WO2009148605A2 - Procédés pour traiter une hypercholestérolémie - Google Patents
Procédés pour traiter une hypercholestérolémie Download PDFInfo
- Publication number
- WO2009148605A2 WO2009148605A2 PCT/US2009/003398 US2009003398W WO2009148605A2 WO 2009148605 A2 WO2009148605 A2 WO 2009148605A2 US 2009003398 W US2009003398 W US 2009003398W WO 2009148605 A2 WO2009148605 A2 WO 2009148605A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- antisense compound
- certain embodiments
- nucleotides
- targeted
- Prior art date
Links
- 0 CCO[C@@](C1)[C@@]1([C@]1OS)OCC(*)[C@]1F Chemical compound CCO[C@@](C1)[C@@]1([C@]1OS)OCC(*)[C@]1F 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/6454—Dibasic site splicing serine proteases, e.g. kexin (3.4.21.61); furin (3.4.21.75) and other proprotein convertases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3525—MOE, methoxyethoxy
Definitions
- Methods are provided for lowering LDL-C levels in an individual having elevated LDL- C levels. Such methods are further useful to treat hypercholesterolemia, and to reduce the risk of coronary heart disease.
- Atherosclerosis is a complex, polygenic disease of arterial degeneration that can lead to coronary heart disease (CHD).
- CHD coronary heart disease
- LDL-C low density lipoprotein-cholesterol
- HDL-C high density lipoprotein cholesterol
- cigarette smoking hypertension, age, and family history of early CHD.
- LDL-R LDL-receptor
- apoB apolipoprotein B
- PCSK9 proprotein convertase subtilisin/kexin type 9
- ApoB- 100 participates in the intracellular assembly and secretion of triglyceride-rich lipoproteins and is a ligand for the LDL-R.
- PCSK9 is proposed to reduce LDL-R expression levels in the liver. Reduced LDL-R expression results in reduced hepatic uptake of circulating apoB-100-containing lipoproteins, which in turn leads to elevated cholesterol.
- Familial hypercholesterolemia is caused by hundreds of different mutations in the LDL-R, and is phenotypically characterized by elevated plasma LDL-C levels and deposits of LDL-C in tendons, skin and arteries, leading to premature cardiovascular disease.
- Homozygous and heterozygous mutations in the LDL-R are associated with FH.
- heterozygous and homozygous mutations in the ligand-binding domain of PCSK9 are associated with the FH phenotype. Mutations in this gene have been associated with a third form of autosomal dominant FH.
- mice genetically deficient in PCSK9 In mice genetically deficient in PCSK9, a marked increase in LDL-R expression and increased plasma LDL clearance rate were observed. Conversely, overexpression in mice of wild-type PCSK9, or certain PCSK9 mutants, promotes decreased LDL-R expression and elevated LDL-C levels.
- Methods for treating hypercholesterolemia comprise administering to an individual an antisense compound targeted to a PCSK9 nucleic acid.
- an antisense compound targeted to a PCSK9 nucleic acid may be targeted to sequences as set forth in GENBANK® Accession No. NM_174936.2, nucleotides 25475000 to 25504000 of GENBANK® Accession No. NT_032977.8, or GENBANK® Accession No. AK124635.1.
- Methods for treating and/or preventing atherosclerosis comprise administering to an individual an antisense compound targeted to a PCSK9 nucleic acid.
- LDL-C levels comprise administering to an individual an antisense compound targeted to a PCSK9 nucleic acid.
- Methods for reducing CHD risk comprise administering to an individual an antisense compound targeted to a PCSK9 nucleic acid. Such methods may comprise the administration of a therapeutically effective amount of an antisense compound targeted to a PCSK9 nucleic acid.
- Methods are provided for reducing LDL-C levels in an individual having elevated LDL- C levels, comprising administering to the individual a therapeutically effective amount of an antisense oligonucleotide targeted to a PCSK9 nucleic acid, thereby reducing LDL-C levels. Also provided are methods for reducing LDL-C levels in an individual comprising selecting an individual having elevated LDL-C levels, and administering to the individual a therapeutically effective amount of an antisense compound targeted to a PCSK9 nucleic acid, and additionally monitoring LDL-cholesterol levels.
- methods for treating atherosclerosis in an individual comprising selecting an individual diagnosed with atherosclerosis, administering to the individual a therapeutically effective amount of an antisense compound targeted to a PCSK9 nucleic acid, and monitoring atherosclerosis.
- methods for reducing coronary heart disease risk comprising selecting an individual having elevated LDL-C levels and one or more additional indicators of coronary heart disease, administering to the individual a therapeutically effective amount of an antisense compound targeted to a PCSK9 nucleic acid, and monitoring LDL-C levels.
- a therapeutically effective amount of an antisense oligonucleotide targeted to a PCSK9 nucleic acid comprising administering to an individual diagnosed with hypercholesterolemia a therapeutically effective amount of an antisense oligonucleotide targeted to a PCSK9 nucleic acid, thereby reducing cholesterol levels.
- an effective amount of one or more of the disclosed antisense compounds for treating atherosclerosis or hypercholesterolemia in an individual in need of such treatment is also provided. Also provided is a use of an effective amount of one or more of the disclosed antisense compounds for reducing LDL-C levels or reducing CHD risk in an individual in need of such treatment. Also provided is the use of one or more of the disclosed antisense compounds in the manufacture of a medicament for the treatment of atherosclerosis or hypercholesterolemia. Further provided is the use of one or more of the disclosed antisense compounds in the manufacture of a medicament for reducing LDL-C levels or for reducing CHD risk.
- a PCSK9 nucleic acid may be the sequence set forth in SEQ ID NO: 1.
- the antisense compound may be targeted to a PCSK9 nucleic acid as set forth in SEQ ID NO: 1.
- Any of the methods provided herein may further comprise monitoring LDL-C levels.
- An individual may be selected for administration of an antisense compound targeted to a PCSK9 nucleic acid when the individual exhibits an LDL-C level above 100 mg/dL, above 130 mg/dL, above 160 mg/dL, or above 190 mg/dL.
- Administration of an antisense compound targeted to a PCSK9 nucleic acid may result in an LDL-C level below 190 mg/dL, below 160 mg/dL, below 130 mg/dL, below 100 mg/dL, below 70 mg/dL, or below 50 mg/dL.
- administration of the antisense compound may comprise parenteral administration.
- the parenteral administration may further comprise subcutaneous or intravenous administration.
- the antisense compound may have least 80%, at least 90%, or at least 95% complementarity to SEQ ID NO: 1.
- the antisense compound may have 100% complementarity to SEQ ID NO: 1.
- the antisense compounds provided herein and employed in any of the described methods may be 8 to 80 subunits in length, 12 to 50 subunits in length, 12 to 30 subunits in length, 15 to 30 subunits in length, 18 to 24 subunits in length, 19 to 22 subunits in length, or 20 subunits in length.
- the antisense compounds employed in any of the described methods may be antisense oligonucleotides 8 to 80 nucleotides in length, 12 to 50 nucleotides in length, 12 to 30 nucleotides in length 15 to 30 nucleotides in length, 18 to 24 nucleotides in length, 19 to 22 nucleotides in length, or 20 nucleotides in length.
- the antisense compound may be an antisense oligonucleotide.
- the antisense oligonucleotide may be a gapmer antisense oligonucleotide.
- the gapmer antisense oligonucleotide may comprise a gap segment often T- deoxynucleotides positioned between wing segments of five 2'-MOE nucleotides.
- the gapmer antisense oligonucleotide may be a gap-widened antisense oligonucleotide, comprising a gap segment of fourteen 2'-deoxynucleotides positioned between wing segments of three 2'-MOE nucleotides.
- the antisense compounds may have at least one modified internucleoside linkage. Additionally, each internucleoside linkage may be a phosphorothioate internucleoside linkage. Each cytosine may be a 5 -methyl cytosine.
- antisense compounds targeted to a PCSK9 nucleic acid are also provided herein.
- antisense oligonucleotides targeted to a PCSK9 nucleic acid may be targeted to PCSK9 nucleic acids, which include the sequences as set forth in GENB ANK® Accession No. NM_174936.2, nucleotides 25475000 to 25504000 of GENBANK® Accession No. NT_032977.8, or
- the antisense compounds, including antisense oligonucleotides may have at least 70%, at least 80%, at least 90%, or at least 95% complementarity to a PCSK9 nucleic acid.
- the antisense compounds, including antisense oligonucleotides may have 99% complementarity to a PCSK9 nucleic acid.
- the antisense compounds, including antisense oligonucleotides may have 100% complementarity to a PCSK9 nucleic acid.
- the PCSK9 nucleic acid may be the sequence set forth in SEQ ID NO: 1.
- Antisense compovinds targeted to a PCSK9 nucleic acid may be 8 to 80 subunits in length, 12 to 50 subunits in length, 12 to 30 subunits in length, 15 to 30 subunits in length, 18 to 24 subunits in length, 19 to 22 subunits in length, or 20 subunits in length.
- Antisense oligonucleotides targeted to a PCSK9 nucleic acid may be 8 to 80 nucleotides in length, 12 to 50 nucleotides in length, 12 to 30 nucleotides in length, 15 to 30 nucleotides in length, 18 to 24 nucleotides in length, 19 to 22 nucleotides in length, or 20 nucleotides in length.
- the antisense compound may be a gapmer antisense oligonucleotide.
- the gapmer antisense oligonucleotide may comprise a gap segment often 2'-deoxynucleotides positioned between wing segments of five 2'-MOE nucleotides.
- the gapmer antisense oligonucleotide may be a gap- widened antisense oligonucleotide, comprising a gap segment of fourteen 2'-deoxynucleotides positioned between wing segments of three 2'-MOE nucleotides.
- Antisense compounds, including antisense oligonucleotides, targeted to a PCSK9 nucleic acid may have at least one modified internucleoside linkage. Additionally, each internucleoside linkage may be a phosphorothioate internucleoside linkage. Each cytosine may be a 5 -methyl cytosine.
- Antisense compounds, including antisense oligonucleotides, targeted to a PCSK9 nucleic acid may have at least one modified nucleoside.
- a modified nucleoside is a sugar-modified nucleoside.
- the sugar-modified nucleosides can further comprise a natural or modified heterocyclic base moiety and/or a natural or modified internucleoside linkage and may include further modifications independent from the sugar modification.
- a sugar modified nucleoside is a 2 '-modified nucleoside, wherein the sugar ring is modified at the 2' carbon from natural ribose or 2'-deoxy-ribose.
- a 2' modified nucleoside has a 2'-F, 2'-OCH 2 (2'-0Me) or a T- O(CH 2 ) 2 -OCH 3 (2'-O-methoxyethyl or 2'-MOE) substituent group
- a 2 '-modified nucleoside has a bicyclic sugar moiety.
- the bicyclic sugar moiety is a D sugar in the alpha configuration.
- the bicyclic sugar moiety is a D sugar in the beta configuration.
- the bicyclic sugar moiety is an L sugar in the alpha configuration.
- the bicyclic sugar moiety is an L sugar in the beta configuration.
- the bicyclic sugar moiety comprises a bridge group between the
- the bridge group comprises from 1 to 8 linked biradical groups.
- the bicyclic sugar moiety comprises from 1 to 4 linked biradical groups.
- the bicyclic sugar moiety comprises 2 or 3 linked biradical groups.
- the bicyclic sugar moiety comprises 2 linked biradical groups.
- the bicyclic sugar moiety is bridged between the 2' and 4' carbon atoms with a biradical group selected from -O-(CH2)p-, -O-CH2-,-O-CH2CH2-, -O- CH(alkyl)-, -NH-(CH2)p-, -N(alkyl)-(CH2)p-, -O-CH(alkyl)-, -(CH(alkyl))-(CH2)p-, -NH-O- (CH2)p-, -N(alkyl)-O-(CH2)p-, or -O-N(alkyl)-(CH2)p-, wherein p is 1, 2, 3, 4 or 5 and each alkyl group can be further substituted. In certain embodiments, p is 1 , 2 or 3.
- each of said bridges is, independently, -[C(Rl)(R2)]n-, -[C(Rl)(R2)]n-O-, -C(R1R2)-N(R1)-O- or -C(R1R2)-O-N(R1)-.
- each of said bridges is, independently, 4'-(CH2)3-2', 4'-(CH2)2-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-O-N(Rl)-2' and 4'-CH2-N(Rl)-O-2'- wherein each Rl is, independently, H, a protecting group or C1-C12 alkyl.
- antisense compounds reduce PCSK9 expression in a cultured cell model system, e.g., Hep3B cells, cynomolgus monkey hepatocytes, or human primary hepatocytes.
- antisense compounds reduce PCSK9 expression in a dose-dependent manner in a cell culture system, where the antisense compounds have an IC 50 in the nanomolar range.
- antisense compounds also reduce the expression of a PCSK9 nucleic acid in an animal model, such as a transgenic mouse that expresses a human PCSK9 nucleic acid (HuPCSK9Tg mice).
- antisense compounds include those that reduce PCSK9 express in an animal model with a physiology that correlates closely with humans, such as monkey, e.g., the cynomolgus monkey.
- Exemplary antisense compounds display minimal side effects. Side effects include responses to the administration of the antisense compound unrelated to the targeting of a PCSK9 nucleic acid, such as an inflammatory response in the host individual. Exemplary antisense compounds are well tolerated by the host individual. Tolerability may be determined though histological analysis of various cell types, and includes examination of such markers as cytoplasmic swelling from multifocal apoptosis in liver cells, follicular hyperplasia in spleen cells, macrophage infiltration, and the like. In particular embodiments, antisense compounds produce minimal signs of host intolerance.
- antisense compounds further display favorable pharmacokinetics.
- antisense compounds accumulate at a relatively high ratio in the liver versus other sensitive organs, such as kidneys.
- antisense compounds exhibit relatively high half-lives in relevant biological fluids or tissues, e.g., liver tissue, reflecting higher stability and resistance to nucleases, for example.
- antisense compounds target identical sequences in human and animal PCSK9 sequences.
- antisense compounds target PCSK9 sequences without a known single nucleotide polymorphism (SNP), have a high relative G-content, have minimal secondary structure, have greatly reduced effets on the host's serum chemistry, body weight, or histopathology, compared to other antisense compounds, and/or induce a minimal adverse immunohistocompatibility reaction.
- the antisense compound is selected from the group of Isis
- antisense compounds effectively inhibit PCSK9 expression with a low IC 5O in a battery of cell culture systems.
- Exemplary antisense compounds include those selected from the group of Isis 395165, Isis 395185, Isis 395186, Isis 395187, Isis 405879, Isis 405881, Isis 405891, Isis 405988, Isis 405994, and Isis 406008.
- antisense compounds exhibit minimal or no adverse histopathological effects when administered at particularly high doses to an individual.
- antisense compounds include those selected from the group consisting of Isis 395185, Isis 395186, Isis 395187, Isis 405879, Isis 405891, and Isis 405988.
- antisense compounds affect therapeutic end-points, e.g., reduction of plasma LDL-C, liver TG, or liver PCSK9 mRNA, in an animal model.
- Exemplary antisense compounds include Isis 405879.
- antisense compounds display combinations of the characteristics above and reduce liver PCSK9 mRNA expression in an animal model with high efficiency, e.g., Isis 405879. Definitions
- a “pharmaceutical composition” means a mixture of substances suitable for administering to an individual.
- a pharmaceutical composition may comprise an antisense oligonucleotide and a sterile aqueous solution.
- administering means providing a pharmaceutical agent to an individual, and includes, but is not limited to administering by a medical professional and self-administering.
- “Individual” means a human or non-human animal selected for treatment or therapy.
- “Duration” means the period of time during which an activity or event continues. In certain embodiments, the duration of treatment is the period of time during which doses of a pharmaceutical agent are administered.
- Parenteral administration means administration through injection or infusion.
- Parenteral administration includes, but is not limited to, subcutaneous administration, intravenous administration, or intramuscular administration.
- Subcutaneous administration means administration just below the skin.
- Intravenous administration means administration into a vein.
- Dose means a specified quantity of a pharmaceutical agent provided in a single administration.
- a dose may be administered in two or more boluses, tablets, or injections.
- the desired dose requires a volume not easily accommodated by a single injection.
- two or more injections may be used to achieve the desired dose.
- a dose may be administered in two or more injections to minimize injection site reaction in a individual.
- Dosage unit means a form in which a pharmaceutical agent is provided.
- a dosage unit is a vial containing lyophilized antisense oligonucleotide.
- a dosage unit is a vial containing reconstituted antisense oligonucleotide.
- “Pharmaceutical agent” means a substance provides a therapeutic benefit when administered to a individual.
- an antisense oligonucleotide targeted to PCSK9 is pharmaceutical agent.
- “Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable.
- the diluent may be a liquid, e.g., saline solution.
- Active pharmaceutical ingredient means the substance in a pharmaceutical composition that provides a desired effect.
- “Pharmaceutically acceptable carrier” means a medium or diluent that does not interfere with the structure of the oligonucleotide. Certain of such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.
- “Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
- a therapeutically effective amount of antisense compound targeted to a PCSK9 nucleic acid is an amount that decreases LDL-C in the individual.
- “Hypercholesterolemia” means a condition characterized by elevated serum cholesterol.
- “Hyperlipidemia” means a condition characterized by elevated serum lipids.
- Hypertriglyceridemia means a condition characterized by elevated serum triglyceride levels.
- Non-familial hypercholesterolemia means a condition characterized by elevated serum cholesterol that is not the result of a single gene mutation.
- Polygenic hypercholesterolemia means a condition characterized by elevated cholesterol that results from the influence of a variety of genetic factors. In certain embodiments, polygenic hypercholesterolemia may be exacerbated by dietary intake of lipids.
- FH familial hypercholesterolemia
- LDL-R LDL-receptor
- a diagnosis of familial hypercholesterolemia is made when an individualmeets one or more of the following criteria: genetic testing confirming 2 mutated LDL-receptor genes; genetic testing confirming one mutated LDL-receptor gene; document history of untreated serum LDL-cholesterol greater than 500 mg/dL; tendinous and/or cutaneous xanthoma prior to age 10 years; or, both parents have documented elevated serum LDL- cholesterol prior to lipid-lowering therapy consistent with heterozygous familial hypercholesterolemia.
- Homozygous familial hypercholesterolemia or “HoFH” means a condition characterized by a mutation in both maternal and paternal LDL-R genes.
- Heterozygous familial hypercholesterolemia or "HeFH” means a condition characterized by a mutation in either the maternal or paternal LDL-R gene.
- Mated dyslipidemia means a condition characterized by elevated serum cholesterol and elevated serum triglycerides.
- Diabetic dyslipidemia or "Type II diabetes with dyslipidemia” means a condition characterized by Type II diabetes, reduced HDL-C, elevated serum triglycerides, and elevated small, dense LDL particles.
- CHD risk equivalents means indicators of clinical atherosclerotic disease that confer a high risk for coronary heart disease, and include clinical coronary heart disease, symptomatic carotid artery disease, peripheral arterial disease, and/or abdominal aortic aneurysm.
- Metabolic syndrome means a condition characterized by a clustering of lipid and non- lipid cardiovascular risk factors of metabolic origin.
- metabolic syndrome is identified by the presence of any 3 of the following factors: waist circumference of greater than 102 cm in men or greater than 88 cm in women; serum triglyceride of at least 150 mg/dL; HDL-C less than 40 mg/dL in men or less than 50 mg/dL in women; blood pressure of at least 130/85 mmHg; and fasting glucose of at least 110 mg/dL.
- NAFLD Non-alcholic fatty liver disease
- Non-alcoholic steatohepatitis means a condition characterized by inflammation and the accumulation of fat and fibrous tissue in the liver, that is not due to excessive alcohol use. NASH is an extreme form of NAFLD.
- Major risk factors mean factors that contribute to a high risk for coronary heart disease, and include without limitation cigarette smoking, hypertension, low HDL-C, family history of coronary heart disease, and age.
- CHD risk factors mean CHD risk equivalents and major risk factors.
- CHD Coronary heart disease
- Reduced coronary heart disease risk means a reduction in the likelihood that an individualwill develop coronary heart disease. In certain embodiments, a reduction in coronary heart disease risk is measured by an improvement in one or more CHD risk factors, for example, a decrease in LDL-C levels.
- Atherosclerosis means a hardening of the arteries affecting large and medium-sized arteries and is characterized by the presence of fatty deposits. The fatty deposits are called “atheromas” or “plaques,” which consist mainly of cholesterol and other fats, calcium and scar tissue, and damage the lining of arteries.
- History of coronary heart disease means the occurrence of clinically evident coronary heart disease in the medical history of an individualor a individual's family member.
- “Early onset coronary heart disease” means a diagnosis of coronary heart disease prior to age 50.
- Statin intolerant individual means an individualwho as a result of statin therapy experiences one or more of creatine kinase increases, liver function test abnormalities, muscle aches, or central nervous system side effects.
- efficacy means the ability to produce a desired effect.
- efficacy of a lipid- lowering therapy may be reduction in the concentration of one or more of LDL-C, VLDL-C, IDL-C, non-HDL-C, ApoB, lipoprotein(a), or triglycerides.
- Acceptable safety profile means a pattern of side effects that is within clinically acceptable limits.
- Side effects means physiological responses attributable to a treatment other than desired effects.
- side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.
- increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality.
- increased bilirubin may indicate liver toxicity or liver function abnormality.
- injection site reaction means inflammation or abnormal redness of skin at a site of injection in an individual.
- Intelligent compliance means adherence to a recommended or prescribed therapy by an individual.
- Lipid-lowering therapy means a therapeutic regimen provided to an individual to reduce one or more lipids in a individual.
- a lipid-lowering therapy is provide to reduce one or more of ApoB, total cholesterol, LDL-C, VLDL-C, IDL-C, non-HDL- C, triglycerides, small dense LDL particles, and Lp(a) in a individual.
- Lipid-lowering agent means a pharmaceutical agent provided to an individual to achieve a lowering of lipids in the individual.
- a lipid- lowering agent is provided to an individualto reduce one or more of ApoB, LDL-C, total cholesterol, and triglycerides.
- LDL-C target means an LDL-C level that is desired following lipid-lowering therapy.
- Comply means the adherence with a recommended therapy by a individual.
- Recommended therapy means a therapeutic regimen recommended by a medical professional for the treatment, amelioration, or prevention of a disease.
- Low LDL-receptor activity means LDL-receptor activity that is not sufficiently high to maintain clinically acceptable levels of LDL-C in the bloodstream.
- Cardiovascular outcome means the occurrence of major adverse cardiovascular events.
- "Improved cardiovascular outcome” means a reduction in the occurrence of major adverse cardiovascular events, or the risk thereof. Examples of major adverse cardiovascular events include, without limitation, death, reinfarction, stroke, cardiogenic shock, pulmonary edema, cardiac arrest, and atrial dysrhythmia.
- “Surrogate markers of cardiovascular outcome” means indirect indicators of cardiovascular events, or the risk thereof.
- surrogate markers of cardiovascular outcome include carotid intimal media thickness (CIMT).
- Another example of a surrogate marker of cardiovascular outcome includes atheroma size. Atheroma size may be determined by intravascular ultrasound (IVUS).
- Surrogate markers also include increased HDL-cholesterol, or any combination of the markers above.
- Increased HDL-C means an increase in serum HDL-C in an individualover time.
- Lipid-lowering means a reduction in one or more serum lipids in an individual over time.
- Co-administration means administration of two or more pharmaceutical agents to a individual.
- the two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions.
- Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration.
- Co-administration encompasses administration in parallel or sequentially.
- administering refers to the administration of two agents at the same therapeutic time frame, in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration.
- Therapeutic lifestyle change means dietary and lifestyle changes intended to lower cholesterol and reduce the risk of developing heart disease, and includes recommendations for dietary intake of total daily calories, total fat, saturated fat, polyunsaturated fat, monounsaturated fat, carbohydrate, protein, cholesterol, insoluble fiber, as well as recommendations for physical activity.
- tatin means a pharmaceutical agent that inhibits the activity of HMG-CoA reductase.
- HMG-CoA reductase inhibitor means a pharmaceutical agent that acts through the inhibition of the enzyme HMG-CoA reductase.
- “Cholesterol absorption inhibitor” means a pharmaceutical agent that inhibits the absorption of exogenous cholesterol obtained from diet.
- LDL apheresis means a form of apheresis by which LDL-C is removed from blood. Typically, a individual's blood is removed from a vein, and separated into red cells and plasma. LDL-C is filtered out of the plasma prior to return of the plasma and red blood cells to the individual.
- MTP inhibitor means a pharmaceutical agent that inhibits the enzyme microsomal triglyceride transfer protein.
- LDL-C Low density lipoprotein-cholesterol
- VLDL-C Very low density lipoprotein-cholesterol
- Concentration of VLDL-C in serum (or plasma) is typically quantified in mg/dL or nmol/L.
- Serum VLDL-C and “plasma VLDL-C” mean VLDL-C in the serum or plasma, respectively.
- Intermediate low density lipoprotein-cholesterol (IDL-C) means cholesterol associated with intermediate density lipoprotein. Concentration of IDL-C in serum (or plasma) is typically quantified in mg/dL or nmol/L.
- Serum IDL-C” and “plasma IDL-C” mean IDL-C in the serum or plasma, respectively.
- Non-high density lipoprotein-cholesterol (Non-HDL-C) means cholesterol associated with lipoproteins other than high density lipoproteins, and includes, without limitation, LDL-C,
- HDL-C High density lipoprotein-C
- Concentration of HDL-C in serum (or plasma) is typically quantified in mg/dL or nmol/L.
- Sporum HDL-C and “plasma HDL-C” mean HDL-C in the serum and plasma, respectively.
- Total cholesterol means all types of cholesterol, including, but not limited to, LDL-C,
- Lipoprotein(a) or “Lp(a)” means a lipoprotein particle that is comprised of LDL-C, an apolipoprotein(a) particle, and an apolipoproteinB-100 particle.
- ApoAl means apolipoprotein-Al protein in serum. Concentration of ApoAl in serum is typically quantified in mg/dL or nmol/L.
- ApoB:ApoAl ratio means the ratio of ApoB concentration to ApoAl concentration.
- ApoB -containing lipoprotein means any lipoprotein that has apolipoprotein B as its protein component, and is understood to include LDL, VLDL, IDL, and lipoprotein(a).
- "Small LDL particle” means a subclass of LDL particles characterized by a smaller, denser size compared to other LDL particles. In certain embodiments, large LDL particles are 23- 27 nm in diameter. In certain embodiments, intermediate LDL particles are 21.2-23 run in diameter. In certain embodiments, small LDL particles are 18-21.2 nm in diameter. In certain embodiments, particle size is measured by nuclear magnetic resonance analysis.
- Small VLDL particle means a subclass of VLDL particles characterized by a smaller, denser size compared to other VLDL particles. In certain embodiments, large VLDL particles are greater than 60 nm in diameter. In certain embodiments, medium VLDL particles are 35-60 nm in diameter. In certain embodiments, small VLDL particles are 27-35 nm in diameter. In certain embodiments, particle size is measured by nuclear magnetic resonance analysis.
- Teriglycerides means lipids that are the triesters of glycerol.
- Serum triglycerides mean triglycerides present in serum.
- Liver triglycerides mean triglycerides present in liver tissue.
- “Serum lipids” mean cholesterol and triglycerides in the serum.
- “Elevated total cholesterol” means total cholesterol at a concentration in an individualat which lipid-lowering therapy is recommended, and includes, without limitation, elevated LDL- C", “elevated VLDL-C,” “elevated IDL-C,” and “elevated non-HDL-C.”
- total cholesterol concentrations of less than 200 mg/dL, 200-239 mg/dL, and greater than 240 mg/dL are considered desirable, borderline high, and high, respectively.
- LDL-C concentrations of 100 mg/dL, 100-129 mg/dL, 130-159 mg/dL, 160-189 mg/dL, and greater than 190 mg/dL are considered optimal, near optimal/above optimal, borderline high, high, and very high, respectively.
- “Elevated triglyceride” means concentrations of triglyceride in the serum or liver at which lipid-lowering therapy is recommended, and includes “elevated serum triglyceride” and “elevated liver triglyceride.” In certain embodiments, serum triglyceride concentration of 150-199 mg/dL, 200-499 mg/dL, and greater than or equal to 500 mg/dL is considered borderline high, high, and very high, respectively.
- Elevated small LDL particles means a concentration of small LDL particles in an individualat which lipid-lowering therapy is recommended.
- Elevated small VLDL particles means a concentration of small VLDL particles in an individualat which lipid-lowering therapy is recommended.
- “Elevated lipoprotein(a)” means a concentration of lipoprotein(a) in an individualat which lipid-lowering therapy is recommended.
- “Low HDL-C” means a concentration of HDL-C in an individualat which lipid-lowering therapy is recommended. In certain embodiments lipid-lowering therapy is recommended when low HDL-C is accompanied by elevations in non-HDL-C and/or elevations in triglyceride. In certain embodiments, HDL-C concentrations of less than 40 mg/dL are considered low. In certain embodiments, HDL-C concentrations of less than 50 mg/dL are considered low.
- “ApoB” means apolipoprotein B-100 protein. Concentration of ApoB in serum (or plasma) is typically quantified in mg/dL or nmol/L. "Serum ApoB” and “plasma ApoB” mean ApoB in the serum and plasma, respectively.
- LDL/HDL ratio means the ratio of LDL-C to HDL-C.
- Oxidized-LDL or "Ox-LDL-C” means LDL-C that is oxidized following exposure to free radicals.
- “Individual having elevated LDL-C levels” means an individual who has been identified by a medical professional (e.g., a physician) as having LDL-C levels near or above the level at which therapeutic intervention is recommended, according to guidelines recognized by medical professionals. Such an individual may also be considered “in need of treatment” to decrease LDL-C levels.
- “Individual having elevated apoB-100 levels” means an individual who has been identified as having apoB-100 levels near or above the level at which therapeutic intervention is recommended, according to guidelines recognized by medical professionals. Such an individual may also be considered “in need of treatment” to decrease apoB-100 levels.
- “Treatment of elevated LDL-C levels” means administration of an antisense compound targeted to a PCSK9 nucleic acid to an individual having elevated LDL-C levels.
- “Treatment of atherosclerosis” means administration of an antisense compound targeted to a PCSK9 nucleic acid to an individual who, based upon a physician's assessment, has or is likely to have atherosclerosis.
- "Prevention of atherosclerosis” means administration of an antisense compound targeted to a PCSK9 nucleic acid to an individual who, based upon a physician's assessment, is susceptible to atherosclerosis.
- “Ameliorate” means to make better or improve a detrimental condition in an individual.
- Target nucleic acid means any nucleic acid capable of being targeted by antisense compounds.
- PCSK9 nucleic acid means any nucleic acid encoding PCSK9.
- a PCSK9 nucleic acid includes, without limitation, a DNA sequence encoding PCSK9, an RNA sequence transcribed from DNA encoding PCSK9, and an mRNA sequence encoding PCSK9.
- PCSK9 mRNA means an mRNA encoding a PCSK9 protein.
- Targeting means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
- “Targeted” means having a nucleobase sequence that will allow specific hybridization of an antisense compound to a target nucleic acid to induce a desired effect.
- a desired effect is reduction of a target nucleic acid.
- a desired effect is reduction of PCSK9 mRNA.
- Antisense inhibition means reduction of a target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.
- Target region means a fragment of a target nucleic acid to which one or more antisense compounds is targeted.
- Target segment means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted.
- 5' target site refers to the 5 '-most nucleotide of a target segment.
- 3' target site refers to the 3 '-most nucleotide of a target segment.
- Active target region means a target region to which one or more active antisense compounds is targeted.
- Active antisense compounds means antisense compounds that reduce target nucleic acid levels.
- Hybridization means the annealing of complementary nucleic acid molecules.
- complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target.
- complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target
- Stringent hybridization conditions means conditions under which a nucleic acid molecule, such as an antisense compound, will hybridize to a target nucleic acid sequence, but to a minimal number of other sequences.
- Specifically hybridizable means an antisense compound that hybridizes to a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids.
- “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
- “Fully complementary” means each nucleobase of a first nucleic acid is capable of pairing with each nucleobase of a second nucleic acid.
- a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
- an antisense oligonucleotide is a first nucleic acid and a target nucleic acid is a second nucleic acid.
- Non-complementary nucleobase means a nucleobase of first nucleic acid that is not capable of pairing with the corresponding nucleobase of a target nucleic acid.
- Mismatch a nucleobase of first nucleic acid that is not capable of pairing with the corresponding nucleobase of a target nucleic acid.
