WO2009095786A2 - Methods and kits for the rapid determination of patients at high risk of death during septic shock - Google Patents

Methods and kits for the rapid determination of patients at high risk of death during septic shock Download PDF

Info

Publication number
WO2009095786A2
WO2009095786A2 PCT/IB2009/000292 IB2009000292W WO2009095786A2 WO 2009095786 A2 WO2009095786 A2 WO 2009095786A2 IB 2009000292 W IB2009000292 W IB 2009000292W WO 2009095786 A2 WO2009095786 A2 WO 2009095786A2
Authority
WO
WIPO (PCT)
Prior art keywords
hla
drb4
genes
areg
fosb
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2009/000292
Other languages
English (en)
French (fr)
Other versions
WO2009095786A3 (en
Inventor
Didier Payen De La Garanderie
Anne-Claire Lukaszewicz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Assistance Publique Hopitaux de Paris APHP
Original Assignee
Assistance Publique Hopitaux de Paris APHP
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Assistance Publique Hopitaux de Paris APHP filed Critical Assistance Publique Hopitaux de Paris APHP
Priority to CA2713839A priority Critical patent/CA2713839A1/en
Priority to JP2010544810A priority patent/JP2011510650A/ja
Priority to EP09705033A priority patent/EP2245194A2/en
Priority to US12/865,536 priority patent/US20110190143A1/en
Publication of WO2009095786A2 publication Critical patent/WO2009095786A2/en
Publication of WO2009095786A3 publication Critical patent/WO2009095786A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the present invention relates to the field of treatment of serious medical syndromes such as severe sepsis or septic shock.
  • the present invention provides methods and kits to obtain an early evaluation of mortality risk and help therapeutic decisions for patients in severe sepsis with two organ failures, for example for patients in septic shock with one additional organ failure.
  • Septic shock is the most severe clinical presentation of sepsis, with a poor prognosis despite intensive therapeutic support and anti-infectious strategy to eradicate the infection foci.
  • the sepsis syndrome is defined as symptoms related to the host response to abnormal presence of micro-organisms or their antigenic fractions.
  • the local infection might spread out for different reasons to the whole body, with a particular activation of blood immune cells controlling the innate immunity during the early phase and activation of the adaptive immunity in a second time.
  • Such an intense immune activation in blood may in turn target organs that were not initially concerned by the initial infection, leading to immune toxicity and dysfunction of these organs.
  • the high mortality rate of septic shock results from a combination of organ failures, comorbidities and virulence of micro-organisms. Death may occur at different times of evolution, most often during the first week despite intensive resuscitation.
  • septic shock primarily consists of antimicrobial chemotherapy, removal of the source of infection when it is possible, and support of organ failure.
  • Other proposed pathophysiological therapies are still under evaluation.
  • corticosteroids especially if combined with a mineralocorticoid, could reduce mortality among patients who have relative adrenal insufficiency (Annane and Bellayne, 2000).
  • APC Activated Protein C
  • the inventors have made the hypothesis that a limited number of positive or negative gene expression modifications in blood white cells may enable to identify patients at high risk of death, in comparison with patients with good prognosis.
  • the micro-array technology performed with a pangenomic micro- chip on white blood cells of 48 patients having a septic shock, the inventors have identified a profile of early gene expression which is indicative of a good or a poor prognosis.
  • these results have been validated by real time PCR applied to some of the found genes of interest. For one of these genes, encoding the HLA-DRB4 molecule, the gene expression differed so strongly at day 0 between survivals and dead patients that a genotyping of this gene was performed. This showed the presence or the absence of this gene according to its expression.
  • the present invention hence provides an early biological footprint or profile indicative of outcome of patients in severe sepsis with at least two organ failures, and in particular, for patients in septic shock with at least one additional organ failure.
  • This footprint can be obtained by microarray or by any other technique, such as real time PCR, which is the most efficient one to date, in terms of sensitivity and rapidity (a few hours).
  • the status of HLA-DRB4 can also be determined by genotyping.
  • a genomic and/or genotyping test according to the present invention can be used for outcome prediction in a few hours after the onset of septic shock, but also to determine which patients will be candidate to receive innovative drugs. This later pharmacogenomic aspect might have an important impact on the cost of septic shock treatment, since these innovative drugs will be more adequately used.
  • the test can also be used to check a patient's response to a given treatment.
  • PCA principal component analysis
  • the upper part shows the dendrogram for 29 sets of probes, the lower part the dendrogram for 8 sets of probes. Probes sets intensities were selected according to criteria FC>2 and p- value ⁇ 0.1.
  • Figure 3 shows the diagram of Kaplan-Meier from day 0 to day 28 according to the B4 expression status. It shows a dramatic difference in mortality between HLA-DRB4+ and HLA-DRB4- gene expression at day 0.
  • Figure 4 shows the ROC (Receiving Operator Characteristics) curves generated by cross validation and represents the specificity (Sp) and sensibility (Ss) according to the chosen threshold for cutting in the model built with 29 (A) or 8 (B) sets of probes.
  • Sp Specificity
  • Ss sensibility
  • a "severe sepsis” is defined as a sepsis syndrome with at least one organ dysfunction
  • a "septic shock” is defined as a severe sepsis syndrome with hypotension requiring vasopressors (which constitutes a first organ failure);
  • day 0 designates the 24-hours period of severe sepsis after the onset of two organ failures; in the particular case of septic shock, day 0 hence designates the 24-hours period of septic shock after the onset of a second organ failure;
  • HLA-DRB4 designates, depending on the context, either the protein or the gene encoding it.
  • HLA-DRB4 can be detected either at the genomic level (DNA), or at the mRNA level, or at the protein level.
  • DNA genomic level
  • mRNA transcription level
  • protein translation level
  • a "representative cohort” is a cohort of patients who have undergone a severe sepsis with at least two organ failures, wherein the outcome of said severe sepsis is known.
