KR101863433B1 - Composition for preventing or treating cancer comprising inducer or activator of KRT19 - Google Patents

Abstract

The present invention relates to a composition for preventing or treating cancer comprising an expression or activity promoting agent for KRT19 as an active ingredient. KRT19 was found to increase proliferation, metastasis, invasion, drug resistance and spherical performance in knockdown breast cancer cells. KRT19 reacted with β-catenin / RAC1 complex to regulate β-catenin stability and intracellular location, -catenin could bind to the NUMB promoter and block the activity of the NOTCH signaling pathway. In addition, KRT19 overexpression can be useful for preventing or treating cancer by decreasing cell proliferation, metastasis, invasion, drug resistance and spheroid formation of breast cancer cells.

Description

[0001] The present invention relates to a composition for preventing or treating cancer comprising an expression or activity promoter of KRT19 as an active ingredient,

The present invention relates to a composition for preventing or treating cancer comprising an expression or activity promoting agent for KRT19 as an active ingredient.

Breast cancer is a disease known to cause a variety of diseases such as gene mutations, chronic inflammation, exposure to toxins and stress. Breast cancer is of worldwide concern but the mechanism of onset is still unknown.

 Some genes in the KRT (Keratin) family can be identified by RT-PCR as an important cancer marker in lymph nodes, peripheral blood, and bone marrow in breast cancer patients. It is known that KRT is a marker of epithelial tissue as an intermediate fiber protein. KRT interacts with kinases, receptors, adapters, and effectors, and these reactions are activated by signal transduction and are known to regulate cell migration, invasion, metastasis, cell cycle and cell death. It is also known that KRT17 binds to the adapter protein and upregulates protein synthesis and cell growth through the AKT / mTOR pathway. In particular, KRT19 knockdown mice exhibit induced skeletal myopathy and KRT19 can activate AKT signaling.

However, there is no known fact that KRT19 is associated with breast cancer and that the expression or activity regulation of KRT19 can treat breast cancer. Therefore, the inventors of the present invention have confirmed that KRT19 increases proliferation, migration, invasion, drug resistance and globule formation in breast cancer cells knocked down by KRT19, and KRT19 reacts with β-catenin / RAC1 complex to improve β- Β-catenin binds to the NUMB promoter and promotes the expression of breast cancer cells. By confirming that the regulation of NUMB expression through KRT19 is related to NOTCH-mediated breast cancer and stem cell signal transduction, The invention was confirmed.

It is an object of the present invention to provide a pharmaceutical composition for preventing or treating cancer, which comprises KRT19 (Keratin 19) expression or activity promoting agent as an active ingredient.

It is another object of the present invention to provide a method for measuring the expression or activity of KRT19 and providing information on the diagnosis of cancer.

It is still another object of the present invention to provide a method for screening anticancer substances by measuring the expression or activity of KRT19 or a gene associated therewith.

A pharmaceutical composition for preventing or treating cancer, which comprises KRT19 (Keratin 19) expression or activity promoting agent as an active ingredient.

Hereinafter, the present invention will be described in detail.

The KRT19 of the present invention increases cell proliferation, metastasis, invasion, drug resistance and spheroid formation in KRT19 knockdown breast cancer cells, and when KRT19 is overexpressed, the cell proliferation, metastasis, invasion, drug resistance, Can be usefully used for cancer prevention or treatment.

The cancer of the present invention may be used for the treatment of cancer such as oral cancer, liver cancer, stomach cancer, colon cancer, breast cancer, lung cancer, bone cancer, pancreatic cancer, skin cancer, head cancer, head cancer, skin cancer, cervical cancer, ovarian cancer, , Endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, lymph node cancer, bladder cancer, gallbladder cancer, endocrine cancer, thyroid cancer, pituitary cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, , Chronic leukemia, acute leukemia, lymphocytic lymphoma, renal cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brain glioma glioma and pituitary adenoma May be breast cancer.

In the present invention, " KRT19 expression or activity promoter " means a substance which directly or indirectly acts on KRT19 to improve, induce, stimulate or increase expression of KRT19. Such materials include single compounds such as organic or inorganic compounds, biopolymer compounds such as peptides, proteins, nucleic acids, carbohydrates and lipids, and complexes of multiple compounds. The mechanism by which the substance promotes the expression or activity of KRT182 is not particularly limited. For example, a substance refers to increasing gene expression such as transcription, translation, and the like.

Preferably, the substance that promotes expression or activity of KRT19 is a biopolymer compound such as a peptide, protein, nucleic acid, carbohydrate and lipid. With respect to the KRT19 sequence for which the nucleic acid and protein sequence are already known, those skilled in the art will appreciate that a single compound peptide such as an organic or inorganic compound acting as an accelerator, a biopolymer compound such as a protein, a nucleic acid, a carbohydrate and a lipid, Technology or can be screened.

The KRT19 activity promoter of the present invention may be the KRT19 protein itself, and the amino acid sequence of the KRT19 protein is SEQ ID NO: 1.