- Portion means a defined number of contiguous (i.e., linked) nucleobases. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
- Olemeric compound means a polymer of linked monomelic subunits which is capable of hybridizing to at least a region of an RNA molecule.
- Antisense compound means an oligomeric compound that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
- Oligomeric compound means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
- Oligonucleoside means an oligonucleotide in which the internucleoside linkages do not contain a phosphorus atom.
- Unmodified nucleotide means a nucleotide composed of naturally occuring nucleobases, sugar moieties and internucleoside linkages.
- an unmodified nucleotide is an RNA nucleotide (i.e., ⁇ -D-ribonucleosides) or a DNA nucleotide (i.e., ⁇ -D- deoxyribonucleoside) .
- Antisense oligonucleotide means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region of a target nucleic acid.
- Microtif means the pattern of unmodified and modified nucleosides in an antisense compound.
- Chimeric antisense compound means an antisense compound that has at least 2 chemically distinct regions, each region having a plurality of subunits.
- a “gapmer” means an antisense compound in which an internal position having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having one or more nucleotides that are chemically distinct from the nucleosides of the internal region.
- gap segment means the plurality of nucleotides that make up the internal region of a gapmer.
- a "wing segment” means the external region of a gapmer.
- Gap-widened means an antisense compound has a gap segment of 12 or more contiguous 2'-deoxyribonucleotides positioned between 5' and 3' wing segments having from one to six nucleotides having modified sugar moieties.
- Nucleoside means a nucleobase linked to a sugar.
- Nucleobase means a heterocyclic base moiety capable of pairing with a base of another nucleic acid.
- Nucleotide means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
- Nucleobase sequence means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.
- Modified nucleotide means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase.
- Modified nucleoside means a nucleotide having, independently, a modified sugar moiety or modified nucleobase.
- Contiguous nucleobases means nucleobases immediately adjacent to each other.
- Modified oligonucleotide means an oligonucleotide comprising a modified internucleoside linkage, a modified sugar, and/or a modified nucleobase.
- Single-stranded modified oligonucleotide means a modified oligonucleotide which is not hybridized to a complementary strand.
- Internucleoside linkage refers to the chemical bond between nucleosides.
- Linked nucleoside means adjacent nucleosides which are bonded together.
- Linked deoxynucleoside means a nucleic acid base (A, G, C, T, U) substituted by deoxyribose linked by a phosphate ester to form a nucleotide.
- “Naturally occurring internucleoside linkage” means a 3' to 5' phosphodiester linkage.
- Modified internucleoside linkage means substitution and/or any change from a naturally occurring internucleoside bond. In certain instances, the modified internucleoside linkage refers to a phosphodiester internucleoside bond.
- Phosphorothioate linkage means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom.
- a phosphorothioate linkage is a modified internucleoside linkage.
- Modified sugar moiety means substitution and/or any change from a natural sugar moiety.
- a “natural sugar moiety” is a sugar moiety found in DNA (2'-H) or RNA (2'-OH).
- Modified sugar refers to a substitution and /or any change from a natural sugar.
- Bicyclic sugar means a furosyl ring modified by the bridging of the two non-geminal ring atoms.
- a bicyclic sugar is a modified sugar.
- Modified nucleobase means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil.
- An "unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
- Modified sugar moiety means a sugar moiety having a substitution and/or any change from a natural sugar moiety.
- Natural sugar moiety means a sugar moiety found in DNA (2'-H) or RNA (2'-OH).
- 2'-O-methoxyethyl sugar moiety means a 2 '-substituted furosyl ring having a 2'- O(CH2) 2 -OCH 3 (2'-O-methoxyethyl or 2'-MOE) substituent group.
- 2'-O-methoxyethyl nucleotide means a nucleotide comprising a 2'-O-methoxyethyl modified sugar moiety.
- 2'-O-methoxyethyl refers to an O-methoxy-ethyl modification of the 2' position of a furosyl ring.
- a 2'-O-methoxyethyl modified sugar is a modified sugar.
- Bicyclic nucleic acid sugar moiety means a furosyl ring modified by the bridging of two non-geminal ring atoms.
- 5-methylcytosine means a cytosine modified with a methyl group attached to the 5' position.
- a 5-methylcytosine is a modified nucleobase.
- Prodrug means a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
- “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
- Salts refers to physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
- “Cures” means a method or course that restores health or a prescribed treatment for an illness.
- Cap structure or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
- ISIS 301012 means a lipid-lowering agent that is an antisense oligonucleotide having the sequence "GCCTCAGTCTGCTTCGCACC" (SEQ ID NO: 457), where each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is a 5-methylcytosine, nucleotides 6-15 are 2'-deoxynucleotides, and nucleotides 1-5 and 16-20 are 2'-O-methoxyethyl nucleotides. ISIS 301012 does not target PCSK9. It is used herein as a non-PCSK9 control. BRIEF DESCRIPTION OF THE FIGURES
- FIG. 1 depicts the location of PCSK9 mRNA target sequences of exemplary antisense compounds.
- FIG. 2 depicts the results of a five-point dose response experiment with exemplary antisense compounds in HEK-293 cells.
- the antisense compounds are identified by Isis number.
- the bars from left to right represent PCSK9 expression in relative units at 0 nM, 25 nM, 50 nM, 100 nM, 200 nM, and 300 nM antisense oligonucleotides.
- FIG. 3 depicts the results of a five-point dose response experiment with exemplary antisense compounds in cyno primary hepatocytes.
- the antisense compounds are identified by Isis number.
- the bars from left to right represent PCSK9 expression in relative units at 300 nM, 150 nM, 50 nM, 25 nM, and 10 nM antisense oligonucleotides. Control values are shown in the rightmost two bars.
- FIG. 4 depicts a reduction of murine PCSK9 mRNA expression (relative units) in the liver of h-apoB/CETP transgenic mice when administered Isis 394816.
- Isis 394816 was administered by intraperitoneal injection for 6 weeks at a dosing regimen of 20 mg/kg/wk or 50 mg/kg/wk.
- Isis 329993 was administered at 50 mg/kg/wk as a control.
- FIG. 5 Panel A, depicts inhibition of plasma LDL-C (mg/dL) in mice administered Isis 394816 at 20 mg/kg/wk or 50 mg/kg/wk.
- FIG. 5 Panel B, depicts inhibition of liver TG (mg/gram) in mice administered Isis 394816 at 20 mg/kg/wk or 50 mg/kg/wk.
- FIG. 6 depicts the dose-dependent inhibition (relative units) of liver PCSK9 mRNA, plasma LDL-C, and liver TG in response to the indicated doses of Isis 394816.
- FIG. 7 depicts a correlation between LDL-C lowering and PCSK9 mRNA inhibition, using the data from FIG. 6.
- FIG. 8 depicts the accumulation of exemplary antisense compounds in rat tissues ( ⁇ g/g tissue) following administration of antisense compounds.
- the antisense compounds are identified by Isis number.
- the bars from left to right represent antisense compound accumulation in kidney and liver.
- FIG. 9 depicts the accumulation of the identified antisense compounds in tissues ( ⁇ g/g tissue) following administration to a cyno monkey. Accumulation at each dosing concentration (15 mg/kg and 30 mg/kg) is shown in cyno kidney (left side bar) and cyno liver (right side bar).
- FIG. 10 depicts PCSK9 mRNA levels (relative units) following administration of the identified antisense compounds to a cyno monkey. Results are shown at each dosing concentration (15 mg/kg and 30 mg/kg).
- FIG. 11 depicts hepatic PCSK9 mRNA levels (relative units) detected by Northern analysis. Cyno monkeys were administered Isis 405879 ("BMS-844421") at a dose of 15 mg/kg or 30 mg/kg.
- FIG. 12 depicts plasma LDL-C levels (mg/dL) following administration of Isis 405879 (labeled "BMS-844421”) at a dose of 15 mg/kg or 30 mg/kg.
- Left side bars represent baseline levels of LDL-C in control animls; right side bars represent LDL-C following administration of antisense compounds.
- FIG. 13 depicts the ratio of plasma HDL/LDL following administration of Isis 405879 (labeled "BMS-844421”) at a dose of 15 mg/kg or 30 mg/kg.
- Left side bars represent baseline HDL/LDL in control animls; right side bars represent HDL/LDL following administration of antisense compounds.
- FIG. 14 depicts the effect of BMS-844421 and control ASOs on liver human PCSK9 mRNA in transgenic mice (6 wk).
- FIG. 15 depicts the effect of BMS-844421 and control ASOs on plasma levels of human PCSK9 protein in transgenic mice (6 wk).
- FIG. 16 depicts plasma hPCSK9 at baseline (FIG. 16A), 3 wk (FIG. 16B), and 6 wk (FIG. 16C) treatment.
- FIG. 17 depicts the BMS-844421 dose response for plasma hPCSK9 levels in transgenic mice at 6 weeks (wk).
- FIG. 18 depicts the BMS-844421 dose response for liver mRNA and plasma protein (hPCSK9).
- FIG. 19 depicts the dose response for plasma hPCSK9 in male and female transgenic mice.
- FIG. 20 depicts the dose response for liver hPCSK9 mRNA in male versus female transgenic mice.
- FIG. 21 depicts the effect of the ASOs on liver endogenous PCSK9 mRNA in the transgenic mouse after 6 weeks of administration.
- the numbers following the hyphens provide the mg ASO/kg body weight dose of each ASO.
- “844421-30” is the data for BMS- 84421 administered to test animals at 30 mg/kg.
- FIG. 22 depicts the effect of ASOs on liver endogenous HMGCoA reductase mRNA in the transgenic mouse after 6 weeks of administration.
- FIG. 23 depicts LDLR protein concentration following a 6 wk ASO treatment, as assayed by a Western blot.
- FIG. 24 depicts the quantification of the Western blot shown in FIG. 23.
- the LDLR band is normalized to a transferring receptor (TR) band, as observed using anti-LDLR and anti-TR antibodies, respectively.
- TR transferring receptor
- FIG. 25 depicts the Liver PCSK9 mRNA concentration in cyno monkeys after 13 weeks of treatment. The numbers in parentheses are administered doses in mg/kg.
- FIG. 26 depicts the concentration of BMS-844421 in the liver of cyno monkeys after 13 weeks of treatment.
- FIG. 27 depicts the average serum LDL-C levels in the cyno monkey study.
- the numbers in parentheses are administered doses in mg/kg.
- FIG. 28A depicts the pharmacodynamic responses in serum lipid assays for the cyno 2.5 and 5 wk ASO studies, as displayed in a scatterplot of individual animal data.
- FIG 28B depicts the average ratio of HDL/LDL in BMS-844421 -treated cynos at 2.5 and 5 wk. The numbers in parentheses in FIG. 28B are administered doses in mg/kg.
- FIG. 29 depicts downregulation of PCSK9 target in cyno monkeys at 13 wk in the toxicology study of liver mRNA and plasma PCSK9.
- Elevated levels of LDL-cholesterol are recognized as a major independent risk factor for coronary heart disease (CHD).
- CHD coronary heart disease
- LDL-C LDL-cholesterol
- LDL-C LDL-cholesterol
- coronary events still occur, and elevated LDL-C levels remain a major risk factor for coronary heart disease in these individuals.
- LDL-C lowering agents many individuals undergoing LDL-lowering therapy do not reach their target LDL-C levels, and thus remain at risk for CHD. Accordingly, there is a need for additional LDL-C lowering agents.
- the antisense compounds and methods provided herein are useful for the treatment of hypercholesterolemia. Treatment of hypercholesterolemia encompasses a therapeutic regimen that results in a clinically desirable outcome.
- the antisense compounds and methods provided herein are useful for the treatment of elevated cholesterol, such as elevated LDL-C.
- the antisense compounds and methods provided herein may be used to reduce the risk of CHD, in individuals exhibiting one or more risk factors for CHD.
- the antisense compounds and methods provided herein may be used to treat and/or prevent atherosclerosis.
- administration of an antisense oligonucleotide targeted to PCSK9 to animals fed a high-fat diet resulted in antisense inhibition of PCSK9, upregulation of the LDL-R, reduction of LDL-C levels, and reduction of liver triglycerides.
- methods comprise the use of antisense compounds targeted to particularly advantageous sequences within a PCSK9 nucleic acid.
- the PCSK9 target sequences are selected on the basis of superior results shown in one or more selection criteria.
- the presently disclosed antisense compounds all exhibit high in vitro efficacy, determined using a battery of cell models to measure antisense regulation of PCSK9 expression. Further, preferred antisense compounds exhibit relatively high in vivo efficacy, determined using a transgenic mouse model that expresses human PCSK9 or a cynomolgus (“cyno") monkey model.
- the antisense compound ISIS 405879 displays superior results in suppressing PCSK9 mRNA expression in the liver of a host individual.
- the present antisense compounds are tolerated to different extents when administered to a host individual. Increased tolerability can depend on a number of factors, including, but not limited to, the nucleotide sequence of the antisense compound, chemical modifications to the nucleotides, the particular motif of unmodified and modified nucleosides in the antisense compound, or combinations thereof. Antisense compounds that exhibit increased or superior tolerability are particularly preferred in the present methods.
- the present antisense compounds also can show different pharmacokinetic properties, depending on their nucleotide sequence, chemical modifications, motifs, or combinations thereof. Particularly preferred antisense compounds also exhibit favorable pharmacokinetics when administered to a host individual.
- the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions of the present invention.
- the individual has hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, acute coronary syndrome, one or more risk factors for coronary heart disease, type II diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, nonalcoholic steatohepatitis, or non-alcoholic fatty liver disease.
- LDL-C levels 130-159 mg/dL, 160-189 mg/dL, and greater than or equal to 190 mg/dL are considered borderline high, high, and very high, respectively.
- Total cholesterol levels of 200-239 and greater than or equal to 240 mg/dL are considered borderline high and high, respectively.
- HDL-C levels of less than 40 mg/dL are considered low.
- the individual has been identified as in need of lipid-lowering therapy. In certain such embodiments, the individual has been identified as in need of lipid-lowering therapy according to the guidelines established in 2001 by Adult Treatment Panel III (ATP III) of the National Cholesterol Education Program (NCEP), and updated in 2004 (Grundy et al., Circulation, 2004, 110, 227-239).
- the individual in need of lipid-lowering therapy has LDL-C above 190 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 160 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 130 mg/dL.
- the individual in need of lipid-lowering therapy has LDL-C above 100 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy should maintain LDL-C below 160 mg/dL. In certain such embodiments, the individual in need of lipid- lowering therapy should maintain LDL-C below 130 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy should maintain LDL-C below 100 mg/dL. In certain such embodiments, the individual should maintain LDL-C below 70 mg/dL or even below 50 mg/dL. In certain embodiments, the invention provides methods for reducing ApoB in an individual. In certain embodiments, the invention provides methods for reducing ApoB- containing lipoprotein in an individual.
- the invention provides methods for reducing LDL-C in an individual. In certain embodiments, the invention provides methods for reducing VLDL-C in an individual. In certain embodiments, the invention provides methods for reducing IDL-C in an individual. In certain embodiments, the invention provides methods for reducing non-HDL-C in an individual. In certain embodiments the invention provides methods for reducing Lp(a) in an individual. In certain embodiments, the invention provides methods for reducing serum triglyceride in an individual. In certain embodiments, the invention provides methods for reducing liver triglyceride in an individual. In certain embodiments, the invention provides methods for reducing Ox-LDL-C in an individual. In certain embodiments, the invention provides methods for reducing small LDL particles in an individual.
- the invention provides methods for reducing small VLDL particles in an individual. In certain embodiments, the invention provides methods for reducing phospholipids in an individual. In certain embodiments, the invention provides methods for reducing oxidized phospholipids in an individual.
- the methods provided by the present invention do not lower HDL-C. In certain embodiments, the methods provided by the present invention do not result in accumulation of lipids in the liver.
- methods for decreasing LDL-C levels or alternatively methods for treating hypercholesterolemia, by administering to an individual suffering from elevated
- LDL-C levels a therapeutically effective amount of an antisense compound targeted to a PCSK9 nucleic acid.
- a method of decreasing LDL-C levels comprises selecting an individual in need of a decrease in LDL-C levels, and administering to the individual a therapeutically effective amount of an antisense compound targeted to a PCSK9 nucleic acid.
- a method of reducing coronary heart disease risk includes selecting an individual having elevated LDL-C levels and one or more additional indicators of coronary heart disease risk, and administering to the individual a therapeutically effective amount of an antisense compound targeted to a PCSK9 nucleic acid.
- the LDL-C level is from 100-129 mg/dL, from 130 to 159 mg/dL, from 160-189 mg/dL, or greater than or equal to 190 mg/dL.
- administration of a therapeutically effective amount of an antisense compound targeted to a PCSK9 nucleic acid is accompanied by monitoring of LDL-C levels in the serum of an individual, to determine an individual's response to administration of the antisense compound. An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.
- administration of an antisense compound targeted to a PCSK9 nucleic acid results in LDL-C levels below 190 mg/dL, below 160 mg/dL, below 130 mg/dL, below 100 mg/dL, below 70 mg/dL, or below 50 mg/dL.
- administration of an antisense compound targeted to a PCSK9 nucleic acid decreases LDL-C by at least 15%, by at least 25%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, or by at least 95%.
- An individual having elevated LDL-C levels may also exhibit reduced HDL-C levels and/or elevated total cholesterol levels. Accordingly, in one embodiment a therapeutically effective amount of an antisense compound targeted to a PCSK9 nucleic acid is administered to an individual having elevated LDL-C levels, who also has reduced HDL-C levels and/or elevated total cholesterol levels.
- a therapeutically effective amount of an antisense compound targeted to a PCSK9 nucleic acid is administered to an individual having elevated LDL-C levels, and also having elevated triglyceride levels.
- Atherosclerosis can lead to coronary heart disease, stroke, or peripheral vascular disease.
- Elevated LDL-C levels are considered a risk factor in the development and progression of atherosclerosis. Accordingly, in one embodiment, a therapeutically effective amount of an antisense compound targeted to a PCSK9 nucleic acid is administered to an individual having atherosclerosis. In a further embodiment, a therapeutically effective amount of antisense compound targeted to a PCSK9 nucleic acid is administered to an individual susceptible to atherosclerosis. Atherosclerosis is assessed directly through routine imaging techniques such as, for example, ultrasound imaging techniques that reveal carotid intimomedial thickness. Accordingly, treatment and/or prevention of atherosclerosis further include monitoring atherosclerosis through routine imaging techniques. In one embodiment, administration of an antisense compound targeted to a PCSK9 nucleic acid leads to a lessening of the severity of atherosclerosis, as indicated by, for example, a reduction of carotid intimomedial thickness in arteries.
- Measurements of cholesterol, lipoproteins and triglycerides are obtained using serum or plasma collected from an individual. Methods of obtaining serum or plasma samples are routine, as are methods of preparation of the serum samples for analysis of cholesterol, triglycerides, and other serum markers. A physician may determine the need for therapeutic intervention for individuals in cases where more or less aggressive LDL-lowering therapy is needed. The practice of the methods herein may be applied to any altered guidelines provided by the NCEP, or other entities that establish guidelines for physicians used in treating any of the diseases or conditions listed herein, for determining coronary heart disease risk and diagnosing metabolic syndrome.
- administration of an antisense compound targeted to a PCSK9 nucleic acid is parenteral administration. Parenteral administration may be intravenous or subcutaneous administration. Accordingly, in another embodiment, administration of an antisense compound targeted to a PCSK9 nucleic acid is intravenous or subcutaneous administration. Administration may include multiple doses of an antisense compound targeted to a PCSK9 nucleic acid.
- a pharmaceutical composition comprising an antisense compound targeted to PCSK9 is for use in therapy.
- the therapy is the reduction of LDL-C, ApoB, VLDL-C, IDL-C, non-HDL-C, Lp(a) , serum triglyceride, liver triglyceride, Ox-LDL-C, small LDL particles, small VLDL, phospholipids, or oxidized phospholipids in an individual.
- the therapy is the treatment of hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, acute coronary syndrome, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease.
- the therapy is the reduction of CHD risk.
- the therapy is prevention of atherosclerosis.
- the therapy is the prevention of coronary heart disease.
- a pharmaceutical composition comprising an antisense compound targeted to PCSK9 is used for the preparation of a medicament for reducing LDL-C, ApoB, VLDL-C, IDL-C, non-HDL-C, Lp(a), serum triglyceride, liver triglyceride, Ox-LDL-C, small LDL particles, small VLDL, phospholipids, or oxidized phospholipids in an individual.
- pharmaceutical composition comprising an antisense compound targeted to PCKS9 is used for the preparation of a medicament for reducing coronary heart disease risk.
- an antisense compound targeted to PCSK9 is used for the preparation of a medicament for the treatment of hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease.
- one or more pharmaceutical compositions of the present invention are co-administered with one or more other pharmaceutical agents.
- such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions of the present invention.
- such one or more other pharmaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions of the present invention.
- such one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions of the present invention.
- one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent.
- one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.
- a composition may comprise a pharmaceutical agent for separate, sequential, or simultaneous administration with an antisense compound.
- pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include lipid-lowering agents or LXR agonists.
- pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include, but are not limited to atorvastatin, simvastatin, rosuvastatin, and ezetimibe.
- the lipid-lowering agent is administered prior to administration of a pharmaceutical composition of the present invention.
- the lipid-lowering agent is administered following administration of a pharmaceutical composition of the present invention.
- the lipid- lowering agent is administered at the same time as a pharmaceutical composition of the present invention.
- the dose of a co-administered lipid-lowering agent is the same as the dose that would be administered if the lipid-lowering agent was administered alone.
- a co-administered lipid-lowering agent is lower than the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a co-administered lipid-lowering agent is greater than the dose that would be administered if the lipid-lowering agent was administered alone.
- a co-administered lipid-lowering agent is a HMG-CoA reductase inhibitor. In certain such embodiments the HMG-CoA reductase inhibitor is a statin. In certain such embodiments, the statin is selected from, for example, atorvastatin, simvastatin, pravastatin, fluvastatin, and rosuvastatin.
- a co-administered lipid-lowering agent is a cholesterol absorption inhibitor.
- cholesterol absorption inhibitor is ezetimibe.
- a co-administered lipid-lowering agent is a co-formulated HMG- CoA reductase inhibitor and cholesterol absorption inhibitor.
- the co-formulated lipid-lowering agent is ezetimibe/simvastatin.
- a co-administered lipid-lowering agent is a microsomal triglyceride transfer protein inhibitor (MTP inhibitor).
- MTP inhibitor microsomal triglyceride transfer protein inhibitor
- a co-administered lipid-lowering agent is an oligonucleotide targeted to ApoB.
- a co-administered pharmaceutical agent is a bile acid sequestrant.
- the bile acid sequestrant is selected from cholestyramine, colestipol, and colesevelam.
- a co-administered pharmaceutical agent is a nicotinic acid.
- the nicotinic acid is selected from immediate release nicotinic acid, extended release nicotinic acid, and sustained release nicotinic acid.
- a co-administered pharmaceutical agent is a f ⁇ bric acid.
- a fibric acid is selected from gemfibrozil, fenofibrate, clofibrate, bezaf ⁇ brate, and ciprofibrate.
- compositions of the present invention include, but are not limited to, corticosteroids, including but not limited to prednisone; LXR agonists; immunoglobulins, including, but not limited to intravenous immunoglobulin (IVIg); analgesics (e.g., acetaminophen); anti-inflammatory agents, including, but not limited to non-steroidal anti- inflammatory drugs (e.g., ibuprofen, COX-I inhibitors, and COX-2, inhibitors); salicylates; antibiotics; antivirals; antifungal agents; antidiabetic agents (e.g., biguanides, glucosidase inhibitors, insulins, sulfonylureas, and thiazolidenediones); adrenergic modifiers; diuretics; hormones (e.g., anabolic steroids, androgen, estrogen, calcitonin, prog
- corticosteroids including but not limited to prednisone
- the pharmaceutical compositions of the present invention may be administered in conjunction with a lipid-lowering therapy.
- a lipid-lowering therapy is therapeutic lifestyle change.
- a lipid-lowering therapy is LDL apheresis.
- Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs.
- An oligomeric compound may be "antisense" to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
- an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
- an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
- an antisense compound targeted to a PCSK9 nucleic acid is 8 to 80, 12 to 50, 12 to 30 or 15 to 30 subunits in length.
- antisense compounds are from 8 to 80, 12 to 50, 12 to 30 or 15 to 30 linked subunits.
- the antisense compounds are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 subunits in length.
- an antisense oligonucleotide targeted to a PCSK9 nucleic acid is 12 to 30 nucleotides in length. In certain such embodiments, an antisense oligonucleotide targeted to a PCSK9 nucleic acid is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
- an antisense compound targeted to a PCSK9 nucleic acid is 15 to 30 subunits in length.
- antisense compounds are from 15 to 30 linked subunits.
- the antisense compounds are 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 subunits in length.
- an antisense oligonucleotide targeted to a PCSK9 nucleic acid is 15 to 30 nucleotides in length. In certain such embodiments, an antisense oligonucleotide targeted to a PCSK9 nucleic acid is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In certain embodiments, an antisense compound targeted to a PCSK9 nucleic acid is 18 to
- antisense compounds are from 18 to 24 linked subunits. In one embodiment, the antisense compounds are 18, 19, 20, 21, 22, 23, or 24 subunits in length.
- an antisense oligonucleotide targeted to a PCSK9 nucleic acid is 18 to 24 nucleotides in length. In certain such embodiments, an antisense oligonucleotide targeted to a PCSK9 nucleic acid is 18, 19, 20, 21, 22, 23, or 24 nucleotides in length. In certain embodiments, an antisense compound targeted to a PCSK9 nucleic acid is 19 to 22 subunits in length. In other words, antisense compounds are from 19 to 22 linked subunits. This embodies antisense compounds of 19, 20, 21, or 22 subunits in length.
- an antisense oligonucleotide targeted to a PCSK9 nucleic acid is 19 to 22 nucleotides in length. In certain such embodiments, an antisense oligonucleotide targeted to a PCSK9 nucleic acid is 19, 20, 21, or 22 nucleotides in length.
- an antisense compound targeted to a PCSK9 nucleic acid is 20 subunits in length. In certain such embodiments, antisense compounds are 20 linked subunits in length. In certain embodiments, an antisense oligonucleotide targeted to a PCSK9 nucleic acid is
- an antisense oligonucleotide targeted to an PCSK9 nucleic acid is 20 linked nucleotides in length.
- antisense compounds target a range of a PCSK9 nucleic acid.
- such compounds contain at least an 8 nucleotide core sequence in common.
- such compounds sharing at least an 8 nucleotide core sequence target a region identified herein.
- an antisense compound targeted to a PCSK9 nucleic acid may target the following nucleotide regions of SEQ ID NO: 1 : 294-317, 406-440, 406-526, 410-436, 410-499, 446-526, 545-581, 591-619, 591-704, 591-743, 595-622, 600-626, 600-639, 600-670, 601-628, 602-628, 603-630, 611-636, 620-647, 638-665, 648-674, 657-684, 705-743, 782-810, 821-859, 835-859, 835-917, 835-942, 860-887, 860-899, 860-909, 860-917, 869-895, 878-905, 888-909, 923-952, 960-1034, 960-1173, 960-986, 967-991, 970-1023, 970-1064, 970-1117, 970- 996, 9
- antisense compounds target a range of a PCSK9 nucleic acid.
- such compounds contain at least an 8 nucleotide core sequence in common.
- such compounds sharing at least an 8 nucleotide core sequence targets the following nucleotide regions of SEQ IDNO: 1 : 294-317, 406-440, 406-526, 410-436, 410- 499, 446-526, 545-581, 591-619, 591-704, 591-743, 595-622, 600-626, 600-639, 600-670, 601- 628, 602-628, 603-630, 611-636, 620-647, 638-665, 648-674, 657-684, 705-743, 782-810, 821- 859, 835-859, 835-917, 835-942, 860-887, 860-899, 860-909, 860-917, 869-895, 878-905, 888- 909,
- an antisense compound targeted to a PCSK9 nucleic acid may target the following nucleotide regions ofSEQ ID NO: 2: 2274-2400, 2274-2575, 2433-2570, 2433-2579, 2549-2575, 2552-2579, 2585-2638, 2605-2638, 3056-3075, 4150-5159, 4306-4325, 5590-5618, 5667-5686, 6444-6463, 6482-6518, 6492-6518, 6528-6555, 6528-6623, 6534-6561, 6535-6562, 6536-6563, 6537-6563, 6538-6565, 6539-6565, 6540-6567, 6541-6567, 6542-6569, 6546-6573, 6557-6584, 6575-6602, 6585-6611, 6594-6621, 6596-6623, 6652-6671, 7099-7118, 7556-7584, 8836-8855, 8948-89
- antisense compounds target a range of a PCSK9 nucleic acid.
- such compounds contain at least an 8 nucleotide core sequence in common.
- such compounds sharing at least an 8 nucleotide core sequence targets the following nucleotide regions ofSEQ ID NO: 2: 2274-2400, 2274-2575, 2433-2570, 2433- 2579, 2549-2575, 2552-2579, 2585-2638, 2605-2638, 3056-3075, 4150-5159, 4306-4325, 5590- 5618, 5667-5686, 6444-6463, 6482-6518, 6492-6518, 6528-6555, 6528-6623, 6534-6561, 6535- 6562, 6536-6563, 6537-6563, 6538-6565, 6539-6565, 6540-6567, 6541-6567, 6542-6569, 6546- 6573, 6557-6584, 6575-6602, 6585-6611,
- an antisense compound targeted to a PCSK9 nucleic acid may target the following nucleotide regions of SEQ ID NO: 3: 220-253, 290-321, 377-419, 451-615, 653-672, 741-760, 871-897, 915-934, 968-1017, 1075-1124, 1075-1174, 1144-1174, 1275-1302, 1315-1341, 1351-1389, 1351-1447, 1365-1439, 1390-1417, 1390-1429, 1390-1439, 1399-1425, 1408-1435, 1420-1447, 1453-1482, 1490-1516, 1490-1564, 1500-1526, 1515-1541, 1527-1553, 1527-1554, 1528-1554, 1529-1555, 1529-1556, 1530-1556, 1530-1557, 1531-1557, 1532-1558, 1533-1559, 1534-1559, 1535-1559, 1536-1559, 1537-1564, 1566-1602, 1566-1681,
- antisense compounds target a range of a PCSK9 nucleic acid. In certain embodiment, such compounds contain at least an 8 nucleotide core sequence in common.
- such compounds sharing at least an 8 nucleotide core sequence targets the following nucleotide regions of SEQ ID NO: 3: 220-253, 290-321, 377-419, 451-615, 653- 672, 741-760, 871-897, 915-934, 968-1017, 1075-1124, 1075-1174, 1144-1174, 1275-1302, 1315-1341, 1351-1389, 1351-1447, 1365-1439, 1390-1417, 1390-1429, 1390-1439, 1399-1425, 1408-1435, 1420-1447, 1453-1482, 1490-1516, 1490-1564, 1500-1526, 1515-1541, 1527-1553, 1527-1554, 1528-1554, 1529-1555, 1529-1556, 1530-1556, 1530-1557, 1531-1557, 1532-1558, 1533-1559, 1534-1559, 1535-1559, 1536-1559, 1537-1564, 1566-1602, 1566-1681, 16
- an antisense compound targeted to a PCSK9 nucleic acid may target the following nucleotide regions of SEQ ID NO: 1 : 320-405, 441-445, 527-544, 582-590, 744-781, 811-820, 918-922, 953-959, 1034-1036, 1152-1153, 1174-1199, 1251-1272, 1445- 1464, 1603-1604, 1625-1627, 1707-1734, 1766-1811, 1832-1848, 1880-1904, 1956-1961, 1982- 1939, 2030-2039, 2060-2099, 2140-2149, 2170-2186, 2207-2304, 2355-2409, 2435-2503, 2529- 2581, 2626-2648, 2669-2749, 2770-2827, 2856-2876, 2891-2899, 2930-2982, 3014-3226, 3253- 3436, 3457-3471, or 3497-3542.
- antisense compounds target a range of a PCSK9 nucleic acid.
- such compounds contain at least an 8 nucleotide core sequence in common.
- such compounds sharing at least an 8 nucleotide core sequence targets the following nucleotide regions of SEQ ID NO: 1 : 320-405, 441-445, 527-544, 582-590, 744- 781, 811-820, 918-922, 953-959, 1034-1036, 1152-1153, 1174-1199, 1251-1272, 1445-1464, 1603-1604, 1625-1627, 1707-1734, 1766-1811, 1832-1848, 1880-1904, 1956-1961, 1982-1939, 2030-2039, 2060-2099, 2140-2149, 2170-2186, 2207-2304, 2355-2409, 2435-2503, 2529-2581, 2626-2648, 2669-2749, 2770-2827, 2856-2876, 2891-2899, 2930
- a shortened or truncated antisense compound targeted to a PCSK9 nucleic acid has a single subunit deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation).