  • a representative cohort must comprise at least 40 patients, with at least 10 in each group (surviving vs/ dead). The patients must have been cared according to the recommendations of -the Surviving Sepsis Campaign (Dellinger et al., 2008),-Of- course, the skilled artisan can chose to use a more numerous cohort for implementing the present invention, and the members of the representative cohort must have been chosen without any selection bias.
  • over-expression and "under-expression" of a gene in a subject is determined by comparing the level of expression of said gene to the mean expression of the same gene in a representative cohort (including all the subjects of the cohort), it being understood that the level of expression of said gene in said subject is measured by using the same technique as was used for measuring the level of expression of the same gene in the subjects of the cohort.
  • a gene will then be considered as over-expressed if its expression is superior (fold change > 1.2) to the mean expression in the representative cohort, and under-expressed if it is inferior (fold change ⁇ -1.2) to said mean expression.
  • the invention pertains to the use of one gene or a set of two, three, four or more genes selected amongst HLA-DRB4 (human leucocyte antigen-DRB4), FOSB (FBJ murine osteosarcoma viral oncogene homolog B), GPR109B (G-protein coupled receptor, HM74), RBP7 (retinol binding protein 7), TLR7 (Toll like receptor 7), AREG (amphiregulin), THBSl (thrombospondin 1), CTSLl (cathepsin Ll), IL 15 (interleukin 15), HLA-C (major histocompatibility complex, class I, C), AMFR (autocrine motility factor receptor), LOC96610 (hypothetical protein similar to KIAAOl 87 gene product), IRF5 (interferon regulatory factor 5), MGC29506 (hypothetical protein MGC29506), EDG3 (endothelial differentiation, sphingolipid G-protein
  • the use of the same gene or set of genes, as a marker for helping a physician in determining a therapeutic strategy and/or in determining the impact of a drug for a patient in severe sepsis with at least two organ failures is also part of the present invention.
  • at least one, two or three of said gene(s) is/are selected amongst HLA-DRB4, AREG, FOSB, GPRl 09B, RBP7, TLR7, THBSl and CTLSl, and even more preferably in the group consisting of HLA-DRB4, AREG and FOSB.
  • the present invention also concerns a method for in vitro establishing a prognosis for a subject in severe sepsis with at least two organ failures, comprising the following steps: (i) from a sample from said subject, obtaining an expression profile of a set of genes, wherein said set of genes comprises at least two genes selected amongst HLA-DRB4, FOSB, GPR109B, RBP7, TLR7, IL15, HLA-C, AMFR, LOC96610, IRF5, MGC29506, EDG3, IGLVl -44, IFIT2, IFI44, EPSTIl, TNFRSF17, AREG, THBSl, CTLSl, TFPI, PHACTR2, PFKFB2 and CHITl; and (ii) comparing said obtained expression profile to one or two reference expression profile(s) to establish a prognosis for said subject.
  • the reference expression profile(s) is (are) obtained from a representative cohort.
  • the same technology will be used to establish the reference profile(s) and to obtain the expression profile of a tested subject.
  • the reference profile can be obtained by determining, for each gene of the considered set of genes, the mean expression level of said gene in the whole representative cohort.
  • the different components of said profiles are advantageously weighted, using any appropriate statistical method which provides for greater statistical power than independent comparison of each of said components.
  • n (n > 2) genes are measured in a biological sample from said patient, wherein at least two of these genes are selected in the group consisting of HLA-DRB4, FOSB, GPR109B, RBP7, TLR7, IL15, HLA-C,
  • AMFR AMFR, LOC96610, IRF5, MGC29506, EDG3, IGLV 1-44, IFIT2, IFI44, EPSTIl,
  • TNFRSF17 TNFRSF17, AREG, THBSl, CTLSl, TFPI, PHACTR2, PFKFB2 and CHITl;
  • step (iii) the score obtained in step (ii) is interpreted by comparing it to a predetermined threshold.
  • the regression coefficients (/?,) can be calculated by any multivariate method, such as PLS-R or SVM, from data collected from a representative cohort.
  • the threshold is determined by the skilled artisan, from the same representative cohort, and depending on the wished sensitivity and specificity. Two examples of such equations, with associated threshold and tables of contingency (referring to the tested cohort), are disclosed in the experimental part below.
  • one, two or three of the genes selected in step (i) is/are selected in the group consisting of HLA-DRB4, AREG and FOSB.
  • additional genes can be selected, without limitation, amongst GPRl 09B, RBP7, TLR7, THBSl and CTLSl.
  • the set of genes selected in step (i) can comprise n genes, with n > 8, among which are HLA-DRB4, AREG, FOSB, GPRl 09B, RBP7, TLR7, THBSl and CTLSl genes.
  • the set of genes selected in step (i) comprises HLA-DRB4, FOSB, GPRl 09B, RBP7, TLR7, ILl 5, HLA-C, AMFR, LOC96610, IRF5, MGC29506, EDG3, IGLV1-44, IFIT2, IFI44, EPSTIl, TNFRSF17, AREG, THBSl, CTLSl, TFPI, PHACTR2, PFKFB2 and CHITl genes, it being understood that other genes not cited in this list can be added to said set of genes. Indeed, the genes cited in this list have been identified by using a micro-array technique which presents certain limitations, and identification of additional relevant genes by another technique must be envisioned. The methods described above can advantageously used for establishing a prognosis for a patient in septic shock with at least one additional organ failure. By using these methods, a physician has an early evaluation of the mortality risk
  • the biological sample comprises white blood cells after removal of mature granulocytes.
  • biological samples as whole blood or peripheral blood mononuclear cells (PBMC) can be used to perform the above methods.
  • PBMC peripheral blood mononuclear cells
  • the invention helps the physician to quickly decide the pharmacological treatment to be administered and is part of the present invention.
  • the above method can be used to determine if a given patient will be a good candidate for Activated Protein C (APC also called drotrecogin alpha).
  • APC Activated Protein C
  • the absence of HLA-DRB4 expression or a score y ⁇ 0.03 indicates the poor prognosis risk and that administration of APC to said patient is appropriate.
  • Another aspect of the present invention is a method for determining if a subject in severe sepsis with at least two organ failures can benefit from the administration of a given medicinal product.
  • the inventors have noticed that depending on the expression profile at day 0, administration of certain costly molecules can be necessary or, to the contrary, can be more risky than beneficial.