The expression promoter of KRT19 of the present invention may be provided in the form of a vector capable of expressing KRT19 in a cell for use in gene therapy or the like.

Accordingly, the present invention provides a composition for the prevention and treatment of cancer comprising a nucleic acid encoding KRT19, preferably a recombinant vector containing the nucleic acid as an active ingredient.

The nucleic acid encoding KRT19 may comprise the nucleotide sequence of SEQ ID NO: 2.

The nucleotide sequence encoding KRT19 may be mutated by substitution, deletion, insertion, or a combination thereof, as long as one or more nucleic acid bases encode a protein having equivalent activity. The sequence of such a nucleic acid molecule may be short or double-stranded, and may be a DNA molecule or an RNA (mRNA) molecule.

The vector of the present invention includes, but is not limited to, liposomes, plasmid vectors, cosmid vectors, bacteriophage vectors, and viral vectors. A preferred vector in the present invention is a viral vector.

Examples of preferred viral vectors in the present invention include adenoviruses, adenoassociated viruses, retroviruses, lentiviruses, herpes simplex viruses, alpha viruses, ). Lentivirus vectors are particularly preferred in the present invention.

The recombinant vector of the present invention may contain a nucleic acid encoding KRT19 and a regulatory sequence for transcription or translation thereof. A particularly important regulatory sequence is the regulation of transcription initiation, such as promoters and enhancers. It may also contain regulatory sequences consisting of initiation codon, termination codon, polyadenylation signal, Kozak, signal sequence for enhancer, membrane targeting and secretion, IRES (Internal Ribosome Entry Site), and the like. Such a regulatory sequence and a nucleic acid encoding KRT19 should be operably linked.

The term " operably linked " as used herein means that the binding between nucleic acid sequences is functionally related. When any nucleic acid sequence is operably linked, any nucleic acid sequence is located so as to be functionally related to another nucleic acid sequence. In the present invention, it is said that when any transcriptional regulatory sequence affects the transcription of a nucleic acid molecule encoding KRT19, the transcriptional control sequence is operably linked to the nucleic acid molecule.

The expression or activity promoting agent of KRT19 of the present invention can be used in admixture with a pharmaceutically acceptable carrier according to a conventional method. Examples of suitable carriers are lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. If necessary, the composition may further contain a filler, an anticoagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent, an antiseptic, and the like.

The compositions of the present invention may be formulated using methods well known in the art so as to provide for rapid or delayed release of the active ingredient after administration to the individual. Formulations may be in the form of tablets, powders, pills, emulsions, solutions, syrups, aerosols, soft or hard gelatine capsules, sterile injectable solutions, sterile powders and the like. The formulations will conveniently be in a disposable dosage form.

The composition of the present invention is administered in a pharmaceutically effective amount. The term " pharmaceutically effective amount " as used herein means an amount sufficient to treat a disease, and the effective dose level is the severity of the disease; Age, weight, health, sex of the patient; The sensitivity of the patient to the drug; Administration time, route of administration and rate of release; Treatment period; Factors including, but not limited to, the drugs used in combination with or contemporaneously with the composition of the present invention used, and other factors known in the medical field. Preferably, the effective amount of the pharmaceutical composition of the present invention may vary depending on the severity of the disease, but is preferably an effective amount of 1 to 10000 / kg body weight / day, more preferably 10 to 1000 / kg body weight / day It can be repeatedly administered several times a day.

In addition, the present invention provides a method for preventing or treating cancer by administering an expression promoter of KRT19 to a mammal.

The pathway for administering the KRT19 expression promoting agent may be administered locally (including buccal, sublingual, subcutaneous, intradermal), parenterally (including subcutaneous, intradermal, intravascular and intraarticular administration) And the like.

Such mammals include, but are not limited to, humans, dogs, pigs, cows, horses, cats, sheep, goats, mice and the like.

In addition, according to a temporal example of the present invention,

1) measuring the expression or activity of KRT19 from a sample isolated from the subject; And

2) determining that there is a risk for cancer when the expression or activity of KRT19 in step 1) is reduced compared to a normal control.

The sample of step 1) above is not limited to cells, tissues, blood, serum, saliva and urine.

Methods for measuring the expression or activity of KRT19 in the step 1) include tissue immuno staining, radioimmunoassay (RIA), enzyme immunoassay (ELISA), Western blotting, immunoprecipitation assay, Immunodiffusion Assay, Complement Fixation Assay, Fluorescence-activated cell sorter (FACS) and protein chip analysis, and RT-PCR.

According to another example of the present invention,

1) treating the cell line with an anticancer candidate substance;

2) a cell line selected from the group consisting of a) an expression amount of KRT19, b) an expression amount of NUMB, c) a combination of β-catenin and RAC1 and localization in nucleus and d) inactivation of NOTCH signal transduction pathway Or more; And

3) Comparing the results of step 2) with those of cells treated with no anticancer candidate substance as a control, it was found that a) increased expression of KRT19, b) increased expression of NUMB, c) And (d) selecting compounds that inactivate the NOTCH signal transduction pathway.