- a shortened or truncated antisense compound targeted to a PCSK9 nucleic acid may have two subunits deleted from the 5' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound.
- the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.
- the additional subunit may be located at the 5' or 3' end of the antisense compound.
- the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound.
- the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end.
- an antisense compound such as an antisense oligonucleotide
- an antisense oligonucleotide it is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity.
- an antisense compound such as an antisense oligonucleotide
- a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
- Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
- Gautschi et al demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.
- PCT/US2007/068404 describes incorporation of chemically-modified high-affinity nucleotides into short antisense compounds about 8-16 nucleobases in length and that such compounds are useful in the reduction of target RNAs in animals with increased potency and improved therapeutic index.
- antisense compounds targeted to a PCSK9 nucleic acid are short antisense compounds.
- such short antisense compounds are oligonucleotide compounds.
- such short antisense compounds are about 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length and comprises a gap region flanked on each side by a wing, wherein each wing independently consists of 1 to 3 nucleotides.
- Preferred motifs include but are not limited to wing - deoxy gap -wing motifs selected from 3-10-3, 2-10-3, 2-10-2, 1-10-1, 2-8-2, 1-8-1, 3-6-3 or 1- 6-1.
- Antisense compounds targeted to a PCSK9 nucleic acid are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.
- an antisense compound is targeted to a region of a PCSK9 nucleic acid that does not contain a single nucleotide polymorphism (SNPs). In certain embodiments, an antisense compound is targeted to a region of a PCSK9 nucleic acid that does contain a single nucleotide polymorph (SNPs).
- SNPs single nucleotide polymorph
- a single nucleotide polymorphism refers to polymorphisms that are the result of a single nucleotide alteration or the existence of two or more alternative sequences which can be, for example, different allelic forms of a gene.
- a polymorphism may comprise one or more base changes including, for example, an insertion, a repeat, or a deletion.
- an antisense oligonucleotide targeted to a PCSK9 nucleic acid overlaps with a SNP at the following positions: 428, 432, 449, 996, 1011, 1044, 1317, 1565, 1617, 1618, 1671, 1711, 1722, 1836, 1911.
- the compounds provided herein that target a region of a PCSK9 nucleic acid that contains one or more SNPs will contain the appropriate base substitution, insertion, repeat or deletion such that the compound is fully complementary to the altered PCSK9 nucleic acid sequence.
- a subgroup of these antisense compounds were selected for further characterization, based on the ability of the selected antisense compounds to inhibit PCSK9 expression selectively and effectively in cell culture assays, set forth in the Examples.
- the antisense compounds selected for further evaluation are listed in Table 1.
- the 5' and 3' boundaries of the PCSK9 target sequence are shown for each antisense compound, with reference to the nucleotide positions of SEQ ID NO: 1.
- “Motif in Table 1 refers to the use of chemically modified nucleosides at the 5' and 3' ends of the antisense compounds.
- an antisense compound has a nucleobase sequence that, when written in the 5' to 3 1 direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
- antisense compounds targeted to a PCSK9 nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced the inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
- Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
- a second region of a chimeric antisense compound may serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
- Antisense compounds having a gapmer motif are considered chimeric antisense compounds.
- a gapmer an internal position having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region.
- the gap segment In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides.
- the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
- each distinct region comprises uniform sugar moieties.
- the wing-gap-wing motif is frequently described as "X-Y-Z", where "X" represents the length of the 5' wing region, "Y” represents the length of the gap region, and "Z" represents the length of the 3' wing region.
- an antisense compound targeted to a PCSK9 nucleic acid has a gap-widened motif. In other embodiments, an antisense oligonucleotide targeted to a PCSK9 nucleic acid has a gap- widened motif.
- the gap-widened antisense oligonucleotides described herein may have various wing- gap-wing motifs selected from: 1-16-1, 2-15-1, 1-15-2, 1-14-3, 3-14-1, 2-14-2, 1-13-4, 4-13-1, 2-13-3, 3-13-2, 1-12-5, 5-12-1, 2-12-4, 4-12-2, 3-12-3, 1-11-6, 6-11-1, 2-11-5, 5-11-2, 3-11-4, 4- 11-3, 1-17-1, 2-16-1, 1-16-2, 1-15-3, 3-15-1, 2-15-2, 1-14-4, 4-14-1, 2-14-3, 3-14-2, 1-13-5, 5- 13-1, 2-13-4, 4-13-2, 3-13-3, 1-12-6, 6-12-1, 2-12-5, 5-12-2, 3-12-4, 4-12-3, 1-11-7, 7-11-1, 2- 11-6, 6-11-2, 3-11-5, 5-11-3, 4-11-4, 1-18-1, 1-17-2, 2-17-1, 1-16-3, 1-16-3, 2-16-2, 1
- a gap-widened antisense oligonucleotide targeted to a PCSK9 nucleic acid has a gap segment of fourteen 2'-deoxyribonucleotides positioned between wing segments of three chemically modified nucleosides.
- the chemical modification comprises a 2 '-sugar modification. In another embodiment, the chemical modification comprises a 2'-MOE sugar modification.
- antisense compounds targeted to a PCSK9 nucleic acid possess a 5- 10-5 gapmer motif.
- Nucleotide sequences that encode PCSK9 include, without limitation, the following: GENBANK® Accession No. NM_174936.2, first deposited with GENB ANK® on June 1, 2003, and incorporated herein as SEQ ID NO: 1 ; nucleotides 25475000 to 25504000 of GENBANK® Accession No. NT_032977.8, first deposited with GENBANK® on February 26, 2006, and incorporated herein as SEQ ID NO: 2; and GENBANK® Accession No. AKl 24635.1, first deposited with GENBANK® on September 8, 2003, and incorporated herein as SEQ ID NO: 3.
- portions of SEQ ID NO: 1 are identical to portions of SEQ ID NO: 2; portions of SEQ ID NO: 1 are identical to portions of SEQ ID NO: 3; and portions of SEQ ID NO: 2 are identical to portions of SEQ ID NO: 3.
- antisense compounds target a PCSK9 nucleic acid having the sequence of GENBANK® Accession No. NM_174936.2, first deposited with GENBANK® on June 1, 2003, and incorporated herein as SEQ ID NO: 1.
- an antisense oligonucleotide targets SEQ ID NO: 1.
- an antisense oligonucleotide that is targeted to SEQ ID NO: 1 is at least 90% complementary to SEQ ID NO: 1.
- an antisense oligonucleotide that is targeted to SEQ ID NO: 1 is at least 95% complementary to SEQ ID NO: 1.
- an antisense oligonucleotide that is targeted to SEQ ID NO: 1 is 100% complementary to SEQ ID NO: 1.
- an antisense oligonucleotide targeted to SEQ ID NO: 1 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Table 2.
- gapmer antisense compounds are targeted to a PCSK9 nucleic acid. In certain such embodiments, gapmer antisense compounds are targeted to SEQ ID NO: 1. In certain such embodiments, the nucleotide sequences illustrated in Table 2 have a 5-10-5 gapmer motif. Table 3 illustrates gapmer antisense compounds targeted to SEQ ID NO: 1, having a 5-10-5 motif, where the gap segment comprises 2'-deoxynucleotides and each wing segment comprises nucleotides comprising a 2'-O-methoxyethyl sugar modification. Internucleoside linkages are phosphorthioate, and cytidines are 5-methylcytidines.
- Table 3 Gapmer antisense compounds having a 5-10-5 motif targeted to SEQ ID NO: 1
- gap-widened antisense compounds are targeted to a PCSK9 nucleic acid. In certain such embodiments, gap-widened antisense compounds are targeted to SEQ ID NO: 1.
- the nucleotide sequences illustrated in Table 2 have a 3-14-3 gap-widened motif.
- Table 4 illustrates gap- widened antisense compounds targeted to SEQ ID NO: 1, having a 3-14-3 motif, where the gap segment comprises 2'-deoxynucleotides and each wing segment comprises nucleotides comprising a 2'-O-methoxyethyl sugar modification. Internucleoside linkages are phosphorthioate, and cytidines are 5-methylcytidines.
- Table 4 Gapmer antisense compounds having a 3-14-3 motif targeted to SEQ ID NO: 1
- gap-widened antisense compounds are targeted to a PCSK9 nucleic acid. In certain such embodiments, gap-widened antisense compounds are targeted to SEQ ID NO: 1.
- the nucleotide sequences illustrated in Table 2 have a 2-13-5 gap-widened motif.
- Table 5 illustrates gap- widened antisense compounds targeted to SEQ ID NO: 1, having a 2-13-5 motif, where the gap segment comprises 2'-deoxynucleotides and each wing segment comprises nucleotides comprising a 2'-O-methoxyethyl sugar modification. Internucleoside linkages are phosphorthioate, and cytidines are 5-methylcytidines.
- Table 5 Gapmer antisense compounds having a 2-13-5 motif targeted to SEQ ID NO: 1
- gap-widened antisense compounds are targeted to a PCSK9 nucleic acid. In certain such embodiments, gap-widened antisense compounds are targeted to SEQ ID NO: 1.
- the nucleotide sequences illustrated in Table 2 have a 3-13-4 gap-widened motif.
- Table 6 illustrates gap-widened antisense compounds targeted to SEQ ID NO: 1, having a 3-13-4 motif, where the gap segment comprises 2'-deoxynucleotides and each wing segment comprises nucleotides comprising a 2'-O-methoxyethyl sugar modification. Internucleoside linkages are phosphorthioate, and cytidines are 5-methylcytidines.
- Table 6 Gapmer antisense compounds having a 3-13-4 motif targeted to SEQ ID NO: 1
- antisense compounds targeted to the target regions are also illustrated. It is understood that the sequence set forth in each SEQ ID NO is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
- antisense compounds target a range of a PCSK9 nucleic acid.
- such compounds contain at least an 8 nucleotide core sequence in common.
- such compounds sharing at least an 8 nucleotide core sequence targets the following nucleotide regions of SEQ ID NO: 1 : 294-317, 406-440, 406-526, 410-436, 410- 499, 446-526, 545-581, 591-619, 591-704, 591-743, 595-622, 600-626, 600-639, 600-670, 601- 628, 602-628, 603-630, 611-636, 620-647, 638-665, 648-674, 657-684, 705-743, 782-810, 821- 859, 835-859, 835-917, 835-942, 860-887, 860-899, 860-909, 860-917, 869-895, 878-905, 888- 909,
- a target region is nucleotides 294-317 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 294-317 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 159 or 160.
- an antisense compound targeted to nucleotides 294-317 of SEQ ID NO: 1 is selected from ISIS NOs: 410742 or 405999.
- a target region is nucleotides 406-440 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 406-440 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 7, 8, 162, 163, 164, 165, 166, 167, 168, 169 or 170.
- an antisense compound targeted to nucleotides 406-440 of SEQ ID NO: 1 is selected from ISIS NOs: 405861, 405862, 405863, 405864, 395152, 399874, 405865, 405866, 405867, 405868, 399793, 399949, or 410743.
- a target region is nucleotides 406-526 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 406-526 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 7, 8, 9, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, or 176.
- an antisense compound targeted to nucleotides 406-526 of SEQ ID NO: 1 is selected from ISIS NOs: 405861, 405862, 405863, 405864, 395152, 399874, 405865, 405866, 405867, 405868, 399793, 399950, 410743, 410744, 410745, 395153, 399875, 406000, 406001, 406002 or 410746.
- a target region is nucleotides 410-436 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 410-436 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 7, 8, 166, 167, 168, 169 or 169.
- an antisense compound targeted to nucleotides 410-436 of SEQ ID NO: 1 is selected from ISIS NOs: 395152, 399874, 405865, 405866, 405867, 405868, or 399793.
- a target region is nucleotides 410-499 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 410-499 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 7, 8, 9, 166, 167, 169, 170, 171 or 172.
- an antisense compound targeted to nucleotides 410-499 of SEQ ID NO: 1 is selected from ISIS NOs: 395152, 399874, 405865, 405866, 405867, 405868, 399793, 399949, 410743, 410744, 410745, 395153, or 399875.
- a target region is nucleotides 446-526 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 446-526 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 9, 171, 172, 173, 174, 175 or 176.
- an antisense compound targeted to nucleotides 446-526 of SEQ ID NO: 1 is selected from ISIS NOs: 410744, 410745, 395153, 399875, 406000, 406001, 406002, or 410746.
- a target region is nucleotides 545-581 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 545-581 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 10, 177, 178, 179, 180 or 181.
- an antisense compound targeted to nucleotides 545-581 of SEQ ID NO: 1 is selected from ISIS NOs: 410747, 406003, 406004, 406005, 395154, 399876, or 406006.
- a target region is nucleotides 591-619 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 591-619 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 11, 182, 183, 184, 185 or 186.
- an antisense compound targeted to nucleotides 591-619 of SEQ ID NO: 1 is selected from ISIS NOs: 410748, 406007, 410529, 410574, 410647, 410530, 410575, 410648, 410531, 410576, 410649, 395155, 399877, or 410650.
- a target region is nucleotides 591-704 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 591-704 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 11, 12, 13, 14, 15, 16, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, or 208.
- an antisense compound targeted to nucleotides 591-704 of SEQ ID NO: 1 is selected from ISIS NOs: 410748, 406007, 410529, 410574, 410647, 410530, 410575, 410648, 410531, 410576, 410649, 395155, 399877, 410650, 410532, 410577, 410651, 406008, 410578, 410652, 410533, 410579, 410653, 406009, 410580, 410654, 410534, 410581, 410655, 399794, 399950, 410656, or 410751.
- a target region is nucleotides 591-743 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 591-743 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 11, 12, 13, 14, 15, 16, 17, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, or 209.
- an antisense compound targeted to nucleotides 591-743 of SEQ ID NO: 1 is selected from ISIS NOs: 410748, 406007, 410529, 410574, 410647, 410530, 410575, 410648, 410531, 410576, 410649, 395155, 399877, 410650, 410532, 410577, 410651, 406008, 410578, 410652, 410533, 410579, 410653, 406009, 410580, 410654, 410534, 410581, 410655, 399794, 399950, 410656, or 410752.
- a target region is nucleotides 595-622 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 595-622 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 11, 183, 184, 185, 186, 187, 188, or 189. In certain such embodiments, an antisense compound targeted to nucleotides 595-622 of SEQ ID
- NO: 1 is selected from ISIS NOs: 406007, 410529, 410574, 410647, 410530, 410575, 410648, 410531, 410576, 410649, 395155, 399877, 410650, 410532, 410577, 410651, 406008, 410578, 410652, 410533, 410579, or 410653.
- a target region is nucleotides 600-626 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 600-626 of SEQ ID NO:
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 11, 12, 87, 188, 189, 190, 191, or 192.
- an antisense compound targeted to nucleotides 600-626 of SEQ ID NO: 1 is selected from ISIS NOs: 395155, 399877, 410650, 410532, 410577, 410651, 406008, 410578, 410652, 410533, 410579, 410653, 406009, 410580, 410654, 410534, 410581, 410655, 399794, 399950, 410656, 410535, 410582, or 410657.
- a target region is nucleotides 600-639 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 600-639 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 11, 12, 13, 14, 187, 188, 189, 190, 191, 192, 193, 194, 195, or 196.
- an antisense compound targeted to nucleotides 600-639 of SEQ ID NO: 1 is selected from ISIS NOs: 395155, 399877, 410650,
- a target region is nucleotides 600-670 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 600-670 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 11, 12, 13, 14, 15, 16, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199.
- an antisense compound targeted to nucleotides 600-670 of SEQ ID NO: 1 is selected from ISIS NOs: 395155, 399877, 410650, 410532, 410577, 410651, 406008, 410578, 410652, 410533, 410579, 410653, 406009,
- a target region is nucleotides 601-628 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 601-628 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 12, 187, 188, 189, 190, 191, 192 or 193.
- an antisense compound targeted to nucleotides 601-628 of SEQ ID NO: 1 is selected from ISIS NOs: 410532, 410577, 410651, 406008, 410578, 410652, 410533, 410579, 410653, 406009, 410580, 410654, 410534, 410581, 410655, 399794, 399950, 410656, 410535, 410582, 410657, or 406010.
- a target region is nucleotides 602-628 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 602-628 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 12, 188, 189, 190, 191, 192 or 193.
- an antisense compound targeted to nucleotides 602-628 of SEQ ID NO: 1 is selected from ISIS NOs: 406008, 410578, 410652, 410533, 410579, 410653, 406009, 410580, 410654, 410534, 410581, 410655, 399794, 399950, 410656, 410535, 410582, 410657, or 406010.
- a target region is nucleotides 603-630 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 603-630 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 12, 189, 190, 191, 192, 193 or 194.
- an antisense compound targeted to nucleotides 603-630 of SEQ ID NO: 1 is selected from ISIS NOs: 410533, 410579, 410653, 406009, 410580, 410654, 410534, 410581, 410655, 399794, 399950, 410656, 410535, 410582, 410657, 406010, or 406011.
- a target region is nucleotides 611-636 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 611-636 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 13, 194, 195 or 196.
- an antisense compound targeted to nucleotides 611-636 of SEQ ID NO: 1 is selected from ISIS NOs: 406011, 406012, 399795, 399951, or 406013.
- a target region is nucleotides 620-647 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 620-647 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 14 or 197.
- an antisense compound targeted to nucleotides 620-647 of SEQ ID NO: 1 is selected from ISIS NOs: 395156, 399878, or 410749.
- a target region is nucleotides 638-665 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 638-665 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 15 or 198.
- an antisense compound targeted to nucleotides 638-665 of SEQ ID NO: 1 is selected from ISIS
- a target region is nucleotides 648-674 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 648-674 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 16, 199, 200, or 201.
- an antisense compound targeted to nucleotides 648-674 of SEQ ID NO: 1 is selected from ISIS NOs: 406014, 399796, 399952, 406015, or 406016.
- a target region is nucleotides 657-684 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 657-684 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 202, 203, 204, 205, or 206.
- an antisense compound targeted to nucleotides 657-684 of SEQ ID NO: 1 is selected from ISIS NOs: 410730, 406017, 406018, 406019, or 406020.
- a target region is nucleotides 705-743 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 705-743 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 17 or 209.
- an antisense compound targeted to nucleotides 705-743 of SEQ ID NO: 1 is selected from ISIS NOs: 395158, 399880, or 410752.
- a target region is nucleotides 782-810 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 782-810 of SEQ ID NO : 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 18, 210, 211, 212, 213, or 214.
- an antisense compound targeted to nucleotides 782-810 of SEQ ID NO: 1 is selected from ISIS NOs: 406021, 406022, 395159, 399881, 406023, 406024, or 410732.
- a target region is nucleotides 821-859 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 821-859 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 19, 20, 215, 216 or 217.
- an antisense compound targeted to nucleotides 821-859 of SEQ ID NO: 1 is selected from ISIS NOs: 410753, 406025, 395160, 399882, 406026, 399797, or 399953.
- a target region is nucleotides 835-859 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 835-859 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 19, 20 or 217.
- an antisense compound targeted to nucleotides 835-859 of SEQ ID NO: 1 is selected from ISIS NOs: 395160, 399882, 406026, 399797, or 399953.
- a target region is nucleotides 835-917 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 835-917 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 19, 20 ,21, 22, 23, 24, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232 or 233.
- an antisense compound targeted to nucleotides 835-917 of SEQ ID NO: 1 is selected from ISIS NOs: 395160, 399882, 406026, 399797, 399953, 395161, 399883, 405869, 405870, 405871, 405872, 399798, 399954, 405873, 405874, 405875, 405876, 406027, 406028, 406029, 399799, 399955, 406030, 406031, 410733, 406032, 395162, 399884, or 410754.
- a target region is nucleotides 835-942 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 835-942 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 19, 20 ,21, 22, 23, 24, 25, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, or 233.
- an antisense compound targeted to nucleotides 835-942 of SEQ ID NO: 1 is selected from ISIS NOs: 395160, 399882, 406026, 399797, 399953, 395161, 399883, 405869, 405870, 405871,
- a target region is nucleotides 860-887 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 860-887 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 21, 22, 218, 219, 220, 221, 222 or 223.
- an antisense compound targeted to nucleotides 860-887 of SEQ ID NO: 1 is selected from ISIS NOs: 395161, 399883, 405869, 405870, 405871, 405872, 399798, 399954, 405873, or 405874.
- a target region is nucleotides 860-899 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 860-899 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 21, 22, 23, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227 or 228.
- an antisense compound targeted to nucleotides 860-899 of SEQ ID NO: 1 is selected from ISIS NOs: 395161, 399883, 405869, 405870, 405871, 405872, 399798, 399954, 405873, 405874, 405875, 405876, 406027, 406028, 406029, 399799, or 399955.
- a target region is nucleotides 860-909 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 860-909 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 21, 22, 23, 24, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231 or 232.
- an antisense compound targeted to nucleotides 860-909 of SEQ ID NO: 1 is selected from ISIS NOs: 395161, 399883, 405869, 405870, 405871, 405872, 399798, 399954, 405873, 405874, 405875, 405876, 406027, 406028, 406029, 399799, 399955, 406030, 406031, 410733, 406032, 395162, or 399884.
- a target region is nucleotides 860-917 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 860-917 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 21, 22, 23, 24, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, or 233.
- an antisense compound targeted to nucleotides 860-917 of SEQ ID NO : 1 is selected from ISIS NOs : 395161 , 399883, 405869, 405870, 405871, 405872, 399798, 399954, 405873, 405874, 405875, 405876, 406027, 406028, 406029, 399799, 399955, 406030, 406031, 410733, 406032, 395162, 399884, or 410754.
- a target region is nucleotides 869-895 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 869-895 of SEQ ID NO:
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 224, 225, 226, or 227.
- an antisense compound targeted to nucleotides 869-895 of SEQ ID NO: 1 is selected from ISIS NOs: 405875, 405876, 406027, or 406028.
- a target region is nucleotides 878-905 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 878-905 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 23, 228, 229, 230, or 231.
- an antisense compound targeted to nucleotides 878-905 of SEQ ID NO: 1 is selected from ISIS NOs: 406029, 399799, 399955, 406030, 406031, or 410733.
- a target region is nucleotides 888-909 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 888-909 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 24 or 232.
- an antisense compound targeted to nucleotides 888-909 of SEQ ID NO: 1 is selected from ISIS NOs: 406032, 395162, or 399884.
- a target region is nucleotides 923-952 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 923-952 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 25 or 234.
- an antisense compound targeted to nucleotides 923-952 of SEQ ID NO: 1 is selected from ISIS NOs: 395163, 399885, or 410755.
- a target region is nucleotides 960-1034 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 960-1034 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 26, 27, 28, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, or 256.
- an antisense compound targeted to nucleotides 960-1034 of SEQ ID NO: 1 is selected from ISIS NOs: 410756, 405526, 405604, 406033, 395164, 399886, 406034, 399800, 399956, 406035, 410757, 406036, 406037, 410536, 410583, 410658, 410537, 410584, 410659, 406038, 410585, 410660, 405877, 410586, 410661, 405878, 410587, 410662, 405879, 410588, 410663, 405880, or 410758.
- a target region is nucleotides 960-1173 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 960-1173 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 26, 27, 28, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260,
- an antisense compound targeted to nucleotides 960-1173 of SEQ ID NO: 1 is selected from ISIS NOs: 410756, 405526, 405604, 406033, 395164, 399886, 406034, 399800, 399956, 406035, 410757, 406036, 406037, 410536, 410583, 410658, 410537, 410584, 410659, 406038, 410585, 410660, 405877, 410586, 410661, 405878, 410587, 410662, 405879, 410588, 410663, 405880, or 410763.
- a target region is nucleotides 960-986 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 960-986 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 235, 236, or 237.
- an antisense compound targeted to nucleotides 960-986 of SEQ ID NO: 1 is selected from ISIS NOs: 410756, 405526, 405604, or 406033.
- a target region is nucleotides 967-991 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 967-991 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 237 or 238.
- an antisense compound targeted to nucleotides 967-991 of SEQ ID NO: 1 is selected from ISIS NOs: 406033 or 406034.
- a target region is nucleotides 970-1023 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 970-1023 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 26, 27, 28, 238, 239, 240, 241 , 242, 243, 244, 245, 246, 247, 248, or 249.
- an antisense compound targeted to nucleotides 970-1023 of SEQ ID NO: 1 is selected from ISIS NOs: 395164, 399886, 406034, 399800, 399956, 406035, 410757, 406036, 406037, 410536, 410583, 410658, 410537, 410584, 410659, 406038, 410585, 410660, 405877, 410586, 410661, 405878, 410587, 410662, 405879, 410588, 410663, 405880, 410589, 410664, 395165, 399887, or 410665.
- a target region is nucleotides 970-1064 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 970-1064 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 26, 27, 28, 29, 30, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 149, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, or
- an antisense compound targeted to nucleotides 970-1064 of SEQ ID NO: 1 is selected from ISIS NOs: 395164, 399886, 406034, 399800, 399956, 406035, 410757, 406036, 406037, 410536, 410583, 410658, 410537, 410584, 410659, 406038, 410585, 410660, 405877, 410586, 410661, 405878, 410587, 410662, 405879, 410588, 410663, 405880, 410589, 410664, 395165, 399887, or 399957.
- a target region is nucleotides 970-1117 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 970-1117 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 26, 27, 28, 29, 30, 31, 32, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 149, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, or 266.
- an antisense compound targeted to nucleotides 970-1117 of SEQ ID NO: 1 is selected from ISIS NOs: 395164, 399886, 406034, 399800, 399956, 406035, 410757, 406036, 406037, 410536, 410583, 410658, 410537, 410584, 410659, 406038, 410585, 410660, 405877, 410586, 410661, 405878, 410587, 410662, 405879, 410588, 410663, 405880, 410589, 410664, 395165, 399887, or 399890.
- a target region is nucleotides 970-996 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 970-996 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 26, 27, or 238.
- an antisense compound targeted to nucleotides 970-996 of SEQ ID NO: 1 is selected from ISIS NOs: 395164, 399886, 406034, 399800, 399956, or 406035.
- a target region is nucleotides 977-1004 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 977-1004 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 239 or 240.
- an antisense compound targeted to nucleotides 977-1004 of SEQ ID NO: 1 is selected from ISIS NOs: 406035 or 410757.
- a target region is nucleotides 985-1011 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 985-1011 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 240, 241, or 242.
- an antisense compound targeted to nucleotides 985-1011 of SEQ ID NO: 1 is selected from ISIS NOs: 410757, 406036, or 406037.
- a target region is nucleotides 989-1016 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 989-1016 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 241, 242, or 243.
- an antisense compound targeted to nucleotides 989-1016 of SEQ ID NO: 1 is selected from ISIS NOs: 406036, 406037, 410536, 410583, or 410658.
- a target region is nucleotides 992- 1019 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 992-1019 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 242, 243, 244, 245, or 246.
- an antisense compound targeted to nucleotides 992-1019 of SEQ ID NO: 1 is selected from ISIS NOs: 406037, 410536, 410583, 410658, 410537, 410584, 410659, 406038, 410585, 410660, 405877, 410586, or 410661.
- a target region is nucleotides 997-1024 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 997-1024 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 243, 244, 245, 246, 247, 248, 249, or 250.
- an antisense compound targeted to nucleotides 997-1024 of SEQ ID NO: 1 is selected from ISIS NOs: 410536, 410583, 410658, 410537, 410584, 410659, 406038, 410585, 410660, 405877, 410586, 410661, 405878, 410587, 410662, 405879, 410588, 410663, 405880, 410589, 410664, 395165, 399887, 409126, 410665, 405881, 410590, or 410666.
- a target region is nucleotides 997-1024 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 997-1024 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 243, 244, 245, 246, 247, 248, 249, or 250.
- an antisense compound targeted to nucleotides 997-1024 of SEQ ID NO: 1 is selected from ISIS NOs: 410536, 410583, 410658, 410537, 410584, 410659, 406038, 410585, 410660, 405877, 410586, 410661, 405878, 410587, 410662, 405879, 410588, 410663, 405880, 410589, 410664, 395165, 399887, 409126, 410665, 405881, 410590, or 410666.
- a target region is nucleotides 998-1025 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 998-1025 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 244, 245, 246, 247, 248, 249, 250, or 251.
- an antisense compound targeted to nucleotides 998-1025 of SEQ ID NO: 1 is selected from ISIS NOs: 410537, 410584, 410659, 406038, 410585, 410660, 405877, 410586, 410661, 405878, 410587, 410662, 405879, 410588, 410663, 405880, 410589, 410664, 395165, 399887, 410665, 405881, 410590, 410666, 405882, 410591, or 410667.
- a target region is nucleotides 999-1026 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 999-1026 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 245, 246, 247, 248, 249, 250, 251, or 252.
- an antisense compound targeted to nucleotides 999-1026 of SEQ ID NO: 1 is selected from ISIS NOs: 406038, 410585, 410660, 405877, 410586, 410661, 405878, 410587, 410662, 405879, 410588, 410663, 405880, 410589, 410664, 395165, 399887, 410665, 405881, 410590, 410666, 405882, 410591, 410667, 405833, 410592, or 410668.
- a target region is nucleotides 1000-1027 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1000-1027 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 246, 247, 248, 249, 250, 251,
- 1027 of SEQ ID NO: 1 is selected from ISIS NOs: 405877, 410586, 410661, 405878, 410587, 410662, 405879, 410588, 410663, 405880, 410589, 410664, 395165, 399887, 410665, 405881,
- a target region is nucleotides 1001-1028 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1001-1028 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 247, 248, 249, 250, 251, 252,
- 1028 of SEQ ID NO: 1 is selected from ISIS NOs: 405878, 410587, 410662, 405879, 410588, 410663, 405880, 410589, 410664, 395165, 399887, 410665, 405881, 410590, 410666, 405882, 410591, 410667, 405833, 410592, 410668, 405884, 410593, 410669, 410538, 410594, or
- a target region is nucleotides 1002-1021 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1002-1021 of SEQ ID NO: 1.
- an antisense compound targeted to nucleotides 1002-1021 of SEQ ID NO: 1 is ISIS NO: 405879.
- a target region is nucleotides 1002-1029 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1002-1029 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 248, 249, 250, 251, 252, 253,
- an antisense compound targeted to nucleotides 1002- 1029 of SEQ ID NO: 1 is selected from ISIS NOs: 405879, 410588, 410663, 405880, 410589,
- a target region is nucleotides 1003-1029 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1003-1029 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 249, 250, 251,252, 253, 254, or
- an antisense compound targeted to nucleotides 1003-1029 of SEQ ID NO: 1 is selected from ISIS NOs: 405880, 410589, 410664, 395165, 399887, 409126, 410665, 405881, 410590, 410666, 405882, 410591, 410667, 405883, 410592, 410668, 405884,
- a target region is nucleotides 1004-1029 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1004-1029 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 250, 251,252, 253, 254, or 255.
- an antisense compound targeted to nucleotides 1004-1029 of SEQ ID NO: 1 is selected from ISIS NOs: 395165, 399887, 409126, 410665, 405881, 410590, 410666, 405882, 410591, 410667, 405883, 410592, 410668, 405884, 410593, 410669, 410538, 410594, 410670, 410539, 410595, or 410671.
- a target region is nucleotides 1005-1029 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1005-1029 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 250, 251,252, 253, 254, or 255.
- an antisense compound targeted to nucleotides 1005-1029 of SEQ ID NO: 1 is selected from ISIS NOs: 410665, 405881, 410590, 410666, 405882, 410591, 410667, 405883, 410592, 410668, 405884, 410593, 410669, 410538, 410594, 410670, 410539, 410595, or 410671.
- a target region is nucleotides 1006-1029 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1006-1029 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 251,252, 253, 254, or 255.
- an antisense compound targeted to nucleotides 1006-1029 of SEQ ID NO: 1 is selected from ISIS NOs: 405882, 410591, 410667, 405883, 410592, 410668, 405884, 410593, 410669, 410538, 410594, 410670, 410539, 410595, or 410671.
- a target region is nucleotides 1007-1034 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1007-1034 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 252, 253, 254, 255, or 256.
- an antisense compound targeted to nucleotides 1007-1034 of SEQ ID NO: 1 is selected from ISIS NOs: 405883, 410592, 410668, 405884, 410593, 410669, 410538, 410594, 410670, 410539, 410595, 410671, or 410758.
- a target region is nucleotides 1036-1061 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1036-1061 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 29, 257, 258, or 259.