  • HLA-DRB4 status in said patient seems to be an important criterion to be considered.
  • the present invention concerns a method for determining if a subject in severe sepsis with at least two organ failures can benefit from the administration of a given medicinal product, comprising a step of in vitro determining if said patient expresses HLA-DRB4.
  • the absence of HLA-DRB4 in a patient expression indicates that administration of Activated Protein C (APC, also called drotrecogin alpha) to said patient is appropriate.
  • APC Activated Protein C
  • the expression level of AREG and/or FOSB genes in said patient, or to other genes cited above, can be measured to help the physician to quickly decide the pharmacological treatment to be administered to said patient.
  • up-regulation of one or several genes selected amongst FOSB, GPR109B, RBP7, TLR7, IL15, HLA-C, AMFR, LOC96610, IRF5, MGC29506, EDG3, IGLV1-44, IFITC, IFI44, EPSTIl and TNFRSF 17, and/or down-regulation of one or several genes selected amongst AREG, THBSl, CTLSl, TFPI, PHACTR2, PFKFB2 and CHITl indicate(s) that said patient will be a good responder to Activated Protein C.
  • a score can be calculated for said patient, as described above, and the physician will consider HLA-DRB4 status and/or said score to determine if said patient is in need of a particular treatment (such as Activated Protein C).
  • Another aspect of the present invention concerns the evaluation of the efficiency of an administered high tech treatment, which comprises a step of measuring the expression level of one or several genes selected in the group.
  • the expression level will preferably be measured one, two and/or three days after the beginning of said high tech treatment.
  • Another aspect of the present invention concerns the evaluation of the efficiency of a (new high tech) treatment.
  • This treatment may induce per se different modifications of gene expression between the responder and the non-responder.
  • the inventors have observed that when a patient is a good responder to a particular treatment, a normalization of the level of expression of the marker genes cited above can be observed in the hours and/or days following the beginning of the treatment.
  • the present invention pertains to a method for evaluating the efficiency of a treatment which has been given to a patient in severe sepsis with at least two organ failures and, in particular, to a patient in septic shock with at least one additional organ failure, wherein said method comprises a step of measuring the expression level of one, two or more genes selected in the group consisting of HLA-DRB4, FOSB, GPRl 09B, RBP7, TLR7, IL15, HLA-C, AMFR, LOC96610, IRF5, MGC29506, EDG3, IGLVl- 44, IFIT2, IFI44, EPSTIl, TNFRSF 17, AREG, THBSl, CTLSl, TFPI, PHACTR2, PFKFB2 and CHITl in said patient before the beginning of said pharmaceutical treatment, and one, two, three or more times after the beginning of said pharmaceutical treatment.
  • the expression level will preferably be measured one, two and/or three days after the beginning of said pharmaceutical treatment.
  • an up-regulation of one or several genes selected amongst FOSB, GPRl 09B, RBP7, TLR7, IL15, HLA-C, AMFR, LOC96610, IRF5, MGC29506, EDG3, IGLV1-44, IFIT2, IFI44, EPSTIl and TNFRSFl 7, and/or a down-regulation of one or several genes selected amongst AREG, THBSl, CTLSl, TFPI, PHACTR2, PFKFB2 and CHITl following the beginning of the pharmaceutical treatment indicate(s) that said treatment has been beneficial to the patient, it being understood that the up- or down-regulation herein corresponds to the evolution of the expression level of a given gene in said patient between the first measure at DO and the measures following the administration of the pharmaceutical treatment.
  • the present invention also relates to a method for selecting patients to be enrolled in a clinical trial for evaluating a medicinal product in the treatment of severe sepsis, especially in the treatment of septic shock. Indeed, the future development of new drugs and the performance of clinical trials would-be helped if only the patients with a poor prognosis are included, thereby eliminating the "noise" coming from patients who would have recovered without the drug under examination.
  • a method for selecting subjects to be enrolled in a clinical trial for evaluating a medicinal product in the treatment of severe sepsis with at least two organ failures, comprising a step of in vitro establishing a prognosis for said subjects, by any of the methods described above, is hence also part of the present invention.
  • the subjects enrolled in the clinical trial are preferably those who have a poor prognosis, i.e., when a representative cohort is used to define references, those who have an expression profile at day 0 (for a set of genes as defined above) which is more similar to that of subjects who have died from severe sepsis than to the profile of the group of subjects who survived.
  • the subjects to be enrolled in the clinical trial are those who have a score inferior to the predetermined threshold.
  • the skilled artisan can chose to enrol subjects only upon determination of their HLA-DRB4 status, since this seems to be of a critical relevance.
  • the level of expression of the selected genes can be measured by any technique, either at the mRNA level, or at the protein level.
  • the transcription level of these genes is measured.
  • the skilled artisan knows several techniques to perform such a measure, and will use the technique which is the most convenient having regard to the context. Particular parameters to consider are the rapidity of the result, its reliability, and the cost of the measure.
  • the level of mRNA encoding the genes of interest can be measured by real-time RT-PCR. A detailed protocol for doing so for HLA-DRB4, including the primers sequence, is described in the experimental part below, but the skilled artisan can perfectly modify this protocol.
  • the level of mRNA encoding the selected genes can be measured by macro- or micro-array, using either a standard chip or a chip which has been designed specifically for performing the methods of the present invention.
  • the inventors have observed that when the HLA-DRB4 gene is present in the genome of a patient, this gene is always expressed.
  • the above-described methods can hence comprise a step of HLA-
  • the HLA-DR loci comprise only one alpha gene and 4 functional beta genes called DRBl, DRB3, DRB4 and DRB5. More than 100 different alleles encode
  • DRB1 which have been grouped into 13 different haplotypes DRl -DRl 6, while there is little allelic diversity for DRB3, 4 and 5. It is now established that particular DRBl alleles are always associated with DRB4 (Bodmer et al., 1992; Nepom and Erlich,
