intestinal glands (Figure IB) when compared with a normal intestinal mucosa where the peptide is undetectable (Figure IA). The immunohistochemical analysis also revealed that both normal and tumoral tissues show a stromal staining for Tbeta4, which is mainly due to inflammatory and linfoid cells.

We then focused on the analysis of T beta4 expression in CCSCs, whose role in the initiation and growth of CRC has been recently clarified (Ricci-Vitiani et al., 2007, O'Brien et al., 2007). CCSCs were identified and isolated shortly after tumor tissue dissociation, through flow cytometry for the expression of CDl 33 marker. They represent rare cells (2.5%) within the tumoral cell population which can be expanded as sphere-like cellular aggregates in serum-free medium containing EGF and FGF-2 and maintained in culture for a long time without loosing the ability to engraft and reproduce the same morphological and antigenic pattern of the original tumours (Ricci-Vitiani et al., 2007). First, we analysed the expression level of Tbeta4 in different clones of CD133-positive CCSCs isolated from different patients affected by CRC, using Real-Time PCR, Northen Blot and Western Blot. The clones are referred to as CCSC accompanied by a number or a name.

Figure 2A shows that Tbeta4 mRNA is highly expressed in five different CCSC clones when compared with normal BerEP4-positive epithelial cells isolated from a normal mucosa. The mRNA over-expression was analysed also by Northern Blot analysis for two CCSC clones (Figure 2 B). We then verified whether mRNA over-expression was accompanied by elevated levels of the protein by Western blot analysis. Figure 2 C shows a strong over-expression of Tbeta4 peptide in CCSC clones when compared to the human colon cancer cell line SW480. Such expression difference was detected also in respect to other human colon carcinoma cell lines including HT29 and CaCo2 (data not shown). Note that the over-expressed peptide in CCSC clones migrates as the control peptide. We also confirmed Tbeta4 expression in CCSCs cultured as spheres by immunofluorescence (Figure 2 D).

We showed for the first time that CCSCs, isolated from patients affected by CRC, have an aberrant expression of Tbeta4.

Down-regulation of Tbeta4 decreases the in vitro growth of Colon Cancer Stem Cells

Alterations in the growth properties have been often observed in carcinoma cells, and an over- expression of Tbeta4 has been often associated with an increased growth rate of cell lines (Wang et al., 2003). Having demonstrated that the expression levels of Tbeta4 are increased in CCSCs, we asked whether its down-regulation could alter their proliferative capacities. To reduce the expression level of endogenous Tbeta4, CCSC clones were transduced using lentiviral infection to over-express an antisense cDNA for Tbeta4. The antisense sequence was tagged with a hemagglutinin (HA) sequence to be distinguishable from the endogenous transcript. Clones were transduced with the empty lentiviral vector as control in all the experiments. After sorting, we obtained enriched populations for both constructs which were maintained in culture in undifferentiating conditions. Then, the levels of human Tbeta4 mRNA were analysed by Real- Time PCR.

Significant reduction in endogenous human Tbeta4 expression was indeed observed after infection with the antisense lentiviral construct (Figure 3A - Tβ4 transcript). To demonstrate that down-regulation was specific for Tbeta4, the expression of the EGFP, which is carried by the lentiviral vector, was also assessed. Figure 3A (EGFP transcript) shows that EGFP expression is equally expressed in both antisense and control clones. Moreover, we performed Real-Time PCR using oligonucleotides annealing in the HA tag to confirm the proper expression of the antisense construct and its absence in the control transduced clones (Figure 3A, HA- transcript). Moreover, the reduction in transcript expression observed by Real-Time PCR was accompained by a decreased Tbeta4 protein level, as shown by Western blot analysis (Figure 3B).

We then analysed first in vitro and then in vivo, the growth properties of the transduced clones. The precise change in the growth rate of the transduced clones was determined by counting the cells every 3-5 days for a total of 21 days in culture. We found that clones transduced with the antisense grew slower in culture than the empty vector transduced clones (Figure 4). Owing to the above observation, cell cycle progression of each individual clone was analysed by flow cytometry. We did not identify a significative difference in the proportion of cells in the different phases of the cell cycle, in a randomly cycling population. Only after a synchronization in S phase by aphidicolin block, BrdU labelled-cells of the antisense clones showed a slower exit from the S phase in respect to the control clone (data not shown).

Down-regulation of Tbeta4 decreases the in vivo growth of colon cancer stem cells thus limiting tumor formation

When CCSCs are intradermally injected in SCID mice, they are able to induce a tumor whose morphological features resemble those of the original human tumor (Ricci-Vitiani et al., 2007). Hence, we tested in vivo the tumor growth capacities of the clones with reduced levels of Tbeta4. We intradermally injected mice (n=6) on one flank of the body with the control clone (number cells=lxlθ⁶) and on the controlateral flank with the antisense clone, and then followed the growth of the tumors for 12 weeks. Figure 5 A shows the in vivo growth curve of tumors. We found a significative decrease of tumor growth in mice injected with cells transduced with the Tbeta4 antisense sequence. The difference in tumor growth was less pronounced in the initial steps, and then became more significative in the last weeks. At 12 weeks after subcutaneous injection, mean tumor volume was 0.2 cm for mice injected with the antisense and 1.1 cm³ for mice injected with control cells (Figure 5 A). Figure 5B shows dissected tumors of different size induced by the injection of control and Tbeta4 antisense CCSC clones.