- an antisense compound targeted to nucleotides 1036-1061 of SEQ ID NO: 1 is selected from ISIS NOs: 406039, 406040, 395166, 399888, or 406041.
- a target region is nucleotides 1045-1072 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1045-1072 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 30, 260, 261, or 262.
- an antisense compound targeted to nucleotides 1045- 1072 of SEQ ID NO: 1 is selected from ISIS NOs: 399801, 399957, 406042, 406043, or 406044.
- a target region is nucleotides 1076-1096 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1076-1096 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 31 or 264.
- an antisense compound targeted to nucleotides 1076-1096 of SEQ ID NO: 1 is selected from ISIS NOs: 408642, 395167, or 399889.
- a target region is nucleotides 1088-1115 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1088-1115 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 265 or 266.
- an antisense compound targeted to nucleotides 1088-1115 of SEQ ID NO: 1 is selected from ISIS NOs: 410760 or 406045.
- a target region is nucleotides 1098-1123 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1098-1123 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 32, 267, 268, or 269.
- an antisense compound targeted to nucleotides 1098-1123 of SEQ ID NO: 1 is selected from ISIS NOs: 395168, 399890, 405909, 405910, or 405911.
- a target region is nucleotides 1200-1251 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1200- 1251 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 33, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, or 285.
- an antisense compound targeted to nucleotides 1200-1251 of SEQ ID NO: 1 is selected from ISIS NOs: 410764, 395169, 399891, 405913, 405914, 405915, 405916, 410734, 405917, 405918, 405919, 405920, 405921, or 405922.
- a target region is nucleotides 1210-1237 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1210-1237 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 33, 275, 276, 277, or 278.
- an antisense compound targeted to nucleotides 1210-1237 of SEQ ID NO: 1 is selected from ISIS NOs: 395169, 399891, 405913, 405914, 405915, or 405916.
- a target region is nucleotides 1219- 1245 of SEQ ID NO : 1.
- an antisense compound is targeted to nucleotides 1219-1245 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 279, 280, 281 or 282.
- an antisense compound targeted to nucleotides 1219-1245 of SEQ ID NO: 1 is selected from ISIS NOs: 410734, 405917, 405918, or 405919.
- a target region is nucleotides 1228-1251 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1228-1251 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 283, 284, or 285.
- an antisense compound targeted to nucleotides 1228-1251 of SEQ ID NO: 1 is selected from ISIS NOs: 405920, 405921, or 405922.
- a target region is nucleotides 1273-1444 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1273-1444 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 34, 35, 36, 37, 38, 39, 40, 41, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307,308, 309, 310, 311, 312, 313, 314, 315, 316, 316, and 318.
- an antisense compound targeted to nucleotides 1273-1444 of SEQ ID NO: 1 is selected from ISIS NOs: 410765, 410766, 405923, 395170, 399892, 410767, 405924, 410735, 405925, 405926, 395171, 399893, 405927, 395172, 399894, 405928, 399802, 399958, 405929, 395173, 399895, 405930, 405931, 405932, 405933, 405934, 399803, 399959, 405935, 410736, 405936, 395174, or 410769.
- a target region is nucleotides 1295-1316 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1295- 1316 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 149 or 288.
- an antisense compound targeted to nucleotides 1295-1316 of SEQ ID NO: 1 is selected from ISIS NOs: 405923, 395170, or 399892.
- a target region is nucleotides 1318-1345 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1318-1345 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 34, 290, 291, 292 or 293.
- an antisense compound targeted to nucleotides 1318-1345 of SEQ ID NO: 1 is selected from ISIS NOs: 405924, 410735, 405925, 405926, 395171, or 399893.
- a target region is nucleotides 1328-1354 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1328-1354 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 35, 128, 294 or 295.
- an antisense compound targeted to nucleotides 1328-1354 of SEQ ID NO: 1 is selected from ISIS NOs: 405927, 395172, 399894, 405928, 399802, or 399958.
- a target region is nucleotides 1337-1361 of SEQ ID NO : 1.
- an antisense compound is targeted to nucleotides 1337-1361 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 36, 296, or 297.
- an antisense compound targeted to nucleotides 1337-1361 of SEQ ID NO: 1 is selected from ISIS NOs: 405929, 395173, 399895, or 405930.
- a target region is nucleotides 1344-1371 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1344-1371 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 37, 298, 299, 300, or 301.
- an antisense compound targeted to nucleotides 1344-1371 of SEQ ID NO: 1 is selected from ISIS NOs: 405931, 405932, 405933, 405934, 399803, or 399959.
- a target region is nucleotides 1354-1377 of SEQ ID NO : 1.
- an antisense compound is targeted to nucleotides 1354-1377 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 302, 303, or 304.
- an antisense compound targeted to nucleotides 1354-1377 of SEQ ID NO: 1 is selected from ISIS NOs: 405935, 410736, or 405936.
- a target region is nucleotides 1380-1406 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1380-1406 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 305 or 306.
- an antisense compound targeted to nucleotides 1380-1406 of SEQ ID NO: 1 is selected from ISIS NOs: 410768 or 405937.
- a target region is nucleotides 1389-1416 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1389-1416 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 39, 307, 308, 309 or 310.
- an antisense compound targeted to nucleotides 1389-1416 of SEQ ID NO: 1 is selected from ISIS NOs: 395175, 399897, 405938, 405939, 405940, or 405941.
- a target region is nucleotides 1400-1426 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1400-1426 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 40, 311, 312, 313, or 314.
- an antisense compound targeted to nucleotides 1400-1426 of SEQ ID NO: 1 is selected from ISIS NOs: 399804, 399960, 405942, 405943, 410737, or 405944.
- a target region is nucleotides 1409-1434 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1409-1434 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 41, 315, 316, or 317.
- an antisense compound targeted to nucleotides 1409-1434 of SEQ ID NO: 1 is selected from ISIS NOs: 405945, 399805, 399961, 405946, or 405947.
- a target region is nucleotides 1465-1491 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1465-1491 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 42, 101, 319, or 320.
- an antisense compound targeted to nucleotides 1465-1491 of SEQ ID NO: 1 is selected from ISIS NOs: 395176, 399898, 405948, 399806, 399962, or 405949.
- a target region is nucleotides 1465-1602 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1465-1602 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 42, 43, 44, 45, 46, 47, 48, 49, 50,
- an antisense compound targeted to nucleotides 1465-1602 of SEQ ID NO: 1 is selected from ISIS NOs: 395176, 399898, 405948, 399806, 399962, 405949, 405950, 405951, 399807, 399963, 405952, 410738, 405953, 405954, 410770, 405955, 405956, 405957, 405958, 405959, 405960, 405961, 399808, 399964, 405962, 410739, 405963, 395177, 399899, 405964, 399809, 399965, or 399969.
- a target region is nucleotides 1474-1499 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1474-1499 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 43, 321, 322, or 323.
- an antisense compound targeted to nucleotides 1474-1499 of SEQ ID NO: 1 is selected from ISIS NOs: 405950, 405951, 399807, 399963, or 405952.
- a target region is nucleotides 1482-1519 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1482-1519 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 324, 325, 326, or 327.
- an antisense compound targeted to nucleotides 1482-1519 of SEQ ID NO: 1 is selected from ISIS NOs: 410738, 405953, 405954, or 410770.
- a target region is nucleotides 1513-1540 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1513-1540 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 328, 329, 330, 331, or 332.
- an antisense compound targeted to nucleotides 1513-1540 of SEQ ID NO: 1 is selected from ISIS NOs: 405955, 405956, 405957, 405958, or 405959.
- a target region is nucleotides 1523-1549 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1523-1549 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 44, 333, 334, 335, or 336.
- an antisense compound targeted to nucleotides 1523-1549 of SEQ ID NO: 1 is selected from ISIS NOs: 405960, 405961, 399808, 399964, 405962, or 410739.
- a target region is nucleotides 1526-1602 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1526-1602 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 44, 45, 46, 47, 48, 49, 50, 51, 87, 335, 336, 337, 338, 339, 340, 341, 342, 343, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, or 359.
- an antisense compound targeted to nucleotides 1526-1602 of SEQ ID NO: 1 is selected from ISIS NOs: 399808, 399964, 405962, 410739, 405963, 395177, 399899, 405964, 399809, 399965, 405965, 405966, 399810, 399966, 405967, 405968, 399811, 399967, 405969, 405970, 410740, 405885, 405886, 405887, 410596, 410672, 405888, 410597, 410673, 399812, 399968, 410674, or 399969.
- a target region is nucleotides 1526-1624 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1526-1624 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 44, 45, 46, 47, 48, 49, 50, 51, 87, 119, 335, 336, 337, 338, 339, 340, 341, 342, 343, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, or 359.
- an antisense compound targeted to nucleotides 1526-1624 of SEQ ID NO: 1 is selected from ISIS NOs: 399808, 399964, 405962, 410739, 405963, 395177, 399899, 405964, 399809, 399965, 405965, 405966, 399810, 399966, 405967, 405968, 399811, 399967, 405969, 405970, 410740, 405885, 405886, 405887, 410596, 410672, 405888, 410597, 410673, 399812, 399968, 410674, or 399902.
- a target region is nucleotides 1532-1558 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1532-1558 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 45, 46, 337, or 338.
- an antisense compound targeted to nucleotides 1532-1558 of SEQ ID NO: 1 is selected from ISIS NOs: 405963, 395177, 399899, 405964, 399809, or 399965.
- a target region is nucleotides 1541-1568 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1541-1568 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 47, 340, 341, or 342.
- an antisense compound targeted to nucleotides 1541-1568 of SEQ ID NO: 1 is selected from ISIS NOs: 405965, 405966, 399810, 399966, 405967, or 405968.
- a target region is nucleotides 1552-1579 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1552-1579 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 48, 343, 344, 345, or 346.
- an antisense compound targeted to nucleotides 1552-1579 of SEQ ID NO: 1 is selected from ISIS NOs: 399811, 399967, 405969, 405970, 410740, or 405885.
- a target region is nucleotides 1560-1587 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1560-1587 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 49, 346, 347 ,348 ,349, 350, 351, 352, or 353.
- an antisense compound targeted to nucleotides 1560- 1587 of SEQ ID NO: 1 is selected from ISIS NOs: 405885, 405886, 405887, 410596, 410672, 405888, 410597, 410673, 399812, 399968, 410674, 405889, 410598, 410675, 405890, 410599, 410676, 405891, 410600, 410677, 405892, 410601, or 410678.
- a target region is nucleotides 1561-1589 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1561-1589 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 49, 50, 346, 347 ,348 ,349, 350, 351, 352, 353, or 354.
- an antisense compound targeted to nucleotides 1561-1589 of SEQ ID NO: 1 is selected from ISIS NOs: 405886, 405887, 410596, 410672, 405888, 410597, 410673, 399812, 399968, 410674, 405889, 410598, 410675, 405890, 410599, 410676, 405891, 410600, 410677, 405892, 410601, 410678, 395178, 399900, 405557, 410679, 408653, 410602, or 410680.
- a target region is nucleotides 1564-1591 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1564-1591 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 49, 50, 350, 351, 352, 353, 354, 355, or 356.
- an antisense compound targeted to nucleotides 1564- 1591 of SEQ ID NO: 1 is selected from ISIS NOs: 399812, 399968, 410674, 405889, 410598, 410675, 405890, 410599, 410676, 405891, 410600, 410677, 405892, 410601, 410678, 395178, 399900, 405557, 410679, 408653, 410602, 410680, 405971, 410603, 410681, 410540, 410604, or 410682.
- a target region is nucleotides 1565-1592 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1565-1592 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 50, 350, 351, 352, 353, 354, 355,
- an antisense compound targeted to nucleotides 1565- 1592 of SEQ ID NO: 1 is selected from ISIS NOs: 405889, 410598, 410675, 405890, 410599, 410676, 405891, 410600, 410677, 405892, 410601, 410678, 395178, 399900, 405557, 410679, 408653, 410602, 410680, 405971, 410603, 410681, 410540, 410604, 410682, or 405972.
- a target region is nucleotides 1566-1592 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1566-1592 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 50, 351, 352, 353, 354, 355, 356, or 357.
- an antisense compound targeted to nucleotides 1566-1592 of SEQ ID NO: 1 is selected from ISIS NOs: 405890, 410599, 410676, 405891, 410600, 410677, 405892, 410601, 410678, 395178, 399900, 405557, 410679, 408653, 410602, 410680, 405971,
- a target region is nucleotides 1567-1592 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1567- 1592 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 50, 352, 353, 354, 355, 356, or
- an antisense compound targeted to nucleotides 1567-1592 of SEQ ID NO: 1 is selected from ISIS NOs: 405891, 410600, 410677, 405892, 410601, 410678, 395178, 399900, 405557, 410679, 408653, 410602, 410680, 405971, 410603, 410681, 410540,
- a target region is nucleotides 1570-1597 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1570-1597 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 354, 355, 356, 357 or 358.
- an antisense compound targeted to nucleotides 1570-1597 of SEQ ID NO: 1 is selected from ISIS NOs: 408653, 410602, 410680, 405971, 410603, 410681, 410540, 410604, 410682, 405972 or 405973.
- a target region is nucleotides 1571-1599 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1571-1599 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 87, 356, 357, 358, or 359.
- an antisense compound targeted to nucleotides 1571-1599 of SEQ ID NO: 1 is selected from ISIS NOs: 405971, 410603, 410681, 410540, 410604, 410682, 405972, 395179, 399901, 405973, or 405974.
- a target region is nucleotides 1605-1706 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1605-1706 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 52, 53, 54, 119, 360, 361, 362, 363,
- an antisense compound targeted to nucleotides 1605-1706 of SEQ ID NO: 1 is selected from ISIS NOs: 395180, 399902, 410771, 395181, 399903, 405975, 399814, 399970, 405976, 405977, 410772, 405978, 395182, 399904, 405979, 405980, 405981, 410741, 405982, or 405983.
- a target region is nucleotides 1628-1706 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1628-1706 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 52, 53, 54, 360, 361, 362, 363, 364,
- an antisense compound targeted to nucleotides 1628-1706 of SEQ ID NO: 1 is selected from ISIS NOs: 410771, 395181, 399903, 405975, 399814, 399970, 405976, 405977, 410772, 405978, 395182, 399904, 405979, 405980, 405981, 410741, 405982, or 405983.
- a target region is nucleotides 1640-1666 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1640-1666 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 52, 53, 361, or 362.
- an antisense compound targeted to nucleotides 1640-1666 of SEQ ID NO: 1 is selected from ISIS NOs: 395181, 399903, 405975, 399814, 399970, or 405976.
- a target region is nucleotides 1672-1698 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1672-1698 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 54, 365, 366, or 367.
- an antisense compound targeted to nucleotides 1672-1698 of SEQ ID NO: 1 is selected from ISIS NOs: 405978, 395182, 399904, 405979, or 405980.
- a target region is nucleotides 1681-1706 of SEQ ID NO : 1.
- an antisense compound is targeted to nucleotides 1681-1706 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 368, 369, 370, or 371.
- an antisense compound targeted to nucleotides 1681-1706 of SEQ ID NO: 1 is selected from ISIS NOs: 405981, 410741, 405982, or 405983.
- a target region is nucleotides 1735-1761 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1735-1761 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 55, 372, 373, or 374.
- an antisense compound targeted to nucleotides 1735-1761 of SEQ ID NO: 1 is selected from ISIS NOs: 405984, 405564, 405641, 405985, 399815, 399971, or 405986.
- a target region is nucleotides 1735-1765 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1735-1765 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 55, 56, 372, 373, 374, or 375.
- an antisense compound targeted to nucleotides 1735-1765 of SEQ ID NO: 1 is selected from ISIS NOs: 405984, 405564, 405641, 405985, 399815, 399971, 405986, 405987, 399816 or 399972.
- a target region is nucleotides 1740- 1765 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1740-1765 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 55, 56, 374, or 375.
- an antisense compound targeted to nucleotides 1740-1765 of SEQ ID NO: 1 is selected from ISIS NOs: 399815, 399971, 405986, 405987, 399816, or 399972.
- a target region is nucleotides 1849-1876 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1849-1876 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 376, 377, 378, 379, 380, 381, 382, 383, or 384.
- 1876 of SEQ ID NO: 1 is selected from ISIS NOs: 410541, 410605, 410683, 410542, 410606, 410684, 410543, 410607, 410685, 410544, 410608, 410686, 410545, 410609, 410687, 405988, 410610, 410688, 410546, 410611, 410689, 405989, 410612, 410690, 410547, 410613, or 410691.
- a target region is nucleotides 1849-1879 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1849-1879 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 58, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, or 386.
- an antisense compound targeted to nucleotides 1849-1879 of SEQ ID NO: 1 is selected from ISIS NOs: 410541, 410605, 410683, 410542, 410606, 410684, 410543, 410607, 410685, 410544, 410608, 410686, 410545, 410609, 410687, 405988, 410610, 410688, 410546, 410611, 410689, 405989, 410612, 410690, 410547, 410613, 395184, 410691, 399906, 410692, 410548, 410614, or 405990.
- a target region is nucleotides 1850-1877 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1850-1877 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 58, 377, 378, 379, 380, 381, 382, 383 or 384.
- an antisense compound targeted to nucleotides 1850- 1877 of SEQ ID NO: 1 is selected from ISIS NOs: 410542, 410606, 410684, 410543, 410607, 410685, 410544, 410608, 410686, 410545, 410609, 410687, 405988, 410610, 410688, 410546,
- a target region is nucleotides 1851-1877 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1851-1877 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 58, 378, 379, 380, 381, 382, 383, or 384.
- an antisense compound targeted to nucleotides 1851 -1877 of SEQ ID NO: 1 is selected from ISIS NOs: 410543, 410607, 410685, 410544, 410608, 410686, 410545, 410609, 410687, 405988, 410610, 410688, 410546, 410611, 410689, 405989, 410612, 410690, 410547, 410613, 395184, 410691, 399906, or 410692.
- a target region is nucleotides 1852-1878 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1852-1878 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 58, 379, 380, 381, 382, 383, 384, or 385.
- an antisense compound targeted to nucleotides 1852-1878 of SEQ ID NO: 1 is selected from ISIS NOs: 410544, 410608, 410686, 410545, 410609, 410687, 405988, 410610, 410688, 410546, 410611, 410689, 405989, 410612, 410690, 410547, 410613, 395184, 410691, 399906, 410692, 410548, 410614, or 410693.
- a target region is nucleotides 1852-1879 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1852-1879 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 58, 379, 380, 381, 382, 383, 384,
- an antisense compound targeted to nucleotides 1852- 1879 of SEQ ID NO: 1 is selected from ISIS NOs: 410544, 410608, 410686, 410545, 410609,
- a target region is nucleotides 1853-1879 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1853-1879 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 58, 380, 381, 382, 383, 384, 385 or
- an antisense compound targeted to nucleotides 1853-1879 of SEQ ID NO: 1 is selected from ISIS NOs: 410545, 410609, 410687, 405988, 410610, 410688, 410546, 410611, 410689, 405989, 410612, 410690, 410547, 410613, 395184, 410691, 399906, 410692, 410548, 410614, 410693, or 405990.
- a target region is nucleotides 1854-1879 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1854-1879 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 58, 381, 382, 383, 384, 385, or 386.
- an antisense compound targeted to nucleotides 1854-1879 of SEQ ID NO: 1 is selected from ISIS NOs: 405988, 410610, 410688, 410546, 410611, 410689, 405989, 410612, 410690, 410547, 410613, 395184, 410691, 399906, 410692, 410548, 410614, 410693, or 405990.
- a target region is nucleotides 1905-1955 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1905-1955 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, or 406.
- an antisense compound targeted to nucleotides 1905-1955 of SEQ ID NO: 1 is selected from ISIS NOs: 410773, 410549, 410615, 410694, 410550, 410616, 410695, 410551, 410617, 410696, 410552, 410618, 410697, 410553, 410619, 410698, 395185, 399907, 410699, 410554, 410620, 410700, 405991, 410621, 410701, 410555, 410622, 410702, 405992, 410623, 410703, 410556, or 410774.
- a target region is nucleotides 1915-1942 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1915-1942 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 388, 389, 390, 391, 392, 393,
- 1942 of SEQ ID NO: 1 is selected from ISIS NOs: 410549, 410615, 410694, 410550, 410616, 410695, 410551, 410617, 410696, 410552, 410618, 410697, 410553, 410619, 410698, 395185, 399907, 410699, 410554, 410620, 410700, 405991, 410621, 410701, 410555, 410622, or 410702.
- a target region is nucleotides 1916-1943 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1916-1943 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 389, 390, 391, 392, 393, 394, 395, or 396.
- 1943 of SEQ ID NO: 1 is selected from ISIS NOs: 410550, 410616, 410695, 410551, 410617, 410696, 410552, 410618, 410697, 410553, 410619, 410698, 395185, 399907, 410699, 410554, 410620, 410700, 405991, 410621, 410701, 410555, 410622, 410702, 405992, 410623, or 410703.
- a target region is nucleotides 1917-1944 of SEQ ID NO : 1.
- an antisense compound is targeted to nucleotides 1917-1944 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 390, 391, 392, 393, 394, 395, 396, or 397.
- an antisense compound targeted to nucleotides 1917- 1944 of SEQ ID NO: 1 is selected from ISIS NOs: 410551, 410617, 410696, 410552, 410618, 410697, 410553, 410619, 410698, 395185, 399907, 410699, 410554, 410620, 410700, 405991, 410621, 410701, 410555, 410622, 410702, 405992, 410623, 410703, 410556, 410624, or 410704.
- a target region is nucleotides 1918-1945 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1918-1945 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 391, 392, 393, 394, 395, 396, 397, or 398.
- an antisense compound targeted to nucleotides 1918- 1945 of SEQ ID NO: 1 is selected from ISIS NOs: 410552, 410618, 410697, 410553, 410619, 410698, 395185, 399907, 410699, 410554, 410620, 410700, 405991, 410621, 410701, 410555, 410622, 410702, 405992, 410623, 410703, 410556, 410624, 410704, 405993, 410625, or 410705.
- a target region is nucleotides 1919-1946 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1919-1946 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 392, 393, 394, 395, 396, 397, or 399.
- an antisense compound targeted to nucleotides 1919-1946 of SEQ ID NO: 1 is selected from ISIS NOs: 410553, 410619, 410698, 395185, 399907, 410699, 410554, 410620, 410700, 405991, 410621, 410701, 410555, 410622, 410702, 405992, 410623, 410703, 410556, 410624, 410704, 405993, 410625, 410705, 410557, 410626, or 410706.
- a target region is nucleotides 1920- 1939 of SEQ ID NO : 1.
- an antisense compound is targeted to nucleotides 1920-1939 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59.
- an antisense compound targeted to nucleotides 1920-1939 of SEQ ID NO: 1 is selected from ISIS NOs: 395185, 399907, or 410699.
- a target region is nucleotides 1920-1947 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1920-1947 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 393, 394, 395, 396, 397, 398, 399, or 400.
- 1947 of SEQ ID NO: 1 is selected from ISIS NOs: 395185, 399907, 410699, 410554, 410620, 410700, 405991, 410621, 410701, 410555, 410622, 410702, 405992, 410623, 410703, 410556, 410624, 410704, 405993, 410625, 410705, 410557, 410626, 410706, 405944, 410627, or 410707.
- a target region is nucleotides 1921-1948 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1921-1948 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 393, 394, 395, 396, 397, 398, 399,
- SEQ ID NO: 1 is selected from ISIS NOs: 410554, 410620, 410700, 405991, 410621,
- a target region is nucleotides 1922-1949 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1922-1949 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 394, 395, 396, 397, 398, 399, 400,
- 1949 of SEQ ID NO: 1 is selected from ISIS NOs: 405991, 410621, 410701, 410555, 410622,
- a target region is nucleotides 1923-1950 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1923-1950 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 395, 396, 397, 398, 399, 400, 401, 402, or 403. In certain such embodiments, an antisense compound targeted to nucleotides 1923-
- SEQ ID NO: 1 1950 of SEQ ID NO: 1 is selected from ISIS NOs: 410555, 410622, 410702, 405992, 410623,
- a target region is nucleotides 1924- 1951 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1924-1951 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 396, 397, 398, 399, 400, 401, 402,
- 1951 of SEQ ID NO: 1 is selected from ISIS NOs: 405992, 410623, 410703, 410556, 410624, 410704, 405993, 410625, 410705, 410557, 410626, 410706, 405994, 410627, 410707, 410558, 410628, 410708, 405995, 410629, 410709, 410559, 410630, 410710, 410560, 410631, or 410711.
- a target region is nucleotides 1925-1952 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1925-1952 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 397, 398, 399, 400, 401, 402, 403,
- 1952 of SEQ ID NO: 1 is selected from ISIS NOs: 410556, 410624, 410704, 405993, 410625, 410705, 410557, 410626, 410706, 405994, 410627, 410707, 410558, 410628, 410708, 405995, 410629, 410709, 410559, 410630, 410710, 410560, 410631, 410711, 410561, 410632, or 410712.
- a target region is nucleotides 1926-1952 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1926-1952 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 398, 399, 400, 401, 402, 403, 404, or 405.
- an antisense compound targeted to nucleotides 1926-1952 of SEQ ID NO: 1 is selected from ISIS NOs: 405993, 410625, 410705, 410557, 410626, 410706, 405994, 410627, 410707, 410558, 410628, 410708, 405995, 410629, 410709, 410559, 410630, 410710, 410560, 410631, 410711, 410561, 410632, or 410712.
- a target region is nucleotides 1927-1952 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1927-1952 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 399, 400, 401, 402, 403, 404, or
- an antisense compound targeted to nucleotides 1927-1952 of SEQ ID NO: 1 is selected from ISIS NOs: 410557, 410626, 410706, 405994, 410627, 410707, 410558, 410628, 410708, 405995, 410629, 410709, 410559, 410630, 410710, 410560, 410631, 410711, 410561, 410632, or 410712.
- a target region is nucleotides 1928-1955 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1928-1955 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 400, 401, 402, 403, 404, 405, or 406.
- an antisense compound targeted to nucleotides 1928-1955 of SEQ ID NO: 1 is selected from ISIS NOs: 405994, 410627, 410707, 410558, 410628, 410708, 405995, 410629, 410709, 410559, 410630, 410710, 410560, 410631, 410711, 410561, 410632, 410712, or 410774.
- a target region is nucleotides 1962-2059 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 1962-2059 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 407, 408, 409, or 410.
- an antisense compound targeted to nucleotides 1962-2059 of SEQ ID NO: 1 is selected from ISIS NOs: 410775, 410776, 410777, or 410778.
- a target region is nucleotides 2040-2126 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2040-2126 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 60, 61, 410, 411, 412, 413, 414, or 415.
- an antisense compound targeted to nucleotides 2040-2126 of SEQ ID NO: 1 is selected from ISIS Nos: 410778, 395186, 399908, 410713, 410562, 410633, 410714, 405996, 410634, 410715, 410563, 410635, 410716, 410564, 410636, 410717, 399817, 399973, 410718, or 405997.
- a target region is nucleotides 2100-2126 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2100-2126 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 60, 61, 411, 412, 413, 414, or 415.
- an antisense compound targeted to nucleotides 2100-2126 of SEQ ID NO: 1 is selected from ISIS NOs: 395186, 399908, 410713, 410562, 410633, 410714, 405996, 410634, 410715, 410563, 410635, 410716, 410564, 410636, 410717, 399817, 399973, 410718 or 405997.
- a target region is nucleotides 2100-2139 of SEQ ID NO : 1.
- an antisense compound is targeted to nucleotides 2100-2139 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 60, 61, 411, 412, 413, 414, 415, or 416.
- an antisense compound targeted to nucleotides 2100-2139 of SEQ ID NO: 1 is selected from ISIS NOs: 395186, 399908, 410713, 410562, 410633, 410714, 405996, 410634, 410715, 410563, 410635, 410716, 410564, 410636, 410717, 399817, 399973, 410718, 405997 or 410779.
- a target region is nucleotides 2100-2206 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2100-2206 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 60, 61, 411, 412, 413, 414, 415, 416, 417, or 418.
- an antisense compound targeted to nucleotides 2100-2206 of SEQ ID NO: 1 is selected from ISIS NOs: 395186, 399908, 410713, 410562, 410633, 410714, 405996, 410634, 410715, 410563, 410635, 410716, 410564, 410636, 410717, 399817, 399973, 410718, 405997, 405997, 410780, or 410781.
- a target region is nucleotides 2101 -2126 of SEQ ID NO : 1.
- an antisense compound is targeted to nucleotides 2101-2126 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 61, 411, 412, 413, 414, or 415.
- an antisense compound targeted to nucleotides 2101-2126 of SEQ ID NO: 1 is selected from ISIS NOs: 410562, 410633, 410714, 405996, 410634, 410715, 410563, 410635, 410716, 410564, 410636, 410717, 399817, 399973, 410718, or 405997.
- a target region is nucleotides 2305-2332 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2305-2332 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 419, 420, 421, 422, 423, 424,
- an antisense compound targeted to nucleotides 2305- 2332 of SEQ ID NO: 1 is selected from ISIS NOs: 410565, 410637, 410719, 410566, 410638, 410720, 410567, 410639, 410721, 410568, 410640, 410722, 410569, 410641, 410723, 395187, 399909, 410724, 410570, 410642, 410725, 410571, 410643, 410726, 405998, 410644, or 410727.
- a target region is nucleotides 2305-2354 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2305-2354 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 419, 420, 421, 422, 423, 424,
- an antisense compound targeted to nucleotides 2305-2354 of SEQ ID NO: 1 is selected from ISIS NOs: 410565, 410637, 410719, 410566, 410638, 410720, 410567, 410639, 410721, 410568, 410640, 410722, 410569, 410641, 410723, 395187, 399909, 410724, 410570, 410642, 410725, 410571, 410643, 410726, 405998, 410644, 410727, 410572, 410645, 410728, 410573, 410646, or 410783.
- a target region is nucleotides 2306-2333 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2306-2333 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 420, 421, 422, 423, 424, 425,
- 2333 of SEQ ID NO: 1 is selected from ISIS NOs: 410566, 410638, 410720, 410567, 410639, 410721, 410568, 410640, 410722, 410569, 410641, 410723, 395187, 399909, 410724, 410570, 410642, 410725, 410571, 410643, 410726, 405998, 410644, 410727, 410572, 410645, or 410728.
- a target region is nucleotides 2307-2334 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2307-2334 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 421 , 422, 423, 424, 425, 426,
- SEQ ID NO: 1 2334 of SEQ ID NO: 1 is selected from ISIS NOs: 410567, 410639, 410721, 410568, 410640, 410722, 410569, 410641, 410723, 395187, 399909, 410724, 410570, 410642, 410725, 410571, 410643, 410726, 405998, 410644, 410727, 410572, 410645, 410728, 410573, 410646, or 410729.
- a target region is nucleotides 2308-2334 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2308-2334 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 422, 423, 424, 425, 426, 427, or 428.
- an antisense compound targeted to nucleotides 2308-2334 of SEQ ID NO: 1 is selected from ISIS NOs: 410568, 410640, 410722, 410569, 410641, 410723, 395187, 399909, 410724, 410570, 410642, 410725, 410571, 410643, 410726, 405998, 410644, 410727, 410572, 410645, 410728, 410573, 410646, or 410729.
- a target region is nucleotides 2309-2334 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2309-2334 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 423, 424, 425, 426, 427, or 428.
- an antisense compound targeted to nucleotides 2309-2334 of SEQ ID NO: 1 is selected from ISIS NOs: 410569, 410641, 410723, 395187, 399909, 410724, 410570, 410642, 410725, 410571, 410643, 410726, 405998, 410644, 410727, 410572, 410645, 410728, 410573, 410646, or 410729.
- a target region is nucleotides 2310-2334 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2310-2334 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 424, 425, 426, 427, or 428.
- an antisense compound targeted to nucleotides 2310-2334 of SEQ ID NO: 1 is selected from ISIS NOs: 395187, 399909, 410724, 410570, 410642, 410725, 410571, 410643, 410726, 405998, 410644, 410727, 410572, 410645, 410728, 410573, 410646, or 410729.
- a target region is nucleotides 2410-2434 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2410-2434 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 63 or 154.
- an antisense compound targeted to nucleotides 2410-2434 of SEQ ID NO: 1 is selected from ISIS NOs: 395188, 399910, 399818, or 399974.
- a target region is nucleotides 2504-2528 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2504-2528 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 64 or 65.
- an antisense compound targeted to nucleotides 2504-2528 of SEQ ID NO: 1 is selected from ISIS NOs: 395189, 399911, 399819, or 399975.
- a target region is nucleotides 2509-2528 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2509-2528 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 65.
