KR101885982B1 - Use of NAB2 as an oral cavity cancer prognostic marker - Google Patents

Abstract

The present invention relates to a composition for measuring the prognosis of oral cancer, a kit for prospective oral cancer using the composition for measuring the prognosis of oral cancer, a method for providing information for measuring the prognosis of oral cancer using the composition, and a composition for preventing or treating oral cancer, NAB2 expression levels can be used to diagnose the progression of oral cancer or the risk of recurrence after surgery.

Description

Use of NAB2 as a Marker for Oral Cancer Prognosis [

The present invention relates to a composition for measuring the prognosis of oral cancer, a kit for application of the oral cancer prophylaxis using the composition for measuring the prognosis of oral cancer, a method for providing information for measuring the prognosis of oral cancer using the composition, and a composition for preventing or treating oral cancer.

According to the World Health Organization (WHO), head and neck squamous cell carcinoma (HNSCC) is among the 12 most prevalent cancers in the world. Despite the development of cancer therapies such as chemotherapy, radiotherapy and surgical approaches, the survival rate of HNSCC patients has not improved for decades, and is mostly confirmed in late cancers. In general, it is known that the cause of death in cancer patients is mostly due to metastatic cancer, not primary primary cancer (Eccles and Welch, 2007, Steeg, 2006).

EGFR, on the other hand, is a glycoprotein belonging to the tyrosine kinase (TK) ErbB / HER family of receptors, composed of an extracellular ligand-binding domain and an intracellular TK domain. Ligand binding to EGFR undergoes structural changes that promote dimerization with other members of the ErbB / HER family of receptors, resulting in autophosphorylation and activation of the TK region (Ciardiello and Tortora, 2003). EGFR is expressed at high levels in most HNSCC tissues associated with poor prognosis (Saranath et al., 1992), and EGF stimulates HNSCC migration and invasion through a variety of molecular mechanisms (Thomas et al., 2003; Tumur et al., 2015). EGFR plays an important role in cell survival and proliferation and has been the target of chemotherapy (Burtness, 2005), but has limited results in HNSCC patients (Cohen et al., 2003; Soulieres et al., 2004) .

NGFI-A binding protein 1 (NAB1) and NGFI-A binding protein 2 (NAB2) are known to inhibit transcriptional activation mediated by EGR1 (Russo et al., 1995; Svaren et al., 1996) , NAB2 modulates the expression of the EGR1 target gene through direct interaction with EGR1 (Svaren et al., 1998). Although zinc finger transcription factors have been implicated in various proliferation and differentiation processes, there is no specific report on the role of NAB2 in malignant transformation, invasion, recurrence and survival of cancer patients with epithelial cell carcinoma such as oral cancer. to be.

DISCLOSURE OF THE INVENTION The present invention has been made in order to solve the above-mentioned problems in the prior art. The present inventors continued research on NAB2, a connective tissue gene that can inhibit the invasion of cancer cells such as oral cancer, The present inventors have completed the present invention by confirming that the expression of NAB2 gene and protein is significantly increased and further expressed in cancer-associated fibroblasts in oral cancer tissues.

Accordingly, an object of the present invention is to provide a composition for measuring oral cancer prognosis, which comprises a substance for measuring the level of NAB2 (NGFI-A-binding protein 2) gene or the level of NAB2 protein.

Another object of the present invention is to provide a kit for measuring oral cancer prognosis, which comprises a substance for measuring the level of NAB2 gene or the level of NAB2 protein.

Another object of the present invention is to measure the expression amount or the amount of protein of NAB2 (NGFI-A-binding protein 2) gene from a biological sample and compare the measurement result with the expression amount or protein amount of NAB2 gene of the control sample And determining a patient having a poor prognosis as a patient having a poor prognosis when the amount of the gene or protein of the biological sample increases, thereby providing an information providing method for measuring the prognosis of oral cancer.

It is still another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of oral cancer comprising an NGF2 (NGFI-A-binding protein 2) inhibitor as an active ingredient.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to achieve the above object, the present invention provides a composition for measuring oral cancer prognosis, which comprises a substance for measuring the level of NAB2 (NGFI-A-binding protein 2) gene or the level of NAB2 protein.

In one embodiment of the present invention, the substance for measuring the level of the NAB2 gene may be a primer or a probe capable of amplifying the NAB2 gene.

In another embodiment of the present invention, the substance that measures the level of the NAB2 protein may be an antibody that specifically recognizes the NAB2 protein.

In addition, the present invention provides a kit for measuring oral cancer prognosis, comprising a substance for measuring the level of NAB2 gene or the level of NAB2 protein.

In one embodiment of the present invention, the substance for measuring the level of the NAB2 gene may be a primer or a probe capable of amplifying the NAB2 gene.