The step of measuring in step 2) may be performed by a method selected from the group consisting of tissue immunostaining, radioimmunoassay (RIA), enzyme immunoassay (ELISA), Western blotting, immunoprecipitation assay, immunodiffusion assay, A complement fixation assay, a fluorescence-activated cell sorter (FACS), a protein chip analysis and an RT-PCR.

KRT19 was found to increase proliferation, metastasis, invasion, drug resistance and spherical performance in knockdown breast cancer cells. KRT19 reacted with β-catenin / RAC1 complex to regulate β-catenin stability and intracellular location, -catenin could bind to the NUMB promoter and block the activity of the NOTCH signaling pathway. In addition, KRT19 overexpression can be useful for preventing or treating cancer by decreasing cell proliferation, metastasis, invasion, drug resistance and spheroid formation of breast cancer cells.

Brief Description of the Drawings Fig. 1 is a view showing expression pattern of KRT family in breast cancer cells and expression pattern of KRT family in KRT19 knockdown breast cancer.
Figure 2 shows cell proliferation, metastasis, invasion, drug resistance and sphere formation in KRT19 knockdown breast cancer cells.
FIG. 3 shows the expression level of signal transduction-related genes in breast cancer cells when KRT19 expression is inhibited.
FIG. 4 shows the effect of KRT19 on the proliferation, metastasis, invasion and NOTCH signaling pathway of knockdown breast cancer cells treated with DAPT.
FIG. 5 is a graph showing the effect of KRT19 on the localization in the β-catenin nucleus.
FIG. 6 shows the effect of KRT19 on β-catenin / RAC1 complex formation and nuclear localization.
FIG. 7 shows the role of KRT19 in breast cancer stem cells.
FIG. 8 is a graph showing inhibition of cell proliferation, metastasis, drug resistance and sphere formation of breast cancer stem cells when KRT19 overexpression or NOTCH1 knockdown.
FIG. 9 is a schematic diagram of KRT19 agonistic NUMB gene expression regulation. FIG.

Hereinafter, preferred embodiments, experimental examples, and production examples are provided to facilitate understanding of the present invention. However, the following examples, experimental examples and production examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the examples, experimental examples and production examples.

[ Example 1] In breast cancer KRT  family expression levels

1. Cell culture

CD133 ^high / ^low expression levels of human breast cancer cell lines (MDA-MB231, SKBR3, and MCF7), hepatocellular carcinoma cell line (HepG2), neuroblastoma cell line (SH-SY5Y), skin cell line (HaCaT), embryonic kidney cell line (HEK293T) CXCR4 ^high / ALDH1 ^high sphere-forming KU-CSLCs cells were cultured in 10% FBS high glucose-DMEM, RPMI 1640 (Sigma-Aldrich, Saint Louis, MO, USA), 5% CO ₂ and 37 ° C. CD133 ^high / CXCR4 ^high / ALDH1 ^high KU-CSLCs were prepared separately from breast cancer patient tissues at Konkuk University Hospital of Seoul, Korea and the experiment was conducted according to the criteria of IRB (KUH 1020003).

2. RT- PCR  Analysis of Breast Cancer KRT Family  Expression confirmation.

In order to confirm the expression pattern of the KRT family in breast cancer, RT-PCR was performed as follows. Total RNA was extracted using Easy-Blue total RNA extraction kit (iNtRON Biotechnology, Republic of Korea) according to the manufacturer's method. The total RNA concentration was measured with a Nanodrop (ND1000) spectrophotometer (Nanodrop Technologies Inc., Wilmington, DE). CDNA was synthesized using 2 μg of total RNA and M-MLV reverse transcriptase, and the PCR reaction was analyzed in 1% or 1.5% agarose gel. qPCR was analyzed using SYBR Green master mix and mRNA expression was calculated using GAPDH (House keeping gene) as a reference value. The primers shown in Table 1 below were used as primers for each gene. The results are shown in Figs. 1 (b) and 1 (c).

Accession no. Gene Forward (5'-3`) Reverse (5'-3`) NM_057088.2 KRT3 GAGCGGGAACAGATCAAGAC TCCACTTGGTCTCCAGGACT NM_002272.3 KRT4 AGATACCTTGGGCAATGACA CTTGTTCAGGTAGGCAGCAT NM_000424.3 KRT5 CACCAAGACTGTGAGGCAGA CCTTGTTCATGTAGGCAGCA NM_005556.3 KRT7 CTCCGGAATACCCGGAATGAG ATCACAGAGATATTCACGGCTCC NM_153490.2 KRT13 ACGCCAAGATGATTGGTTTC CGACCAGAGGCATTAGAGGT NM_000224.2 KRT18 AGATCGAGGCTCTCAAGGAGG CACGGTCAACCCAGAGCTG NM_002276.4 KRT19 GCGAGCTAGAGGTGAAGATC CGGAAGTCATCTGCAGCCA NM_002046.5 GAPDH AATCCCATCACCATCTTCCAG CACGATACCAAAGTTGTCATGG