  • the methods according to the present invention can comprise a step of genotyping either the DRBl locus, or the
  • DRB4 locus (or both).
  • a genotyping step can be done as an alternative or in addition to the determination of the transcription level of the HLA-DRB4
  • the methods described above can also comprise, as an alternative or in addition, a step of measuring, in a sample from said patient, the level of one or several of the proteins encoded by the genes cited in the above list. This can be done by any immunoassay which the skilled artisan will consider as appropriate.
  • kits for performing any of the methods described above comprises one, two or three pairs of primers, wherein each pair of primers is specific for a gene selected amongst HLA-DRB4, AREG and FOSB.
  • kit can also comprise probes for performing real-time amplification of part of one or several of the selected genes.
  • a set of primers and probe for real-time amplification of part of the HLA-DRB4 gene is described in the experimental part below.
  • the skilled artisan can chose to use different primers and probes specific for HLA-DRB4 to constitute a kit according to the invention, and the sequences indicated herein are not limitative.
  • the kit is adapted for genotyping the HLA-DRB4 gene.
  • the kit can comprise, for example, reagents for DNA extraction.
  • a kit according to the invention will also advantageously comprise a notice mentioning the relevance of the level of expression of the selected genes in the prediction of the outcome of severe sepsis with at least two organ failures.
  • a kit according to the present invention can further comprise one or several additional pairs of primers, wherein each pair of primers is specific for one sequence selected in the group consisting of 18S rRNA, GPRl 09B, RBP7, TLR7, IL15, HLA-C, AMFR, LOC96610, IRF5, MGC29506, EDG3, IGLVl- 44, IFIT2, IFI44, EPSTIl, TNFRSF 17, THBSl, CTLSl, TFPI, PHACTR2, PFKFB2 and CHITl genes.
  • the primer(s) and/or probe(s) can advantageously be labeled. Any labeling technique known by the skilled artisan can be used to that purpose.
  • Reagents and/or enzymes for performing amplification reactions can also be included in such a kit.
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription-polymerase chain reaction
  • this kit comprises a chip enabling hybridization of nucleic acids specific for at least two genes selected in the group consisting of HLA-DRB4, AREG, FOSB, GPRl 09B, RBP7,
  • TLR7 TLR7, IL15, HLA-C, AMFR, LOC96610, IRF5, MGC29506, EDG3, IGLV1-44, IFIT2,
  • IFI44 EPSTIl, TNFRSF17, THBSl, CTLSl, TFPI, PHACTR2, PFKFB2 and CHITl.
  • kits according to the present invention can be designed to perform the above-described methods either from a whole blood sample, or from isolated PBMC. In this latter case, the kits can optionally also comprise reagents for PBMC isolation.
  • Inclusion criteria patients in septic shock having at least two organ failures (defined by sequential organ failure assessment (Vincent et al., 1998) related to sepsis, within the 24 hours after the occurrence of the second organ failure; exclusion criteria: age lower than 18 y/o; treatment for cancer within the last 6 months; recent treatment for immune or hematologic diseases; a life expectancy inferior to 6 months.
  • the day of inclusion corresponded to the first blood sampling quoted day 0, within 24 hours after the occurrence of the second organ failure. Blood samples consisted in 15 ml on EDTA.
  • RNA samples were isolated by gradient centrifugation (Histopaque, Sigma, St Quentin Fallavier, France) to eliminate mature polymorphonuclear cells.
  • Total RNA was extracted using the Qiagen Rneasy kit (Qiagen GmbH, Germany). All RNA samples were treated with RNase-free DNAse.
  • RNA samples Quality of RNA samples was assessed using RNA 6000 Nano chips (Agilent technologies, Palo Alto, CA, USA) and quantity of RNA samples was assessed by measuring the absorbance at 260 run with spectrophotometer NanoDrop ND- 1000 (Labtech international Biotech, Ringmer, UK).
  • Preparation of cRNA was performed according to the protocols of the manufacturer (Affymetrix, Santa Clara, CA USA). Briefly, 5 ⁇ g of RNA samples were used to generate first-strand cDNA using a T7- oligo(DT) primer and the Superscript II Reverse Transcriptase. Second-strand synthesis was achieved using a cocktail of enzymes from E.
  • RNA obtained from 5 ⁇ g of total RNA yielded between 50 and 80 ⁇ g of purified cRNA. Then, 20 ⁇ g of cRNA from samples were incubated at 94°C for 35 min in a fragmentation buffer to be reduced into a mean size of approximately 35-200 nucleotides and finally added to the hybridisation buffer. Fragmented cRNA were hybridised on Affymetrix HG-Ul 33 Plus 2.0 array for 16 hours at 45°C together with internal hybridisation controls (bioB, bioC, bioD, ere and oligonucleotide B2). The washing and staining procedure was performed in the Affymetrix Fluidics Station 450.
  • Probe arrays were exposed to 10 washes in non- stringent wash buffer A (6x SSPE, 0.01% Tween20) at 30°C, followed by 6 washes in stringent buffer B (10OmM MES, 0.1M [Na + ], 0.01% Tween20) at 50 0 C.
  • stringent buffer B (10OmM MES, 0.1M [Na + ], 0.01% Tween20) at 50 0 C.
  • the biotinylated cRNA were stained with a streptavidin-phycoerythrin conjugate (SAPE, lO ⁇ g/ml) 5 minutes at 35°C and washed again with non-stringent buffer A (10 washes at 30°C).
  • SAPE streptavidin-phycoerythrin conjugate
  • the array contains -54600 human probe sets corresponding to approximately 22400 Unigene clusters.
  • CEL files were produced using GCOS (GeneChip® Operating Software). Normalisation of data was performed using GC- robust multi-array average (GC-RMA) that generates intra- and inter-chips normalizations in a single step.
  • GC-RMA GC- robust multi-array average
  • a real time PCR was performed for the 8 most important genes and for an endogenous control eukaryotic 18S rRNA. Reverse transcription reactions were performed according to established methods or manufacturer specifications (High Capacity cDNA Archive kit, Applied Biosystems, Foster City, CA, USA). Briefly, the probes contain a 6-carboxy-fluorescein phosphoramidite (FAM dye) label at the 5' end of the gene and a minor groove binder and nonfluorescent quencher at the 3' end and are designed to hybridize across exon junctions. The assays are supplied with primers and probe concentrations of 900 nM and 250 nM, respectively.
  • FAM dye 6-carboxy-fluorescein phosphoramidite
  • the gene expression assay for HLA-DRB4 was performed with the following primers and probe, which have been used at the same concentration for the three of them: Forward primer: TTTGTGCTTCCCTTTACCTAAACTG (SEQ ID No: 1); Reverse primer: AATAATGCAATGTGTGGCACAAG (SEQ ID No: 2); and Probe: CCTGCCTCCCGTGCATCTGTACTCC (SEQ ID No: 3).