In another embodiment of the present invention, the substance that measures the level of the NAB2 protein may be an antibody that specifically recognizes the NAB2 protein.

The present invention also provides a method for detecting the expression level of NAB2 (NGFI-A-binding protein 2) gene or a protein thereof from a biological sample and comparing the measurement result with the expression amount or protein amount of the NAB2 gene of the control sample, A method for providing information for measuring the prognosis of oral cancer, comprising the step of determining that the amount of gene or protein in the biological sample increases, and determining the patient as a patient with poor prognosis.

In one embodiment of the present invention, the biological sample may be a tissue, a cell, a blood, a serum, a plasma, a saliva or a urine, and preferably the tissue may be oral cancer lymphoid tissue, Cancer-associated fibroblast, CAF).

In another embodiment of the present invention, the control sample may be a patient-derived sample that has been cured after treatment with a normal human or oral cancer.

In another embodiment of the present invention, the oral cancer prognostic measure may include determining whether the oral cancer has recovered after treatment.

In another embodiment of the present invention, the method for measuring the expression level of the gene may be selected from the group consisting of RT-PCR, competitive RT-PCR, real-time RT- PCR, RNase protection assay (RPA), Northern blotting or DNA chip.

In another embodiment of the present invention, the method for measuring the expression level of the protein may be Western blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Immunoprecipitation Assay, Complement Fixation Assay, Fluorescence Activated Cell Sorter (FACS), or Protein Chip (FACS), as well as immunoprecipitation assays such as Ouchterlony immunodiffusion, rocket immunoelectrophoresis, protein chip).

The present invention also provides a pharmaceutical composition for the prevention or treatment of oral cancer comprising an inhibitor of NABI (NGFI-A-binding protein 2) as an active ingredient.

The present invention also provides a method of treating oral cancer comprising administering the pharmaceutical composition to a subject.

The present invention provides the use of an NAB2 inhibitor for the manufacture of a medicament for the prevention or treatment of oral cancer.

The present invention relates to a composition for measuring the prognosis of oral cancer, a kit for prospective oral cancer using the composition for measuring the prognosis of oral cancer, a method for providing information for measuring the prognosis of oral cancer using the composition, and a composition for preventing or treating oral cancer, NAB2 expression levels can be used to diagnose the progression of oral cancer or the risk of recurrence after surgery.

FIG. 1 shows the effect of increasing EGR1 expression according to epithelial growth factor (EGF).
2 is a graph showing the effect of NAB2 on cell invasion and morphology of head and neck squamous cell carcinoma (HNSCC).
Figure 3 shows the effect of NAB2 knockdown (knockdown) on EGF-dependent gene expression.
FIG. 4 shows the effect of NAB2 expression level on the permeability of oral cancer cells in a keratinocyte, which is a part of the oral cancer microenvironment, by a co-culture method.
FIG. 5 is a view showing the effect of NAB2 expression level on keratinocyte on a gene regulating the permeability of oral cancer cells by a co-culture method.
FIG. 6 shows that NAB2 expression in oral squamous cell carcinoma tissues is specifically expressed only in cancer-associated fibroblast (CAF).

The present inventors have specifically confirmed the expression of NAB2 gene in tumor tissues and normal tissues of patients with oral squamous cell carcinoma based on the fact that the expression of NAB2 gene and protein is remarkably increased upon treatment with EGF in epithelial cancer cells in the Examples, The present invention has been completed.

Hereinafter, the present invention will be described in detail.

The present invention is characterized by providing a composition for measuring oral cancer prognosis, which comprises a substance that measures the level of NAB2 (NGFI-A-binding protein 2) gene or the level of NAB2 protein.

The present inventors have confirmed that NAB2 (NGFI-A-binding protein 2) gene is specifically expressed only in CAF (Cancer-associated fibroblast) around the primary and metastatic cancer, and the nucleotide sequence of the NAB2 gene is shown in SEQ ID NO: And the amino acid sequence of the NAB2 protein is shown in SEQ ID NO: 2.

In one embodiment of the present invention, it has been confirmed that the expression of NAB2 is specifically increased when EGF is treated in the head and neck squamous cell carcinoma (HNSCC) tissues (see Example 3), and the NAB2 gene Can be used for various purposes and applications that require prediction of prognosis of oral cancer.

Accordingly, the present invention provides a related product and / or application method including a kit for measuring oral cancer prognosis and / or a kit comprising a substance for measuring the level of NAB2 (NGFI-A-binding protein 2) gene or the level of NAB2 protein do.

In the present invention, "prognostic measurement" includes diagnosis of oral cancer and determination of recovery after treatment.

In the present invention, the substance for measuring the level of the NAB2 gene may be a primer or a probe capable of amplifying the NAB2 gene, and the substance for measuring the level of the NAB2 protein may be an antibody specifically recognizing the NAB2 protein.