A morphological analysis showed that tumors induced by the injection of the control clone have a higher number of mitotic cells when compared with tumors derived from Tbeta4 antisense CCSC clones. Indeed, immunohistochemistry performed with ki67 (Figure 6A), a proliferative marker, showed a less intense staining in Tbeta4 antisense CCSC- induced tumors than control. On the contrary, tumors derived from Tbeta4 antisense CCSCs, had a stronger staining for MUC 2 (Figure 6B), a marker of mucin-expressing cells, indicating that a higher number of cells differentiated into goblet cells. The goblet cells are dispersed throughout the colonic epithelium and secrete mucus into the intestinal lumen to trap and expel micro-organisms. Indeed, in the Tbeta4 antisense CCSC-induced tumors, the higher number of goblet cells was associated with a strong number of deposits of mucin (Figure 6C, D arrows). In conclusion, the down-regulation of Tbeta4 reduces in vivo tumor growth by instructing cells towards a differentiative pathway that leads to a goblet cell phenotype.

Down-regulation of Tbeta4 reduces ILK expression and Akt phosphorylation level in colon cancer stem cells

Previous studies have shown that Tbeta4 triggers an epithelial-mesenchymal transition in colorectal carcinoma (Wang et al., 2004; Huang et al., 2007), a process by which cells lose their polarized epithelial structures to acquire a migratory mesenchymal phenotype. This transition is crucial for the invasion and metastatis of many epithelial tumors including CRC and is mediated by Tbeta4 through the upregulation of the integrin-linked kinase (ILK), a focal adhesion protein activated by both ECM and growth factors. In addition, it has been shown that in certain CRC cells (SW480 cells), the over-expression of Tbeta4 increaseas ILK expression and the phosphorylation state of its down-stream effector Akt (Huang et al. 2007).

We focused the biochemical analysis of the Tbeta4 antisense transduced CCSC clones on the expression of ILK and the phosphorylation state of its effector Akt. Western blot analyses showed that in CCSCs with reduced Tbeta4 levels, ILK expression is significatively decreased (70% decrease) (Figure 7A). Meanwhile, the decreased ILK expression is paralleled by a decreased phosporylation state of Akt in Ser473, whereas total Akt protein was unchanged (Figure 7B). Interestingly, no significative modifications were found for the expression of cyclin-dependent kinase inhibitor IA (p21), which is involved in the regulation of cell cycle checkpoints and repair, or beta— Catenin, whose genetic mutations have been correlated with several CRC (Figure 7B).

In conclusion, the observed cellular phenotype following Tbeta4 down-regulation, could be due to alterations of ILK expression and Akt phosphorylation, whose role in cell survival, differentiation and growth is mostly known (Vivanco and Sawyers, 2002).

Discussion

A highly regulated assembly and disassembly of the actin filaments are crucial for cells to respond normally to the extracellular signals by moving, changing shapes and dividing. Moreover, involvements of actin filaments in oncogenic transformation were implicated by the findings that the tumorigenicity of certain cancer cells was suppressed by the enforced expression of genes encoding different structural components of the actin cytoskeleton (Pawlawk and Helfman, 2001). Although the correlation between tumor progression and the aberrant expression of Tbeta4 was uniquivocally estalished, the role(s) played by this G-actin sequestering peptide in promoting the malignancy of human carcinomas remains to be defined.

In the present study, we confirmed an in situ over-expression of Tbeta4 in human carcinomas and, for the first time, we showed that CCSCs, isolated from different CRC patients, have an aberrant Tbeta4 expression.

CRC is currently thought to be a disease originating within colonic stem cells. However, due to their primitive nature, and the lack of any histological or morphological markers, the intestinal stem cells remain mostly unidentified.

The finding that Tbeta4 expression is extremely increased in CCSCs opens the possibility of employing Tbeta4 as a marker of malignancy of CCSCs.

Up to now, most of the information underlying a link between the up-regulation of Tbeta4 and malignant phenotypes comes from tumoral cell lines, not CCSCs, in which the peptide has been exogenously over-expressed. In this respect, previous works showed that disruption of the actin microfilaments in SW480 colon carcinoma cell line by overexpressing Tbeta4, results in a drastic increase in their growth and motility which are likely to be accounted by an E-cadherin downregulation, plus an enhanced beta-Catenin signaling (Wang et al., 2003). On the contrary, in the present study we focused on the effects of a down-regulation of Tbeta4 in CCSCs, recently identified as a subpopulation of tumor cells with self-renewal ability that have a role in the initiation and growth of CRC. We found that Tbeta4 down-regulation impairs the in vitro growth activity and tumorigenic capacity of CCSCs. Considering that stem cells provide a foundation for therapeutic advancement in oncology and clinical genetics, the identification of Tbeta4 as a factor involved in proliferative and differentiative mechanisms could result in medical strategies aimed at the root cause of cancer.

Biochemical analysis of the Tbeta4 anti sense transduced clones has shown alterations in the signaling mediated by ILK. This is an interesting finding considering that Tbeta4 overexpression effects have been reconducted to alteration of ILK activity and expression (Huang et al., 2007; Srivastava et al., 2007). In fact, Huang et al. (2007) postulated that ILK is the most critical mediator for Tbeta4 induced epithelial to mesenchymal transition in colon cancer cells which might not only disrupt the cell-cell adhesions by downregulating E-cadherin expression, but also trigger a reorganization of the actin cytoskeleton by interacting with Rac and Cdc42 (Filipenko et al., 2005). ILK couples integrins and growth factor receptors to a variety of downstream signaling events that result in cell adhesion, proliferation, migration, differentiation and survival (reviewed in Dedhar and Hannigan, 1996; Dedhar et al., 1999, Dedhar, 2000; Wu and Dedhar, 2001; Hannigan et al., 2005).

