WO2009090190A1 - Mouse models carrying a knock-out mutation of the glutaminyl cyclase gene - Google Patents
Mouse models carrying a knock-out mutation of the glutaminyl cyclase gene Download PDFInfo
- Publication number
- WO2009090190A1 WO2009090190A1 PCT/EP2009/050387 EP2009050387W WO2009090190A1 WO 2009090190 A1 WO2009090190 A1 WO 2009090190A1 EP 2009050387 W EP2009050387 W EP 2009050387W WO 2009090190 A1 WO2009090190 A1 WO 2009090190A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- qpct
- gene
- human animal
- pcr
- mouse
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0276—Knock-out vertebrates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/104—Aminoacyltransferases (2.3.2)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/28—Neurological disorders
- G01N2800/2814—Dementia; Cognitive disorders
Definitions
- the present invention relates generally to knock-out animals, in particular mouse models having a knock-out mutation of the Qpct gene .
- Qpct i.e. glutaminyl peptide cyclotransferase
- glutaminyl cyclase also termed glutaminyl cyclase (QC, EC 2.3.2.5) catalyzes the intramolecular cyclization of N-terminal glutamine residues into pyroglutamic acid (5-oxo-proline, pGlu*) under liberation of ammonia and the intramolecular cyclization of N-terminal glutamate residues into pyroglutamic acid under liberation of water.
- Glutaminyl cyclase catalyzes the intramolecular cyclization of N-terminal glutamine residues into pyroglutamic acid (pGlu*) liberating ammonia.
- pGlu* pyroglutamic acid
- a QC was first isolated by Messer from the Latex of the tropical plant Carica papaya in 1963 (Messer, M. 1963 Nature 4874, 1299) . 24 years later, a corresponding enzymatic activity was discovered in animal pituitary (Busby, W. H. J. et al . 1987 J Biol Chem 262, 8532- 8536; Fischer, W. H. and Spiess, J. 1987 Proc Natl Acad Sci U S A 84, 3628-3632) .
- EP 02 011 349.4 discloses polynucleotides encoding insect glutaminyl cyclase, as well as polypeptides encoded thereby.
- This application further provides host cells comprising expression vectors comprising polynucleotides of the invention. Isolated polypeptides and host cells comprising insect QC are useful in methods of screening for agents that reduce glutaminyl cyclase activity. Such agents are described as useful as pesticides.
- AD Alzheimer's disease
- astrocytes reactive astrocytes and microglia
- Intagaki S. et al . 1989 J Neuroimmunol 24, 173-182
- Funato H. et al . 1998 Am J Pathol 152, 983-992
- Selkoe D. J.
- Amyloid-beta (abbreviated as A ⁇ ) peptides are the primary components of senile plaques and are considered to be directly involved in the pathogenesis and progression of AD, a hypothesis supported by genetic studies (Glenner, G. G. and Wong, C. W. 1984 Biochem Biophys Res Comm 120, 885-890; Borchelt, D. R. et al. 1996 Neuron 17, 1005-1013; Lemere, C. A. et al . 1996 Nat Med 2, 1146-1150; Mann, D. M. and Iwatsubo, T. 1996 Neurodegeneration 5, 115-120; Citron, M. et al .
- a ⁇ is generated by proteolytic processing of the ⁇ -amyloid precursor protein (APP) (Rang, J. et al . 1987 Nature 325, 733-736; Selkoe, D. J. 1998 Trends Cell Biol 8, 447-453), which is sequentially cleaved by ⁇ -secretase at the N-terminus and by ⁇ -secretase at the C-terminus of A ⁇ (Haass, C. and Selkoe, D. J. 1993 Cell 75, 1039-1042; Simons, M. et al. 1996 J Neurosci 16 899-908) .
- APP ⁇ -amyloid precursor protein
- N-terminally truncated forms occurs in senile plaques.
- Such shortened peptides are reported to be more neurotoxic in vitro and to aggregate more rapidly than the full-length isoforms (Pike, C. J. et al. 1995 J Biol Chem 270, 23895-23898).