The term "primer" in the present invention means a short nucleic acid sequence capable of forming a base pair with a complementary template with a short free 3-terminal hydroxyl group and functioning as a starting point for template strand copying. The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures.

The term "probe" in the present invention means a nucleic acid fragment such as RNA or DNA corresponding to a few nucleotides or hundreds of nucleotides that can specifically bind to mRNA and is labeled so that presence or absence of a specific mRNA Can be confirmed. The probe can be produced in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, or an RNA probe. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.

In the present invention, "antibody" means a specific protein molecule directed against an antigenic site. For purposes of the present invention, an antibody refers to an antibody that specifically binds to a marker protein and includes both polyclonal antibodies, monoclonal antibodies, and recombinant antibodies.

Since the nucleic acid sequence of the present invention is registered in the gene bank, a person skilled in the art can design an antisense oligonucleotide, a primer pair or a probe which specifically amplifies a specific region of these genes based on the above sequence.

The antisense oligonucleotides, primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution with one or more of the natural nucleotide analogs, and modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, Amidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

The present invention also provides a method for detecting the expression level of NAB2 (NGFI-A-binding protein 2) gene or a protein thereof from a biological sample and comparing the measurement result with the expression amount or protein amount of the NAB2 gene of the control sample, A method for providing information for measuring the prognosis of oral cancer, comprising the step of determining that the amount of gene or protein in the biological sample increases, and determining the patient as a patient with poor prognosis.

The methods of the present invention include mammals, particularly humans. At this time, the human subject includes a person who has developed oral cancer, or a person who is recovering after the onset, and who needs the measurement of oral cancer prognosis.

The term "biological sample" in the present invention may be composed of tissue, cells, blood, serum, plasma, saliva and urine, preferably the tissue may be oral cancer lymphoid tissue, fibroblast, CAF). < / RTI >

In the present invention, "measurement of gene expression amount" is a process of confirming the presence or absence of mRNA and the expression level of the gene in oral cancer cells, and measuring the amount of mRNA. For example, RT-PCR, competitive RT-PCR, real-time RT-PCR, and RNase protection assay (RPA). RNase protection assay, Northern blotting, DNA chip, and the like.

The agent for measuring the level of a gene in the present invention is preferably an antisense oligonucleotide, a primer pair or a probe. In the present invention, "antisense" means that the antisense oligomer is hybridized with the target sequence in the RNA by Watson-Crick base pairing to form the sequence of the nucleotide base, typically within the target sequence, And an oligomer having a backbone between subunits. Oligomers may have an exact sequence complement or approximate complementarity to the target sequence. This antisense oligomer can alter the processing of mRNA that blocks or inhibits translation of mRNA and produces splice variants of mRNA.

In the present invention, "measurement of protein expression level" is a process of confirming the presence and expression level of the protein expressed from the gene of the present invention in oral cancer cells, and measuring the amount of protein. Examples of the assay methods include Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis But are not limited to, tissue immuno staining, immunoprecipitation assays, complement fixation assays, fluorescence activated cell sorters (FACS), protein chips, and the like. The agent for measuring the protein expression level in the present invention is preferably an antibody.

In the present invention, the term "detection" includes quantitative and / or qualitative analysis, including detection of presence and absence and detection of the expression level, and such methods are well known in the art and are well known to those skilled in the art You will be able to choose a method.

The present invention also provides a pharmaceutical composition for the prevention or treatment of oral cancer comprising an inhibitor of NABI (NGFI-A-binding protein 2) as an active ingredient.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[Example]

Example 1. Experimental Preparation and Experimental Method

1-1. Experimental material

DMEM, DMEM / F12, FBS and penicillin / streptomycin antibiotics were purchased from Gibco (Invitrogen, Carlsbad, CA, USA). Qiazol was purchased from Qiagen (Valencia, CA. USA) and 2X SYBR green PCR master mix was purchased from Takara Biotechnology (Dalian, Japan). Rabbit anti-E-cadherin and anti-p21 antibody were purchased from Abcam (Cambridge, MA, USA), rabbit anti-AKT, anti-p-Akt (Thr308) UK). Rabbit anti-ERK, mouse anti-pERK, anti-NAB2, anti-PTEN, HRP-conjugated mouse IgG anti-β-actin antibodies and goat anti- rabbit and anti- mouse secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Alexa Fluor 594 anti-mouse and Alexa Fluor 488 anti-rabbit fluorescent antibody were purchased from Invitrogen (Carlsbad, CA, USA). PD98059 and EGF were purchased from Sigma Aldrich Co. (Castle Hill, NSW, USA). All other reagents used standard commercial materials.

1-2. Cell culture

Human oral cancer cell line FaDU and human oral keratinocyte IHOK were purchased from the American Type Culture Collection (ATTC) and cultured in DMEM or DMEM / F12 medium containing 10% FBS and 1% penicillin / streptomycin solution at 37 ° C , And 5% CO ₂ .