A majority of recent work on ILK has centered on its involvement in Akt and glycogen synthase kinase-3 (GSK-3) beta signaling. However, in addition to regulating Akt and GSK-3 beta activities, the expression of ILK in epithelial cells results in a striking change in cellular morphology (Hannigan et al., 1996; Somasiri et al., 2001), which is thought to occur via reorganization of the actin cytoskeleton. Recent investigations utilizing knockout mice have substantiated this hypothesis. Specifically, the genetic deletion of ILK resulted in early embryonic lethality due to defects in epiblast polarization whereby F-actin was abnormally accumulated at integrin attachment sites (Sakai et al., 2003). In addition, fibroblasts isolated from these knockout mice also demonstrated impaired cell spreading and focal adhesion formation. All together these data demonstrate an essential role of ILK activity in actin cytoskeleton reorganization in epithelial cells, further solidifying a role for ILK in the regulation of cancer cell motility and invasiveness. Owing to these findings it is reasonable to identify ILK as the most critical mediator of Tbeta4 downregulation-induced effects in CCSCs, triggering a reorganization of the actin cytoskeleton thus altering cell-cell adhesions, proliferation and cellular motility. However, we are planning to identify other molecular targets whose alteration in the expression or activation state, following Tbeta4 down-regulation, could be involved in the observed cellular phenotypes such as Fas, Survivin and matrix metalloproteinase (MMP)-7 (Hsiao et al., 2006).

The identification of the effects obtained through the down-regulation of Tbeta4 on CCSC growth, represents an important step in understanding how tumorigenic pathways operate and also for the development of novel therapeutic strategies aimed at eradicating the subpopulation of chemotherapic-resistent CCSCs. Figure Legends For Example 1

Figure 1

In situ expression of Tbeta4 in human colon carcinoma

Immunohistochemical analysis of Tbeta4 expression in colon carcinoma and normal mucosa. A higher expression of Tbeta4 is detectable in the tumoral glands (b) as compared with the normal crypts (a). Note the labelling of Tbeta4 in the stroma of a normal mucosa identified by linfoid cells which are known to express Tbeta4. Samples were counterstained with haematoxilin-eosϊn.

Figure 2

Tbeta4 expression levels in CCSC clones isolated from different CRC patients

A. Real-Time PCR performed on total RNA of CCSCs isolated from various CRC patients. All clones show a higher Tbeta4 expression in comparison with a calibrator sample, represented by Br-EP4-positive epithelial cells isolated from normal mucosa. The relative quantitation was performed after normalization using 18S rRNA as reference gene. Tbeta4 mRNA level is expressed as logaritm (base2) of fold changes with respect to the calibrator sample. B. Northern blot analysis of Tbeta4 mRNA confirms a higher expression level in two analysed CCSC clones (CCSC 1.1, CCSC 1.2), in respect to a human colon carcinomaa cell line SW480. The membrane was hybridized with a non-radioactive Tbeta4 cDNA probe. The appereance of the rRNA shows a proper loading and extraction of the samples. C. Western Blot analysis shows a stronger expression of Tbeta4 in CCSC clones when compared with the human colon carcinoma cell line SW480. Similar results were obtained using HT29 and CaCo2 carcinoma cell lines as controls (data not shown). The synthetic peptide was used as control to confirm the specificity of the antibody, beta-tubulin was used as loading control. D. Double immunofluorescence analysis of a sphere formed by purified CCSCs in culture stained with an antibody against Tbeta4protein (green) and DNA (red).

Figure 3

Tbeta4 transcript and protein down-regulation mediated by antisense lentiviral infection in colon cancer stem cells

A. Real-Time PCR was performed on total RNA of untreated colon cancer stem cell (CCSC 1.1 clone) and the same clone after lentiviral transducion with the empty vector or Tbeta4 antisense vector. The total human Tbeta4 transcript (upper panel), the EGFP transcript level (middle panel), and the exogenous Tbeta4 antisense transcript - distinguishable for the presence of the HA-tag sequence (lower panel), were evaluated. Tbeta4 transcript expression is significantly reduced only in Tbeta4 antisense transduced clone as compared to both the untreated and empty vector-transduced clone. In the Tbeta4 antisense transduced clone there is a strong over- expression of the exogenous transcript, which is undetectable in both untreated and empty vector clone. Note that the expression of EGFP transcript is similar in Tbeta4 antisense and empty vector clones, confirming that the effect of down-regulation is specific for the Tbeta4 transcript. Values are plotted as log (base2) fold change of calibrator (empty vector sample). 18S rRNA expression was used for each sample normalization. * p< 0.01 vs. control values. B. Western blot analysis performed on extracts from untreated, empty vector-transduced CCSC 1.1 and Tbeta4 antisense-transduced CCSC 1.1 clone, reveales a reduction of Tbeta4 protein level following lentiviral infection with the antisense vector, beta-tubulin was used to confirm equal protein loading.