- N-truncated peptides are known to be overproduced in early onset familial AD
- Russo C, et al. 2000 Nature 405, 531-532
- DS Down's syndrome
- their amount reflects the progressive severity of the disease (Russo, C. et al. 1997 FEBS Lett 409, 411-416; Guntert, A. et al . 2006 Neuroscience 143, 461-475).
- Additional post-translational processes may further modify the N-terminus by isomerization or racemization of the aspartate at position 1 and 7 and by cyclization of glutamate at residues 3 and 11.
- Pyroglutamate- containing isoforms at position 3 [pGlu3A ⁇ 3-40/42 ] represent the prominent forms -approximately 50 % of the total A ⁇ amount - of the N-truncated species in senile plaques (Mori, H. et al . 1992 J Biol Chem 267, 17082-17086, Saido, T. C. et al . 1995 Neuron 14, 457-466; Russo, C. et al .
- Shirotani et al investigated the generation of [pGlu 3 ]A ⁇ peptides in primary cortical neurons infected by Sindbis virus in vitro. They constructed amyloid precursor protein complementary DNAs, which encoded a potential precursor for [pGlu 3 ]A ⁇ by amino acid substitution and deletion. For one artificial precursor starting with a N-terminal glutamine residue instead of glutamate in the natural precursor, a spontaneous conversion or an enzymatic conversion by glutaminyl cyclase to pyroglutamate was suggested. The cyclization mechanism of N-terminal glutamate at position 3 in the natural precursor of [pGlu 3 ]A ⁇ was neither determined in vitro, in situ nor in vivo (Shirotani, K. et al .
- knock-out animals in particular knock-out mice which carry a knock-out mutation in the Qpct gene, preferably wherein this mutation should be provided in both a constitutive and a conditional manner so as to enable exact investigations as to the relevance and potential of the Qpct gene.
- the aim of this invention was to develop knock-out animals, i.e. mouse models carrying a constitutive or a conditional knock-out mutation of the Qpct gene, respectively.
- the present invention comprises methods and compositions for non-human knock-out, in particular mammalian, models for Qpct- related diseases.
- the present invention comprises non-human animal models that have a knock-out mutation in the Qpct gene, resulting in the knock-out of Qpct.
- Another aspect of the present invention comprises methods and compositions for screening for Qpct inhibitors/effectors.
- the present invention comprises methods and compositions for the treatment and/or prevention of Qpct-related diseases, particularly methods and compositions that inhibit or promote Qpct.
- the present invention provides pharmaceutical compositions for parenteral, enteral or oral administration, comprising at least one effector of QC optionally in combination with customary carriers and/or excipients, whererin said effector of QC was identified by employing the screening methods and Qpct knock-out animals of the present invention.
- Figure 1 Principle for the generation of constitutive and conditional knock-out Qcpt mouse lines .
- Dashed boxes represent exons . Solid line represents intronic sequence. LoxP and FRT elements are shown as triangles and are indicated. Neo and DTA boxes represent the neomycin positive selection cassette and the DTA negative selection cassette, respectively.
- Figure 2 Schematic representation of the Qpct locus organization.
- Diagram is not depicted to scale. Hatched boxes represent exons. Solid line represents chromosome sequence. Functionally relevant residues are highlighted.
- Figure 3 Schematic representation of the targeting vector.
- Hatched boxes represent Qpct exons .
- Solid line represents Qpct intronic sequence.
- LoxP and FRT elements are shown as differently oriented triangles and are indicated.
- Neo and DTA boxes represent the neomycin positive selection cassette and the DTA negative selection cassette, respectively.
- Figure 4 Schematic representation of the murine Qpct gene cloning
- the diagram is not depicted to scale. Boxes represent exons. Solid line represents intronic sequence. The approximate locations of the primers that were designed for the amplification of the 2 fragments of homology are represented by half arrows. The two resulting fragments are depicted above.
- Figure 5 Schematic representation of the targeting vector construction strategy.