  • Table 1 References of the gene expression assays designed and distributed by Applied Biosystems and used in the present study.
  • Eukaryotic 18S ribosomal RNA was used as the endogenous RNA controls (Assay ID: Hs99999901_sl; Applied Biosystems).
  • mRNA messenger RNA
  • Genomic DNA used for HLA-DRB4 typing was extracted through salting-out technique from fresh peripheral blood leucocytes.
  • HLA-DRB4 samples were typed at high resolution DNA based typing (allelic level) using the Polymerase Chain Reaction- Sequence Specific Primers (PCR-SSP) amplifications (one Lambda, Inc., Canoga Park, CA or Genovision).
  • PCR-SSP Polymerase Chain Reaction- Sequence Specific Primers
  • Microarray analysis genes with significant differential expression between surviving and non-surviving patients were identified using statistical packages from Bioconductor (http://www.bioconductor.org). After GC-RMA ⁇ Gene Chip Robust Multiarray Averaging) normalization (Irizarry et al., 2003), data were subjected to unpaired t-test for outcome at DO. Global transcriptional profiles were visualized in 2- dimentional space spanned by the two first factors of the Principal Component Analysis (PCA) at day 0 (figure 1). Twenty-nine sets of probes, corresponding to 24 genes, were identified at day 0 (tables 3 and 4) and were analyzed using hierarchical clustering methods. Among them, 8 genes were further selected as a top list (table 2), taking into account the classification by p- value and fold change (FC).
  • PCA Principal Component Analysis
  • Table 3 list of sets of probes which were differentially expressed and selected according to outcome at DO (alive versus dead). DR means downregulated, and UR upregulated. Classification considering p-value
  • Table 4 list of sets of probes which were differentially expressed and selected -according to outcome at DO (alive versus dead). DR means downregulated, and UR upregulated. Classification considering fold change (DF)
  • Predictive models can be built by using any multivariate method known by the skilled artisan. In the present case, Partial Least Squares Regression has been used, but other methods, such as Support Vector Machines, can also be used to that purpose. The principles of these methods are recalled below.
  • X [X 1 ,..., X p ) a /7-dimensional space of variables representing the set of predictors and by y the response variable.
  • PLS-R Partial Least Squares Regression
  • SVM Support Vector Machines
  • Support Vector Machines (SVM) (Boser et al, 1992; Vapnik, 1998) seeks the optimal separating hyperplane (the so-called margin) that separates two classes of observations (e.g., "dead patients” versus "surviving patients”).
  • the margin is defined as the distance between the hyperplane and its nearest points. It can be shown that choosing the optimal separating hyperplane results in an improvement of the trained classifier to predict new observations (Vapnik, 1998).
  • the parameters h or ⁇ of the classifier were computed, for each training set based on a Leave One Out cross validation technique - This was repeated 100 times to correctly estimate the average of the prediction accuracy.
  • Genes of interest have been selected on the microarray differential expression (see above) (fold change >2 and p value ⁇ 0.1).
  • the 24 genes related to 29 selected sets of probes (tables 3 and 4) correlating with outcome were grouped to build a predictive model based on Partial Least Squares (PLS) regression, useful to deal with correlated data situation encountered in the data set (as verified by the correlation matrix).
  • PLS Partial Least Squares
  • the relative contribution of each gene was weighted by a coefficient and put in an equation allowing the estimation of the outcome for a new individual.
  • a first equation including the 29 sets of probes was built (equation 2). Additionally, the inventors built an equation (equation 3) including the 8 selected genes (table 2), more adapted to available methods of detection of gene expression in nowadays clinical context. Of course, additional patient data can be included in the model and improve the accuracy of coefficients.
  • Table 5 mean and SD from a representative cohort to calculate centered and reduced data.
  • X ] , X 2 , • ⁇ ⁇ , X 29 correspond to the centered and reduced (or standardized) variable of the genes of interest.
  • the score could be written as:
  • Results are expressed as median (interquartile range IQR). Forty eight patients of the training cohort were 66 (22 IQR) year old. At the inclusion time, they had the following characteristics: 1) a SAPSII at 59 (15 IQR) and a SOFA score at 10 (4 IQR) (Vincent et al., 1998)) 2) monocyte HLA-DR expression at 2765 (2909 IQR) AB/C and plasma IL-IO at 175 (500 IQR) pg/ml (IL-12p40 not detectable) as inflammatory parameters. Sixteen over 48 patients died within the 28-day study period.
  • HLA-DRB4 presented the highest FC (FC>5) in survivors, with a large difference of fluorescence between the group of patients expressing HLA-DRB4 (positive) and a group showing low intensities (negative).
  • the positive HLA-DRB4 expression corresponded to surviving patients, except for three (18% of patients with positive expression) (table 6).
  • the negative HLA-DRB4 expression group had a high risk of death, with only 54% of patients who survived.
  • HLA-DRB4 expression encodes for HLA-DRB4 protein that belongs to the HLA class II gene cluster, which has been described as an important inflammatory marker in sepsis (D ⁇ cke et al., 1997; Venet et al., 2007).
  • HLA-DRB4 transcript was associated with a good outcome.
  • the very large difference in expression between dead and alive patients motivated to genotype this gene.
  • Table 6 summarizes HLA-DR data obtained with microarray technique, real-time PCR (qPCR) or genotyping in relation with outcome. Validation by real time PCR
  • HLA-DRB4 It is known that the presence of the gene HLA-DRB4 is associated with specific alleles on the gene HLA-DRBl (Bodmer et al., 1992; Nepom and Erlich, 1991).
  • the alleles related to the presence of HLA-DRB4 are Bl*04, Bl*07 and Bl *09, a relation confirmed in the population herein studied.
  • HLA-DRB4 was always present when it was expressed with PCR, and was always absent when it was not expressed in PCR.
  • HLA-DRB4 When present, it can result from the presence in genotyping of a non functional allelic composition, counted as non-expressed HLA-DRB4 with microarray. This rare configuration suggests that it may be preferable to perform both genotyping and functional genomic (or only functional genomic).