Figure 4

Tbeta4 protein down-regulation reduces in vitro growth of trasduced colon cancer stem cells

CCSC 1.1 clone transduced with the empty vector or with Tbeta4 antisense vector were maintained in culture for three weeks. Every 3-5 days cells spherese were dissociated and cells counted and the values plotted in a graph. The graph shows that Tbeta4 antisense transduced CCSC 1.1 cells grow significatively slower when compared to control cells.

Figure 5

Tbeta4 protein down-regulation reduces the in vivo growth of tumors in SCID mice

A. Tumor Growth Curve. SCID mice were subcutaneously injected with CCSC cells transduced with the empty vector or with Tbeta4 antisense vector. Cells were separated, counted and mixed to matrigel prior injection. The same animal was injected on one flank with the empty vetor cells, and on the other flank with the Tbeta4 antisense cells. Tumor growth was monitored and teir length and width measured with calipers for a maximum of 12 weeks. Measuraments were then plotted in a graph. Tumor growth is significatively reduced following injection of Tbeta4 antisense transduced cells as compared with empty vector cells. Such an effect is more evident after several weeks from the injection. B. The image shows the size difference of the induced tumors after 12 week from the initial injection (right, empty vector flank; left, Tbeta4antisense vector flank). Figure 6

Tbeta4 protein down-regulation induces colon cancer stem cells to differentiate into goblet cells

Immunohistochemical analysis of intradermally induced tumors. In tumors induced by Tbeta4 antisense transduced cell injection a lower number of dividing cells is detected, as indicated by the staining with Ki67 antibody, in respect to a comparable field of a tumor induced by control cell injection (A). Differently, MUC2 labeling shows a higher number of positie cells and mucin accumulations in tumors induced by the Tbeta4 antisense transduced cell injection (B). 1Ox enlargements. Haematoxilin- and eosin stained section of subcutaneous tumors at two different enlardgements (C, 1Ox; D 2Ox). In tumors induced by Tbeta4 antisense transduced cell injection, it is visible a high number of goblet cells whose cytoplasm is occupied by mucin accumulation (C, D arrow). The photographs were taken under a microscope with a magnification of 10x and 2Ox objectives)

Figure 7

Tbeta4 down-regulation decreases ILK expression and Akt phosphorylation level

Protein extracts from CCSC 1.1 Tbeta4 antisense transduced clones were analyzed by Western blotting using ILK (A), pAkt Ser473, total Akt, beta-Catenin, p21 and beta-tubulin (B) antibodies. Densitometric analysis of the Western Blot bands for ILK, normalized to beta- tubulin, shows a 70% decrease in ILK expression, in Tbeta4 antisense extracts as compared to control (empty vector) (A). Quantitation of immunoreactive levels of phosphorylated Akt (Ser473) and total Akt, normalized by the amount of the total kinase, also revealed a 70% decrease in the phosporylation level of Akt in Tbeta4 antisense extracts as compared to control (empty vector) (B). No significative differences were detected in the extracts for p21 and beta- Catenin.

Example 2

Loss of Tbeta4 attenuates cell growth by Gl/S phase delay, and inhibits colony formation and migration ability of colon cancer stem cells

We showed that down-regulation of Tbeta4 has a significant effect on in vivo and in vitro proliferation of colon cancer stem cells (CCSC). To investigate the mechanisms underlying cellular growth inhibition mediated by Tbeta4 down-regulation, we examined DNA content and cell cycle distribution of empty vector and antisense CCSC clones by flow cytometry. Figure 8 A shows similar flow cytometric profiles between Tbeta4-antisense and empty vector in randomly cycling CCSC in presence of Bromo-2'-deoxyuridine (BrdU). The analysis of the DNA profiles failed to show a significant difference in the proportion of cells in the different phases of the cell cycle. To assess whether the observed growth inhibition mediated by Tbeta4 loss could result in a modification of S phase progression, we synchronized cells at Gl/S boundary by aphidicolin after a pulse with BrdU and analysed cell cycle progression 48 h after release from DNA replication arrest.

The exact percentages of Gl/S phase cells was determined by flow cytometric analysis (Figure 8 D) which shows that a reduced amounts of Tbeta4-antisense CCSCs entered S phase whose duration appeared prolonged (data not shown). Similarly, to further characterize and confirm the Gl/S phase alteration induced by Tbeta4 loss, we repeated the above experiments using a nocodazole treatment to block transduced CCSC in mitosis. Figure 8 B shows that in presence of nocodazole, a higher number of empty vector CCSC enter and remain blocked in mitosis compared to antisense CCSC clones. The flow cytometric analysis is summarized in the table (Figure 8 C). In conclusion, these results clearly show that Tbeta4 loss is able to influence the length and progression of Gl/S phase of cell cycle in CCSC.

We investigated other cellular features and properties of the antisense clones compared with the empty vector CCSC clones. In particular, studies were carried out to determine whether inhibition of Tbeta4 expression could affect colony forming ability in anchorage-independent growth conditions and cellular migration. Figure 9 A shows that when transduced CCSC were plated in soft agar, antisense clones formed a considerably lower number of colonies (around 48% inhibition) compared to empty vector CCSC. The motility of transduced CCSC was also examined using a transwell chamber assay. The number of cells that were capable of moving through the membrane reaching the lower chamber after 48 h incubation, were stained and counted on a microscope. Figure 9 B shows that antisense CCSC clones are less prone to migration (around 33% inhibition) compared to control cells.