1-3. Transwell Matrigel  Penetration and wound healing ( Transwell matrigel  invasion and wound healing

In vitro (in vitro) is invading cells Matrigel were performed using a 8.0 μm filter coating chamber (BD Biosciences, San Jose, CA , USA). More specifically, 100 μl of Matrigel solution was added to a Transform insert (Costar, Cambridge, MA), gelled at 37 ° C for 2 hours, and then dried for 10 hours. Cells were suspended in media and 300 [mu] l aliquots were added to each Matrigel-coated transwell. The lower chamber of the transwell was filled with 400 [mu] l of medium. After 48 hours of incubation, the cells were washed twice with PBS and stained with 0.2% crystal violet in 10% ethanol. The number of cells perforated down the membrane was counted.

1-4. Real-time quantitative PCR (qPCR) analysis

Total RNA was extracted using QIAzol and 5 μg of the extracted RNA was reverse-transcribed with cDNA using the first-strand cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA). The resulting cDNA was diluted 10-fold and kept at -20 [deg.] C until use. The primer sequences used in qPCR are shown in Table 1 below.

Primer sequence forward, 5'-3 ' reverse, 5'-3 ' EGR-1 CAGGAGTGATGAACGCAAGA GGGATGGGTAGGAAGAGAGG NAB2 CACATCCCTGCTAAAGCTGAA GTCGAAACGGCCATAGATGAT E-cadherin CGACCCAACCCAAGAATCTA CTCCAAGAATCCCCAGAATG claudin GGCTGCTTTGCTGCAACTGTC AGCCGTGGCACCTTACACG fibronectin CAGGATCACTTACGGAGAAACAG GCCAGTGACAGCATACACAGTG Vimentin GCAAAGCAGGAGTCCACTGAGT ATTTCACGCATCTGGCGTTC GAPDH AGATCATCAGCAATGCCTCCTG ATGGCATGGACTGTGGTCATG

GAPDH was used as a housekeeping gene to normalize gene expression. qPCR was performed using the ABI 7500 real-time PCR system (Applied Biosystems). Calculation was performed on the basis of the normalized Ct value of each treatment to the endogenous GAPDH control value and then the value of ΔCt (Δcycle threshold) determined by calculating 2 ^{- ΔΔCt} for each treatment. All experiments were repeated 3-4 times.

1-5. Western blot analysis

Cells were washed twice with cold PBS and then 200 μl of PRO-PREP protein extraction solution (Intron, Daejon, Korea) was added. The cell lysates were then centrifuged and protein concentrations were estimated using a Coomassie protein assay reagent (Thermo Scientific, Rockford, IL USA). Next, a 30-40 μg aliquot of the protein sample was electrophoresed on an 8-15% SDS-PAGE gel. The protein was then transferred to a nitrocellulose membrane and incubated with primary antibody overnight (4 ° C). The horseradish peroxidase-conjugated secondary antibody was applied for 1 hour at room temperature. β-actin was used as a loading control. Target proteins were detected with ECL detection reagents and the relative intensities of the bands were analyzed using ImageJ software. All experiments were repeated 2-3 times.

1-6. siRNA or overexpression vector transfection (siRNA or overexpression vector transfection) analysis

Cells were transiently transfected with a NAB2 siRNA mixture (Santa Cruz Biotechnology). 1 × 10 ⁵ cells were plated on a 60 mm plate and immediately replaced with serum-free medium immediately before transfection. Cells were seeded at a final concentration of 10 nM using an electroporation system (Bio-Rad Laboratories, Inc., Hercules, CA, USA) RTI ID = 0.0 > siEGR1. ≪ / RTI > After 8 hours, the medium was replaced with fresh serum-containing medium. Full-length PCR was performed from human cDNA clones (EHS1001-6537373: Open Biosystems, Huntsville, AL, USA) using sense primer (5'-GGGGTACCCCAGGATGGCCGCG) and antisense primer (5'- CGGAATTCGCAAATTTCAATTGTCCTGGG) for exogenous EGR1 over- length EGR1 cDNA. The amplified product was cloned into the pCDNA3.1 myc-HisA vector. For exogenous NAB2 overexpression, pcMV6-AC-tGFP NAB2 (Origene Technologies, Rockville, MD, USA) was used.

1-7. Immunocytochemical analysis

First, standard assays were used to examine the effect of EGF on the intracellular location of EGR1 and NAB2. Cells were cultured in 6-well plates containing cover slides. The next day, cells were treated with EGF at 37 < 0 > C for 24 hours. After washing with PBS, cells were immediately fixed in 4% paraformaldehyde and blocked with Tris buffer containing bovine serum albumin (0.05 M TBS + 3 drops of bovine serum albumin) at room temperature. After staining with primary and fluorescent secondary antibodies, cells were stained with Hoechst staining for 1 minute. After several washes with PBS, cells were examined with a fluorescence microscope (BX 51, Olympus, Tokyo, Japan).