- an antisense compound targeted to nucleotides 2509-2528 of SEQ ID NO: 1 is selected from ISIS NOs: 399819 or 399975.
- a target region is nucleotides 2582-2625 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2582-2625 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 66, 67 or 122.
- an antisense compound targeted to nucleotides 2582-2625 of SEQ ID NO: 1 is selected from ISIS NOs: 399820, 399976, 395190, 399912, 395191, or 399913.
- a target region is nucleotides 2606-2668 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2606-2668 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 67 or 153.
- an antisense compound targeted to nucleotides 2606-2668 of SEQ ID NO: 1 is selected from ISIS NOs: 395191, 399913, 395192, or 399914.
- a target region is nucleotides 2828-2855 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2828-2855 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 69, 431 , 432, 433, 434, 435, 436, 437 or 438.
- an antisense compound targeted to nucleotides 2828- 2855 of SEQ ID NO: 1 is selected from ISIS NOs: 405893, 405894, 405895, 405896, 395194, 399916, 405897, 405898, 405899, or 405900.
- a target region is nucleotides 2832-2851 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2832-2851 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 69.
- an antisense compound targeted to nucleotides 2832-2851 of SEQ ID NO: 1 is selected from ISIS NOs: 395194, or 399916.
- a target region is nucleotides 2900-2927 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2900-2927 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 70, 71, 439, 440, 441, 442, 443 or 444.
- an antisense compound targeted to nucleotides 2900-2927 of SEQ ID NO: 1 is selected from ISIS NOs: 395195, 399917, 405901, 405902, 405903, 405904, 399821, 399977, 405905, or 405906.
- a target region is nucleotides 2900-2929 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2900-2929 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 70, 71, 439, 440, 441, 442, 443, 444, 446 or 446.
- an antisense compound targeted to nucleotides 2900-2929 of SEQ ID NO: 1 is selected from ISIS NOs: 395195, 399917, 405901, 405902, 405903, 405904, 399821, 399977, 405905, 405906, 405907, or 405908.
- a target region is nucleotides 2902-2927 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2902-2927 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 71, 439, 440, 441, 442, 443 or 444.
- an antisense compound targeted to nucleotides 2902-2927 of SEQ ID NO: 1 is selected from ISIS NOs: 405901, 405902, 405903, 405904, 399821, 399977, 405905, or 405906.
- a target region is nucleotides 2983-3007 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2983-3007 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 72 or 73.
- an antisense compound targeted to nucleotides 2983-3007 of SEQ ID NO: 1 is selected from ISIS NOs: 395196, 399918, 399822, or 399978.
- a target region is nucleotides 2983-3013 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 2983-3013 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 72, 73 or 135.
- an antisense compound targeted to nucleotides 2983-3013 of SEQ ID NO: 1 is selected from ISIS NOs: 395196, 399918, 399822, 399978, 399823, or 399979.
- a target region is nucleotides 3227-3252 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 3227-3252 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 74 or 112.
- an antisense compound targeted to nucleotides 3227-3252 of SEQ ID NO: 1 is selected from ISIS NOs: 395197, 399919, 399824, or 399980.
- a target region is nucleotides 3227-3456 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 3227-3456 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 74, 75 or 112.
- an antisense compound targeted to nucleotides 3227-3456 of SEQ ID NO: 1 is selected from ISIS NOs: 395197, 399919, 399824, 399980, 395198, or 399920.
- a target region is nucleotides 3472-3496 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 3472-3496 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 76 or 77.
- an antisense compound targeted to nucleotides 3472-3496 of SEQ ID NO: 1 is selected from ISIS NOs: 395199, 399921, 399825 or 399981.
- a target region is nucleotides 3543-3569 of SEQ ID NO: 1.
- an antisense compound is targeted to nucleotides 3543-3569 of SEQ ID NO: 1.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 78 or 99.
- an antisense compound targeted to nucleotides 3543-3569 of SEQ ID NO: 1 is selected from ISIS NOs: 395200, 399922, 399826 or 399982.
- antisense compound target a PCSK9 nucleic acid having the sequence of nucleotides 25475000 to 25504000 of GENBANK® Accession No. NT 032977.8, first deposited with GENBANK® on February 26, 2006, and incorporated herein as SEQ ID NO: 2.
- an antisense oligonucleotide is targeted to SEQ ID NO: 2.
- an antisense oligonucleotide that is targeted to SEQ ID NO: 2 is at least 90% complementary to SEQ ID NO: 2.
- an antisense oligonucleotide that is targeted to SEQ ID NO: 2 is at least 95% complementary to SEQ ID NO: 2.
- an antisense oligonucleotide that is targeted to SEQ ID NO: 1 is 100% complementary to SEQ ID NO: 1.
- an antisense oligonucleotide comprises a nucleotide sequence selected from a nucleotide sequence set forth in Table 7.
- gapmer antisense compounds are targeted to a PCSK9 nucleic acid. In certain such embodiments, gapmer antisense compounds are targeted to SEQ ID NO: 2. In certain such embodiments, the nucleotide sequences illustrated in Table 7 have a 5-10-5 gapmer motif. Table 8 illustrates gapmer antisense compounds targeted to SEQ ID NO: 2, having a 5-10-5 motif, where the gap segment comprises 2'-deoxynucleotides and each wing segment comprises nucleotides comprising a 2'-O-methoxyethyl sugar modification. Internucleoside linkages are phosphorthioate, and cytidines are 5-methylcytidines.
- Table 8 Gapmer antisense compounds having a 5-10-5 motif targeted to SEQ ID NO: 2
- gap-widened antisense compounds are targeted to a PCSK9 nucleic acid. In certain such embodiments, gap-widened antisense compounds are targeted to SEQ ID NO: 2. In certain such embodiments, the nucleotide sequences illustrated in Table 7 have a 3-14-3 gap-widened motif. Table 9 illustrates gap- widened antisense compounds targeted to SEQ ID NO: 2, having a 3-14-3 motif, where the gap segment comprises 2'-deoxynucleotides and each wing segment comprises nucleotides comprising a 2'-O-methoxyethyl sugar modification. Internucleoside linkages are phosphorthioate, and cytidines are 5-methylcytidines.
- Table 9 Gapmer antisense compounds having a 3-14-3 motif targeted to SEQ ID NO: 2
- gap-widened antisense compounds are targeted to a PCSK9 nucleic acid. In certain such embodiments, gap-widened antisense compounds are targeted to SEQ ID NO: 2. In certain such embodiments, the nucleotide sequences illustrated in Table 7 have a 2-13-5 gap- widened motif. Table 10 illustrates gap-widened antisense compounds targeted to SEQ ID NO: 2, having a 2-13-5 motif, where the gap segment comprises 2'- deoxynucleotides and each wing segment comprises nucleotides comprising a 2'-O- methoxyethyl sugar modification. Internucleoside linkages are phosphorthioate, and cytidines are 5-methylcytidines.
- Table 10 Gapmer antisense compounds having a 2-13-5 motif targeted to SEQ ID NO: 2
- gap-widened antisense compounds are targeted to a PCSK9 nucleic acid. In certain such embodiments, gap-widened antisense compounds are targeted to SEQ ID NO: 2. In certain such embodiments, the nucleotide sequences illustrated in Table 7 have a 3-13-4 gap-widened motif. Table 11 illustrates gap-widened antisense compounds targeted to SEQ ID NO: 2, having a 3-13-4 motif, where the gap segment comprises T- deoxynucleotides and each wing segment comprises nucleotides comprising a 2'-O- methoxyethyl sugar modification. Internucleoside linkages are phosphorthioate, and cytidines are 5-methylcytidines. Table 11: Gapmer antisense compounds having a 3-13-4 motif targeted to SEQ ID NO: 2
- antisense compounds targeted to the target regions are also illustrated. It is understood that the sequence set forth in each SEQ ID NO is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
- antisense compounds target a range of a PCSK9 nucleic acid.
- such compounds contain at least an 8 nucleotide core sequence in common.
- such compounds sharing at least an 8 nucleotide core sequence targets the following nucleotide regions of SEQ ID NO: 2: 2274-2400, 2274-2575, 2433-2570, 2433- 2579, 2549-2575, 2552-2579, 2585-2638, 2605-2638, 3056-3075, 4150-5159, 4306-4325, 5590- 5618, 5667-5686, 6444-6463, 6482-6518, 6492-6518, 6528-6555, 6528-6623, 6534-6561, 6535- 6562, 6536-6563, 6537-6563, 6538-6565, 6539-6565, 6540-6567, 6541-6567, 6542-6569, 6546- 6573, 6557-6584, 6575-6602, 6585-6611
- a target region is nucleotides 2274-2400 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 2274-2400 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 4 or 5.
- an antisense compound targeted to nucleotides 2274-2400 of SEQ ID NO: 2 is selected from ISIS NOs: 395149, 399871, 395150 or 399872.
- a target region is nucleotides 2274-2575 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 2274-2575 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 4, 5, 6, 7, 8, 159, 160, 162, 163, 164, 165, 166, 167, 168 or 169.
- an antisense compound targeted to nucleotides 2274-2575 of SEQ ID NO: 2 is selected from ISIS NOs: 395149, 399871, 395150, 399872, 410742, 405999, 395151, 399873, 405861, 405862, 405863, 405864, 395152, 399874, 405865, 405866, 405867, 405868, 399793, or 399949.
- a target region is nucleotides 2433-2570 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 2433-2570 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 6, 7, 159, 160, 162, 163, 164, 165,
- an antisense compound targeted to nucleotides 2433- 2570 of SEQ ID NO: 2 is selected from ISIS NOs: 395151, 395152, 399873, 399874, 405861, 405862, 405863, 405864, 405865, 405866, 405999, or 410742.
- a target region is nucleotides 2433-2579 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 2433-2579 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 6, 7, 8, 159, 160, 162, 163, 164, 165, 166, 167, 168, 169, or 170.
- an antisense compound targeted to nucleotides 2433-2579 of SEQ ID NO: 2 is selected from ISIS NOs: 395151, 395152, 399793, 399873, 399874, 399949, 405861, 405862, 405863, 405864, 405865, 405866, 405867, 405868, 405999, 410742, or 410743.
- a target region is nucleotides 2549-2575 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 2549-2575 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 7, 8, 166, 167, 168 or 169.
- an antisense compound targeted to nucleotides 2549-2575 of SEQ ID NO: 2 is selected from ISIS NOs: 395152, 399793, 399874, 399949, 405865, 405866, 405867, or 405868.
- a target region is nucleotides 2552-2579 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 2552-2579 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 8, 168, 169 or 170.
- an antisense compound targeted to nucleotides 2552-2579 of SEQ ID NO: 2 is selected from ISIS NOs: 399793, 399949, 405867, 405868, or 410743.
- a target region is nucleotides 2585-2638 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 2585-2638 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 9, 171 or 172.
- an antisense compound targeted to nucleotides 2585-2638 of SEQ ID NO: 2 is selected from ISIS NOs: 395153, 399875, 410744, or 410745.
- a target region is nucleotides 2605-2638 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 2605-2638 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 8, 168 or 169.
- an antisense compound targeted to nucleotides 2605-2638 of SEQ ID NO: 2 is selected from ISIS NOs: 410745, 395153, or 399875.
- a target region is nucleotides 3056-3075 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 3056-3075 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 107.
- an antisense compound targeted to nucleotides 3056-3075 of SEQ ID NO: 2 is selected from ISIS NOs: 399837 or 399993.
- a target region is nucleotides 4150-5159 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 4150-5159 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 106.
- an antisense compound targeted to nucleotides 4150-5159 of SEQ ID NO: 2 is selected from ISIS NOs: 399839 or 399995.
- a target region is nucleotides 4306-4325 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 4306-4325 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 80.
- an antisense compound targeted to nucleotides 4306-4325 of SEQ ID NO: 2 is selected from ISIS NOs: 399838 or 399994.
- a target region is nucleotides 5590-5618 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 5590-5618 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 102 or 121.
- an antisense compound targeted to nucleotides 5590-5618 of SEQ ID NO: 2 is selected from ISIS NOs: 395221, 399840, 399943, or 399996.
- a target region is nucleotides 5667-5686 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 5667-5686 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 94.
- an antisense compound targeted to nucleotides 5667-5686 of SEQ ID NO: 2 is selected from ISIS NOs: 399841 or 399997.
- a target region is nucleotides 6444-6463 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6444-6463 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 176.
- an antisense compound targeted to nucleotides 6444-6463 of SEQ ID NO: 2 is selected from ISIS NOs: 410746.
- a target region is nucleotides 6482-6518 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6482-6518 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 10, 177, 178, 179, 180 or 181.
- an antisense compound targeted to nucleotides 6482-6518 of SEQ ID NO: 2 is selected from ISIS NOs: 395154, 399876, 406003, 406004, 406005, 406006 or 410747.
- a target region is nucleotides 6492-6518 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6492-6518 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 10, 178, 179, 180 or 181.
- an antisense compound targeted to nucleotides 6492-6518 of SEQ ID NO: 2 is selected from ISIS NOs: 395154, 399876, 406003, 406004, 406005 or 406006.
- a target region is nucleotides 6528-6555 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6528-6555 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 182, 183, 184, 185 or 186. In certain such embodiments, an antisense compound targeted to nucleotides 6528-6555 of SEQ ID
- NO: 2 is selected from ISIS NOs: 406007, 410529, 410530, 410531, 410574, 410575, 410576, 410647, 410648, 410649 or 410748.
- a target region is nucleotides 6528-6623 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6528-6623 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 11, 12, 13, 13, 14, 15, 16, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, or 207.
- an antisense compound targeted to nucleotides 6528-6623 of SEQ ID NO: 2 is selected from ISIS NOs: 395155, 395156, 395157, 399794, 399795, 399796, 399877, 399878, 399879, 399950, 399951, 399952, 406007, 406008, 406009, 406010, 406011, 406012, 406013, 406014, 406015, 406016, 406017, 406018, 406019, 406020, 410529, 410530, 410531, 410532, 410533, 410534, 410535, 410574, 410575, 410576, 410577, 410578, 410579, 410580, 410581, 410582, 410647, 410648, 410649, 410650, 410651, 410652, 410653, 410654, 410655, 410656, 410657, 410730, 4107
- a target region is nucleotides 6534-6561 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6534-6561 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 11, 184, 185, 186, 187, 188, 189, 190 or 191.
- 6561 of SEQ ID NO: 2 is selected from ISIS NOs: 395155, 399877, 406008, 406009, 410529, 410530, 410531, 410532, 410533, 410534, 410574, 410575, 410576, 410577, 410578, 410579,
- a target region is nucleotides 6535-6562 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6535-6562 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 11, 12, 185, 186, 187, 188, 189, 190 or 191.
- 6562 of SEQ ID NO: 2 is selected from ISIS NOs: 395155, 399794, 399877, 399950, 406008, 406009, 410530, 410531, 410532, 410533, 410534, 410575, 410576, 410577, 410578, 410579, 410580, 410581, 410648, 410649, 410650, 410651, 410652, 410653, 410654, 410655 or 410656.
- a target region is nucleotides 6536-6563 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6536-6563 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 11, 12, 186, 187, 188, 189, 190, 191 or 192.
- 6563 of SEQ ID NO: 2 is selected from ISIS NOs: 395155, 399794, 399877, 399950, 406008, 406009, 410531, 410532, 410533, 410534, 410535, 410576, 410577, 410578, 410579, 410580, 410581, 410582, 410649, 410650, 410651, 410652, 410653, 410654, 410655, 410656 or 410657.
- a target region is nucleotides 6537-6563 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6537-6563 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 11, 12, 187, 188, 189, 190, 191 or 192.
- an antisense compound targeted to nucleotides 6537-6563 of SEQ ID NO: 2 is selected from ISIS NOs: 395155, 399794, 399877, 399950, 406008, 406009, 410532, 410533, 410534, 410535, 410577, 410578, 410579, 410580, 410581, 410582, 410650, 410651, 410652, 410653, 410654, 410655, 410656 or 410657.
- a target region is nucleotides 6538-6565 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6538-6565 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 12, 187, 188, 189, 190, 191, 192 or 193.
- an antisense compound targeted to nucleotides 6538-6565 of SEQ ID NO: 2 is selected from ISIS Nos: 399794, 399950, 406008, 406009, 406010, 410532, 410533, 410534, 410535, 410577, 410578, 410579, 410580, 410581, 410582, 410651, 410652, 410653, 410654, 410655, 410656 or 410657.
- a target region is nucleotides 6539-6565 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6539-6565 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 12, 188, 189, 190, 191, 192 or 193.
- an antisense compound targeted to nucleotides 6539-6565 of SEQ ID NO: 2 is selected from ISIS NOs: 399794, 399950, 406008, 406009, 406010, 410533, 410534, 410535, 410578, 410579, 410580, 410581, 410582, 410652, 410653, 410654, 410655, 410656 or 410657.
- a target region is nucleotides 6540-6567 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6540-6567 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 12, 189, 190, 191, 192, 193 or 194.
- an antisense compound targeted to nucleotides 6540-6567 of SEQ ID NO: 2 is selected from ISIS Nos: 399794, 399950, 406009, 406010, 406011, 410533, 410534, 410535, 410579, 410580, 410581, 410582, 410653, 410654, 410655, 410656 or 410657.
- a target region is nucleotides 6541-6567 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6541-6567 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 12, 190, 191, 192, 193 or 194.
- an antisense compound targeted to nucleotides 6541-6567 of SEQ ID NO: 2 is selected from ISIS NOs: 399794, 399950, 406009, 406010, 406011, 410534, 410535,
- a target region is nucleotides 6542-6569 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6542-6569 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 12, 191, 192, 193, 194 or 195.
- an antisense compound targeted to nucleotides 6542-6569 of SEQ ID NO: 2 is selected from ISIS NOs: 399794, 399950, 406010, 406011, 406012, 410534, 410535,
- a target region is nucleotides 6546-6573 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6546-6573 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 13, 193, 194, 195 or 196.
- an antisense compound targeted to nucleotides 6546-6573 of SEQ ID NO: 2 is selected from ISIS NOs: 399795, 399951, 406010, 406011, 406012 or 406013.
- a target region is nucleotides 6557-6584 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6557-6584 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 14, 197 or 198.
- an antisense compound targeted to nucleotides 6557-6584 of SEQ ID NO: 2 is selected from ISIS NOs: 395156, 399878, 410749 or 410750.
- a target region is nucleotides 6575-6602 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6575-6602 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 15 or 198.
- an antisense compound targeted to nucleotides 6575-6602 of SEQ ID NO: 2 is selected from ISIS NOs: 395157, 399879 or 410750.
- a target region is nucleotides 6585-6611 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6585-6611 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 16, 199, 200 or 201.
- an antisense compound targeted to nucleotides 6585-6611 of SEQ ID NO: 2 is selected from ISIS NOs: 399796, 399952, 406014, 406015 or 406016.
- a target region is nucleotides 6594-6621 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6594-6621 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 202, 203, 204, 205 or 206.
- an antisense compound targeted to nucleotides 6594-6621 of SEQ ID NO: 2 is selected from ISIS NOs: 406017, 406018, 406019, 406020 or 410730.
- a target region is nucleotides 6596-6623 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6596-6623 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 203, 204, 205, 206 or 207.
- an antisense compound targeted to nucleotides 6596-6623 of SEQ ID NO: 2 is selected from ISIS NOs: 406017, 406018, 406019, 406020 or 410731.
- a target region is nucleotides 6652-6671 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 6652-6671 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 108.
- an antisense compound targeted to nucleotides 6652-6671 of SEQ ID NO: 2 is selected from ISIS
- a target region is nucleotides 7099-7118 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 7099-7118 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 114.
- an antisense compound targeted to nucleotides 7099-7118 of SEQ ID NO: 2 is selected from ISIS NOs: 399843 or 399999.
- a target region is nucleotides 7556-7584 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 7556-7584 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 91 or 131.
- an antisense compound targeted to nucleotides 7556-7584 of SEQ ID NO: 2 is selected from ISIS NOs: 399844, 399845, 400000 or 400001.
- a target region is nucleotides 8836-8855 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 8836-8855 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 145.
- an antisense compound targeted to nucleotides 8836-8855 of SEQ ID NO: 2 is selected from ISIS NOs: 399846 or 400002.
- a target region is nucleotides 8948-8967 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 8948-8967 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 90.
- an antisense compound targeted to nucleotides 8948-8967 of SEQ ID NO: 2 is selected from ISIS NOs: 399847 or 400003.
- a target region is nucleotides 9099-9118 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 9099-9118 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 125.
- an antisense compound targeted to nucleotides 9099-9118 of SEQ ID NO: 2 is selected from ISIS NOs: 399848 or 400004.
- a target region is nucleotides 9099-9168 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 9099-9168 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 17, 125 or 209.
- an antisense compound targeted to nucleotides 9099-9168 of SEQ ID NO: 2 is selected from ISIS NOs: 395158, 399848, 399880, 400004 or 410752.
- a target region is nucleotides 9130-9168 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 9130-9168 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 17.
- an antisense compound targeted to nucleotides 9130-9168 of SEQ ID NO: 2 is selected from ISIS NOs: 395158 or 399880.
- a target region is nucleotides 9207-9233 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 9207-9233 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 18, 210, 211, 212 or 213.
- an antisense compound targeted to nucleotides 9207-9233 of SEQ ID NO: 2 is selected from ISIS NOs: 395159, 399881, 406021, 406022, 406023 or 406024.
- a target region is nucleotides 9207-9235 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 9207-9235 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 18, 210, 211, 212, 213 or 214.
- an antisense compound targeted to nucleotides 9207-9235 of SEQ ID NO: 2 is selected from ISIS NOs: 395159, 399881, 406021, 406022, 406023, 406024 or 410732.
- a target region is nucleotides 9209-9235 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 9209-9235 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 18, 211, 212, 213 or 214.
- an antisense compound targeted to nucleotides 9209-9235 of SEQ ID NO: 2 is selected from ISIS NOs: 395159, 399881, 406022, 406023, 406024 or 410732.
- a target region is nucleotides 10252-10271 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 10252-10271 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 148.
- an antisense compound targeted to nucleotides 10252-10271 of SEQ ID NO: 2 is selected from ISIS NOs: 399849 or 400005.
- a target region is nucleotides 10633-10652 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 10633-10652 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 127.
- an antisense compound targeted to nucleotides 10633-10652 of SEQ ID NO: 2 is selected from ISIS NOs: 395222 or 399944.
- a target region is nucleotides 11308-11491 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 11308-11491 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 79 or 84.
- an antisense compound targeted to nucleotides 11308-11491 of SEQ ID NO: 2 is selected from ISIS NOs: 395223, 399850, 399945 or 400006.
- a target region is nucleotides 12715-12734 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 12715- 12734 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 88.
- an antisense compound targeted to nucleotides 12715-12734 of SEQ ID NO: 2 is selected from ISIS NOs: 399851 or 400007.
- a target region is nucleotides 12928-12947 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 12928-12947 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 111.
- an antisense compound targeted to nucleotides 12928-12947 of SEQ ID NO: 2 is selected from ISIS NOs: 399852 or 400008.
- a target region is nucleotides 13681-13700 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 13681-13700 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 85.
- an antisense compound targeted to nucleotides 13681-13700 of SEQ ID NO: 2 is selected from ISIS NOs: 395201 or 399923.
- a target region is nucleotides 13746-13779 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 13746-13779 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 100 or 116.
- an antisense compound targeted to nucleotides 13746-13779 of SEQ ID NO: 2 is selected from ISIS NOs: 399827, 399828, 399983 or 399984.
- a target region is nucleotides 13816-13847 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 13816-13847 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 117 or 129.
- an antisense compound targeted to nucleotides 13816-13847 of SEQ ID NO: 2 is selected from ISIS NOs: 395202, 399829, 399924 or 399985.
- a target region is nucleotides 13903-13945 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 13903-13945 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 81 or 110.
- an antisense compound targeted to nucleotides 13903-13945 of SEQ ID NO: 2 is selected from ISIS NOs: 395203, 399830, 399925 or 399986.
- a target region is nucleotides 13977-14141 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 13977-14141 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 83, 136, 137, 140 or 152.
- an antisense compound targeted to nucleotides 13977-14141 of SEQ ID NO: 2 is selected from ISIS NOs: 395204, 395205, 395206, 399831, 399832, 399926, 399927, 399928, 399987 or 399988.
- a target region is nucleotides 14179-14198 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14179-14198 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 132.
- an antisense compound targeted to nucleotides 14179-14198 of SEQ ID NO: 2 is selected from ISIS NOs: 395207 or 399929.
- a target region is nucleotides 14267-14286 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14267-14286 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 139.
- an antisense compound targeted to nucleotides 14267-14286 of SEQ ID NO: 2 is selected from
- a target region is nucleotides 14397-14423 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14397-14423 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 92 or 142.
- an antisense compound targeted to nucleotides 14397-14423 of SEQ ID NO: 2 is selected from ISIS NOs: 395209, 399833, 399931 or 399989.
- a target region is nucleotides 14441-14460 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14441-14460 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 113.
- an antisense compound targeted to nucleotides 14441-14460 of SEQ ID NO: 2 is selected from ISIS NOs: 395210 or 399932.
- a target region is nucleotides 14494-14513 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14494-14513 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 138.
- an antisense compound targeted to nucleotides 14494-14513 of SEQ ID NO: 2 is selected from ISIS NOs: 395211 or 399933.
- a target region is nucleotides 14494-14543 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14494-14543 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 98 or 138.
- an antisense compound targeted to nucleotides 14494-14543 of SEQ ID NO: 2 is selected from ISIS NOs: 395211, 395212, 399933 or 399934.
- a target region is nucleotides 14524-14543 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14524-14543 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 98.
- an antisense compound targeted to nucleotides 14524-14543 of SEQ ID NO: 2 is selected from ISIS NOs: 395212 or 399934.
- a target region is nucleotides 14601-14650 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14601-14650 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 96 or 124.
- an antisense compound targeted to nucleotides 14601-14650 of SEQ ID NO: 2 is selected from ISIS NOs: 395213, 395214, 399935 or 399936.
- a target region is nucleotides 14670-14700 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14670-14700 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 82, 103 or 133.
- an antisense compound targeted to nucleotides 14670-14700 of SEQ ID NO: 2 is selected from ISIS NOs: 395215, 395216, 399834, 399937, 399938 or 399990.
- a target region is nucleotides 14675-14700 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14675-14700 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 103 or 133.
- an antisense compound targeted to nucleotides 14675-14700 of SEQ ID NO: 2 is selected from ISIS NOs: 395215, 395216, 399937 or 399938.
- a target region is nucleotides 14801-14828 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14801-14828 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 155 or 156.
- an antisense compound targeted to nucleotides 14801-14828 of SEQ ID NO: 2 is selected from ISIS NOs: 395217, 399835, 399939 or 399991.
- a target region is nucleotides 14877-14912 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14877-14912 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 19, 215, 216 or 217.
- an antisense compound targeted to nucleotides 14877-14912 of SEQ ID NO: 2 is selected from ISIS NOs: 395160, 399882, 406025, 406026 or 410753.
- a target region is nucleotides 14877-14915 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14877- 14915 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 19, 20, 215, 216 or 217.
- an antisense compound targeted to nucleotides 14877-14915 of SEQ ID NO: 2 is selected from ISIS NOs: 395160, 399797, 399882, 399953, 406025, 406026 or 410753.
- a target region is nucleotides 14877-14973 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14877-14973 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 19, 20, 21, 22, 23, 24, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, or 233.
- an antisense compound targeted to nucleotides 14877-14973 of SEQ ID NO: 2 is selected from ISIS NOs: 395160, 395161, 395162, 399797, 399798, 399799, 399882, 399883, 399884, 399953, 399954, 399955, 405869, 405870, 405871, 405872, 405873, 405874, 405875, 405876, 406025, 406026, 406027, 406028, 406029, 406030, 406031, 406032, 410733, 410753, or 410754.
- a target region is nucleotides 14916-14943 of SEQ ID NO:, 2.
- an antisense compound is targeted to nucleotides 14916-14943 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 21, 22, 218, 219, 220, 221, 222 or 223.
- an antisense compound targeted to nucleotides 14916-14943 of SEQ ID NO: 2 is selected from ISIS NOs: 395161, 399798, 399883, 399954, 405869, 405870, 405871, 405872, 405873 or 405874.
- a target region is nucleotides 14916-14973 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14916-14973 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 21, 22, 23, 24, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, or 223.
- an antisense compound targeted to nucleotides 14916-14973 of SEQ ID NO: 2 is selected from ISIS
- a target region is nucleotides 14925-14951 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14925-14951 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 224, 225, 226 or 227.
- an antisense compound targeted to nucleotides 14925-14951 of SEQ ID NO: 2 is selected from ISIS NOs: 405875, 405876, 406027 or 406028.
- a target region is nucleotides 14934-14963 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14934-14963 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 23, 228, 229, 230, 231 or 232.
- an antisense compound targeted to nucleotides 14934-14963 of SEQ ID NO: 2 is selected from ISIS NOs: 399799, 399955, 406029, 406030, 406031, 406032 or 410733.
- a target region is nucleotides 14946-14973 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14946-14973 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 24 or 233.
- an antisense compound targeted to nucleotides 14946-14973 of SEQ ID NO: 2 is selected from ISIS NOs: 395162, 399884 or 410754.
- a target region is nucleotides 14979-14998 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 14979-14998 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 25.
- an antisense compound targeted to nucleotides 14979-14998 of SEQ ID NO: 2 is selected from ISIS NOs: 395163 or 399885.
- a target region is nucleotides 15254-15280 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15254-15280 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 235, 236 or 237.
- an antisense compound targeted to nucleotides 15254-15280 of SEQ ID NO: 2 is selected from ISIS NOs: 405526, 405604, 406033 or 410756.
- a target region is nucleotides 15254-15328 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15254-15328 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 26, 27, 28, 235, 236, 237, 238, 239, 240, 241, 242, 243, 243, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, or 447.
- an antisense compound targeted to nucleotides 15254-15328 of SEQ ID NO: 2 is selected from ISIS NOs: 395164, 395165, 399800, 399886, 399887, 399956, 405526, 405604, 405877, 405878, 405879, 405880, 405881, 405882, 405883, 405884, 406033, 406034, 406035, 406036, 406037, 406038, 409126, 410536, 410537, 410538, 410539, 410583, 410584, 410585, 410586, 410587, 410588, 410589, 410590, 410591, 410592, 410593, 410594, 410595, 410658, 410659, 410660, 410661, 410662, 410663, 410664, 410665, 410666, 410667, 410668, 410669, 410670, 410671, 4
- a target region is nucleotides 15264-15290 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15264-15290 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 26, 27, 238 or 239.
- an antisense compound targeted to nucleotides 15264-15290 of SEQ ID NO: 2 is selected from ISIS NOs: 395164, 399800, 399886, 399956, 406034, or 406035.
- a target region is nucleotides 15279-15305 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15279-15305 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 240, 241 or 242.
- an antisense compound targeted to nucleotides 15279-15305 of SEQ ID NO: 2 is selected from ISIS NOs: 406036, 406037, or 410757.
- a target region is nucleotides 15291-15318 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15291-15318 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 243, 244, 245, 246, 247, 248, 249, 250, or 447.
- an antisense compound targeted to nucleotides 15291-15318 of SEQ ID NO: 2 is selected from ISIS NOs: 395165, 399887, 405877, 405878, 405879, 405880, 405881, 406038, 409126, 410536, 410537, 410583, 410584, 410585, 410586, 410587, 410588, 410589, 410590, 410658, 410659, 410660, 410661, 410662, 410663, 410664, 410665, or 410666.
- a target region is nucleotides 15292-15319 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15292- 15319 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 244, 245, 246, 247, 248, 249, 250 or 447.
- an antisense compound targeted to nucleotides 15292- 15319 of SEQ ID NO: 2 is selected from ISIS NOs: 395165, 399887, 405877, 405878, 405879, 405880, 405881, 406038, 409126, 410537, 410584, 410585, 410586, 410587, 410588, 410589, 410590, 410659, 410660, 410661, 410662, 410663, 410664, 410665, or 410666.
- a target region is nucleotides 15293-15320 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15293-15320 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 245, 246, 247, 248, 249, 250,
- an antisense compound targeted to nucleotides 15293-15320 of SEQ ID NO: 2 is selected from ISIS NOs: 395165, 399887, 405877, 405878,
- a target region is nucleotides 15294-15321 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15294-15321 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 246, 247, 248, 249, 250, 251,
- an antisense compound targeted to nucleotides 15294-15321 of SEQ ID NO: 2 is selected from ISIS NOs: 395165, 399887, 405877, 405878, 405879, 405880, 405881, 405882, 405883, 405884, 409126, 410586, 410587, 410588, 410589, 410590, 410591, 410592, 410593, 410661, 410662, 410663, 410664, 410665, 410666, 410667, 410668 or 410669.