3. Western Blot  Using breast cancer KRT family  Identification of expression pattern

To confirm the expression pattern of the KRT family in breast cancer, Western blotting was performed. (Sigma-Aldrich), 100 mM Tris-HCl (pH 7.5), 10 mM NaCl, 10% glycerol (Amresco, Solon OH, USA), 50 mM sodium fluoride The lysates were centrifuged at 13,000 rpm for 15 min at 4 ° C using 1 mM p-nitrophenyl phosphate (Sigma-Aldrich), 1 mM sodiumorthovanadate (Sigma-Aldrich) Protein supernatants were quantified with Bradford protein reagents and proteins were resolved in SDS PAGE (10% or 12%). The separated proteins were transferred to an osmium membrane at a nitrocellular rate and reacted with 5% skimmed milk powder dissolved in TBS (Tris-buffered saline) for about 1 hour. Then, the KRT family antibody (Santa Cruz Biotechnology, Dallas TX , USA) at < RTI ID = 0.0 > 4 C < / RTI > for 12-18 hours. This was followed by binding to an HRP-tagged anti-mouse, -goat, or -rabbit antibody. Protein signal was measured using ECL kit (Amersham Bioscience, Piscataway NJ, USA). The results are shown in Fig. 1 (c).

4. Conclusion

After gene expression was confirmed on Oncomine site (FIG. 1 a), expression levels of various KRT families were compared. It was confirmed that KRT18 and KRT19 expression levels were high in invasive breast cancer. In particular, KRT19 confirmed that there is a marked difference in the expression of breast cancer and normal cells compared with other KRT families, confirming that KRT19 is highly related to breast cancer.

[ Example 2] KRT19 Knockdown (knockdown) Identification of cell proliferation, metastasis, invasion, drug resistance and sphere formation in breast cancer cells.

One. KRT19 Knockdown cells  Produce

BamHI and EcoRI restriction sites of KRT19 (shKRT19) shRNA were used to confirm the effect of KRT19 knockdown in cancer cells. The annealed oligonucleotides were inserted into the pGreenPuro lentivirus expression vector to construct a KRT19-knockdown and KRT19-control vector. Subsequently, HEK293T cells were transfected with a specific lentiviral vector and a virus packaging plasmid (RRE, REV) according to the calcium phosphate transfection method, cultured at 37 ° C in 5% CO ₂ for 72 hours, (Optima L-90K, Beckman Coulter Inc., CA, USA). MDA-MB231, KU-CSLCs, and MCF7 cells were infected with scrambled shRNA or shKRT19, and then cultured at 37 ° C in 5% CO ₂ for 12 hours. After 12 to 18 hours, the cells were replaced with new media (High-Glucose DMEM / RPMI 1640 with 10% FBS) and the lentivirus infection efficiency was calculated to be <95%, and the presence or absence of lentivirus expression was confirmed by RT-PCR and Western blot Respectively.

2. KRT19 Knocked down  Confirmation of proliferation of breast cancer cells

To analyze cell proliferation after KRT19 knockdown in Example 2.1, 2 × 10 ⁴ cells / well cells were prepared in 12-wells, and the number of cells was measured every 24 hours while culturing for 4 days.

The result is shown in Fig. 2d.

3. KRT19 Knocked down  Of breast cancer cells Transferability  Confirm

In order to confirm the metastatic potential of KRT19 knockdown breast cancer cells, cell migration and wound healing experiments were performed. More specifically, 1 × 10 ⁶ cells / after the well cell prepared in 60mm petri dish, after the culture the number of cells to 90% confluence of the cells mitomycin C (10 μg / ml) of 5% CO _2, 37 treated Lt; RTI ID = 0.0 &gt; C &lt; / RTI &gt; for 2 to 3 hours. The cells were then scratched with a 200 μl pipette tip and the cells were washed three times with PBS buffer and photographed at time (0, 12, 24 hours) to confirm cell migration.

The results are shown in Fig. 2e.

4. KRT19 Knocked down  Confirmation of Breast Cancer Cell Invasion

For analysis of cell invasion, CytoSelect ™ 96-Wells Cell Invasion Assay Kit (Cell Biolabs Inc., CA, USA) was used. 1 × 10 ⁵ cells / well cells were prepared in 96-wells and assayed according to the manufacturer's method. The results are shown in FIG. 2F.

5. KRT19 Knocked down  Identification of drug resistance in breast cancer cells

For the drug resistance analysis of KRT19 knockdown breast cancer cells, 1 × 10 ⁵ cells / well cells were prepared in 12-wells, followed by culturing at 5% CO ₂ at 37 ° C. for 12-16 hours. Then, 0.5 μM doxorubicin And cultured for 48 hours. The number of cells was measured and expressed as a percentage (%) of living cells. RT-PCR was also performed on the drug resistance markers ABCG2, ABCC1 and ABCB5. The result is shown in Fig. 2 (g).