Next, in order to confirm the expression of NAB2 in oral squamous cell carcinoma and normal oral tissues, patients with HNSCC who underwent tumor resection for oral cancer treatment at Kyungpook National University Hospital from 2010 to 2015, Paraffin-embedded tissue blocks were obtained from 10 HNSCC tissues, metastatic primary HNSCC tissues and a pair of metastatic lymph node tissues. This study was approved by Kyungpook National University Hospital Ethics Committee and was approved by all participants to meet the requirements of the Declaration of Helsinki before sampling. Tissue sections (5 μm) were dewaxed in xylene and rehydrated in ethanol. The sections were then heated with a citrate buffer solution in a pressure cooker for 10 minutes and blocked with blocking solution for 5 minutes at room temperature to block non-specific binding. The sections were incubated with diluted NAB2 antibody (1:50) for 2 hours at room temperature. Immunohistochemical staining was performed using the UltraTek HRP Anti-Polyvalent Kit (SterTek Laboratories, Logan, UT, USA) and chromogen was 3,3'-diaminobenzidine (Dako, Carpinteria, CA, USA). Nuclei were counterstained with hematoxylin. Immunoreactivity was independently assessed by two skilled investigators at 400X magnification.

1-8. Cell co-culture analysis

FaDU and IHOK (Immortalized human oral keratinocytes) were co-cultured using transwell. For physical isolation of the two cell lines, FDU cells were cultured at the bottom and IHOK cells were cultured in Transwell Permeable Supports (0.4 μm pore; Corning, Incorporated, New York, NY). After 24 hours of incubation, FaDU and IHOK cells were separated and subjected to real-time q-PCR.

1-9. Statistical analysis

We conducted a parametric two-tailed non-paired t-test using significant variance analysis and compared the two populations using variance analysis and non-parametric Mann-Whitney U-test. All analyzes were performed using Origin 8.0 (OriginLab, Northampton, Mass., USA) and P values <0.05 were considered statistically significant.

Example 2. Confirmation of EGR1 Expression Enhancement Effect According to Epithelial Cell Growth Factor (EGF)

First, in order to confirm EGR1 expression increase effect of EGF, the effect of EGF on mRNA expression of E-cadherin (E-cad) in the oral cancer cell line FaDU was confirmed by real-time PCR.

As a result, it was confirmed that EGF down-regulated E-cad mRNA within 3 hours of treatment (FIG. 1A), and EGR1 mRNA and protein expression were significantly increased within 30 minutes, as shown in FIGS. 1A and 1B, And then recovered to the original level (Fig. 1B).

Furthermore, EGF is known to increase ERK-phosphorylation, further confirming the pretreatment effect of ERK inhibitors on EGF-dependent EGR1 upregulation.

As a result, as shown in Figure 1C, pretreatment with PD98059 relaxed EGR1 upregulation in both mRNA and protein levels suggesting that EGF increases EGR1 protein expression in an ERK-dependent manner.

Example  3. Head and neck Squamous cell carcinoma  ( HNSCC ) Confirmation of the effect of NAB2 on cell invasion and morphology

Previous studies have confirmed that oxytocin inhibits HNSCC cell invasion through an EGFR-ERK-EGR1-dependent manner in vitro . To confirm the differential effect of EGF on oxytocin in relation to upregulation of EGR1, MRNA and protein expression of NAB2, a regulator of EGR1, was confirmed.

As a result, as shown in Figs. 2A to 2C, it was confirmed that oxytocin (OXT) did not change NAB2 expression, EGF increased NAB2 expression within 1-3 hours of treatment (Fig. 2A), siRNAB2 pretreatment (P < 0.01, Fig. 2B). &Lt; / RTI &gt; These results indicate that upregulation of NGF2 is an important condition for EGF-dependent cell invasion and EGF-dependent NAB2 upregulation occurs via ERK activation, similar to EGR1 upregulation by EGF treatment 2C).

As a result, the intracellular location of EGR1 and NAB2 due to EGF treatment was further confirmed. As shown in FIG. 2D, when EGF was not treated, fluorescence EGR1 or NAB2 signal was weak, but EGF was treated for 3 hours , The superposition signal between nuclear staining, EGR1 and NAB2 fluorescence in FaDU cells was significantly increased. This expression pattern was restored to the control level after 24 hours.

Furthermore, morphological changes with and without siNAB2 pretreatment were observed. As shown in FIG. 2E, there was no significant morphological change in single treatment of siNAB2, but it was found that the single treatment of EGF induces a more fusiform shape. However, pretreatment of EGF with siNAB2 did not show such morphological changes as compared to siRNA or EGF treatment suggesting that NAB2 contributes in part to EGF-dependent cell migration.