- a target region is nucleotides 15294-15321 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15294-15321 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 246, 247, 248, 249, 250, 251, 252, 253 or 447.
- an antisense compound targeted to nucleotides 15294-15321 of SEQ ID NO: 2 is selected from ISIS NOs: 395165, 399887, 405877, 405878, 405879, 405880, 405881, 405882, 405883, 405884, 409126, 410586, 410587, 410588, 410589, 410590, 410591, 410592, 410593, 410661, 410662, 410663, 410664, 410665, 410666, 410667,
- a target region is nucleotides 15295-15322 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15295-15322 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 247, 248, 249, 250, 250, 251, 252, 253, 254 or 447.
- an antisense compound targeted to nucleotides 15295-15322 of SEQ ID NO: 2 is selected from ISIS NOs: 395165, 399887, 405878, 405879, 405880, 405881, 405882, 405883, 405884, 409126, 410538, 410587, 410588, 410589, 410590, 410591, 410592, 410593, 410594, 410662, 410663, 410664, 410665, 410666, 410667, 410668, 410669 or 410670.
- a target region is nucleotides 15296- 15315 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15296-15315 of SEQ ID NO: 2.
- an antisense compound targeted to nucleotides 15296-15315 of SEQ ID NO: 2 is ISIS NO: 405879.
- a target region is nucleotides 15296-15323 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15296-15323 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 248, 249, 250, 251, 252, 253, 254, 255 or 447.
- an antisense compound targeted to nucleotides 15296-15323 of SEQ ID NO: 2 is selected from ISIS NOs: 395165, 399887, 405879, 405880, 405881, 405882, 405883, 405884, 409126, 410538, 410539, 410588, 410589, 410590, 410591, 410592, 410593, 410594, 410595, 410663, 410664, 410665, 410666, 410667, 410668, 410669, 410670 or 410671.
- a target region is nucleotides 15297-15323 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15297-15323 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 249, 250, 251, 252, 253, 254, 255 or 447.
- an antisense compound targeted to nucleotides 15297- 15323 of SEQ ID NO: 2 is selected from ISIS NOs: 395165, 399887, 405880, 405881, 405882, 405883, 405884, 409126, 410538, 410539, 410589, 410590, 410591, 410592, 410593, 410594, 410595, 410664, 410665, 410666, 410667, 410668, 410669, 410670 or 410671.
- a target region is nucleotides 15298-15323 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15298-15323 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 250, 251, 252, 253, 254, 255 or 447.
- an antisense compound targeted to nucleotides 15298-15323 of SEQ ID NO: 2 is selected from ISIS NOs: 395165, 399887, 405881, 405882, 405883, 405884, 409126, 410538, 410539, 410590, 410591, 410592, 410593, 410594, 410595, 410665, 410666, 410667, 410668, 410669, 410670 or 410671.
- a target region is nucleotides 15299-15323 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15299-15323 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 250, 251 , 252, 253, 254 or 255.
- an antisense compound targeted to nucleotides 15299-15323 of SEQ ID NO: 2 is selected from ISIS NOs: 405881, 405882, 405883, 405884, 410538, 410539, 410590, 410591, 410592, 410593, 410594, 410595, 410666, 410667, 410668, 410669, 410670 or 410671.
- a target region is nucleotides 15300- 15323 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15300-15323 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 251, 252, 253, 254 or 255.
- an antisense compound targeted to nucleotides 15300-15323 of SEQ ID NO: 2 is selected from ISIS NOs: 405882, 405883, 405884, 410538, 410539, 410591, 410592, 410593, 410594, 410595, 410667, 410668, 410669, 410670 or 410671.
- a target region is nucleotides 15301-15328 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15301-15328 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 252, 253, 254, 255 or 256.
- an antisense compound targeted to nucleotides 15301-15328 of SEQ ID NO: 2 is selected from ISIS NOs: 405883, 405884, 410538, 410539, 410592, 410593, 410594, 410595, 410668, 410669, 410670, 410671 or 410758.
- a target region is nucleotides 15330-15355 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15330-15355 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 29, 257, 258 or 259.
- an antisense compound targeted to nucleotides 15330-15355 of SEQ ID NO: 2 is selected from ISIS NOs: 395166, 399888, 406039, 406040 or 406041.
- a target region is nucleotides 15330-15490 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15330-15490 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 29, 30, 86, 257, 258, 259, 260, 261, 262 or 263.
- an antisense compound targeted to nucleotides 15330- 15490 of SEQ ID NO: 2 is selected from ISIS NOs: 395166, 399801, 399853, 399888, 399957, 400009, 406039, 406040, 406041, 406042, 406043, 406044 or 410759.
- a target region is nucleotides 15339-15366 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15339-15366 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 30, 260, 261 or 262.
- an antisense compound targeted to nucleotides 15339-15366 of SEQ ID NO: 2 is selected from ISIS NOs: 399801, 399957, 406042, 406043 or 406044.
- a target region is nucleotides 15358-15490 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 15358-15490 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 86 or 263.
- an antisense compound targeted to nucleotides 15358-15490 of SEQ ID NO: 2 is selected from ISIS NOs: 399853, 400009 or 410759.
- a target region is nucleotides 16134-16153 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 16134-16153 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 97.
- an antisense compound targeted to nucleotides 16134-16153 of SEQ ID NO: 2 is selected from ISIS NOs: 399854 or 400010.
- a target region is nucleotides 16668-16687 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 16668-16687 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 120.
- an antisense compound targeted to nucleotides 16668-16687 of SEQ ID NO: 2 is selected from ISIS NOs: 399855 or 400011.
- a target region is nucleotides 17267-17286 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 17267-17286 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 150.
- an antisense compound targeted to nucleotides 17267-17286 of SEQ ID NO: 2 is selected from ISIS NOs: 399856 or 400012.
- a target region is nucleotides 18377-18427 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 18377-18427 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 115 or 134.
- an antisense compound targeted to nucleotides 18377-18427 of SEQ ID NO: 2 is selected from ISIS NOs: 399857, 399858, 400013 or 400014.
- a target region is nucleotides 18561-18580 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 18561-18580 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 157.
- an antisense compound targeted to nucleotides 18561-18580 of SEQ ID NO: 2 is selected from ISIS NOs: 395224 or 399946.
- a target region is nucleotides 18591-18618 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 18591-18618 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 32, 266, 267, 268 or 269. In certain such embodiments, an antisense compound targeted to nucleotides 18591-18618 of SEQ
- ID NO: 2 is selected from ISIS NOs: 395168, 399890, 405909, 405910, 405911 or 406045.
- a target region is nucleotides 18591-18646 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 18591-18646 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 32, 32, 266, 267, 268, 269, 270,
- an antisense compound targeted to nucleotides 18591- 18646 of SEQ ID NO: 2 is selected from ISIS NOs: 395168, 399890, 405909, 405910, 405911, 405912, 406045, 410761 or 410762.
- a target region is nucleotides 18591-18668 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 18591-18668 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 32, 266, 267, 268, 269, 270, 271, 272 or 273.
- an antisense compound targeted to nucleotides 18591- 18668 of SEQ ID NO: 2 is selected from ISIS NOs: 395168, 399890, 405909, 405910, 405911, 405912, 406045, 410761, 410762 or 410763.
- a target region is nucleotides 18695-18746 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 18695-18746 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 33, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284 or 285.
- an antisense compound targeted to nucleotides 18695-18746 of SEQ ID NO: 2 is selected from ISIS NOs: 395169, 399891, 405913, 405914, 405915, 405916, 405917, 405918, 405919, 405920, 405921, 405922, 410734 or 410764.
- a target region is nucleotides 18705-18730 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 18705-18730 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 33, 275, 276 or 277.
- an antisense compound targeted to nucleotides 18705-18730 of SEQ ID NO: 2 is selected from ISIS NOs: 395169, 399891, 405913, 405914 or 405915.
- a target region is nucleotides 18709-18736 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 18709-18736 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 276, 277, 278, 279 or 280.
- an antisense compound targeted to nucleotides 18709-18736 of SEQ ID NO: 2 is selected from ISIS NOs: 405914, 405915, 405916, 405917 or 410734.
- a target region is nucleotides 18719-18746 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 18719-18746 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 281, 282, 283, 284 or 285.
- an antisense compound targeted to nucleotides 18719-18746 of SEQ ID NO: 2 is selected from ISIS NOs: 405918, 405919, 405920, 405921 or 405922.
- a target region is nucleotides 19203-20080 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 19203-20080 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 34, 35, 36, 37, 38, 39, 40, 41, 105, 128, 149, 151, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317 or 318.
- an antisense compound targeted to nucleotides 19203-20080 of SEQ ID NO: 2 is selected from ISIS NOs: 395170, 395171, 395172, 395173, 395174, 395175, 399802, 399803, 399804, 399805, 399859, 399860, 399892, 399893, 399894, 399895, 399896, 399897, 399958, 399959, 399960, 399961, 400015, 400016, 405923, 405924, 405925, 405926, 405927, 405928, 405929, 405930, 405931, 405932, 405933, 405934, 405935, 405936, 405937, 405938, 405939, 405940, 405941, 405942, 405943, 405944, 405945, 405946, 405947, 410735, 410736, 410737, 410767, 410768 or 4107
- a target region is nucleotides 19931-19952 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 19931-19952 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 149 or 188.
- an antisense compound targeted to nucleotides 19931-19952 of SEQ ID NO: 2 is selected from ISIS NOs: 395170, 399892 or 405923.
- a target region is nucleotides 19954-19981 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 19954-19981 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 34, 290, 291, 292 or 293.
- an antisense compound targeted to nucleotides 19954-19981 of SEQ ID NO: 2 is selected from ISIS NOs: 395171, 399893, 405924, 405925, 405926 or 410735.
- a target region is nucleotides 19964-19990 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 19964-19990 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 35, 128, 128, 294 or 295.
- an antisense compound targeted to nucleotides 19964-19990 of SEQ ID NO: 2 is selected from ISIS NOs: 395172, 399802, 399894, 399958, 405927 or 405928.
- a target region is nucleotides 19973-19999 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 19973-19999 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 36, 296, 297 or 298.
- an antisense compound targeted to nucleotides 19973-19999 of SEQ ID NO: 2 is selected from ISIS NOs: 395173, 399895, 405929, 405930 or 405931.
- a target region is nucleotides 19982-20009 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 19982-20009 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 37, 299, 300, 301 or 302.
- an antisense compound targeted to nucleotides 19982-20009 of SEQ ID NO: 2 is selected from ISIS NOs: 399803, 399959, 405932, 405933, 405934 or 405935.
- a target region is nucleotides 19992-20016 of SEQ ID NO : 2.
- an antisense compound is targeted to nucleotides 19992-20016 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 38, 303 or 304.
- an antisense compound targeted to nucleotides 19992-20016 of SEQ ID NO: 2 is selected from ISIS NOs: 395174, 399896, 405936 or 410736.
- a target region is nucleotides 20016-20042 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20016-20042 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 305 or 306.
- an antisense compound targeted to nucleotides 20016-20042 of SEQ ID NO: 2 is selected from ISIS NOs: 405937 or 410768.
- a target region is nucleotides 20025-20052 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20025-20052 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 39, 307, 308, 309 or 310.
- an antisense compound targeted to nucleotides 20025-20052 of SEQ ID NO: 2 is selected from ISIS NOs: 395175, 399897, 405938, 405939, 405940 or 405941.
- a target region is nucleotides 20036-20062 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20036-20062 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 40, 311 , 312, 313 or 314.
- an antisense compound targeted to nucleotides 20036-20062 of SEQ ID NO: 2 is selected from ISIS NOs: 399804, 399960, 405942, 405943, 405944 or 410737.
- a target region is nucleotides 20045-20070 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20045-20070 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 41 , 315, 316 or 317.
- an antisense compound targeted to nucleotides 20045-20070 of SEQ ID NO: 2 is selected from ISIS NOs: 399805, 399961, 405945, 405946 or 405947.
- a target region is nucleotides 20100-20119 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20100-20119 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 158.
- an antisense compound targeted to nucleotides 20100-20119 of SEQ ID NO: 2 is selected from ISIS NOs: 399861 or 400017.
- a target region is nucleotides 20188-20207 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20188-20207 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 109.
- an antisense compound targeted to nucleotides 20188-20207 of SEQ ID NO: 2 is selected from ISIS NOs: 399862 or 400018.
- a target region is nucleotides 20624-20650 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20624-20650 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 141, 320 or 321.
- an antisense compound targeted to nucleotides 20624-20650 of SEQ ID NO: 2 is selected from ISIS NOs: 399863, 400019, 405949 or 405950.
- a target region is nucleotides 20624-20759 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20624-20759 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 43, 44, 45, 46, 47, 48, 49, 50, 51, 87, 141, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358 or 359.
- an antisense compound targeted to nucleotides 20624-20759 of SEQ ID NO: 2 is selected from ISIS NOs: 395177, 395178, 395179, 399807, 399808, 399809, 399810, 399811, 399812, 399813, 399863, 399899, 399900, 399901, 399963, 399964, 399965, 399966, 399967, 399968, 399969, 400019, 405557, 405885, 405886, 405887, 405888, 405889, 405890, 405891, 405892, 405949, 405950, 405951, 405952, 405953, 405954, 405955, 405956, 405957, 405958, 405959, 405960, 405961, 405962, 405963, 405964, 405965, 405966, 405967, 405968, 405969, 405970, 405971,
- a target region is nucleotides 20629-20804 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20629-20804 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 43, 44, 45, 46, 47, 48, 49, 50, 51, 87, 119, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 356, 357, 358, 359 or 360.
- an antisense compound targeted to nucleotides 20629-20804 of SEQ ID NO: 2 is selected from ISIS NOs: 395177, 395178, 395179, 395180, 399807, 399808, 399809, 399810, 399811, 399812, 399813, 399899, 399900, 399901, 399902, 399963, 399964, 399965, 399966, 399967, 399968, 399969, 405557, 405885, 405886, 405887, 405888, 405889, 405890, 405891, 405892, 405949, 405950, 405951, 405952, 405953, 405954, 405955, 405956, 405957, 405958, 405959, 405960, 405961, 405962, 405963, 405964, 405965, 405966, 405967, 405968, 405969, 405970, 405971,
- a target region is nucleotides 20633-20660 ofSEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20633-20660 ofSEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 43, 322, 323, 324 or 325.
- an antisense compound targeted to nucleotides 20633-20660 of SEQ ID NO: 2 is selected from ISIS NOs: 399807, 399963, 405951, 405952, 405953 or 410738.
- a target region is nucleotides 20635-20781 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20635-20781 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 43, 44, 45, 46, 47, 48, 49, 50, 51, 87, 119, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358 or 359.
- an antisense compound targeted to nucleotides 20635-20781 of SEQ ID NO: 2 is selected from ISIS NOs: 395177, 395178, 395179, 395180, 399807, 399808, 399809, 399810, 399811, 399812, 399813, 399899, 399900, 399901, 399902, 399963, 399964, 399965, 399966, 399967, 399968, 399969, 405557, 405885, 405886, 405887, 405888, 405889, 405890, 405891, 405892, 405952, 405953, 405954, 405955, 405956, 405957, 405958, 405959, 405960, 405961, 405962, 405963, 405964, 405965, 405966, 405967, 405968, 405969, 405970, 405971, 405972, 405973, 405974, 40
- a target region is nucleotides 20643-20662 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20643-20662 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 326.
- an antisense compound targeted to nucleotides 20643-20662 of SEQ ID NO: 2 is selected from ISIS NOs: 405954.
- a target region is nucleotides 20657-20676 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20657-20676 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 327.
- an antisense compound targeted to nucleotides 20657-20676 of SEQ ID NO: 2 is selected from
- a target region is nucleotides 20670-20697 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20670-20697 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 328, 329, 330, 331 or 332.
- an antisense compound targeted to nucleotides 20670-20697 of SEQ ID NO: 2 is selected from ISIS NOs: 405955, 405956, 405957, 405958 or 405959.
- a target region is nucleotides 20680-20706 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20680-20706 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 44, 333, 334, 335 or 336.
- an antisense compound targeted to nucleotides 20680-20706 of SEQ ID NO: 2 is selected from ISIS NOs: 399808, 399964, 405960, 405961, 405962 or 410739.
- a target region is nucleotides 20683-20781 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20683-20781 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 44, 45, 46, 47, 48, 49, 50, 51, 87, 119, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358 or 359.
- an antisense compound targeted to nucleotides 20683-20781 of SEQ ID NO: 2 is selected from ISIS NOs: 395177, 395178, 395179, 395180, 399808, 399809, 399810, 399811, 399812, 399813, 399899, 399900, 399901, 399902, 399964, 399965, 399966, 399967, 399968, 399969, 405557, 405885, 405886, 405887, 405888, 405889, 405890, 405891, 405892, 405962, 405963, 405964, 405965, 405966, 405967, 405968, 405969, 405970, 405971, 405972, 405973, 405974, 408653, 410540, 410596, 410597, 410598, 410599, 410600, 410601, 410602, 410603, 410604, 410672, 4
- a target region is nucleotides 20689-20715 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20689-20715 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 45, 46, 337 or 338.
- an antisense compound targeted to nucleotides 20689-20715 of SEQ ID NO: 2 is selected from ISIS NOs: 395177, 399809, 399899, 399965, 405963 or 405964.
- a target region is nucleotides 20698-20725 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20698-20725 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 47, 47, 339, 340, 341 or 342.
- an antisense compound targeted to nucleotides 20698-20725 of SEQ ID NO: 2 is selected from ISIS NOs: 399810, 399966, 405965, 405966, 405967 or 405968.
- a target region is nucleotides 20709-20736 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20709-20736 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 48, 48, 343, 344, 345 or 346.
- an antisense compound targeted to nucleotides 20709-20736 of SEQ ID NO: 2 is selected from ISIS NOs: 399811, 399967, 405885, 405969, 405970 or 410740.
- a target region is nucleotides 20717-20744 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20717-20744 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 49, 346, 347, 348, 349, 350, 351, 352 or 353. In certain such embodiments, an antisense compound targeted to nucleotides 20717-
- 20744 of SEQ ID NO: 2 is selected from ISIS NOs: 399812, 399968, 405885, 405886, 405887, 405888, 405889, 405890, 405891, 405892, 410596, 410597, 410598, 410599, 410600, 410601, 410672, 410673, 410674, 410675, 410676, 410677 or 410678.
- a target region is nucleotides 20718-20745 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20718-20745 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 49, 50, 347, 348, 349, 350, 351, 352 or 353. In certain such embodiments, an antisense compound targeted to nucleotides 20718-
- 20745 of SEQ ID NO: 2 is selected from ISIS NOs: 395178, 399812, 399900, 399968, 405557, 405886, 405887, 405888, 405889, 405890, 405891, 405892, 410596, 410597, 410598, 410599, 410600, 410601, 410672, 410673, 410674, 410675, 410676, 410677, 410678 or 410679.
- a target region is nucleotides 20719-20746 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20719-20746 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 49, 50, 348, 349, 350, 351, 352, 353 or 354. In certain such embodiments, an antisense compound targeted to nucleotides 20719-
- 20746 ofSEQ ID NO: 2 is selected from ISIS NOs: 395178, 399812, 399900, 399968, 405557, 405887, 405888, 405889, 405890, 405891, 405892, 408653, 410596, 410597, 410598, 410599, 410600, 410601, 410602, 410672, 410673, 410674, 410675, 410676, 410677, 410678, 410679 or 410680.
- a target region is nucleotides 20720-207 '47 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20720-20747 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 49, 50, 349, 350, 351, 352, 353, 354 or 355. In certain such embodiments, an antisense compound targeted to nucleotides 20720-
- 20747 of SEQ ID NO: 2 is selected from ISIS NOs: 395178, 399812, 399900, 399968, 405557, 405888, 405889, 405890, 405891, 405892, 405971, 408653, 410597, 410598, 410599, 410600, 410601, 410602, 410603, 410673, 410674, 410675, 410676, 410677, 410678, 410679, 410680 or 410681.
- a target region is nucleotides 20721-20748 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20721-20748 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 49, 50, 350, 351, 352, 353, 354,
- an antisense compound targeted to nucleotides 20721- 20748 of SEQ ID NO: 2 is selected from ISIS NOs: 395178, 399812, 399900, 399968, 405557,
- a target region is nucleotides 20722-20749 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20722-20749 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 50, 350, 351, 352, 353, 354, 355,
- an antisense compound targeted to nucleotides 20722- 20749 of SEQ ID NO: 2 is selected from ISIS NOs: 395178, 399900, 405557, 405889, 405890, 405891, 405892, 405971, 405972, 408653, 410540, 410598, 410599, 410600, 410601, 410602,
- a target region is nucleotides 20727-20752 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20727-20752 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 87, 354, 355, 356 or 357.
- an antisense compound targeted to nucleotides 20727-20752 of SEQ ID NO: 2 is selected from ISIS NOs: 395179, 399901, 405971, 405972, 408653, 410540, 410602, 410603, 410604, 410680, 410681 or 410682.
- a target region is nucleotides 20735-20759 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20735-20759 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 51, 358 or 359.
- an antisense compound targeted to nucleotides 20735-20759 of SEQ ID NO: 2 is selected from ISIS NOs: 399813, 399969, 405973 or 405974.
- a target region is nucleotides 20762-21014 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20762-21014 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 93, 119 or 360.
- an antisense compound targeted to nucleotides 20762-21014 of SEQ ID NO: 2 is selected from ISIS NOs: 395180, 399864, 399902, 400020 or 410771.
- a target region is nucleotides 20785-21014 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 20785-21014 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 93 or 360.
- an antisense compound targeted to nucleotides 20785-21014 of SEQ ID NO: 2 is selected from ISIS NOs: 399864, 400020 or 410771.
- a target region is nucleotides 21082-21107 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 21082-21107 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 95 or 361.
- an antisense compound targeted to nucleotides 21082-21107 of SEQ ID NO: 2 is selected from ISIS NOs: 399865, 400021 or 405975.
- a target region is nucleotides 21082-21152 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 21082-21152 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 53, 54, 95, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370 or 371.
- an antisense compound targeted to nucleotides 21082-21152 of SEQ ID NO: 2 is selected from ISIS NOs: 395182, 399814, 399865, 399904, 399970, 400021, 405975, 405976, 405977, 405978, 405979, 405980, 405981, 405982, 405983, 410741 or 410772.
- a target region is nucleotides 21091-21114 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 21091 -21114 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 53, 362 or 363.
- an antisense compound targeted to nucleotides 21091-21114 of SEQ ID NO: 2 is selected from ISIS NOs: 399814, 399970, 405976 or 405977.
- a target region is nucleotides 21118-21144 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 21118-21144 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 54, 365, 366 or 367.
- an antisense compound targeted to nucleotides 21118-21144 of SEQ ID NO: 2 is selected from ISIS NOs: 395182, 399904, 405978, 405979 or 405980.
- a target region is nucleotides 21127-21152 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 21127-21152 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 368, 369, 370 or 371. In certain such embodiments, an antisense compound targeted to nucleotides 21127-21152 of SEQ ID NO:
- a target region is nucleotides 21181-21209 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 21181-21209 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 55, 372, 373, 374 or 375.
- an antisense compound targeted to nucleotides 21181-21209 of SEQ ID NO: 2 is selected from ISIS NOs: 399815, 399971, 405564, 405641, 405984, 405985, 405986 or 405987.
- a target region is nucleotides 21181-21211 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 21181-21211 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 55, 56, 372, 373, 374 or 375.
- an antisense compound targeted to nucleotides 21181-21211 of SEQ ID NO: 2 is selected from ISIS NOs: 399815, 399816, 399971, 399972, 405564, 405641, 405984, 405985, 405986 or 405987.
- a target region is nucleotides 21183-21211 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 21183-21211 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 55, 56, 373, 374 or 375.
- an antisense compound targeted to nucleotides 21183-21211 of SEQ ID NO: 2 is selected from ISIS NOs: 399815, 399816, 399971, 399972, 405564, 405641, 405985, 405986 or 405987.
- a target region is nucleotides 21481-21500 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 21481-21500 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 143.
- an antisense compound targeted to nucleotides 21481-21500 of SEQ ID NO: 2 is selected from ISIS NOs: 399866 or 400022.
- a target region is nucleotides 21589-21608 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 21589-21608 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 89.
- an antisense compound targeted to nucleotides 21589-21608 of SEQ ID NO: 2 is selected from ISIS NOs: 399867 or 400023.
- a target region is nucleotides 21692-21719 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 21692-21719 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 123, 448, 449, 450, 451, 452, 453, 454 or 455.
- an antisense compound targeted to nucleotides 21692- 21719 of SEQ ID NO: 2 is selected from ISIS NOs: 399868, 400024, 406478, 406479, 406480, 406481, 406482, 406483, 406484 or 406485.
- a target region is nucleotides 22000-22227 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22000-22227 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 389, 390, 391, 392, 393, 394, 395 or 396.
- an antisense compound targeted to nucleotides 22000- 22227 of SEQ ID NO: 2 is selected from ISIS NOs: 395185, 399907, 405991, 405992, 410550, 410551, 410552, 410553, 410554, 410555, 410616, 410617, 410618, 410619, 410620, 410621, 410622, 410623, 410695, 410696, 410697, 410698, 410699, 410700, 410701, 410702 or 410703.
- a target region is nucleotides 22096-22115 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22096-22115 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 57.
- an antisense compound targeted to nucleotides 22096-22115 of SEQ ID NO: 2 is selected from ISIS NOs: 395183 or 399905.
- a target region is nucleotides 22096-22223 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22096-22223 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 57, 58, 59, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391 or 392.
- an antisense compound targeted to nucleotides 22096-22223 of SEQ ID NO: 2 is selected from ISIS NOs: 395183, 395184, 395185, 399905, 399906, 399907, 405988, 405989, 405990, 410541, 410542, 410543, 410544, 410545, 410546, 410547, 410548, 410549, 410550, 410551, 410552, 410553, 410605, 410606, 410607, 410608, 410609, 410610, 410611, 410612, 410613, 410614, 410615, 410616, 410617, 410618, 410619, 410683, 410684, 410685, 410686, 410687, 410688, 410689, 410690, 410691, 410692, 410693, 410694, 410695, 410696, 410697, 410698, 410699 or 4
- a target region is nucleotides 22096-22311 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22096-22311 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 57, 58, 59, 126, 126, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 401, 401, 402, 402, 402, 403, 403, 403, 404, 404, 404, 405, 405, 405 or 406.
- an antisense compound targeted to nucleotides 22096-22311 of SEQ ID NO: 2 is selected from ISIS NOs: 395183, 395184, 395185, 395225, 399905, 399906, 399907, 399947, 405988, 405989, 405990, 405991, 405992, 405993, 405994, 405995, 410541, 410542, 410543, 410544, 410545, 410546, 410547, 410548, 410549, 410550, 410551, 410552, 410553, 410554, 410555, 410556, 410557, 410558, 410559, 410560, 410561, 410605, 410606, 410607, 410608, 410609, 410610, 410611, 410612, 410613, 410614, 410615, 410616, 410617, 410618, 410619, 410620, 410621, 4
- a target region is nucleotides 22133-22160 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22133-22160 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 376, 377, 378, 379, 380, 381, 382, 383 or 384.
- an antisense compound targeted to nucleotides 22133- 22160 of SEQ ID NO: 2 is selected from ISIS NOs: 405988, 405989, 410541, 410542, 410543, 410544, 410545, 410546, 410547, 410605, 410606, 410607, 410608, 410609, 410610, 410611, 410612, 410613, 410683, 410684, 410685, 410686, 410687, 410688, 410689, 410690 or 410691.
- a target region is nucleotides 22133-22163 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22133-22163 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 58, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385 or 386.
- an antisense compound targeted to nucleotides 22133-22163 of SEQ ID NO: 2 is selected from ISIS NOs: 395184, 399906, 405988, 405989, 405990, 410541, 410542, 410543, 410544, 410545, 410546, 410547, 410548, 410605, 410606, 410607, 410608, 410609, 410610, 410611, 410612, 410613, 410614, 410683, 410684, 410685, 410686, 410687, 410688, 410689, 410690, 410691, 410692 or 410693.
- a target region is nucleotides 22134-22161 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22134-22161 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 58, 377, 378, 379, 380, 381, 382, 383 or 384. In certain such embodiments, an antisense compound targeted to nucleotides 22134-
- SEQ ID NO: 2 is selected from ISIS NOs: 395184, 399906, 405988, 405989, 410542,
- a target region is nucleotides 22135-22162 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22135-22162 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 58, 378, 379, 380, 381, 382, 383,
- 22162 of SEQ ID NO: 2 is selected from ISIS NOs: 395184, 399906, 405988, 405989, 410543, 410544, 410545, 410546, 410547, 410548, 410607, 410608, 410609, 410610, 410611, 410612,
- a target region is nucleotides 22136-22163 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22136-22163 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 58, 379, 380, 381, 382, 383, 384,
- SEQ ID NO: 2 is selected from ISIS NOs: 395184, 399906, 405988, 405989, 405990,
- a target region is nucleotides 22137-22163 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22137-22163 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 58, 380, 381, 382, 383, 384, 385 or 386.
- an antisense compound targeted to nucleotides 22137-22163 of SEQ ID NO: 2 is selected from ISIS NOs: 395184, 399906, 405988, 405989, 405990, 410545,
- a target region is nucleotides 22138-22163 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22138-22163 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 58, 381, 382, 383, 384, 385 or 386.
- an antisense compound targeted to nucleotides 22138-22163 of SEQ ID NO: 2 is selected from ISIS NOs: 395184, 399906, 405988, 405989, 405990, 410546, 410547, 410548, 410610, 410611, 410612, 410613, 410614, 410688, 410689, 410690, 410691, 410692 or 410693.
- a target region is nucleotides 22189-22239 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22189-22239 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405 or 406.
- an antisense compound targeted to nucleotides 22189-22239 of SEQ ID NO: 2 is selected from ISIS NOs: 395185, 399907, 405991, 405992, 405993, 405994, 405995, 410549, 410550, 410551, 410552, 410553, 410554, 410555, 410556, 410557, 410558, 410559, 410560, 410561, 410615, 410616, 410617, 410618, 410619, 410620, 410621, 410622, 410623, 410624, 410625, 410626, 410627, 410628, 410629, 410630, 410631, 410632, 410694, 410695, 410696, 410697, 410698, 410699, 410700, 410701, 410702, 410703, 410704, 410705, 410706, 410707, 410708, 410709, 4
- a target region is nucleotides 22199-22226 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22199-22226 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 388, 389, 390, 391, 392, 393, 394 or 395.
- 22226 of SEQ ID NO: 2 is selected from ISIS NOs: 395185, 399907, 405991, 410549, 410550, 410551, 410552, 410553, 410554, 410555, 410615, 410616, 410617, 410618, 410619, 410620, 410621, 410622, 410694, 410695, 410696, 410697, 410698, 410699, 410700, 410701 or 410702.
- a target region is nucleotides 22199-22227 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22199-22227 of SEQ ID
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 388, 389, 390, 391, 392, 393, 394, 395 or 396.
- an antisense compound targeted to nucleotides 22199-22227 of SEQ ID NO: 2 is selected from ISIS NOs: 395185, 399907, 405991, 405992, 410549, 410550, 410551, 410552, 410553, 410554, 410555, 410615, 410616, 410617, 410618, 410619, 410620, 410621, 410622, 410623, 410694, 410695, 410696, 410697, 410698, 410699, 410700, 410701, 410702 or 410703.
- a target region is nucleotides 22200-22227 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22200-22227 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 389, 390, 391, 392, 393, 394, 395 or 396. In certain such embodiments, an antisense compound targeted to nucleotides 22200-
- 22227 of SEQ ID NO: 2 is selected from ISIS NOs: 395185, 399907, 405991, 405992, 410550, 410551, 410552, 410553, 410554, 410555, 410616, 410617, 410618, 410619, 410620, 410621, 410622, 410623, 410695, 410696, 410697, 410698, 410699, 410700, 410701, 410702 or 410703.