Taken together, these results indicate that Tbeta4 antisense CCSCs have a long term inhibition effects on proliferation, colony formation and migration which generally correlates well with reduced in vivo tumorigenicity. Cellular phenotypes mediated by loss of Tbeta4 can be rescued by Akt signaling pathway

Akt signaling plays a crucial role in many biological processes including cell proliferation and survival. Akt promotes cell proliferation through many downstream effectors. Particularly, Akt positively regulates Gl to S transition in cell cycle progression through regulation of D-type cyclins and cyclin-dependent kinase inhibitors, such as p27, at the transcriptional level (Schmidt et al., 2002). To confirm the role of Akt as the effector of the cellular phenotypes observed in Tbeta4 antisense clones, a lentiviral mutant Akt with a myristilated signal at the carboxy terminus (Myr-Akt) was used to over-express constitutively active Akt in CCSC previously transduced with Tbeta4 antisense (Tbeta4 As Myr Akt). This modification targets Akt permanently to the cell membrane, rendering it continuously susceptible to PDK phosphorylation (Crowder et al., 1998; Matsui et al., 2002).

In antisense CCSCs following lentiviral infection with Myr-Akt, the basal level of phosphorylation of Akt was strongly increased over both the empty vector and antisense CCSC clones, respectively (Figure 10 A). Once we obtained stable Tbeta4 As Myr Akt clones, we studied their cellular properties to evidence possible effects of rescued phenotypes originally mediated by the loss of Tbeta4. Indeed, we observed that the Tbeta4 As Myr Akt CCSCs have cellular properties similar to the empty vector clones. In fact, their abilities in terms of agar growth and migration were comparable to that observed in empty vector CCSC clones (Figure 10 B, C). Interestingly, we observed a significant rescue of the in vitro proliferation capacity of Tbeta4 As Myr Akt CCSC clones. More importantly, the over-expression of the Myr Akt was able to restore the rate of tumor growth in vivo, determining the formation of tumor masses comparable to those produced by empty vector CCSC clones (Figure 11 A, B). All together these results confirm that the cellular effects mediated by Tbeta4 loss can be rescued by the over- expression of an active form of the mediator Akt.

Materials and Methods

Cell cycle assay

Cell proliferation was measured by Bromo-2'-deoxyuridine (BrdU) incorporation. Briefly, Tbeta 4As and empty vector transduced CCSCs were mechanically dissociated and incubated with BrdU (lOμM, BD Pharmingen). After 48 hours cell were harvested, and fixed with cold Methanol (90% in PBS) for 10 min at -20°C. At the end of the incubation cells were washed twice with PBS and incubated for 30 min at RT, with 2N HCl, 0,5% Triton to obtain the DNA denaturation. Neutralization was performed with 0,1M Sodium tetraborate. Cells when then incubated with FITC conjugated anti-BrdU antibody (BD, Pharmingen) according to the manufacturer protocol. Propidium iodide (PI, 50μg/ml, Sigma)) staining was performed before flow cytometric analysis. Mitosis arrest was induced by incubating CCSCs with Nocodazole (lOOng/mL, Sigma) for 48 hours before PI staining.

Soft agar colony formation assay

Assays of colony formation in soft agar were done using standard protocols. Briefly, Tbeta4As and empty vector transduced CCSCs (5-10 x 10⁴ cells per well) were suspended in 0.35% Noble agar and were plated onto a layer of 0.7% Noble agar in stem cell medium containing EGF and bFGF growth factors in 24-well tissue culture plates (Corning). The agar containing cells was allowed to solidify overnight at 37⁰C in 5% CO2 humidified atmosphere. Additional stem cell medium containing growth factors was overlaid on the agar and the cells allowed growing undisturbed for 2 wk. Plates were stained with 0,5ml of 0,005% Crystal Violet for 1 hour. Visible colonies were counted with the aid of a microscope.

In vitro cell migration assay

The motility of Tbeta4 As and empty vector transduced CCSCs was evaluated in 24-well transwell chambers (Costar), as directed by the manufacturer. Briefly, the upper and lower culture compartments of each well are separated by polycarbonate membranes (8 μm pore size). The lower chambers of the 24-well plate were filled with 500 μL of stem cell medium containing EGF and bFGF; 10 x 10⁴ cells in 500 μL of the same medium was placed into the upper compartment of wells. The transwell chambers were incubated at 37⁰C in 5% CO2 humidified atmosphere for 24 h. The cells that had not invaded were removed from the upper face of the filters using cotton swabs. The cells that had invaded to the lower surface of the filters were fixed and stained in 0.1% crystal violet, and quantified by counting the numbers of cells that penetrated the membrane in five microscopic fields (at xlOO magnification) per filter. The experiment was repeated twice.

Lentiviral expression of myr-Akt

Constitutively active Akt (Myr-Akt, HA-tagged) was cloned under the CMV promoter of a lentiviral vector carrying the puromycin resistance gene under the hPGK promoter. Lentiviral particle production and Tbeta4 As target cell infection were performed as previously described. Transduced cells were selected by exposure to puromycin (1 μg/ml) until a virtually pure population of Tbeta4 As Myr-Akt expressing cells was obtained.

Figure Legends for Example 2

Figure 8

Effects of down-regulation of Tbeta4 in cell cycle progression of CCSCs

Cell cycle profiles of empty vector and Tbeta4 As CCSCs upon incubation with BrdU (A). In random cycling conditions, no major differences have been observed in the percentage of cells in the different phases of the cell cycle. DNA profiles of empty vector and Tbeta4 As CCSCs cultivated for 24 h with nocodazole (B). In the presence of this mitotic drug, a higher number of empty vector CCSCs progress through Gl /S phase remaining blocked in mitosis compared to Tbeta4 As CCSCs. The percentages in different phase of cell cycle are indicated for each experimental condition in the table (C).