Example 4. Determination of the effect of NAB2 knockdown (knockdown) on EGF-dependent gene expression

Based on the results of the above examples, the effect of NAB2 knockdown (knockdown) on EGF-dependent genes such as tumor suppressor gene or gene promoting cell mobility was confirmed.

As a result, as shown in Fig. 3, pretreatment of siNAB2 upon EGF treatment was found to restore downregulation of E-cadherin (Fig. 3A) or upregulation of vimentin (Fig. 3B) NAB2 knockdown (knockdown) did not cause a significant change in E-cadherin or vimentin expression. In addition, siNAB2 pretreatment restored the EGF-dependent reduction of PTEN and p53 protein expression (Fig. 3C), but NAB2 knockdown without knockdown of EGF did not cause a significant change in these gene expression .

Furthermore, EGR1 competitively acts as a transcription factor to Sp1. As a result, it was confirmed whether EGF-dependent NAB2 up-regulation results in an increase in the efficiency of Sp1 transcriptional regulation. As shown in FIG. 3D, siNAB2 pretreatment was inhibited by MMP2, MMP9 And an EGF-dependent increase in mRNA and protein expression of MDM2. At this time, MMP2, MMP9 and MDM2 correspond to a typical target gene of Sp1.

Example 5. Confirmation of the effect of NAB2 on penetration of oral cancer cells

FaDU and IHOK were cultured by co-culturing method to compare the permeability difference of oral cancer cells according to the degree of NAB2 expression in keratinocyte cell (IHOK), a type of oral connective tissue cell.

As a result, as shown in Figs. 4A to 4C, IHOK single-culture cultured with EGF for 6 hours or 24 hours did not cause a change or slight decrease in NAB2 expression (Fig. 4A) Treatment significantly increased NAB2 mRNA in IHOK cells (Fig. 4B). In addition, co-culture of IHOK overexpressing NAB2 increased vimentin mRNA and decreased E-cadherin mRNA in FaDU cells (Fig. 4C).

Furthermore, FaDU cell infiltration was confirmed in conditioned medium co-cultured with siNAB2 or NAB2 overexpressing vector by matrigel invasion assay, resulting in NAB2 knockdown (knockdown) in IHOK, as shown in Figures 4D and 4E In addition, the infiltration of FaDU cells was significantly increased in the culture medium co-cultured with IHOK overexpressing NAB2.

Example 6. Confirmation of the effect of NAB2 on gene expression of cancerous microenvironment due to penetration of oral cancer cells

Based on the results of the above example, in order to confirm whether FaDU affects the gene expression of the cancerous microenvironment involved in metastasis regulation, IHOK and FaDU were co-cultured and cancer-associated fibroblast (CAF ) Marker mRNA expression was compared.

As a result, as shown in FIG. 5A, CAF markers (COL1A1, collagen; FAP, FSP1, fibroblast-specific protein 1, PDGFR-α, platelet -dived growth factor receptor-α (PDGFR-β, platelet-derived growth factor receptor-β).

In order to confirm whether NAB2 is involved in the increase of CAF marker expression of IHOK by FaDu, siNAB2 and control siRNA which knock-down knockdown of NAB2 gene into IHOK were co-cultured with FaDU, and CAF MRNA expression of the marker was confirmed.

As a result, as shown in FIG. 5B, it was confirmed that the expression of all the CAF markers decreased commonly when NAB2 was knocked down (knocked down).

Example 7. Expression of NAB2 in Oral Squamous Cell Carcinoma and Normal Oral Tissue

To confirm the expression of NAB2 in oral squamous cell carcinoma and normal oral tissues, mRNA expression of NAB2 from non - metastatic HNSCC tissues, metastatic primary HNSCC tissues and metastatic lymph node tissues in head and neck squamous cell carcinoma (HNSCC) patients was confirmed.

As a result, as shown in Fig. 6, NAB2 was specifically expressed only in the CAF around primary (B) and metastatic cancer (D), and not expressed in other normal oral tissues (A) and lymphoid tissues (C) .