- a target region is nucleotides 22201-22228 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22201-22228 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 390, 391, 392, 393, 394, 395,
- 22228 of SEQ ID NO: 2 is selected from ISIS NOs: 395185, 399907, 405991, 405992, 410551, 410552, 410553, 410554, 410555, 410556, 410617, 410618, 410619, 410620, 410621, 410622,
- a target region is nucleotides 22202-22229 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22202-22229 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 391 , 392, 393, 394, 395, 396,
- 22229 of SEQ ID NO: 2 is selected from ISIS NOs: 395185, 399907, 405991, 405992, 405993, 410552, 410553, 410554, 410555, 410556, 410618, 410619, 410620, 410621, 410622, 410623,
- a target region is nucleotides 22203-22230 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22203-22230 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 392, 393, 394, 395, 396, 397, 398 or 399.
- 22230 of SEQ ID NO: 2 is selected from ISIS NOs: 395185, 399907, 405991, 405992, 405993, 410553, 410554, 410555, 410556, 410557, 410619, 410620, 410621, 410622, 410623, 410624, 410625, 410626, 410698, 410699, 410700, 410701, 410702, 410703, 410704, 410705 or 410706.
- a target region is nucleotides 22204-22231 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22204-22231 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 59, 393, 394, 395, 396, 397, 398, 399 or 400. In certain such embodiments, an antisense compound targeted to nucleotides 22204-
- 22231 of SEQ ID NO: 2 is selected from ISIS NOs: 395185, 399907, 405991, 405992, 405993, 405994, 410554, 410555, 410556, 410557, 410620, 410621, 410622, 410623, 410624, 410625,
- a target region is nucleotides 22205-22232 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22205-22232 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 393, 394, 395, 396, 397, 398, 399,
- 22232 of SEQ ID NO: 2 is selected from ISIS NOs: 405991, 405992, 405993, 405994, 410554, 410555, 410556, 410557, 410558, 410620, 410621, 410622, 410623, 410624, 410625, 410626,
- a target region is nucleotides 22206-22233 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22206-22233 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 394, 395, 396, 397, 398, 399, 400,
- 22233 of SEQ ID NO: 2 is selected from ISIS NOs: 405991, 405992, 405993, 405994, 405995, 410555, 410556, 410557, 410558, 410621, 410622, 410623, 410624, 410625, 410626, 410627,
- a target region is nucleotides 22207-22234 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22207-22234 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 395, 396, 397, 398, 399, 400, 401, 402 or 403.
- 22234 of SEQ ID NO: 2 is selected from ISIS NOs: 405992, 405993, 405994, 405995, 410555,
- a target region is nucleotides 22208-22235 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22208-22235 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 396, 397, 398, 399, 400, 401, 402, 403 or 404. In certain such embodiments, an antisense compound targeted to nucleotides 22208-
- SEQ ID NO: 2 22235 of SEQ ID NO: 2 is selected from ISIS NOs: 405992, 405993, 405994, 405995, 410556,
- a target region is nucleotides 22209-22236 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22209-22236 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 397, 398, 399, 400, 401, 402, 403, 404 or 405.
- 22236 of SEQ ID NO: 2 is selected from ISIS NOs: 405993, 405994, 405995, 410556, 410557, 410558, 410559, 410560, 410561, 410624, 410625, 410626, 410627, 410628, 410629, 410630,
- a target region is nucleotides 22210-22236 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22210-22236 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 398, 399, 400, 401, 402, 403, 404 or 405.
- an antisense compound targeted to nucleotides 22210- 22236 of SEQ ID NO: 2 is selected from ISIS NOs: 405993, 405994, 405995, 410557, 410558, 410559, 410560, 410561, 410625, 410626, 410627, 410628, 410629, 410630, 410631, 410632, 410705, 410706, 410707, 410708, 410709, 410710, 410711 or 410712.
- a target region is nucleotides 22210-22239 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22210-22239 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 398, 399, 400, 401, 402, 403, 404, 405 or 405.
- an antisense compound targeted to nucleotides 22210- 22239 of SEQ ID NO: 2 is selected from ISIS NOs: 405993, 405994, 405995, 410557, 410558, 410559, 410560, 410561, 410625, 410626, 410627, 410628, 410629, 410630, 410631, 410632, 410705, 410706, 410707, 410708, 410709, 410710, 410711, 410712 or 410774.
- a target region is nucleotides 22211-22236 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22211-22236 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 399, 400, 401, 402, 403, 404 or 405.
- an antisense compound targeted to nucleotides 22211-22236 of SEQ ID NO: 2 is selected from ISIS NOs: 405994, 405995, 410557, 410558, 410559, 410560, 410561, 410626, 410627, 410628, 410629, 410630, 410631, 410632, 410706, 410707, 410708, 410709, 410710, 410711 or 410712.
- a target region is nucleotides 22212-22239 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22212-22239 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 400, 401, 402, 403, 404, 405 or 406.
- an antisense compound targeted to nucleotides 22212-22239 of SEQ ID NO: 2 is selected from ISIS NOs: 405994, 405995, 410558, 410559, 410560, 410561, 410627, 410628, 410629, 410630, 410631, 410632, 410707, 410708, 410709, 410710, 410711, 410712 or 410774.
- a target region is nucleotides 22292-22311 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 22292-22311 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 126.
- an antisense compound targeted to nucleotides 22292-22311 of SEQ ID NO: 2 is selected from ISIS NOs: 395225 or 399947.
- a target region is nucleotides 23985-24054 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 23985-24054 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 408, 409 or 410.
- an antisense compound targeted to nucleotides 23985-24054 of SEQ ID NO: 2 is selected from ISIS NOs: 410776, 410777 or 410778.
- a target region is nucleotides 24035-24134 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 24035-24134 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 60, 61, 410, 411, 412, 413, 414, 415 or 416.
- an antisense compound targeted to nucleotides 24035- 24134 of SEQ ID NO: 2 is selected from ISIS NOs: 395186, 399817, 399908, 399973, 405996, 405997, 410562, 410563, 410564, 410633, 410634, 410635, 410636, 410713, 410714, 410715, 410716, 410717, 410718, 410778 or 410779.
- a target region is nucleotides 24095-24121 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 24095-24121 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 60, 61, 411, 412, 413, 414 or 415.
- an antisense compound targeted to nucleotides 24095-24121 of SEQ ID NO: 2 is selected from ISIS NOs: 395186, 399817, 399908, 399973, 405996, 405997, 410562, 410563, 410564, 410633, 410634, 410635, 410636, 410713, 410714, 410715, 410716, 410717 or 410718.
- a target region is nucleotides 24858-24877 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 24858-24877 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 147. In certain such embodiments, an antisense compound targeted to nucleotides 24858-24877 of SEQ ID NO: 2 is selected from ISIS NOs: 395226 or 399948. In certain embodiments, a target region is nucleotides 24907-24926 of SEQ ID NO: 2. In certain embodiments, an antisense compound is targeted to nucleotides 24907-24926 of SEQ ID NO: 2. In certain embodiments, an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 118. In certain such embodiments, an antisense compound targeted to nucleotides 24907-24926 of SEQ ID NO: 2 is selected from ISIS NOs: 399869 or 400025.
- a target region is nucleotides 25413-25432 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 25413-25432 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 114.
- an antisense compound targeted to nucleotides 25413-25432 of SEQ ID NO: 2 is selected from ISIS NOs: 399870 or 400026.
- a target region is nucleotides 25994-26013 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 25994-26013 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 418.
- an antisense compound targeted to nucleotides 25994-26013 of SEQ ID NO: 2 is selected from ISIS NOs: 410781.
- a target region is nucleotides 26112-26139 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26112-26139 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 419, 420, 421, 422, 423, 424, 425 or 426.
- an antisense compound targeted to nucleotides 26112- 26139 of SEQ ID NO: 2 is selected from ISIS NOs: 395187, 399909, 405998, 410565, 410566, 410567, 410568, 410569, 410570, 410571, 410637, 410638, 410639, 410640, 410641, 410642, 410643, 410644, 410719, 410720, 410721, 410722, 410723, 410724, 410725, 410726 or 410727.
- a target region is nucleotides 26112-26161 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26112-26161 of SEQ ID
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429 or 430.
- an antisense compound targeted to nucleotides 26112-26161 of SEQ ID NO: 2 is selected from ISIS NOs: 395187, 399909, 405998, 410565, 410566, 410567, 410568, 410569, 410570, 410571, 410572, 410573, 410637, 410638, 410639, 410640, 410641, 410642, 410643, 410644, 410645, 410646, 410719, 410720, 410721, 410722, 410723, 410724, 410725, 410726, 410727, 410728, 410729, 410782 or 410783.
- a target region is nucleotides 26112-27303 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26112-27303 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 1 12, 122, 135, 153, 154, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445 or 446.
- an antisense compound targeted to nucleotides 26112-27303 of SEQ ID NO: 2 is selected from ISIS NOs: 395187, 395188, 395189, 395190, 395191, 395192, 395193, 395194, 395195, 395196, 395197, 395198, 395199, 399818, 399819, 399820, 399821, 399822, 399823, 399824, 399825, 399909, 399910, 399911, 399912, 399913, 399914, 399915, 399916, 399917, 399918, 399919, 399920, 399921, 399974, 399975, 399976, 399977, 399978, 399979, 399980, 399981, 405893, 405894, 405895, 405896, 405897, 405898, 405899, 405900, 405901, 405902, 405903, 405904, 40
- a target region is nucleotides 26113-26140 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26113-26140 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 420, 421, 422, 423, 424, 425,
- an antisense compound targeted to nucleotides 26113- 26140 of SEQ ID NO: 2 is selected from ISIS NOs: 395187, 399909, 405998, 410566, 410567, 410568, 410569, 410570, 410571, 410572, 410638, 410639, 410640, 410641, 410642, 410643, 410644, 410645, 410720, 410721, 410722, 410723, 410724, 410725, 410726, 410727 or 410728.
- a target region is nucleotides 26114-26141 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26114-26141 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 421, 422, 423, 424, 425, 426,
- an antisense compound targeted to nucleotides 26114- 26141 of SEQ ID NO: 2 is selected from ISIS NOs: 395187, 399909, 405998, 410567, 410568,
- a target region is nucleotides 26115-26141 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26115-26141 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 422, 423, 424, 425, 426, 427 or 248.
- an antisense compound targeted to nucleotides 26115-26141 of SEQ ID NO: 2 is selected from ISIS NOs: 395187, 399909, 405998, 410568, 410569, 410570, 410571, 410572, 410573, 410640, 410641, 410642, 410643, 410644, 410645, 410646, 410722, 410723, 410724, 410725, 410726, 410727, 410728 or 410729.
- a target region is nucleotides 26116-26141 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 261 16-26141 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 423, 424, 425, 426, 427 or 428.
- an antisense compound targeted to nucleotides 26116-26141 of SEQ ID NO: 2 is selected from ISIS NOs: 395187, 399909, 405998, 410569, 410570, 410571, 410572, 410573, 410641, 410642, 410643, 410644, 410645, 410646, 410723, 410724, 410725, 410726, 410727 or 410728.
- a target region is nucleotides 26117-26141 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26117-26141 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 424, 425, 426, 427 or 428.
- an antisense compound targeted to nucleotides 26117-26141 of SEQ ID NO: 2 is selected from ISIS NOs: 395187, 399909, 405998, 410570, 410571, 410572, 410573, 410642, 410643, 410644, 410645, 410646, 410724, 410725, 410726, 410727, 410728 or 410729.
- a target region is nucleotides 26117-26475 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26117-26475 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 62, 63, 64, 65, 66, 67, 122, 153, 154, 424, 425, 426, 427, 428, 429 or 430.
- an antisense compound targeted to nucleotides 26117-26475 of SEQ ID NO: 2 is selected from ISIS NOs: 395187,
- a target region is nucleotides 26118-26141 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26118-26141 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 424, 425, 426, 427 or 428.
- an antisense compound targeted to nucleotides 26118-26141 of SEQ ID NO: 2 is selected from ISIS NOs: 405998, 410570, 410571, 410572, 410573, 410642, 410643, 410644, 410645, 410646, 410725, 410726, 410727, 410728 or 410729.
- a target region is nucleotides 26120-26141 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26120-26141 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 426, 427 or 428.
- an antisense compound targeted to nucleotides 26120-26141 of SEQ ID NO: 2 is selected from ISIS NOs: 405998, 410572, 410573, 410644, 410645, 410646, 410727, 410728 or 410729.
- a target region is nucleotides 26132-26151 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26132-26151 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 429.
- an antisense compound targeted to nucleotides 26132-26151 of SEQ ID NO: 2 is selected from ISIS NOs: 410782.
- a target region is nucleotides 26142-26161 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26142-26161 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 430.
- an antisense compound targeted to nucleotides 26142-26161 of SEQ ID NO: 2 is selected from ISIS NOs: 410783.
- a target region is nucleotides 26217-26241 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26217-26241 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 63 or 154.
- an antisense compound targeted to nucleotides 26217-26241 of SEQ ID NO: 2 is selected from ISIS NOs: 395188, 399818 or 399910.
- a target region is nucleotides 26311 -26335 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26311-26335 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 64 or 65.
- an antisense compound targeted to nucleotides 26311-26335 of SEQ ID NO: 2 is selected from ISIS NOs: 395189, 399819, 399911 or 399975.
- a target region is nucleotides 26389-26432 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26389-26432 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 66, 67 or 122.
- an antisense compound targeted to nucleotides 26389-26432 of SEQ ID NO: 2 is selected from ISIS NOs: 395190, 395191, 399820, 399912, 399913 or 399976.
- a target region is nucleotides 26456-26576 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26456-26576 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 68 or 153.
- an antisense compound targeted to nucleotides 26456-26576 of SEQ ID NO: 2 is5 selected from ISIS NOs: 395192, 395193, 399914 or 399915.
- a target region is nucleotides 26635-26662 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26635-26662 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 69, 431, 432, 433, 434, 435, 436, O 437 or 438.
- an antisense compound targeted to nucleotides 26635- 26662 of SEQ ID NO: 2 is selected from ISIS NOs: 395194, 399916, 405893, 405894, 405895, 405896, 405897, 405898, 405899 or 405900.
- a target region is nucleotides 26707-26734 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26707-26734 of SEQ ID 5 NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 70, 71, 439, 440, 441, 442, 443 or 444.
- an antisense compound targeted to nucleotides 26707-26734 of SEQ ID NO: 2 is selected from ISIS NOs: 395195, 399821, 399917, 399977, 405901, 405902, 405903, 405904, 405905 or 405906. 0
- a target region is nucleotides 26707-26736 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26707-26736 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 70, 71, 439, 440, 441, 442, 443, 444, 445 or 446.
- an antisense compound targeted to nucleotides 26707-26736 of SEQ ID NO: 2 is selected from ISIS NOs: 395195, 399821, 399917, 399977, 405901, 405902, 405903, 405904, 405905, 405906, 405907 or 405908.
- a target region is nucleotides 26790-26820 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 26790-26820 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 72, 73 or 135.
- an antisense compound targeted to nucleotides 26790-26820 of SEQ ID NO: 2 is selected from ISIS NOs: 395196, 399822, 399823, 399918, 399978 or 399979.
- a target region is nucleotides 27034-27263 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 27034-27263 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 74, 75 or 112.
- an antisense compound targeted to nucleotides 27034-27263 of SEQ ID NO: 2 is selected from ISIS NOs: 395197, 395198, 399824, 399919, 399920 or 399980.
- a target region is nucleotides 27279-27303 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 27279-27303 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 76 or 77.
- an antisense compound targeted to nucleotides 27279-27303 of SEQ ID NO: 2 is selected from ISIS NOs: 395199, 399825, 399921 or 399981.
- a target region is nucleotides 27350-27376 of SEQ ID NO: 2.
- an antisense compound is targeted to nucleotides 27350-27376 of SEQ ID NO: 2.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 78 or 99.
- an antisense compound targeted to nucleotides 27350-27376 of SEQ ID NO: 2 is selected from ISIS NOs: 395200, 399826, 399922 or 399982.
- antisense compounds target a PCSK9 nucleic acid having the sequence of GENB ANK® Accession No. AK 124635.1 , first deposited with GENB ANK® on
- an antisense oligonucleotide is targeted to SEQ ID NO: 3.
- an antisense oligonucleotide that is targeted to SEQ ID NO: 3 is at least 90% complementary to SEQ ID NO: 1.
- an antisense oligonucleotide that is targeted to SEQ ID NO: 3 is at least 95% complementary to SEQ ID NO: 3.
- an antisense oligonucleotide that is targeted to SEQ ID NO: 3 is 100% complementary to SEQ ID NO: 3.
- an antisense oligonucleotide comprises a nucleotide sequence selected from a nucleotide sequence set forth in Table 12.
- gapmer antisense compounds are targeted to a PCSK9 nucleic acid. In certain such embodiments, gapmer antisense compounds are targeted to SEQ ID NO: 3. In certain such embodiments, the nucleotide sequences illustrated in Table 12 have a 5-10-5 gapmer motif. Table 13 illustrates gapmer antisense compounds targeted to SEQ ID NO: 3, having a 5-10-5 motif, where the gap segment comprises 2'-deoxynucleotides and each wing segment comprises nucleotides comprising a 2'-O-methoxyethyl sugar modification. Internucleoside linkages are phosphorthioate, and cytidines are 5-methylcytidines.
- Table 13 Gapmer antisense compounds having a 5-10-5 motif targeted to SEQ ID NO: 3
- gap-widened antisense compounds are targeted to a PCSK9 nucleic acid. In certain such embodiments, gap-widened antisense compounds are targeted to SEQ ID NO: 3. In certain such embodiments, the nucleotide sequences illustrated in Table 12 have a 3-14-3 gap- widened motif. Table 14 illustrates gap- widened antisense compounds targeted to SEQ ID NO: 3, having a 3-14-3 motif, where the gap segment comprises T- deoxynucleotides and each wing segment comprises nucleotides comprising a 2'-O- methoxyethyl sugar modification. Internucleoside linkages are phosphorthioate, and cytidines are 5-methylcytidines. Table 14: Gapmer antisense compounds having a 3-14-3 motif targeted to SEQ ID NO: 3
- gap-widened antisense compounds are targeted to a PCSK9 nucleic acid. In certain such embodiments, gap-widened antisense compounds are targeted to SEQ ID NO: 3. In certain such embodiments, the nucleotide sequences illustrated in Table 12 have a 2-13-5 gap- widened motif. Table 15 illustrates gap-widened antisense compounds targeted to SEQ ID NO: 3, having a 2-13-5 motif, where the gap segment comprises T- deoxynucleotides and each wing segment comprises nucleotides comprising a 2'-O- methoxyethyl sugar modification. Internucleoside linkages are phosphorthioate, and cytidines are 5 -methylcytidines.
- Table 15 Gapmer antisense compounds having a 2-13-5 motif targeted to SEQ ID NO: 3
- antisense compounds targeted to the target regions are also illustrated. It is understood that the sequence set forth in each SEQ ID NO is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
- antisense compounds target a range of a PCSK9 nucleic acid.
- such compounds contain at least an 8 nucleotide core sequence in common.
- such compounds sharing at least an 8 nucleotide core sequence targets the following nucleotide regions of SEQ ID NO: 3: 220-253, 290-321, 377-419, 451-615, 653- 672, 741-760, 871-897, 915-934, 968-1017, 1075-1124, 1075-1174, 1144-1174, 1275-1302, 1315-1341, 1351-1389, 1351-1447, 1365-1439, 1390-1417, 1390-1429, 1390-1439, 1399-1425, 1408-1435, 1420-1447, 1453-1482, 1490-1516, 1490-1564, 1500-1526, 1515-1541, 1527-1553, 1527-1554, 1528-1554, 1529-1555, 1529-1556, 1530-1556, 1530-1557, 15
- a target region is nucleotides 290-321 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 290-321 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 117 or 129.
- an antisense compound targeted to nucleotides 290-321 of SEQ ID NO: 3 is selected from ISIS NOs: 395202, 399924, 399829 or 399985.
- a target region is nucleotides 220-253 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 220-253 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 100 or 116.
- an antisense compound targeted to nucleotides 220-253 of SEQ ID NO: 3 is selected from ISIS NOs: 399827, 399983, 399828 or 399984.
- a target region is nucleotides 377-419 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 377-419 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 81 or 110.
- an antisense compound targeted to nucleotides 377-419 of SEQ ID NO: 3 is selected from ISIS NOs: 399830, 399986, 395203 or 399925.
- a target region is nucleotides 451-615 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 451 -615 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 152, 140, 137 or 136.
- an antisense compound targeted to nucleotides 451-615 of SEQ ID NO: 3 is selected from ISIS NOs: 395204, 399926, 399831, 399987, 395205, 399927, 399832, 399988, 395206 or 399928.
- a target region is nucleotides 653-672 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 653-672 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 132.
- an antisense compound targeted to nucleotides 653-672 of SEQ ID NO: 3 is selected from ISIS NOs: 395207 or 399929.
- a target region is nucleotides 741-760 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 741-760 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 139.
- an antisense compound targeted to nucleotides 741-760 of SEQ ID NO: 3 is selected from ISIS NOs: 395208 or 399930.
- a target region is nucleotides 871-897 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 871-897 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 92 or 142.
- an antisense compound targeted to nucleotides 871-897 of SEQ ID NO: 3 is selected from ISIS NOs: 399833, 399989, 395209 or 399931.
- a target region is nucleotides 915-934 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 915-934 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 113.
- an antisense compound targeted to nucleotides 915-934 of SEQ ID NO: 3 is selected from ISIS NOs: 395210 or 399932.
- a target region is nucleotides 968-1017 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 968-1017 of SEQ ID NO:
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 98 or 138.
- an antisense compound targeted to nucleotides 968-1017 of SEQ ID NO: 3 is selected from ISIS NOs: 395211, 399933, 395212, or 399934.
- a target region is nucleotides 1075-1124 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1075-1 124 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 96 or 124.
- an antisense compound targeted to nucleotides 1075-1124 of SEQ ID NO: 3 is selected from ISIS NOs: 395213, 399935, 395214, or 399936.
- a target region is nucleotides 1075-1174 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1075-1174 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 82, 96, 103, 124, or 133.
- an antisense compound targeted to nucleotides 1075-1174 of SEQ ID NO: 3 is selected from ISIS NOs: 395213, 399935, 395214, 399936, 399834, 399990, 395215, 399937, 395216, or 399938.
- a target region is nucleotides 1144-1174 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1144-1174 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 82, 133 or 103.
- an antisense compound targeted to nucleotides 1144-1174 of SEQ ID NO: 3 is selected from ISIS NOs: 399834, 399990, 395215, 399937, 395216 or 399938.
- a target region is nucleotides 1275-1302 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1275-1302 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 155 or 156.
- an antisense compound targeted to nucleotides 1275-1302 of SEQ ID NO: 3 is selected from ISIS NOs: 395217, 399939, 399835 or 399991.
- a target region is nucleotides 1315-1341 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1315-1341 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 146 or 161.
- an antisense compound targeted to nucleotides 1315-1341 of SEQ ID NO: 3 is selected from ISIS NOs: 395218, 399940, 395219 or 399941.
- a target region is nucleotides 1351-1389 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1351-1389 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 215, 216, 19, 217 or 20.
- an antisense compound targeted to nucleotides 1351-1389 of SEQ ID NO: 3 is selected from ISIS NOs: 410753, 406025, 395160, 399882, 406026, 399797 or 399953.
- a target region is nucleotides 1351-1447 of SEQ ID NO : 3.
- an antisense compound is targeted to nucleotides 1351-1447 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 215, 216, 19, 217, 20, 21, 218, 219,
- an antisense compound targeted to nucleotides 1351-1447 of SEQ ID NO: 3 is selected from ISIS NOs: 410753, 406025, 395160, 399882, 406026, 399797, 399953, 395161, 399883, 405869, 405870, 405871, 405872, 399798, 399954, 405873, 405874, 405875, 405876, 406027, 406028, 406029, 399799, 399955, 406030, 406031, 410733, 406032, 395162, 399884 or 410754.
- a target region is nucleotides 1365-1439 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1365-1439 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 19, 20, 21, 22, 23, 24, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, or 232.
- an antisense compound targeted to nucleotides 1365-1439 of SEQ ID NO: 3 is selected from ISIS NOs: 395160, 399882, 406026, 399797, 399953, 395161, 399883, 405869, 405870, 405871, 405872, 399798, 399954, 405873, 405874, 405875, 405876, 406027, 406028, 406029, 399799, 399955, 406030, 406031, 410733, 406032, 395162, or 399884.
- a target region is nucleotides 1390-1417 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1390-1417 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 21, 218, 219, 220, 221, 22, 222 or 223.
- an antisense compound targeted to nucleotides 1390-1417 of SEQ ID NO: 3 is selected from ISIS NOs: 395161, 399883, 405869, 405870, 405871, 405872, 399798, 399954, 405873 or 405874.
- a target region is nucleotides 1390-1429 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1390- 1429 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 21, 22, 23, 217, 218, 219, 220,
- an antisense compound targeted to nucleotides 1390-1429 of SEQ ID NO: 3 is selected from ISIS NOs: 395160, 399882, 406026, 399797, 399953, 395161, 399883, 405869, 405870, 405871, 405872, 399798, 399954, 405873, 405874, 405875, 405876, 406027, 406028, 406029, 399799, or 399955.
- a target region is nucleotides 1390-1439 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1390-1439 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 21, 22, 23, 24, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, or 232.
- an antisense compound targeted to nucleotides 1390-1439 of SEQ ID NO: 3 is selected from ISIS NOs: 395160, 399882, 406026, 399797, 399953, 395161, 399883, 405869, 405870, 405871, 405872, 399798, 399954, 405873, 405874, 405875, 405876, 406027, 406028, 406029, 399799, 399955, 406030, 406031, 410733, 406032, 395162, or 399884.
- a target region is nucleotides 1399-1425 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1399-1425 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 224, 225, 226 or 227.
- an antisense compound targeted to nucleotides 1399-1425 of SEQ ID NO: 3 is selected from ISIS NOs: 405875, 405876, 406027 or 406028.
- a target region is nucleotides 1408-1435 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1408-1435 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 228, 23, 229, 230 or 231.
- an antisense compound targeted to nucleotides 1408-1435 of SEQ ID NO: 3 is selected from ISIS NOs: 406029, 399799, 399955, 406030, 406031 or 410733.
- a target region is nucleotides 1420-1447 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1420-1447 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 24 or 233.
- an antisense compound targeted to nucleotides 1420-1447 of SEQ ID NO: 3 is selected from ISIS NOs: 395162, 399884 or 410754.
- a target region is nucleotides 1453-1482 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1453-1482 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 25 or 234.
- an antisense compound targeted to nucleotides 1453-1482 of SEQ ID NO: 3 is selected from ISIS NOs: 395163, 399885 or 410755.
- a target region is nucleotides 1490-1516 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1490-1516 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 235, 236, or 237.
- an antisense compound targeted to nucleotides 1490- 1516 of SEQ ID NO : 3 is selected from ISIS NOs: 410756, 405604, or 406033.
- a target region is nucleotides 1490-1564 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1490- 1564 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 235, 236, 237, 26, 238, 27, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 447, 28, 250, 251, 252, 253, 254, 255, or 256.
- an antisense compound targeted to nucleotides 1490-1564 of SEQ ID NO: 3 is selected from ISIS NOs: 410756, 405604, 406033, 395164, 399886, 406034,
- a target region is nucleotides 1500-1526 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1500- 1526 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 26, 238, 27, or 239.
- an antisense compound targeted to nucleotides 1500-1526 of SEQ ID NO: 3 is selected from ISIS NOs: 395164, 399886, 406034, 399800, 399956, or 406035.
- a target region is nucleotides 1515-1541 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1515-1541 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 240, 241, or 242.
- an antisense compound targeted to nucleotides 1515-1541 of SEQ ID NO: 3 is selected from ISIS NOs: 399886, 406034, 399800, 399956, or 406035.
- a target region is nucleotides 1527-1553 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1527-1553 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 243, 244, 245, 246, 247, 248, 447, 28 or 249. In certain such embodiments, an antisense compound targeted to nucleotides 1527-
- 1553 of SEQ ID NO: 3 is selected from ISIS NOs: 410536, 410583, 410658, 410537, 410584, 410659, 406038, 410585, 410660, 405877, 410586, 410661, 405878, 410587, 410662, 405879,
- a target region is nucleotides 1527-1554 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1527-1554 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 243, 244, 245, 246, 247, 248, 249, 447, 28, or 250.
- an antisense compound targeted to nucleotides 1527-1554 of SEQ ID NO: 3 is selected from ISIS NOs: 410536, 410583, 410658, 410537, 410584, 410659, 406038, 410585, 410660, 405877, 410586, 410661, 405878, 410587, 410662, 405879, 410588, 410663, 405880, 410589, 410664, 395165, 399887, 405881, 410590, 410666, or 410665.
- a target region is nucleotides 1528-1554 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1528-1554 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 244, 245, 246, 247, 248, 249, 447, 28, or 250. In certain such embodiments, an antisense compound targeted to nucleotides 1528-
- SEQ ID NO: 3 1554 of SEQ ID NO: 3 is selected from ISIS NOs: 410537, 410584, 410659, 406038, 410585, 410660, 405877, 410586, 410661, 405878, 410587, 410662, 405879, 410588, 410663, 405880, 410589, 410664, 395165, 399887, 409126, 410665, or 405881.
- a target region is nucleotides 1529-1555 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1529-1555 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 245, 246, 247, 248, 249, 447, 28, 250 or 251. In certain such embodiments, an antisense compound targeted to nucleotides 1529-
- SEQ ID NO: 3 1555 of SEQ ID NO: 3 is selected from ISIS NOs: 406038, 395165, 399887, 405877, 405878, 405879, 405880, 405881, 405882, 409126, 410585, 410586, 410587, 410588, 410589, 410590,
- a target region is nucleotides 1529-1556 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1529-1556 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 245, 246, 247, 248, 249, 447, 28, 250, 251 , or 252.
- an antisense compound targeted to nucleotides 1529-1556 of SEQ ID NO: 3 is selected from ISIS NOs: 406038, 395165, 399887, 405877, 405878, 405879, 405880, 405881, 405882, 405883, 409126, 410585, 410586, 410587, 410588, 410589, 410590, 410591, 410592, 410660, 410661, 410662, 410663, 410664, 410665, 410666,
- a target region is nucleotides 1530-1556 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1530-1556 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 246, 247, 248, 249, 447, 28, 250,
- an antisense compound targeted to nucleotides 1530- 1556 of SEQ ID NO: 3 is selected from ISIS NOs: 406038, 395165, 399887, 405877, 405878,
- a target region is nucleotides 1530-1557 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1530-1557 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 246, 247, 248, 249, 250, 251,
- an antisense compound targeted to nucleotides 1530-1557 of SEQ ID NO: 3 is selected from ISIS NOs: 395165, 399887, 405877, 405878, 405879, 405880, 405881, 405882, 405883, 405884, 409126, 410586, 410587, 410588, 410589, 410590, 410591, 410592, 410593, 410661, 410662, 410663, 410664, 410665, 410666, 410667,
- a target region is nucleotides 1531-1557 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1531-1557 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 247, 248, 249, 250, 251, 252,
- an antisense compound targeted to nucleotides 1531- 1557 of SEQ ID NO: 3 is selected from ISIS NOs: 395165, 399887, 405878, 405879, 405880, 405881, 405882, 405883, 405884, 409126, 410587, 410588, 410589, 410590, 410591, 410592, 410593, 410662, 410663, 410664, 410665, 410666, 410667, 410668, or 410669.
- a target region is nucleotides 1532-1551 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1532- 1551 of SEQ ID NO: 3.
- an antisense compound targeted to nucleotides 1532-1551 of SEQ ID NO: 3 is ISIS NO: 405879.
- a target region is nucleotides 1532-1558 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1532-1558 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 248, 249, 250, 251, 252, 253, 254 or 447. In certain such embodiments, an antisense compound targeted to nucleotides 1532-
- 1558 of SEQ ID NO: 3 is selected from ISIS NOs: 405879, 410588, 410663, 405880, 410589, 410664, 395165, 399887, 410665, 405881, 410590, 410666, 405882, 410591, 410667, 405883, 410592, 410668, 405884, 410593, 410669, 410538, 410594, or 410670.
- a target region is nucleotides 1533-1559 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1533-1559 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 249, 250, 251, 252, 253, 254, 255 or 447. In certain such embodiments, an antisense compound targeted to nucleotides 1533-
- SEQ ID NO: 3 1559 of SEQ ID NO: 3 is selected from ISIS NOs: 405880, 410589, 410664, 395165, 399887, 410665, 405881, 410590, 410666, 405882, 410591, 410667, 405883, 410592, 410668, 405884, 410593, 410669, 410538, 410594, 410670, 410539, 410595, or 410671.
- a target region is nucleotides 1534-1559 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1534- 1559 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 28, 250, 251, 252, 253, 254, 255 or 447.