6. KRT19 Confirm sphere formation of knock down breast cancer cells

In order to confirm the spherical formation of KRT19 knockdown breast cancer cells , 1 × 10 ⁴ cells were seeded on a plate not coated with GM [growth medium: DMEM / RPMI (DMEM / F12 supplemented with B27-supplement (1:50; Invitrogen, Carlsbad, CA, USA)] supplemented with 10% FBS and 1640 (Sigma-Aldrich) with 10% FBS.

For in vitro spheroidization, cells were treated with 0.25% trypsin-EDTA to dissociate into single cells and then cultured on non-coated plates to obtain spheroids. Spheres in MDA-MB231, MCF7, and KU-CSLCs cells were cultured for 5 days, then collected, stained with crystal violet, and photographed with Nikon eclipse TE2000-U microscopy before colony formation. The results are shown in FIG. 2 h.

7. Stem cells Marker  Confirmation of expression

To confirm the expression of stem cell markers, the expression of OCT4, SOX2, NANOG and c-MYC genes was analyzed by RT-PCR Respectively. The result is shown in Fig. 2 (i).

8. Conclusion

Since KRT19 is highly expressed in breast cancer cells MDA-MB231 and MCF7, KRT19 was reduced in both cells. As a result, KRT19 expression was reduced by 80% by shKRT19 transfection, and KRT19 knockdown was detected in breast cancer cell line Respectively.

In particular, it was confirmed that the proliferation, metastasis, invasion rate, and drug resistance marker genes ABCG2, ABCC1, and ABCB5 expression tended to increase in cancer cells, and it was confirmed that spheroidization was increased.

[ Example 3] KRT19 Knockdown  Identifying the impact on the NOTCH signaling pathway.

1. RT- PCR  Of NOTCH signaling pathway Expression level  Confirm.

RT-PCR was performed using primer sequences shown in Table 2 below in the same manner as in Example 1 to confirm the expression level of NOTCH signal transduction pathway related genes. The results are shown in Fig. 3 (a).

Accession no. Gene Forward (5'-3`) Reverse (5'-3`) NM_001005743.1 NUMB TCCCACTCTCCTACTTCTG TGCCTCCCCTTCTACTTCTG NM_005430.3 WNT1 CTTCGGCCGGGAGTTCGTGG CACCGTGCATGAGCCGGACA NM_017617.3 NOTCH1 GGGTACAAGTGCGACTGTGA CGGCAACGTCGTCAATACAC NM_014757.4 MAML1 CACCAGCCACCGAGTAACTT AACAGGGAGTTCTGCTCGTG NM_005349.3 RBPjK GAACAAATGGAACGCGATGG GATGACTTTTATCCGCTTGCTG NM_005524.3 HES1 GGCTAAGGTGTTTGGAGGCT GGTGGGTTGGGGAGTTTAGG NM_001130442.1 HRAS TTCTACACGTTGGTGCGTGA CACAAGGGAGGCTGCTGAC NM_053056.2 CCND1 CACACGGACTACAGGGGAGT ATGGTTTCCACTTCGCAGCA

2. Western Blot  Used Notch signal transduction pathway genes and cell cycle control genes

Western blotting was performed in the same manner as in Example 1 to confirm the expression level of NOTCH signal transduction pathway related gene and cell cycle control related gene. The results are shown in Fig. 3 (b). FIG. 3C shows the relative expression levels of KRT19, NOTCH1 and NUMB in the Oncomine database.

3. Conclusion

After kinetics of KRT19 knockdown, intracellular signal transduction changes were examined and the results confirmed that KRT19 affects NOTCH signaling. It was confirmed that the NOTCH signal affects the fate, differentiation and proliferation of cells.

 The results show that the NOTCH1 intracellular domain binds to MAML1 and RBPjK and migrates to the nucleus. In addition, it was confirmed that the expression of HES1, Cyclin D1 and H-Ras, which are targets of NOTCH1, increases.

[ Example 4] DAPT  If processed, confirm breast cancer cell proliferation, metastasis and invasion

KRT19 knockdown breast cancer cells were treated with DAPT [ N - [(3,5-Difluorophenyl) acetyl] -L-alanyl-2-phenyl] glycine-1,1-dimethylethyl ester, (Fig. 4A), metastasis (Fig. 4B) and invasion (Fig. 4C). The results are shown in Fig.

As shown in FIG. 4, when DAPT was treated on KRT19 knockdown cells, it was confirmed that both cell proliferation and NOTCH signal changes caused by KRT19 knockdown were restored.

[ Example 5] of KRT19  β- catenin  Confirm movement control in nucleus

1. β- catenin  Confirmation of movement control in the nucleus.