Therefore, the present inventors confirmed that the permeability of cancer cells depends on the degree of expression of NAB2 protein in the connective tissue, and thus, NAB2 can be used as a marker for measuring the prognosis of oral cancer.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Use of NAB2 as an oral cavity cancer prognostic marker <130> MP16-409 <160> 2 <170> KoPatentin 3.0 <210> 1 <211> 1575 <212> DNA NGF2 (NGFI-A-binding protein 2) Nucleotide Sequence <400> 1 atgcacagag cgccttcccc cacagccgag cagccgccgg gcggagggga cagcgcccgc 60 cggaccctgc agcccagact caagcccagt gcccgagcca tggcactgcc tcggacgctg 120 ggggagctgc agctgtaccg ggtcctgcag cgcgccaacc tcctttccta ctatgagacc 180 ttcatccagc agggagggga cgacgtgcag cagctgtgtg aggcgggtga ggaggagttt 240 ctggagatca tggcacttgt gggcatggcc accaagcccc tccatgtccg gcgcctgcag 300 aaggcactga gagagtgggc caccaatcca gggctcttca gtcaaccagt gcctgctgtt 360 cccgtctcca gcatcccgct cttcaagatc tctgagactg cgggtacccg gaaagggagc 420 atgagcaatg ggcatggcag cccaggggaa aaggcaggca gtgcccgcag ttttagcccc 480 aagagccccc ttgaacttgg agagaagcta tcaccactgc ctgggggacc tggggcaggg 540 gacccccgga tctggccagg ccggagcact ccagagtcgg acgttggggc aggaggagaa 600 gaggaggctg gctcgccccc cttctccccc cctgcagggg gaggagtccc tgaggggact 660 ggggctgggg ggctggcagc aggtgggact gggggtggtc cagaccgact ggagccagag 720 atggtacgca tggtggtgga aagtgtggag aggatcttcc ggagcttccc aaggggggat 780 gctggggagg tcacatccct gctaaagctg aataagaagc tggcacggag cgttgggcac 840 atctttgaga tggatgataa tgacagccag aaggaagagg agatccgcaa atacagcatc 900 atctatggcc gtttcgactc taagcggcgg gagggcaagc agctcagcct gcacgagctc 960 accatcaacg aggctgctgc ccagttctgc atgagggaca acacgctctt attacggaga 1020 gtggagctct tctctttgtc ccgccaagta gcccgagaga gcacctactt gtcctccttg 1080 aagggctcca ggcttcaccc tgaagaactg ggaggccctc cactgaagaa gctgaaacaa 1140 cagcagcctc gtacccccat accgccccag cctggaggag gacagcgcca gcctgtctgg ggagagtctg 1260 ggggacatt tgcaggctgt ggggtcatgt ccaaggctga cgccgccccc tgctgacctg 1320 cctctggcat tgccagccca tgggctatgg agccgacaca tcctgcagca gacactgatg 1380 gcgaggggc tgcggctcgc ccgcctcgtc tcccacgacc gcgtgggccg cctcagcccc 1440 tgtgtgcctg cgaagccacc tctcgcagag ttcgaggaag ggctgctgga cagatgtcct 1500 gccccaggac cccatcccgc gctggtggag ggtcgcagga gcagcgtgaa agtggaggct 1560 gaggccagcc ggcag 1575 <210> 2 <211> 525 <212> PRT <213> NABI (NGFI-A-binding protein 2) Protein Sequence <400> 2 Met His Arg Ala Pro Ser Pro Thr Ala Glu Gln Pro Pro Gly Gly Gly   1 5 10 15 Asp Ser Ala Arg Arg Thr Leu Gln Pro Arg Leu Lys Pro Ser Ala Arg              20 25 30 Ala Met Ala Leu Pro Arg Thr Leu Gly Glu Leu Gln Leu Tyr Arg Val          35 40 45 Leu Gln Arg Ala Asn Leu Leu Ser Tyr Tyr Glu Thr Phe Ile Gln Gln      50 55 60 Gly Gly Asp Asp Val Gln Gln Leu Cys Glu Ala Gly Glu Glu Glu Phe  65 70 75 80 Leu Glu Ile Met Ala Leu Val Gly Met Ala Thr Lys Pro Leu His Val                  85 90 95 Arg Arg Leu Gln Lys Ala Leu Arg Glu Trp Ala Thr Asn Pro Gly Leu             100 105 110 Phe Ser Gln Pro Val Pro Ala Val Pro Val Ser Ser Ile Pro Leu Phe         115 120 125 Lys Ile Ser Glu Thr Ala Gly Thr Arg Lys Gly Ser Ser Ser Asn Gly     130 135 140 His Gly Ser Pro Gly Glu Lys Ala Gly Ser Ala Arg Ser Phe Ser Pro 145 150 155 160 Lys Ser Pro Leu Glu Leu Gly Glu Lys Leu Ser Pro Leu Pro Gly Gly                 165 170 175 Pro Gly Ala Gly Asp Pro Arg Ile Trp Pro Gly Arg Ser Thr Pro Glu             180 185 190 Ser Asp Val Gly Ala Gly Gly Glu Glu Glu Ala Gly Ser Pro Pro Phe         195 200 205 Ser Pro Pro Ala Gly Gly Gly Val Pro Glu Gly Thr Gly Ala Gly Gly     210 215 220 Leu Ala Ala Gly Gly Thr Gly Gly Gly Pro Asp Arg Leu Glu Pro Glu 225 230 235 240 Met Val Arg Met Val Val Glu Ser Val Glu Arg Ile Phe Arg Ser Phe                 245 250 255 Pro Arg Gly Asp Ala Gly Glu Val Thr Ser Leu Leu Lys Leu Asn Lys             260 265 270 Lys Leu Ala Arg Ser Val Gly His Ile Phe Glu Met Asp Asp Asn Asp         275 280 285 Ser Gln Lys Glu Glu Glu Ile Arg Lys Tyr Ser Ile Ile Tyr Gly Arg     290 295 300 Phe Asp Ser Lys Arg Arg Glu Gly Lys Gln Leu Ser Leu His Glu Leu 305 310 315 320 Thr Ile Asn Glu Ala Ala Gln Phe Cys Met Arg Asp Asn Thr Leu                 325 330 335 Leu Leu Arg Arg Val Glu Leu Phe Ser Leu Ser Arg Gln Val Ala Arg             340 345 350 Glu Ser Thr Tyr Leu Ser Ser Leu Lys Gly Ser Arg Leu His Pro Glu         355 360 365 Glu Leu Gly Gly Pro Pro Leu Lys Lys Leu Lys Gln Glu Val Gly Glu     370 375 380 Gln Ser His Pro Glu Ile Gln Gln Pro Pro Pro Gly Pro Glu Ser Tyr 385 390 395 400 Val Pro Pro Tyr Arg Pro Ser Leu Glu Glu Asp Ser Ala Ser Leu Ser                 405 410 415 Gly Glu Ser Leu Asp Gly His Leu Gln Ala Val Gly Ser Cys Pro Arg             420 425 430 Leu Thr Pro Pro Ala Asp Leu Pro Leu Ala Leu Pro Ala His Gly         435 440 445 Leu Trp Ser Arg His Ile Leu Gln Gln Thr Leu Met Asp Glu Gly Leu     450 455 460 Arg Leu Ala Arg Leu Val Ser His Asp Arg Val Gly Arg Leu Ser Pro 465 470 475 480 Cys Val Pro Ala Lys Pro Pro Leu Ala Glu Phe Glu Glu Gly Leu Leu                 485 490 495 Asp Arg Cys Pro Ala Pro Gly Pro His Pro Ala Leu Val Glu Gly Arg             500 505 510 Arg Ser Ser Val Lys Val Glu Ala Glu Ala Ser Arg Gln         515 520 525