  • Three HLA-DRB4 alleles were observed to be associated to HLA-DRBl alleles as follows: B4*0103 was associated to 5 Bl* 0401, 1 Bl*0404, 1 Bl*0402, 1 Bl*07 and 1 Bl*09 alleles, B4*0101 and B4*01030102N were associated to 5 Bl*07 alleles. It was remarkable to note that for one patient (GAM 5066), HLA-DRB4 gene expression was found both with microarrays and PCR, although the genotyping revealed the null allele.
  • HLA-DRB4 The expression and then the presence of HLA-DRB4 gene was associated with a good outcome in this septic shock population.
  • Table 6 summarizes the results of HLA-DRB4 determination performed both with microarray and real time PCR in relation with outcome in the studied population.
  • Figure 3 shows the outcome actuarial curve from day 0 to day 28 according to the B4 expression status. It shows a dramatic difference in mortality between HLA-DRB4+ and HLA-DRB4- gene expression at day 0.
  • Predictive model :
  • Tables 7 and 8 give an estimation of the ⁇ j obtained by PLS regression.
  • Table 8 estimation of the ⁇ j obtained by PLS regression For 8 selected sets of probes
  • the score y for a new patient is obtained as follows:
  • this equation can be applied to predict his/her outcome.
  • the equation will refine along time by increasing the size of the learning set of patients to compute the model.
  • ROC Receiveiving Operator Characteristics
  • the thresholds are those providing the best precision or sensibility.
  • a new patient will be classified in term of prognosis as follows: for a score y > 0.03 (8 sets of probes footprint), the patient will have a high probability to survive and will not require costly specific treatment(s).
  • tissue(s) for such approach could concern all the failing organs and blood cells.
  • Tissue samples have limitations since it is ethically difficult to perform biopsies in patients in severe conditions especially for coagulation.
  • organ failures occur after a certain delay that might be too long to make decisions.
  • the number of cells is small compared to tissue samples, it can be drawn easily and the quantity of RNA material for micro-array becomes smaller than before. This approach has been used for several microarray studies in healthy volunteers (Calvano et al., 2005).
  • the septic shock population studied had a high risk of mortality (34%) as shown by the expected mortality related to the SAPS II.
  • HLA-DRB4 appeared to be strongly associated with a good outcome in septic shock.
  • This molecule belongs to the MHC class II system implicated in the presentation of antigen by antigen presenting cells (monocyte, macrophage, B lymphocyte or dendritic cells) to T lymphocyte during the early immune response.
  • HLA-DRB4 gene is located on a highly polymorphic locus (6p21) associated to numerous auto-immune disorders such as multiple sclerosis and rheumatoid arthritis (Holoshitz et al., 1992). It is well established that polymorphisms for this locus include presence or absence of the DRB4. Thus, 50% of the Caucasian population do not have any copy of DRB4 gene in their genomes.
  • HLA-DRB genes are all located in the same cluster and are functionally redundant. Only 4 different genes encode functional proteins (DRBl, DRB3, DRB4 and DRB5). In addition, 3 pseudogenes are known. If DRBl is found constitutive in human, the other genes are only present in some specific haplogroups. This important observation led the inventors to proceed to an extensive genotyping of this locus (Table 6). Gathering data from microarray, genotyping and qPCR, they were able to separate patients expressing a functional HLA-DRB4 protein from those who did not. This analysis shows that patients bearing/expressing DRB4 gene had a largely better chance to survive septic shock.
  • the proposed model based on the fluorescence of 29 (or 8) probe sets of interest measured by the microarray technique allowed bulding a classification model which will lead to determine a threshold value of -0.24 (or 0.03 for 8 probe sets) suitable to classify new patients.
  • precision is not the main issue; sensitivity and specificity are far more relevant because of different misclassification costs.
  • Diagnostic and therapeutic decision correspond to a modulation of a sensitivity level, this decision is very important for the outcome prediction because of the unbalanced classification cost: sensibility is far more important than specificity since disregarding a high death risk patient is a severe error.
  • the proposed models show a high sensitivity in detriment to the specificity, which means a good estimation of death risk: we can afford a low specificity because the potential false diagnosis will not have detrimental consequences, as the proposed treatment does not have any severe adverse consequences.
  • the proposed models appear to fit well with these goals.
  • HLA- DRB4 is a strong determinant, with an expression which is associated with a good prognosis.
  • the large difference in expression between survivals and non survivals has genotyping correspondence: expression is always related to the constitutive presence of the gene, whereas the under-expression or absence of expression always corresponded to the constitutive absence of this gene.
  • the expression level of the 28 other selected genes is important to determine, especially for negative expression of HLA-DRB4.
  • Bodmer J. G., Marsh, S. G., Albert, E. D., Bodmer, W. F., Dupont, B., Erlich, H. A., Mach, B., Mayr, W. R., Parham, P., Sasazuki, T., and et al. (1992). Nomenclature for factors of the HLA system, 1991. Eur J Immunogenet 19, 327-344.
  • HLA-DR alleles differ in their ability to present staphylococcal enterotoxins to T cells. J Exp Med 172, 709-717.
  • Kernel logistic PLS A tool for supervised nonlinear dimensionality reduction and binary classification, 2007, 51 (9), 4083-4100.
  • Venet F., Tissot, S., Debard, A. L., Faudot, C, Crampe, C, Pachot, A., Ayala, A., and Monneret, G. (2007). Decreased monocyte human leukocyte antigen- DR expression after severe burn injury: Correlation with severity and secondary septic shock. Crit Care Med 35, 1910-1917.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/IB2009/000292 2008-02-01 2009-01-30 Methods and kits for the rapid determination of patients at high risk of death during septic shock Ceased WO2009095786A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CA2713839A CA2713839A1 (en) 2008-02-01 2009-01-30 Methods and kits for the rapid determination of patients at high risk of death during septic shock
JP2010544810A JP2011510650A (ja) 2008-02-01 2009-01-30 敗血症性ショックの間に死亡する危険が高い患者を迅速に決定する方法及びキット
EP09705033A EP2245194A2 (en) 2008-02-01 2009-01-30 Methods and kits for the rapid determination of patients at high risk of death during septic shock
US12/865,536 US20110190143A1 (en) 2008-02-01 2009-01-30 Methods and Kits for the Rapid Determination of Patients at High Risk of Death During Septic Shock