To confirm the relationship between KRT19 and β-catenin-RAC1 complex, KRT19 knockdown Western blots (Figs. 5A and 5B) were performed on phosphorylated-AKT, AKT, phosphorylated-GSK3? And GSK3? In the cells. Also, the location of β-catenin / RAC1 was confirmed by immunocytochemistry (FIG. 5C). The immunocytochemistry was performed as follows.

1 × 10 ⁴ KRT19 knockdown cells were prepared and cultured in 5% CO ₂ at 37 ° C. for 24 hours. The cells were washed with PBS, fixed with 4% paraformaldehyde, and incubated with 0.2% Triton X-100. &Lt; / RTI &gt; The fixed cells were coded in PBS with 10% normal goat serum for 1 hour, then incubated with primary antibody, diluted with PBS and incubated overnight at 4 ° C. After washing three times with PBS, cells were incubated with secondary antibody for 1 hour. The nuclei were stained with TOPRO3 (10 μg / ml) for an additional 10 to 15 minutes. Cells were washed three times with PBS and immunofluorescence was monitored with a Leica TCS SP5 II laser scanning confocal microscope (Leica Microsystems, Wetzlar, Germany). The results are shown in FIG. 5 (b: nucleotide or cytoplasmic β-catenin and RAC1 levels in FIG. 5) (FIG. 5: a: Phospho (p) -AKT, AKT, p-GSK3β and GSK3β Confirmation (Western Blot): Intracellular localization of β-catenin and RAC1 using immunocytochemistry of FIG. 5).

As shown in Fig. 5, it was confirmed that the expression of the signal transduction gene AKT and GSK3? Is not substantially different from each other. Overall, β-catenin and RAC1 tended to decrease slightly, but both proteins were significantly decreased in the nucleus.

2. KRT19 , β- catenin  And RAC1  Confirmation of movement of the complex in the nucleus.

Co-immunoprecipitation was performed to confirm whether KRT19 directly affects β-catenin and RAC1 complexes. The results are shown in FIG. 6 (a: A / G sepharose in FIG. 6: KRT19, β-catenin, an antibody against RAC1; an immunoprecipitation method using IgG; 6: c: FIG. 6: Expression of KRT19, β-catenin and RAC1 protein expression in cells treated with MG132; d in FIG. 6: labeled antibody that can be visualized after MG132 treatment Immunoprecipitation method results).

As shown in FIG. 6, it was confirmed that KRT19 directly affects the β-catenin and RAC1 complexes. However, it was confirmed that the binding was inhibited when KRT19 was knocked down. When MG132, which is a proteasome inhibitor, was treated, the expression of β-catenin and KRT19 was increased and RAC1 was not significantly changed. That is, the expression of KRT19, β-catenin and RAC1 slightly increased when MG132 was treated, while that of β-catenin and RAC1 decreased dramatically when KRT19 expression was suppressed. Therefore, it was confirmed that KRT19 plays a role in regulating β-catenin and RAC1.

[ Example  6] Breast cancer stem cells (KU- CSLCs )in Of KRT19  Identify roles.

Expression of KRT19, NOTCH1, HES1, and the like was confirmed in patient-derived CD133 ^high / CXCR ^high / ALDH1high breast cancer stem cells (KU-CSLCs) in the same manner as in Examples 1 and 2, . The results are shown in FIG. 7 (a: MDA-MB231 cells and KU-CSLCs cells showed the expression level of KRT19 mRNA; Fig. 7b: expression levels of KRT19, NUMB, NOTCH1 and HES1 And Western blot); c and d of FIG. 7: confirmation of spherical performance; e of FIG. 7: confirmation of stem cell marker gene expression; quantification of MDA-MB231 and KU-CSLCs cells in f growth medium or spherical growth medium of FIG. 7; Fig. 7 g: Tumor formation (left), confirmation of tumor removed from the mouse (right) after 4 weeks of transplantation of MDA-MB231 or KU-CSLCs cells into immunodeficient mouse (SCID) 7: Determination of Expression Patterns of KRT18, NUMB, NOTCH1 and HES1 Gene after DAPT Treatment: After the DAPT treatment in Fig. 7, the transfer or invasiveness of cancer Confirm)

As shown in FIG. 7, KRT19 showed low expression in breast cancer stem cells (KU-CSLCs), and NOTCH1 and HES1 also showed low levels. In addition, it was confirmed that KU-CSLCs were easily formed in spherical form as well as spherical form medium in spherical form. In addition, the cells showed high expression of the stem cell marker gene.

In addition, when DAPT was treated with cells, NUMB expression in shKRT19 MDA-MB231 and KU-CSLCs was not different from that of the control. DAPT inhibited cell proliferation and metastasis, decreased expression of stem cell marker genes Respectively. Especially, it was confirmed that the above-mentioned change appears more strongly in KU-CSLCs.

[ Example 7] KRT19  Overexpression or NOTCH1  When suppressed, breast cancer stem cells (KU- CSLCs ), Cell proliferation, metastasis, drug resistance, and Sphere formation  Confirming inhibition.