Figure 9

Reduced anchorage-independent growth and migration in Tbeta4 As CCSCs

Histograms of the percentage of colony formation show that two different CCSC clones with reduced levels of Tbeta4 form a lower percentage of colonies compared to their respective empty vector clones (A left panel). A panel of phase contrast images show a representative example of colony formation assay (A right panel). Histograms of the percentage of migrating cells show that two different CCSC clones with reduced levels of Tbeta4, have a lower ability to move and pass through the membrane (B left panel). A panel of phase contrast images show a representative example of migration assay (B right panel).

Figure 10

Over-expression of constitutively active Akt rescue Tbeta4 As phenotypes in CCSCs

A. Western blot analysis was used to confirm the over-expression of the exogenous Myr Akt. Both antibodies directed against HA-tag and phosphorylated Akt (Ser473) show a strong expression of active Akt in the Tbeta4 As Myr Akt transduced CCSCs. The increased expression of exogenous Akt was further confirmed by an antibody directed against total Akt. β-Tubulin was used as loading control. B. The over-expression of Myr Akt rescue the ability of Tbeta4 As CCSCs to form colonies in soft agar. The percentage of colonies are illustrated in histograms (upper panel). A panel of phase contrast images show a representative example of colony formation assay (lower panel). C. Histograms of the percentage of migrating cells show that in two different CCSC clones with reduced levels of Tbeta4, the over-expression of Myr Akt rescue the ability to migrate.

Figure 11

Over-expression of constitutively active Akt rescue the in vitro and in vivo growth of Tbeta4

As CCSCs

A. Two independent Tbeta4 As CCSC clones were transduced with Myr Akt and maintained in cultures for ten days. Proliferative curves indicate that Myr Akt CCSCs have proliferative capacities comparable with their respective empty vector clones. B. Tumor grow curves. SCID mice were subcutaneously injected with CCSCs transduced with: empty vector, Tbeta4 As and Tbeta4 As Myr Akt transduced CCSCs. Tumor growth was monitored by caliper measurements for 8 weeks. Measurements were then plotted in a graph (left panel). The tumor growth of Tbeta4 As Myr Akt is comparable to the growth of tumors induced by empty vector CCSCs suggesting that constitutively active Akt can rescue in vivo tumorigenity of CCSC with reduced levels of Tbeta4. The image show the size difference of the different tumors after 8 weeks from the injections (right panel).

References

The following references are hereby incorporated by reference to the extent that they do not conflict with the present application.

Andreassen PR, Lacroix FB, Lohez OD, Margolis RL (2001) Neither p21 WAFl nor 14-3-

3sigma prevents G2 progression to mitotic catastrophe in human colon carcinoma cells after DNA damage, but p21 WAFl induces stable Gl arrest in resulting tetraploid cells. Cancer Res 61 :7660-7668.

Bednarek R, Boncela J, Smolarczyk K, Cierniewska-Cieslak A, Wyroba E, Cierniewski CS (2008) Ku80 as a novel receptor for thymosin 4 that mediates its intracellular activity different from G-actin sequestering. J Biol Chem 283:1534-1544.

Brieger A, Plotz G, Zeuzem S, Trojan J (2007) Thymosin beta 4 expression and nuclear transport are regulated by hMLHl. Biochem Biophys Res Commun 364:731-736. Cha HJ, Jeong MJ, Kleinman HK (2003) Role of thymosin beta4 in tumor metastasis and angiogenesis. J Natl Cancer Inst 95:1674-1680. Clark EA, Golub TR, Lander ES, Hynes RO (2000) Genomic analysis of metastasis reveals an essential role for RhoC. Nature 406:532-535. Decloitre F, Cassingena R, Estrade S, Martin M (1991) Concomitant alterations of microfilaments and microtubules in human epithelial cells (HBL- 100) in relation to their malignant conversion. Tumour Biol 12:111-119. Dedhar S, Hannigan GE (1996) Integrin cytoplasmic interactions and bidirectional transmembrane signalling. Curr Opin Cell Biol 8:657-669. Dedhar S, Williams B, Hannigan G (1999) Integrin-linked kinase (ILK): a regulator of integrin and growth-factor signalling. Trends Cell Biol 9:319-323. Dedhar S (2000) Cell-substrate interactions and signaling through ILK. Curr Opin Cell Biol

12:250-256. Filipenko NR, Attwell S, Roskelley C, Dedhar S (2005) Integrin-linked kinase activity regulates

Rac- and Cdc42-mediated actin cytoskeleton reorganization via alpha-PIX. Oncogene

24:5837-5849. Gabbiani G (1979) The cytoskeleton in cancer cells in animals and humans. Methods Achiev

Exp Pathol 9:231-243. Goldstein AL, Hannappel E, Kleinman HK (2005) Thymosin beta4: actin-sequestering protein moonlights to repair injured tissues. Trends MoI Med 11 :421-429. Golla R, Philp N, Safer D, Chintapalli J, Hoffman R, Collins L, Nachmias VT (1997) Coordinate regulation of the cytoskeleton in 3T3 cells overexpressing thymosin-beta4. Cell

Motil Cytoskeleton 38:187-200. Grant DS, Kinsella JL, Kibbey MC, LaFlamme S, Burbelo PD, Goldstein AL, Kleinman HK