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP08290090A EP2085486A1 (en) 2008-02-01 2008-02-01 Methods and kits for the rapid determination of patients at high risk of death during septic shock
EP08290090.3 2008-02-01
US4391408P 2008-04-10 2008-04-10
US61/043,914 2008-04-10

Publications (2)

Publication Number Publication Date
WO2009095786A2 true WO2009095786A2 (en) 2009-08-06
WO2009095786A3 WO2009095786A3 (en) 2009-11-05

Family

ID=39590402

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2009/000292 Ceased WO2009095786A2 (en) 2008-02-01 2009-01-30 Methods and kits for the rapid determination of patients at high risk of death during septic shock

Country Status (5)

Country Link
US (1) US20110190143A1 (enExample)
EP (2) EP2085486A1 (enExample)
JP (1) JP2011510650A (enExample)
CA (1) CA2713839A1 (enExample)
WO (1) WO2009095786A2 (enExample)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013119869A1 (en) * 2012-02-07 2013-08-15 Children's Hospital Medical Center A multi-biomarker-based outcome risk stratification model for adult septic shock
US20140335526A1 (en) * 2010-09-03 2014-11-13 Confarma France Quantification of residual host cell dna by real-time quantitative pcr
WO2015135071A1 (en) * 2014-03-14 2015-09-17 Hancock Robert E W Diagnostic for sepsis
US9238841B2 (en) 2012-02-07 2016-01-19 Children's Hospital Medical Center Multi-biomarker-based outcome risk stratification model for pediatric septic shock
US10261068B2 (en) 2015-06-04 2019-04-16 Children's Hospital Medical Center Persevere-II: redefining the pediatric sepsis biomarker risk model with septic shock phenotype
US10815526B2 (en) 2013-11-25 2020-10-27 Children's Hospital Medical Center Temporal pediatric sepsis biomarker risk model