One. KRT19  Overexpression or NOTHCH1 Knockdown  Cell Manufacturing

NOTCH1 knockdown cells were prepared by cloning shNOTCH according to the method of Example 1. For over-expression of KRT19, sub-cloned in the gene KRT19 ^ⓡ pGEM -T Easy vector (Promega, Madison, WI, USA ), pCDH-EF1-MCS-T2A-copGFP lentiviral vector (System Biosciences) and then cloned into the. HEK293T cells were transfected with a specific lentiviral vector and a virus packaging plasmid (RRE, REV) according to the calcium phosphate transfection method. 5% CO ₂ at 37 ° C for 72 hours, and then harvested using a virus ultracentrifuge (Optima L-90K, Beckman Coulter Inc., CA, USA). MDA-MB231, KU-CSLCs and MCF7 cells were then infected with the lentivirus and then cultured at 37 ° C for 12 hours in 5% CO _2. After 12 to 18 hours, the cells were cultured in new medium (High-Glucose DMEM / RPMI 1640 with 10% FBS). The efficiency of lentivirus infection was calculated to be <95%, and the presence or absence of lentivirus expression was confirmed by RT-PCR and Western blot analysis.

2 . Confirming cell proliferation, metastasis, drug resistance, and sphere formation inhibition of breast cancer stem cells (KU- CSLCs ) upon overexpression of KRT19 or inhibition of NOTCH1 .

In order to confirm that KRT19 regulates the NOTCH1 signal, experiments were performed to reduce KRT19 overexpression or NOTCH1. The results are shown in FIG. 8 (a in FIG. 8: expression of KRT19, NUMB, NOTCH1 and HES1 when KRT19 is overexpressed or NOTCH1 knockdown; b in FIG. 8: confirmation of cell proliferation when overexpression or NOTCH1 knockdown of KRT19; 8: confirmation of drug resistance when KRT19 is overexpressed or NOTCH1 knockdown; e: KRT19 is overexpressed or NOTCH1 knockdown , F: confirmation of expression of stem cell marker when KRT19 was overexpressed or NOTCH1 knockdown, as shown in Fig. 8).

As shown in FIG. 8, it is confirmed that the above two experimental results show the same tendency. In addition, when KRT19 expression was increased or NOTCH1 was decreased, proliferation and metastasis of KU-CSLCs cells were inhibited and the expression of drug resistance markers and stem cell markers was decreased. The above results indicate that KRT19 regulates the NOTCH signal through NUMB.