(1995) Matrigel induces thymosin beta 4 gene in differentiating endothelial cells. J Cell

Sci 108 ( Pt l2):3685-3694. Grant DS, Rose W, Yaen C, Goldstein A, Martinez J, Kleinman H (1999) Thymosin beta4 enhances endothelial cell differentiation and angiogenesis. Angiogenesis 3:125-135. Hall AK (1991) Differential expression of thymosin genes in human tumors and in the developing human kidney. Int J Cancer 48:672-677. Hannigan GE, Leung-Hagesteijn C, Fitz-Gibbon L, Coppolino MG, Radeva G, Filmus J, Bell

JC, Dedhar S (1996) Regulation of cell adhesion and anchorage-dependent growth by a new beta 1 -integrin-linked protein kinase. Nature 379:91-96. Hsiao HL, Wang WS, Chen PM, Su Y (2006) Overexpression of thymosin b-4 renders SW480 colon carcinoma cells more resistant to apoptosis triggered by FasL and two topoisomerase II inhibitors via downregulating Fas and upregulating Survivin expression, respectively. Carcinogenesis 27: 936-944. Huang WQ, Wang BH, Wang QR (2006) Thymosin beta4 and AcSDKP inhibit the proliferation of HL-60 cells and induce their differentiation and apoptosis. Cell Biol Int 30:514-520. Huang HC, Hu CH, Tang MC, Wang WS₅ Chen PM, Su Y (2007) Thymosin beta4 triggers an epithelial-mesenchymal transition in colorectal carcinoma by upregulating integrin- linked kinase. Oncogene 26:2781-2790. Huff T, Rosorius O, Otto AM, Muller CS, Ballweber E, Hannappel E, Mannherz HG (2004)

Nuclear localisation of the G-actin sequestering peptide thymosin beta4. J Cell Sci

117:5333-5341. Kobayashi T, Okada F, Fujii N₅ Tomita N, Ito S, Tazawa H, Aoyama T, Choi SK, Shibata T,

Fujita H, Hosokawa M (2002) Thymosin-beta4 regulates motility and metastasis of malignant mouse fibrosarcoma cells. Am J Pathol 160:869-882. Low TL, Goldstein AL (1982) Chemical characterization of thymosin beta 4. J Biol Chem

257:1000-1006. Malinda KM, Sidhu GS, Mani H₅ Banaudha K, Maheshwari RK₅ Goldstein AL₅ Kleinman HK

(1999) Thymosin beta4 accelerates wound healing. J Invest Dermatol 113:364-368. O'Brien CA₅ Pollett A, Gallinger S, Dick JE (2007) A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature 445:106-110. Paasinen-Sohns A₅ Kielosto M, Kaariainen E, Eloranta T, Laine A₅ Janne OA, Birrer MJ, Holtta

E (2000) c-Jun activation-dependent tumorigenic transformation induced paradoxically by overexpression or block of S-adenosylmethionine decarboxylase. J Cell Biol 151:801-

810. Pawlak G, Helfman DM (2001) Cytoskeletal changes in cell transformation and tumorigenesis.

Curr Opin Genet Dev 11 :41-47. Philp D₅ Nguyen M, Scheremeta B₅ St-Surin S, Villa AM₅ Orgel A, Kleinman HK, Elkin M

(2004) Thymosin beta4 increases hair growth by activation of hair follicle stem cells.

Faseb J 18:385-387. Pollack R, Osborn M₅ Weber K (1975) Patterns of organization of actin and myosin in normal and transformed cultured cells. Proc Natl Acad Sci U S A 72:994-998. Ricci-Vitiani L, Pedini F, Mollinari C, Condorelli G, Bond D, Bez A, Colombo A, Parati E,

Peschle C, De Maria R (2004) Absence of caspase 8 and high expression of PED protect primitive neural cells from cell death. J Exp Med 200:1257-1266. Ricci-Vitiani L, Lombardi DG, Pilozzi E, Biffoni M, Todaro M, Peschle C, De Maria R (2007)

Identification and expansion of human colon-cancer-initiating cells. Nature 445:111-115. Sakai T, Li S, Docheva D₅ Grashoff C₅ Sakai K, Kostka G, Braun A, Pfeifer A, Yurchenco PD,

Fassler R (2003) Integrin-linked kinase (ILK) is required for polarizing the epiblast, cell adhesion, and controlling actin accumulation. Genes Dev 17:926-940. Sanders MC₅ Goldstein AL, Wang YL (1992) Thymosin beta 4 (Fx peptide) is a potent regulator of actin polymerization in living cells. Proc Natl Acad Sci U S A 89:4678-4682. Sanger JM, Golla R, Safer D₅ Choi JK, Yu KR₅ Sanger JW₅ Nachmias VT (1995) Increasing intracellular concentrations of thymosin beta 4 in PtK2 cells: effects on stress fibers, cytokinesis, and cell spreading. Cell Motil Cytoskeleton 31 :307-322. Santelli G₅ Califano D₅ Chiappetta G, Vento MT₅ Bartoli PC₅ Zullo F₅ Trapasso F₅ Viglietto G,

Fusco A (1999) Thymosin beta-10 gene overexpression is a general event in human carcinogenesis. Am J Pathol 155:799-804. Somasiri A, Howarth A₅ Goswami D₅ Dedhar S, Roskelley CD (2001) Overexpression of the integrin-linked kinase mesenchymally transforms mammary epithelial cells. J Cell Sci