- an antisense compound targeted to nucleotides 1534-1559 of SEQ ID NO: 3 is selected from ISIS NOs: 395165, 399887, 410665, 405881, 410590, 410666, 405882, 410591, 410667, 405883, 410592, 410668, 405884, 410593, 410669, 410538, 410594,
- a target region is nucleotides 1535-1559 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1535-1559 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 250, 251, 252, 253, 254, 255 or 447.
- an antisense compound targeted to nucleotides 1535-1559 of SEQ ID NO: 3 is selected from ISIS NOs: 405881, 410590, 410666, 405882, 410591, 410667, 405883, 410592, 410668, 405884, 410593, 410669, 410538, 410594 or 410671.
- a target region is nucleotides 1536-1559 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1536-1559 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 251, 252, 253, 254, or 255.
- an antisense compound targeted to nucleotides 1536-1559 of SEQ ID NO: 3 is selected from ISIS NOs: 405882, 410591, 410667, 405883, 410592, 410668, 405884, 410593, 410669, 410538, 410594, 410670, 410539, 410595, or 410671.
- a target region is nucleotides 1537-1564 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1537-1564 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 251, 252, 253, 254, 255, or 256.
- an antisense compound targeted to nucleotides 1537-1564 of SEQ ID NO: 3 is selected from ISIS NOs: 405882, 410591, 410667, 405883, 410592, 410668, 405884, 410593, 410669, 410538, 410594, 410670, 410539, 410595, 410671, or 410758.
- a target region is nucleotides 1566-1602 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1566-1602 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 29, 30, 31 , 32, 257, 258, 259, 260,
- an antisense compound targeted to nucleotides 1566- 1602 of SEQ ID NO: 3 is selected from ISIS NOs: 395166, 395167, 395168, 399801, 399888, 399889, 399890, 399957, 405909, 405910, 405911, 405912, 406039, 406040, 406041, 406042, 406043, or 406044.
- a target region is nucleotides 1566-1681 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1566-1681 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 29, 30, 31, 32, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, or 272.
- an antisense compound targeted to nucleotides 1566-1681 of SEQ ID NO: 3 is selected from ISIS NOs: 395166, 395167, 395168, 399801, 399888, 399889, 399890, 399957, 405909, 405910, 405911, 405912, 406039, 406040, 406041, 406042, 406043, 406044, 406045, 408642, 410759, 410760, 410761, or 410762.
- a target region is nucleotides 1606-1626 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1606-1626 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 264 or 31.
- an antisense compound targeted to nucleotides 1606-1626 of SEQ ID NO: 3 is selected from ISIS NOs: 408642, 395167, or 399889.
- a target region is nucleotides 1618-1645 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1618-1645 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 265 or 266.
- an antisense compound targeted to nucleotides 1618-1645 of SEQ ID NO: 3 is selected from ISIS NOs: 410760 or 406045.
- a target region is nucleotides 1626-1653 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1626-1653 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 32, 266, 267, 268, or 269.
- an antisense compound targeted to nucleotides 1626-1653 of SEQ ID NO: 3 is selected from ISIS NOs: 395168, 399890, 405909, 405910, 405911, or 406045.
- a target region is nucleotides 1684-1703 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1684-1703 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 273.
- an antisense compound targeted to nucleotides 1684-1703 of SEQ ID NO: 3 is selected from ISIS NOs: 410763.
- a target region is nucleotides 1730-1781 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1730-1781 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 33, 33, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, or 285.
- an antisense compound targeted to nucleotides 1730-1781 of SEQ ID NO: 3 is selected from ISIS Nos: 395169, 399891, 405913, 405914, 405915, 405916, 405917, 405918, 405919, 405920, 405921, 405922, 410734, or 410764.
- a target region is nucleotides 1740-1767 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1740-1767 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 33, 275, 276, 277, or 278.
- an antisense compound targeted to nucleotides 1740-1767 of SEQ ID NO: 3 is selected from ISIS NOs: 395169, 399891, 405913, 405914, 405915, or 405916.
- a target region is nucleotides 1749-1775 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1749-1775 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 279, 280, 281 or 282.
- an antisense compound targeted to nucleotides 1749-1775 of SEQ ID NO: 3 is selected from ISIS NOs: 410734, 405917, 405918 or 405919.
- a target region is nucleotides 1758-1781 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1758-1781 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 283, 284, or 285.
- an antisense compound targeted to nucleotides 1758-1781 of SEQ ID NO: 3 is selected from ISIS NOs: 405920, 405921, or 405922.
- a target region is nucleotides 1820-1847 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1820-1847 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 39, 306, 307, 308, or 309.
- an antisense compound targeted to nucleotides 1820-1847 of SEQ ID NO: 3 is selected from ISIS NOs: 395175, 399897, 405937, 405938, 405939, or 405940.
- a target region is nucleotides 1820-1877 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1820-1877 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 39, 40, 41, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, or 318.
- an antisense compound targeted to nucleotides 1820-1877 of SEQ ID NO: 3 is selected from ISIS NOs: 395175, 399804, 399805, 399897, 399960, 399961, 405937, 405938, 405939, 405940, 405941, 405942, 405943, 405944, 405945, 405946, 405947, 410737, or 410769.
- a target region is nucleotides 1822-2198 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1822-2198 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 39, 307, 308, 309, 310, 40, 311, 312, 313, 314, 315, 41, 41, 316, 317, 318, 101, 319, 42, 320, 321, 322, 43, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 44, 335, 336, 337, 45, 338, 46, 339, 340, 47, 341, 342, 48, 343, 344, 345, 346, 347, 3, or 366.
- an antisense compound targeted to nucleotides 1822-2198 of SEQ ID NO: 3 is selected from ISIS NOs: 395175, 399897, 405938, 405939, 405940, 405941, 399804, 399960, 405942, 405943, 410737, 405944, 405945, 399805, 399961, 405946, 405947, 410769, 395176, 399898, 405948, 399806, 399962, 405949, 405950, 405951, 399807, 399963, 405952, 410738, 405953, 405954, or 405979.
- a target region is nucleotides 1830-1856 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1830-1856 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 40, 310, 311, or 312.
- an antisense compound targeted to nucleotides 1830-1856 of SEQ ID NO: 3 is selected from ISIS NOs: 399804, 399960, 405941, 405942, or 405943.
- a target region is nucleotides 1839-1865 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1839-1865 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 41, 313, 314, 315, or 316.
- an antisense compound targeted to nucleotides 1839-1865 of SEQ ID NO: 3 is selected from ISIS NOs: 399805, 399961, 405944, 405945, 405946, or 410737.
- a target region is nucleotides 1840- 1867 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1840-1867 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 314, 315, 316, or 317.
- an antisense compound targeted to nucleotides 1840-1867 of SEQ ID NO: 3 is selected from ISIS NOs: 399961, 405944, 405945, 405946, 410737, or 405947.
- a target region is nucleotides 1898-1924 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1898-1924 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 42, 101, 319, or 320.
- an antisense compound targeted to nucleotides 1898-1924 of SEQ ID NO: 3 is selected from ISIS NOs: 395176, 399898, 405948, 399806, 399962, 405949, or 405949.
- a target region is nucleotides 1898-2035 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1898-2035 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 87, 101, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, or 359.
- an antisense compound targeted to nucleotides 1898-2035 of SEQ ID NO: 3 is selected from ISIS NOs: 395176, 395177, 395178, 395179, 399806, 399807, 399808, 399809, 399810, 399811, 399812, 399813, 399898, 399899, 399900, 399901, 399962, 399963, 399964, 399965, 399966, 399967, 399968, 399969, 405885, 405886, 405887, 405888, 405889, 405890, 405891, 405892, 405948, 405949, 405950, 405951, 405952, 405953, 405954, 405955, 405956, 405957, 405958, 405959, 405960, 405961, 405962, 405963, 405964, 405965, 405966, 405967, 405968, 405969, 4059
- a target region is nucleotides 1903-2127 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1903-2127 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 42, 320, 321, 322, 43, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 44, 335, 336, 337, 45, 338, 46, 339, 340, 47, 341, 342, 48, 343, 344, 345, 346, 347, 348, 349, 49, 350, 351, 352, 353, 50, 354, 355, 356, 357, 87, 358, 359, 51, 119, 360, or 54.
- an antisense compound targeted to nucleotides 1903-2127 of SEQ ID NO: 3 is selected from ISIS NOs: 399806, 399962, 405949, 405950, 405951, 399807, 399963, 405952, 410738, 405953, 405954, 410770, 405955, 405956, 405957, 405958, 405959, 405960, 405961, 399808, 399964, 405962, 410739, 405963, 395177, 399899, 405964, 399809, 399965, 405965, 405966, 399810, or 399967.
- a target region is nucleotides 1907-1934 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1907-1934 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 43, 321, 322, 323, or 324.
- an antisense compound targeted to nucleotides 1907-1934 of SEQ ID NO: 3 is selected from ISIS NOs: 405950, 405951, 399807, 399963, 405952, or 410738.
- a target region is nucleotides 1911-1938 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1911-1938 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 43, 323, 324, 325, or 326.
- an antisense compound targeted to nucleotides 1911 - 1938 of SEQ ID NO: 3 is selected from ISIS NOs: 399807, 399963, 405952, 410738, 405953, or 405954.
- a target region is nucleotides 1946-1971 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1946-1971 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 328, 329, 330, or 331.
- an antisense compound targeted to nucleotides 1946-1971 of SEQ ID NO: 3 is selected from ISIS NOs: 405955, 405956, 405957, or 405958.
- a target region is nucleotides 1954-1980 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1954-1980 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 44, 332, 333, 334, or 335.
- an antisense compound targeted to nucleotides 1954-1980 of SEQ ID NO: 3 is selected from ISIS NOs: 405959, 405960, 405961, 399808, 399964, or 405962.
- a target region is nucleotides 1959-2035 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1959-2035 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 44, 335, 336, 337, 45, 338, 46, 339, 340, 47, 341, 342, 48, 343, 344, 345, 346, 347, 348, 349, 49, 350, 351, 352, 353, 50, 354, 355, 356, 357, 87, 358, 359, or 51.
- an antisense compound targeted to nucleotides 1959-2035 of SEQ ID NO: 3 is selected from ISIS NOs: 399808, 399964, 405962, 410739, 405963, 395177, 399899, 405964, 399809, 399965, 405965, 405966, 399810, 399966, 405967, 405968, 399811, 399967, 405969, 405970, 410740, 405885, 405886, 405887, 410596, 410672, 405888, 410597, 410673, 399812, 399968, 410674, or 399969.
- a target region is nucleotides 1959-2057 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1959-2057 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 44, 335, 336, 337, 45, 338, 46, 339, 340, 47, 341, 342, 48, 343, 344, 345, 346, 347, 348, 349, 49, 350, 351, 352, 353, 50, 354, 355, 356, 357, 87, 358, 359, 51, or 119.
- an antisense compound targeted to nucleotides 1959-2057 of SEQ ID NO: 3 is selected from ISIS NOs: 399808, 399964, 405962, 410739, 405963, 395177, 399899, 405964, 399809, 399965, 405965, 405966, 399810, 399966, 405967, 405968, 399811, 399967, 405969, 405970, 410740, 405885, 405886, 405887, 410596, 410672, 405888, 410597, 410673, 399812, 399968, 410674, or 399902.
- a target region is nucleotides 1963-1988 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1963-1988 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 45, 336, 337 or 338.
- an antisense compound targeted to nucleotides 1963-1988 of SEQ ID NO: 3 is selected from ISIS NOs: 410739, 405963, 395177, 399899, or 405964.
- a target region is nucleotides 1967-2035 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1967-2035 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 45, 338, 46, 339, 340, 47, 341, 342, 48, 343, 344, 345, 346, 347, 348, 349, 49, 350, 351, 352, 353, 50, 354, 355, 356, 357, 87, 358, 359 or 51.
- an antisense compound targeted to nucleotides 1967- 2035 of SEQ ID NO: 3 is selected from ISIS NOs: 395177, 399899, 405964, 399809, 399965, 405965, 405966, 399810, 399966, 405967, 405968, 399811, 399967, 405969, 405970, 410740,
- a target region is nucleotides 1972-1999 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1972-1999 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 46, 47, 339, 340, or 341.
- an antisense compound targeted to nucleotides 1972-1999 of SEQ ID NO: 3 is selected from ISIS NOs: 399809, 399965, 405965, 405966, 399810, 399966, or 405967.
- a target region is nucleotides 1982-2008 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1982-2008 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 48, 342, 343, or 344.
- an antisense compound targeted to nucleotides 1982-2008 of SEQ ID NO: 3 is selected from ISIS NOs: 405968, 399811, 399967, 405969, or 405970.
- a target region is nucleotides 1991-2018 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1991-2018 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 49, 345, 346, 347, 348, 349, 350, or 351.
- an antisense compound targeted to nucleotides 1991-2018 of SEQ ID NO: 3 is selected from ISIS NOs: 399812, 399968, 405885, 405886, 405887, 405888, 405889, 405890, 410596, 410597, 410598, 410599, 410672, 410673, 410674, 410675, 410676, or 410740.
- a target region is nucleotides 1993-2019 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1993-2019 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 49, 346, 347, 348, 349, 350, or 354.
- an antisense compound targeted to nucleotides 1993-2019 of SEQ ID NO: 3 is selected from ISIS NOs: 405885, 405887, 410596, 410672, 405888, 410597, 410673, 399812, 399968, 410674, 405889, 410598, 410675, 405890, 410599, 410676, 405891, 410600, or 410677.
- a target region is nucleotides 1995-2022 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1995-2022 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 348, 349, 350, 351, 352, 353, 50, or 351
- an antisense compound targeted to nucleotides 1995-2022 of SEQ ID NO: 3 is selected from ISIS NOs: 405887, 410596, 410672, 405888, 410597, 410673, 399812, 399968, 410674, 405889, 410598, 410675, 405890, 410599, 410676, 405891, 410600, 405892, 410601, 410678, 395178, 399900, 410679, 408653, 410602, or 410680.
- a target region is nucleotides 1996-2023 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1996-2023 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 49, 50, 349, 350, 351, 352, 353,
- an antisense compound targeted to nucleotides 1996- 2023 of SEQ ID NO: 3 is selected from ISIS NOs: 395178, 399812, 399900, 399968, 405888,
- a target region is nucleotides 1997-2024 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1997-2024 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 49, 50, 350, 351, 352, 353, 354,
- 2024 of SEQ ID NO: 3 is selected from ISIS NOs: 399812, 399968, 410674, 405889, 410598, 410675, 405890, 410599, 410676, 405891, 410600, 410677, 405892, 410601, 410678, 395178,
- a target region is nucleotides 1998-2025 of SEQ ID NO: 3.
- an antisense compound is targeted to nucleotides 1998-2025 of SEQ ID NO: 3.
- an antisense compound targeted to a PCSK9 nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 50, 350, 351, 352, 353, 354, 355, 356 or 357.
Abstract
L'invention porte sur des composés antisens et sur des procédés pour diminuer le cholestérol associé aux lipoprotéines basse densité (LDL-C) chez un individu ayant un taux de LDL-C élevé. De plus, l'invention porte sur des composés antisens et sur des procédés pour traiter, prévenir ou améliorer l’hypercholestérolémie et/ou l’athérosclérose. L'invention porte en outre sur des composés antisens et sur des procédés pour diminuer un risque de coronaropathie. De tels procédés comprennent l'administration, à un individu ayant besoin d'un traitement, d'un composé antisens ciblé vers un acide nucléique PCSK9. Les composés antisens administrés comprennent des oligonucléotides antisens « gapmères ».
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US5870708P | 2008-06-04 | 2008-06-04 | |
US61/058,707 | 2008-06-04 | ||
US5916908P | 2008-06-05 | 2008-06-05 | |
US61/059,169 | 2008-06-05 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2009148605A2 true WO2009148605A2 (fr) | 2009-12-10 |
WO2009148605A3 WO2009148605A3 (fr) | 2010-04-01 |
Family
ID=41203920
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2009/003398 WO2009148605A2 (fr) | 2008-06-04 | 2009-06-04 | Procédés pour traiter une hypercholestérolémie |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2009148605A2 (fr) |
Cited By (30)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8084437B2 (en) | 2006-11-27 | 2011-12-27 | Isis Pharmaceuticals, Inc. | Methods for treating hypercholesterolemia |
US8093222B2 (en) | 2006-11-27 | 2012-01-10 | Isis Pharmaceuticals, Inc. | Methods for treating hypercholesterolemia |
EP2612914A1 (fr) * | 2010-08-31 | 2013-07-10 | Osaka University | Oligonucléotide, et agent thérapeutique pour la dyslipidémie contenant l'oligonucléotide comme ingrédient actif |
US8563528B2 (en) | 2009-07-21 | 2013-10-22 | Santaris Pharma A/S | Antisense oligomers targeting PCSK9 |
WO2014076195A1 (fr) | 2012-11-15 | 2014-05-22 | Santaris Pharma A/S | Conjugués d'oligonucléotides |
WO2014118267A1 (fr) | 2013-01-30 | 2014-08-07 | Santaris Pharma A/S | Conjugués glucidiques d'oligonucléotides d'acides nucléiques bloqués |
WO2014202022A1 (fr) * | 2013-06-21 | 2014-12-24 | 四川大学华西医院 | Procédé de préparation d'un modèle de diabète sucré de type 2 chez le macaque rhésus |
WO2014207232A1 (fr) * | 2013-06-27 | 2014-12-31 | Santaris Pharma A/S | Oligomères antisens et conjugués ciblant pcsk9 |
US9394333B2 (en) | 2008-12-02 | 2016-07-19 | Wave Life Sciences Japan | Method for the synthesis of phosphorus atom modified nucleic acids |
US9598458B2 (en) | 2012-07-13 | 2017-03-21 | Wave Life Sciences Japan, Inc. | Asymmetric auxiliary group |
US9605019B2 (en) | 2011-07-19 | 2017-03-28 | Wave Life Sciences Ltd. | Methods for the synthesis of functionalized nucleic acids |
US9617547B2 (en) | 2012-07-13 | 2017-04-11 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant |
CN106947825A (zh) * | 2017-04-25 | 2017-07-14 | 华南理工大学 | 用于食蟹猴起源(亚群)鉴定的snp标记及其应用 |
US9744183B2 (en) | 2009-07-06 | 2017-08-29 | Wave Life Sciences Ltd. | Nucleic acid prodrugs and methods of use thereof |
US9982257B2 (en) | 2012-07-13 | 2018-05-29 | Wave Life Sciences Ltd. | Chiral control |
WO2018175839A1 (fr) * | 2017-03-24 | 2018-09-27 | Ionis Pharmaceutical, Inc. | Modulateurs de l'expression de pcsk9 |
US10144933B2 (en) | 2014-01-15 | 2018-12-04 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator |
US10149905B2 (en) | 2014-01-15 | 2018-12-11 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant having antitumor effect and antitumor agent |
US10160969B2 (en) | 2014-01-16 | 2018-12-25 | Wave Life Sciences Ltd. | Chiral design |
US10322173B2 (en) | 2014-01-15 | 2019-06-18 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent |
US10428019B2 (en) | 2010-09-24 | 2019-10-01 | Wave Life Sciences Ltd. | Chiral auxiliaries |
US10479995B2 (en) | 2015-07-22 | 2019-11-19 | Wave Life Sciences Ltd. | Oligonucleotide compositions and methods thereof |
US10570169B2 (en) | 2014-05-22 | 2020-02-25 | Ionis Pharmaceuticals, Inc. | Conjugated antisense compounds and their use |
US10724035B2 (en) | 2016-05-04 | 2020-07-28 | Wave Life Sciences Ltd. | Oligonucleotide compositions and methods thereof |
US10883104B2 (en) | 2013-05-01 | 2021-01-05 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating apolipoprotein (a) expression |
WO2022002160A1 (fr) * | 2020-07-01 | 2022-01-06 | 陈敏 | Utilisation d'un inhibiteur de pcsk9 dans la préparation d'un médicament destiné au traitement de multiples maladies |
US11225664B2 (en) | 2010-01-08 | 2022-01-18 | Ionis Pharmaceuticals, Inc. | Modulation of angiopoietin-like 3 expression |
US11400161B2 (en) | 2016-10-06 | 2022-08-02 | Ionis Pharmaceuticals, Inc. | Method of conjugating oligomeric compounds |
EP4035659A1 (fr) | 2016-11-29 | 2022-08-03 | PureTech LYT, Inc. | Exosomes destinés à l'administration d'agents thérapeutiques |
WO2023011360A1 (fr) * | 2021-08-02 | 2023-02-09 | 成都凌泰氪生物技术有限公司 | Méthode d'amélioration de la capacité de libération prolongée d'un médicament à base d'acide nucléique |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003011887A2 (fr) * | 2001-08-01 | 2003-02-13 | Isis Pharmaceuticals, Inc. | Modulation antisens de l'expression de l'apolipoproteine b |
WO2007131237A2 (fr) * | 2006-05-05 | 2007-11-15 | Isis Pharmaceuticals, Inc. | Composés et procédés permettant de moduler l'expression de la protéine ptp1b |
WO2008043753A2 (fr) * | 2006-10-09 | 2008-04-17 | Santaris Pharma A/S | Composés antagonistes de l'arn pour la modulation de pcsk9 |
WO2008066776A2 (fr) * | 2006-11-27 | 2008-06-05 | Isis Pharmaceuticals, Inc. | Procédés pour traiter l'hypercholestérolémie |
-
2009
- 2009-06-04 WO PCT/US2009/003398 patent/WO2009148605A2/fr active Application Filing
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003011887A2 (fr) * | 2001-08-01 | 2003-02-13 | Isis Pharmaceuticals, Inc. | Modulation antisens de l'expression de l'apolipoproteine b |
WO2007131237A2 (fr) * | 2006-05-05 | 2007-11-15 | Isis Pharmaceuticals, Inc. | Composés et procédés permettant de moduler l'expression de la protéine ptp1b |
WO2008043753A2 (fr) * | 2006-10-09 | 2008-04-17 | Santaris Pharma A/S | Composés antagonistes de l'arn pour la modulation de pcsk9 |
WO2008066776A2 (fr) * | 2006-11-27 | 2008-06-05 | Isis Pharmaceuticals, Inc. | Procédés pour traiter l'hypercholestérolémie |
Non-Patent Citations (1)
Title |
---|
GRAHAM MARK J ET AL: "Antisense inhibition of proprotein convertase subtilisin/kexin type 9 reduces serum LDL in hyperlipidemic mice" JOURNAL OF LIPID RESEARCH, vol. 48, no. 4, April 2007 (2007-04), pages 763-767, XP002565438 ISSN: 0022-2275 * |
Cited By (59)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8912160B2 (en) | 2006-11-27 | 2014-12-16 | Isis Pharmaceuticals, Inc. | Methods for treating hypercholesterolemia |
US8093222B2 (en) | 2006-11-27 | 2012-01-10 | Isis Pharmaceuticals, Inc. | Methods for treating hypercholesterolemia |
US9650636B2 (en) | 2006-11-27 | 2017-05-16 | Ionis Pharmaceuticals, Inc. | Methods for treating hypercholesterolemia |
US11530410B2 (en) | 2006-11-27 | 2022-12-20 | Ionis Pharmaceuticals, Inc. | Methods for treating hypercholesterolemia |
US8664190B2 (en) | 2006-11-27 | 2014-03-04 | Isis Pharmaceuticals, Inc. | Methods for treating hypercholesterolemia |
US8084437B2 (en) | 2006-11-27 | 2011-12-27 | Isis Pharmaceuticals, Inc. | Methods for treating hypercholesterolemia |
US9394333B2 (en) | 2008-12-02 | 2016-07-19 | Wave Life Sciences Japan | Method for the synthesis of phosphorus atom modified nucleic acids |
US10329318B2 (en) | 2008-12-02 | 2019-06-25 | Wave Life Sciences Ltd. | Method for the synthesis of phosphorus atom modified nucleic acids |
US9695211B2 (en) | 2008-12-02 | 2017-07-04 | Wave Life Sciences Japan, Inc. | Method for the synthesis of phosphorus atom modified nucleic acids |
US10307434B2 (en) | 2009-07-06 | 2019-06-04 | Wave Life Sciences Ltd. | Nucleic acid prodrugs and methods of use thereof |
US9744183B2 (en) | 2009-07-06 | 2017-08-29 | Wave Life Sciences Ltd. | Nucleic acid prodrugs and methods of use thereof |
US8563528B2 (en) | 2009-07-21 | 2013-10-22 | Santaris Pharma A/S | Antisense oligomers targeting PCSK9 |
US11225664B2 (en) | 2010-01-08 | 2022-01-18 | Ionis Pharmaceuticals, Inc. | Modulation of angiopoietin-like 3 expression |
EP2612914A4 (fr) * | 2010-08-31 | 2014-12-31 | Univ Osaka | Oligonucléotide, et agent thérapeutique pour la dyslipidémie contenant l'oligonucléotide comme ingrédient actif |
EP2612914A1 (fr) * | 2010-08-31 | 2013-07-10 | Osaka University | Oligonucléotide, et agent thérapeutique pour la dyslipidémie contenant l'oligonucléotide comme ingrédient actif |
US10428019B2 (en) | 2010-09-24 | 2019-10-01 | Wave Life Sciences Ltd. | Chiral auxiliaries |
US9605019B2 (en) | 2011-07-19 | 2017-03-28 | Wave Life Sciences Ltd. | Methods for the synthesis of functionalized nucleic acids |
US10280192B2 (en) | 2011-07-19 | 2019-05-07 | Wave Life Sciences Ltd. | Methods for the synthesis of functionalized nucleic acids |
US9617547B2 (en) | 2012-07-13 | 2017-04-11 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant |
US10167309B2 (en) | 2012-07-13 | 2019-01-01 | Wave Life Sciences Ltd. | Asymmetric auxiliary group |
US9598458B2 (en) | 2012-07-13 | 2017-03-21 | Wave Life Sciences Japan, Inc. | Asymmetric auxiliary group |
US9982257B2 (en) | 2012-07-13 | 2018-05-29 | Wave Life Sciences Ltd. | Chiral control |
US10590413B2 (en) | 2012-07-13 | 2020-03-17 | Wave Life Sciences Ltd. | Chiral control |
US11155816B2 (en) | 2012-11-15 | 2021-10-26 | Roche Innovation Center Copenhagen A/S | Oligonucleotide conjugates |
US10077443B2 (en) | 2012-11-15 | 2018-09-18 | Roche Innovation Center Copenhagen A/S | Oligonucleotide conjugates |
EP3406718A1 (fr) | 2012-11-15 | 2018-11-28 | Roche Innovation Center Copenhagen A/S | Conjugués d'oligonucléotides |
WO2014076195A1 (fr) | 2012-11-15 | 2014-05-22 | Santaris Pharma A/S | Conjugués d'oligonucléotides |
WO2014118267A1 (fr) | 2013-01-30 | 2014-08-07 | Santaris Pharma A/S | Conjugués glucidiques d'oligonucléotides d'acides nucléiques bloqués |
US10883104B2 (en) | 2013-05-01 | 2021-01-05 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating apolipoprotein (a) expression |
US11299736B1 (en) | 2013-05-01 | 2022-04-12 | Ionis Pharmaceuticals, Inc. | Conjugated antisense compounds and their use |
US11851655B2 (en) | 2013-05-01 | 2023-12-26 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating apolipoprotein (a) expression |
WO2014202022A1 (fr) * | 2013-06-21 | 2014-12-24 | 四川大学华西医院 | Procédé de préparation d'un modèle de diabète sucré de type 2 chez le macaque rhésus |
EP3591054A1 (fr) * | 2013-06-27 | 2020-01-08 | Roche Innovation Center Copenhagen A/S | Oligomères et conjugués antisens ciblant pcsk9 |
CN105358692B (zh) * | 2013-06-27 | 2020-08-21 | 罗氏创新中心哥本哈根有限公司 | 靶向pcsk9的反义寡聚体和缀合物 |
US10370668B2 (en) | 2013-06-27 | 2019-08-06 | Roche Innovation Center Copenhagen A/S | Manufacture of antisense oligomers and conjugates targeting PCSK9 |
US10385342B2 (en) | 2013-06-27 | 2019-08-20 | Roche Innovation Center Copenhagen A/S | Methods of treatment using antisense oligomers and conjugates targeting PCSK9 |
US9879265B2 (en) | 2013-06-27 | 2018-01-30 | Roche Innovation Center Copenhagen A/S | Oligonucleotide conjugates |
US10443058B2 (en) | 2013-06-27 | 2019-10-15 | Roche Innovation Center Copenhagen A/S | Antisense oligomers targeting PCSK9 |
WO2014207232A1 (fr) * | 2013-06-27 | 2014-12-31 | Santaris Pharma A/S | Oligomères antisens et conjugués ciblant pcsk9 |
US11739332B2 (en) | 2013-06-27 | 2023-08-29 | Roche Innovation Center Copenhagen A/S | Antisense oligomers targeting PCSK9 |
AU2014300981B2 (en) * | 2013-06-27 | 2017-08-10 | Roche Innovation Center Copenhagen A/S | Antisense oligomers and conjugates targeting PCSK9 |
CN105358692A (zh) * | 2013-06-27 | 2016-02-24 | 罗氏创新中心哥本哈根有限公司 | 靶向pcsk9的反义寡聚体和缀合物 |
US10322173B2 (en) | 2014-01-15 | 2019-06-18 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent |
US10149905B2 (en) | 2014-01-15 | 2018-12-11 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant having antitumor effect and antitumor agent |
US10144933B2 (en) | 2014-01-15 | 2018-12-04 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator |
US10160969B2 (en) | 2014-01-16 | 2018-12-25 | Wave Life Sciences Ltd. | Chiral design |
US10570169B2 (en) | 2014-05-22 | 2020-02-25 | Ionis Pharmaceuticals, Inc. | Conjugated antisense compounds and their use |
US10479995B2 (en) | 2015-07-22 | 2019-11-19 | Wave Life Sciences Ltd. | Oligonucleotide compositions and methods thereof |
US10724035B2 (en) | 2016-05-04 | 2020-07-28 | Wave Life Sciences Ltd. | Oligonucleotide compositions and methods thereof |
US11400161B2 (en) | 2016-10-06 | 2022-08-02 | Ionis Pharmaceuticals, Inc. | Method of conjugating oligomeric compounds |
EP4035659A1 (fr) | 2016-11-29 | 2022-08-03 | PureTech LYT, Inc. | Exosomes destinés à l'administration d'agents thérapeutiques |
US11000595B2 (en) | 2017-03-24 | 2021-05-11 | Ionis Pharmaceuticals, Inc. | Modulators of PCSK9 expression |
WO2018175839A1 (fr) * | 2017-03-24 | 2018-09-27 | Ionis Pharmaceutical, Inc. | Modulateurs de l'expression de pcsk9 |
US11633483B2 (en) | 2017-03-24 | 2023-04-25 | Ionis Pharmaceuticals, Inc. | Modulators of PCSK9 expression |
US10517953B2 (en) | 2017-03-24 | 2019-12-31 | Ionis Pharmaceuticals, Inc. | Modulators of PCSK9 expression |
CN110446784A (zh) * | 2017-03-24 | 2019-11-12 | Ionis制药公司 | Pcsk9表达的调节剂 |
CN106947825A (zh) * | 2017-04-25 | 2017-07-14 | 华南理工大学 | 用于食蟹猴起源(亚群)鉴定的snp标记及其应用 |
WO2022002160A1 (fr) * | 2020-07-01 | 2022-01-06 | 陈敏 | Utilisation d'un inhibiteur de pcsk9 dans la préparation d'un médicament destiné au traitement de multiples maladies |
WO2023011360A1 (fr) * | 2021-08-02 | 2023-02-09 | 成都凌泰氪生物技术有限公司 | Méthode d'amélioration de la capacité de libération prolongée d'un médicament à base d'acide nucléique |
Also Published As
Publication number | Publication date |
---|---|
WO2009148605A3 (fr) | 2010-04-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US11530410B2 (en) | Methods for treating hypercholesterolemia | |
US8084437B2 (en) | Methods for treating hypercholesterolemia | |
US11225664B2 (en) | Modulation of angiopoietin-like 3 expression | |
WO2009148605A2 (fr) | Procédés pour traiter une hypercholestérolémie | |
US20130053430A1 (en) | Modulation of cetp expression | |
AU2017201078C1 (en) | Modulation of angiopoietin-like 3 expression |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09758768 Country of ref document: EP Kind code of ref document: A2 |
|
NENP | Non-entry into the national phase in: |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 09758768 Country of ref document: EP Kind code of ref document: A2 |