Claims (15)

A composition for measurement of oral cancer prognosis, comprising a substance that measures the level of NAB2 (NGFI-A-binding protein 2) gene or the level of NAB2 protein.
The method according to claim 1,
Wherein the substance for measuring the level of the NAB2 gene is a primer or a probe capable of amplifying the NAB2 gene.
The method according to claim 1,
Wherein the substance for measuring the level of the NAB2 protein is an antibody that specifically recognizes the NAB2 protein.
A kit for measuring oral cancer prognosis, comprising a substance that measures the level of the NAB2 gene or the level of the NAB2 protein.
5. The method of claim 4,
Wherein the substance for measuring the level of the NAB2 gene is a primer or a probe capable of amplifying the NAB2 gene.
5. The method of claim 4,
Wherein the substance measuring the level of the NAB2 protein is an antibody that specifically recognizes the NAB2 protein.
a) measuring the expression level or the amount of protein of NAB2 (NGFI-A-binding protein 2) gene from a biological sample;
b) comparing the measurement result of step a) with the expression amount or the amount of protein of the NAB2 gene of the control sample; And
c) determining a patient with a poor prognosis as an oral cancer patient when the amount of gene or protein of the sample increases as compared to the control sample.
8. The method of claim 7,
Wherein the biological sample is at least one selected from the group consisting of tissue, cell, blood, serum, plasma, saliva, and urine.
9. The method of claim 8,
RTI ID = 0.0 &gt; 1, &lt; / RTI &gt; wherein said tissue is oral cancer lymphoid tissue.
9. The method of claim 8,
Wherein the cell is a cancer-associated fibroblast (CAF).
8. The method of claim 7,
Wherein the control sample is a patient-derived sample that has been cured after being treated with a normal human or oral cancer.
8. The method of claim 7,
Wherein the oral cancer prognostic measure comprises determining whether the oral cancer has recovered after treatment.
8. The method of claim 7,
Methods for measuring the expression level of the gene include RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA; RNaseprotection assay, Northern blotting, and DNA chips.
8. The method of claim 7,
Methods for measuring the expression level of the protein include Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, (1) selected from the group consisting of immunoprecipitation assays, complement fixation assays, fluorescence activated cell sorters (FACS), and protein chips. &Lt; / RTI &gt; or more.
delete

Images