114:1125-1136. Srivastava D, Saxena A, Michael Dimaio J₅ Bock-Marquette I (2007) Thymosin beta4 is cardioprotective after myocardial infarction. AnnN Y Acad Sci 1112:161-170.. Vivanco I₅ Sawyers CL (2002) The phosphatidylinositol 3 -Kinase AKT pathway in human cancer. Nat Rev Cancer 2:489-501. Wang WS₅ Chen PM₅ Hsiao HL, Ju SY, Su Y (2003) Overexpression of the thymosin beta-4 gene is associated with malignant progression of SW480 colon cancer cells. Oncogene

22:3297-3306. Wang WS, Chen PM₅ Hsiao HL₅ Wang HS, Liang WY, Su Y (2004) Overexpression of the thymosin beta-4 gene is associated with increased invasion of SW480 colon carcinoma cells and the distant metastasis of human colorectal carcinoma. Oncogene 23:6666-6671. Wu C, Dedhar S (2001) Integrin-linked kinase (ILK) and its interactors: a new paradigm for the coupling of extracellular matrix to actin cytoskeleton and signaling complexes. J Cell

Biol 155:505-510. Xie D₅ Jauch A₅ Miller CW, Bartram CR, Koeffler HP (2002) Discovery of over-expressed genes and genetic alterations in breast cancer cells using a combination of suppression subtractive hybridization, multiplex FISH and comparative genomic hybridization. Int J Oncol 21 :499-507. Yamamoto T, Gotoh M, Kitajima M, Hirohashi S (1993) Thymosin beta-4 expression is correlated with metastatic capacity of colorectal carcinomas. Biochem Biophys Res Commun 193:706-710.

Additional References for Example 2

Crowder RJ, Freeman RS (1998) Phosphatidylinositol 3-kinase and Akt protein kinase are necessary and sufficient for the survival of nerve growth factor-dependent sympathetic neurons. J Neurosci 18:2933-2943.

Matsui T, Li L, Wu JC, Cook SA, Nagoshi T, Picard MH, Liao R, Rosenzweig A (2002) Phenotypic spectrum caused by transgenic overexpression of activated Akt in the heart. J Biol Chem 277:22896-22901.

Schmidt M, Fernandez de Mattos S, van der Horst A, Klompmaker R, Kops GJ, Lam EW, Burgering BM, Medema RH (2002) Cell cycle inhibition by FoxO forkhead transcription factors involves downregulation of cyclin D. MoI Cell Biol 22:7842-7852.

Claims

Claims:

1 Use of an agent, capable of reducing Thymosin Beta 4 (TB4 or Tbeta4) expression in colon cells, in the manufacture of a medicament for treating colon cancer.

2 Use according to claim 1, wherein the cells are cancerous colon or colorectal cancer cells, colon carcinoma cells or Colon Cancer Stem Cells (CCSCs).

3 Use according to claim 1 or 2, wherein the cancerous cells are resistant to chemotherapeutic treatments.

4 Use according to any preceding claim, wherein the agent is a TB4 binding agent.

5 Use according to claim 4, wherein the TB4 binding agent is an antibody or TB4-binding fragment thereof.

6 Use according to claim 4, wherein the TB4 binding agent is an interfering polynucleotide, such as miRNA and/or siRNA.

7 Use according to any of claims 1-3, wherein the agent is an agonist or antagonist of TB4, such as Ku80.

8 A CCSC or colon cancer cell for implanting in a patient, wherein the cell has been treated to reduce, or displays reduced, Thymosin beta4 (TB4) expression and, preferably, also expresses an anti-cancer agent, such as a toxin able to kill cancerous cells.

9 A cell according to claim 8, transformed by a suitable plasmid or vector comprising an anticancer agent under control of suitable promoter and preferably a suitable marker.

10 A method for identifying CCSCs by detecting TB4 overexpression in a sample of cells, preferably from a colon cancer patient or a patient considered likely to have colon cancer, comprising assaying for the presence of overexpression of TB4.

11 A method of screening a population of colon cancer patients or patients considered likely to have colon cancer patients, comprising assaying for the presence of overexpression of TB4.

12 A method according to claim 10 or 1 1, comprising detecting the presence of elevated TB4 levels in a sample, the elevated levels of TB4 being measurable compared to CD 133- BerEP4+ normal epithelial cells.

13 A method according to claim 12, wherein the elevated levels of TB4 are at least a 20 fold increase, more preferably at least a 60 fold increase of TB4 mRNA in colon cancer stem cells as compared to normal epithelial cells

14 A method according to claim 12 or 13, wherein increased TB4 expression is detectable by assaying for an increase in ILK expression and/or an increased phosporylation state of Akt at a position corresponding to Ser473.

15 A method of treating colon cancer comprising administering an agent capable of reducing Thymosin Beta 4 (TB4 or Tbeta4) expression in colon cells.

16. A method of stimulating proliferation in a colon cell where TBeta4 expression has been reduced, said method comprising contacting said cell with Akt and/or overexpressing Akt in said cell.

17. A method according to claim 16, wherein the Akt is constitutively active.

18. A method according to claim 17, where the active Akt is as described in Kohn et ah, J Biol Chem. 1996 Dec 6;271(49):31372-8.

The invention will now be described with reference to the following Examples. All references cited herein are hereby incorporated to the extent that they agree with the teaching of the present application.