<110> Kunkuk-Industry effort foundation <120> Composition for preventing or treating cancer          or activator of KRT19 <130> P-1 <160> 2 <170> KoPatentin 3.0 <210> 1 <211> 400 <212> PRT <213> Artificial Sequence <220> <223> it is KRT19 amino acid sequence <400> 1 Met Thr Ser Tyr Ser Tyr Arg Gln Ser Ser Ala Thr Ser Ser Phe Gly   1 5 10 15 Gly Leu Gly Gly Gly Gly Ser Val Arg Phe Gly Pro Gly Val Ala Phe Arg              20 25 30 Ala Pro Ser Ile His Gly Gly Ser Gly Gly Arg Gly Val Ser Ser Ser          35 40 45 Ser Ala Arg Phe Val Ser Ser Ser Ser Gly Ala Tyr Gly Gly Gly      50 55 60 Tyr Gly Gly Val Leu Thr Ala Ser Asp Gly Leu Leu Ala Gly Asn Glu  65 70 75 80 Lys Leu Thr Met Gln Asn Leu Asn Asp Arg Leu Ala Ser Tyr Leu Asp                  85 90 95 Lys Val Arg Ala Leu Glu Ala Ala Asn Gly Glu Leu Glu Val Lys Ile             100 105 110 Arg Asp Trp Tyr Gln Lys Gln Gly Pro Gly Pro Ser Arg Asp Tyr Ser         115 120 125 His Tyr Tyr Thr Thr Ile Gln Asp Leu Arg Asp Lys Ile Leu Gly Ala     130 135 140 Thr Ile Glu Asn Ser Arg Ile Val Leu Gln Ile Asp Asn Ala Arg Leu 145 150 155 160 Ala Ala Asp Asp Phe Arg Thr Lys Phe Glu Thr Glu Gln Ala Leu Arg                 165 170 175 Met Ser Val Glu Ala Asp Ile Asn Gly Leu Arg Arg Val Leu Asp Glu             180 185 190 Leu Thr Leu Ala Arg Thr Asp Leu Glu Met Gln Ile Glu Gly Leu Lys         195 200 205 Glu Glu Leu Ala Tyr Leu Lys Lys Asn His Glu Glu Glu Ile Ser Thr     210 215 220 Leu Arg Gly Gln Val Gly Gly Gln Val Ser Val Glu Val Asp Ser Ala 225 230 235 240 Pro Gly Thr Asp Leu Ala Lys Ile Leu Ser Asp Met Arg Ser Gln Tyr                 245 250 255 Glu Val Met Ala Glu Gln Asn Arg Lys Asp Ala Glu Ala Trp Phe Thr             260 265 270 Ser Arg Thr Glu Glu Leu Asn Arg Glu Val Ala Gly His Thr Glu Gln         275 280 285 Leu Gln Met Ser Ser Ser Glu Val Thr Asp Leu Arg Arg Thr Leu Gln     290 295 300 Gly Leu Glu Ile Glu Leu Glu Ser Glu Leu Ser Met Lys Ala Ala Leu 305 310 315 320 Glu Asp Thr Leu Ala Glu Thr Glu Ala Arg Phe Gly Ala Gln Leu Ala                 325 330 335 His Ile Gln Ala Leu Ile Ser Gly Ile Glu Ala Gln Leu Gly Asp Val             340 345 350 Arg Ala Asp Ser Glu Arg Gln Asn Gln Glu Tyr Gln Arg Leu Met Asp         355 360 365 Ile Lys Ser Arg Leu Glu Gln Glu Ile Ala Thr Tyr Arg Ser Leu Leu     370 375 380 Glu Gly Glu Glu Asp His Tyr Asn Asn Leu Ser Ala Ser Lys Val Leu 385 390 395 400 <210> 2 <211> 1203 <212> DNA <213> Artificial Sequence <220> <223> it is KRT19 DNA sequence <400> 2 atgacttcct acagctatcg ccagtcgtcg gccacgtcgt ccttcggagg cctgggcggc 60 ggctccgtgc gttttgggcc gggggtcgcc tttcgcgcgc ccagcattca cgggggctcc 120 ggcggccgcg gcgtatccgt gtcctccgcc cgctttgtgt cctcgtcctc ctcgggggcc 180 tacggcggcg gctacggcgg cgtcctgacc gcgtccgacg ggctgctggc gggcaacgag 240 aagctaacca tgcagaacct caacgaccgc ctggcctcct acctggacaa ggtgcgcgcc 300 ctggaggcgg ccaacggcga gctagaggtg aagatccgcg actggtacca gaagcagggg 360 cctgggccct cccgcgacta cagccactac tacacgacca tccaggacct gcgggacaag 420 attcttggtg ccaccattga gaactccagg attgtcctgc agatcgacaa tgcccgtctg 480 gctgcagatg acttccgaac caagtttgag acggaacagg ctctgcgcat gagcgtggag 540 gccgacatca acggcctgcg cagggtgctg gatgagctga ccctggccag gaccgacctg 600 gagatgcaga tcgaaggcct gaaggaagag ctggcctacc tgaagaagaa ccatgaggag 660 gaaatcagta cgctgagggg ccaagtggga ggccaggtca gtgtggaggt ggattccgct 720 ccgggcaccg atctcgccaa gatcctgagt gacatgcgaa gccaatatga ggtcatggcc 780 gagcagaacc ggaaggatgc tgaagcctgg ttcaccagcc ggactgaaga attgaaccgg 840 gaggtcgctg gccacacgga gcagctccag atgagcaggt ccgaggttac tgacctgcgg 900 cgcacccttc agggtcttga gattgagctg cagtcacagc tgagcatgaa agctgccttg 960 gaagacacac tggcagaaac ggaggcgcgc tttggagccc agctggcgca tatccaggcg 1020 ctgatcagcg gtattgaagc ccagctgggc gatgtgcgag ctgatagtga gcggcagaat 1080 caggagtacc agcggctcat ggacatcaag tcgcggctgg agcaggagat tgccacctac 1140 cgcagcctgc tcgagggaca ggaagatcac tacaacaatt tgtctgcctc caaggtcctc 1200 tga 1203

Claims (9)

KRT19 (Keratin 19) is an amino acid of SEQ ID NO: 1 or a nucleotide sequence of SEQ ID NO: 2, which comprises treating the cell with an expression or activity promoter of KRT19, enhancing the expression of catenin and RAC1; And inhibiting NOTCH expression. delete delete delete delete delete delete 1) treating the cell line with an anti-breast cancer candidate substance;
2) measuring the amount of a) KRT19 expression, b) the expression level of NUMB in the cell line, c) the binding and nuclear localization of β-catenin and RAC1, and d) the activity of the NOTCH signaling pathway; And
3) Comparing the result of step 2) with that of a cell line not treated with an anti-breast cancer candidate substance as a control group, a) increase of expression amount of KRT19, b) increase of expression amount of NUMB, c) And locating in the nucleus, and d) selecting a compound that inactivates the NOTCH signaling pathway. The method according to claim 8, wherein the measurement in step 2) is performed using tissue immuno staining, radioimmunoassay (RIA), enzyme immunoassay (ELISA), Western blotting, immunoprecipitation assay, Screening of anti-breast cancer candidates using one or more methods selected from Immunodiffusion Assay, Complement Fixation Assay, Fluorescence-activated cell sorter (FACS) and protein chip assay and RT-PCR Way.

Images