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010049818A1 (en) * 2008-10-28 2010-05-06 Assistance Publique - Hopitaux De Paris Methods and kits for the rapid determination of patients at high risk of death during severe sepsis and septic shock
US8283131B2 (en) 2008-10-28 2012-10-09 Assistance Publique-Hopitaux De Paris Methods and kits for the rapid determination of patients at high risk of death during severe sepsis and septic shock
US9938557B2 (en) 2010-09-16 2018-04-10 The General Hospital Corporation Red blood cell dynamics for administering treatment for iron-deficiency anemia
WO2012068519A2 (en) * 2010-11-19 2012-05-24 Sirius Genomics Inc. Markers associated with response to activated protein c administration, and uses thereof
WO2015073665A1 (en) * 2013-11-13 2015-05-21 The General Hospital Corporation Methods and assays relating to the treatment of infection
US20170108487A1 (en) * 2014-06-05 2017-04-20 The General Hospital Corporation Predicting morbidity associated with red blood cell volume variance
WO2017106461A1 (en) 2015-12-15 2017-06-22 The General Hospital Corporation Methods of estimating blood glucose and related systems
US11293852B2 (en) 2016-04-07 2022-04-05 The General Hospital Corporation White blood cell population dynamics
WO2019173647A1 (en) * 2018-03-08 2019-09-12 University Of Notre Dame Du Lac Products for assessing colorectal cancer molecular subtype and risk of recurrence and for determining and adminstering treatment protocols based thereon

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7267945B2 (en) * 2001-03-26 2007-09-11 Applera Corporation Methods of determining the presence of polynucleotides employing amplification
FR2881437B1 (fr) * 2005-01-31 2010-11-19 Biomerieux Sa Procede pour le diagnostic/pronostic d'un syndrome septique

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140335526A1 (en) * 2010-09-03 2014-11-13 Confarma France Quantification of residual host cell dna by real-time quantitative pcr
WO2013119869A1 (en) * 2012-02-07 2013-08-15 Children's Hospital Medical Center A multi-biomarker-based outcome risk stratification model for adult septic shock
US9238841B2 (en) 2012-02-07 2016-01-19 Children's Hospital Medical Center Multi-biomarker-based outcome risk stratification model for pediatric septic shock
US9267175B2 (en) 2012-02-07 2016-02-23 Children's Hospital Medical Center Multi-biomarker-based outcome risk stratification model for adult septic shock
US10815526B2 (en) 2013-11-25 2020-10-27 Children's Hospital Medical Center Temporal pediatric sepsis biomarker risk model
WO2015135071A1 (en) * 2014-03-14 2015-09-17 Hancock Robert E W Diagnostic for sepsis
CN106661765A (zh) * 2014-03-14 2017-05-10 罗伯特·E·W·汉考克 用于脓毒症的诊断
EP3117030A4 (en) * 2014-03-14 2017-10-25 Hancock, Robert, E.W. Diagnostic for sepsis
US11851717B2 (en) 2014-03-14 2023-12-26 Robert E. W. Hancock Diagnostic for sepsis
US10261068B2 (en) 2015-06-04 2019-04-16 Children's Hospital Medical Center Persevere-II: redefining the pediatric sepsis biomarker risk model with septic shock phenotype

Also Published As

Publication number Publication date
US20110190143A1 (en) 2011-08-04
EP2085486A1 (en) 2009-08-05
EP2245194A2 (en) 2010-11-03
WO2009095786A3 (en) 2009-11-05
JP2011510650A (ja) 2011-04-07
CA2713839A1 (en) 2009-08-06

Similar Documents

Publication Publication Date Title
EP2085486A1 (en) Methods and kits for the rapid determination of patients at high risk of death during septic shock
US20230227911A1 (en) Methods for Diagnosis of Sepsis
US11578367B2 (en) Diagnosis of sepsis
US11072830B2 (en) Methods for breast cancer risk assessment
AU2012261820B2 (en) Molecular diagnostic test for cancer
US20120245235A1 (en) Classification of cancers
US20080199853A1 (en) Methods and Compositions for Diagnosis and Monitoring Auto Immune and Chronic Inflammatory Diseases
KR102334702B1 (ko) 유방암 발생 위험의 평가 방법
JP2013066474A (ja) 血液白血球中の遺伝子発現サインが、急性感染の差次的診断を可能にする
AU2012261820A1 (en) Molecular diagnostic test for cancer
CN101208602A (zh) 脓毒症的诊断
CN105473743A (zh) 脓毒症生物标志物及其应用
US20220235417A1 (en) Biomarkers for assessing idiopathic pulmonary fibrosis
US20100304987A1 (en) Methods and kits for diagnosis and/or prognosis of the tolerant state in liver transplantation
US20120264633A1 (en) Methods for detecting thrombocytosis using biomarkers
HK1155781A (en) Method and apparatus for determining a probability of colorectal cancer in a subject

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09705033

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2713839

Country of ref document: CA

Ref document number: 2010544810

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2009705033

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 12865536

Country of ref document: US