- FIG. 6 PCR identification of the 3 ' end homologous recombination event.
- Solid and dotted lines represent Qpct intronic sequences located inside and outside of the targeting vector, respectively. Boxes represent Qpct exons.
- FRT sites are shown as double triangles, LoxP sites are represented by triangle.
- Half arrows illustrate the primer localisation.
- the positive control vector will be used for the screening setting up.
- the dotted line within the positive control vector represents the portion of sequence that is absent in the final targeting vector.
- Lanes 1 and 12 1 kb DNA ladder (NEBioLabs) Lane 2 to 5: 0.1, 0.5, 1, 10 genomic equivalent copies of TOR2- C+ plasmid,
- Lane 6 to 9 0.1, 0.5, 1, 10 genomic equivalent copies of TOR2- C+ plasmid diluted in 150 ng of genomic DNA extracted from wild type 129Sv/Pas ES cells,
- Lane 10 150 ng of genomic DNA extracted from wild type 129Sv/Pas ES cells
- Lane 11 dd H 2 O
- Figure 8 Setting up of the 3 ' integration event PCR reaction on ES cells transfected with TOR2-C+ vector.
- Lanes 2 to 22 ES cell clones transfected with TOR2-C+ vector Lane 24: 1 copy of TOR2-C+ vector Lane 25: dd H 2 O
- Figure 9 PCR identification of the 5 ' end homologous recombination event.
- Solid and dotted lines represent Qpct intronic sequences located inside and outside of the targeting vector, respectively. Boxes represent Qpct exons . FRT sites are shown as double triangles, LoxP sites are represented by triangles.
- Half arrows illustrate the primers' localisations.
- the size of the PCR product is given below the primers, as well as the restriction profile obtained after digestion of the PCR product by Swal .
- Figure 10 Setting up of the 5' end PCR screening (GX2633- TOR2-J2/GX2634-TOR2-K2 primers) .
- Lane 2 150 ng of genomic DNA extracted from wild type 129Sv/Pas ES cells
- Lane 3 10 ng of genomic DNA extracted from wild type C57BL/6 tail biopsies
- Lane 4 dd H 2 O
- Figure 11 Schematic representation of the 5' and 3' Southern blot screening for the homologous recombination event.
- Solid and dotted lines represent the intronic gene sequences located inside and outside of the targeted region, respectively; hatched boxes represent Qpct exons . LoxP sites are shown as triangles, FRT sites are represented as double triangles. Small rectangles represent the K and R Southern probes. Relevant restriction sites for Southern blot screening and the corresponding detected fragments are indicated with double arrows. The diagram is not depicted to scale.
- Figure 12 Setting up of the 3 ' Southern blot screening strategy on wild type DNA.
- Lane 1 and 6 1 Kb ladder (NEBioLabs) Lane 2: 4 ⁇ g of genomic DNA extracted from wild type 129Sv/Pas
- Lane 3 15 ⁇ g of genomic DNA extracted from wild type 129Sv/Pas
- Lane 4 15 ⁇ g of genomic DNA extracted from wild type 12901a ES cells.
- Lane 5 15 ⁇ g of genomic DNA extracted from wild type C57BL/6 tail biopsies.
- Figure 13 PCR identification of the Cre-mediated and FIp- mediated excisions events.
- Solid and dotted lines represent Qpct intronic sequences located inside and outside of the targeting vector, respectively. Hatched boxes represent Qpct exons. FRT sites are shown as double triangles, LoxP sites are represented by triangles.
- Half arrows illustrate the primers' localisations.
- the primers used for the detection of the Cre-mediated events are TOR2-N and TOR2-I1, and for the Flp-mediated events TOR2-N2 and TOR2-I4.
- the size of the PCR product is given below the primers.
- Figure 14 3' PCR screening of ES cell clones for detection of correct homologous recombination event.
- Lanes 1, 26 1 Kb ladder (NEBioLabs), Lanes 2 to 25:24 resistant ES cell clones, Lane 2: positive ES cell clone #5A1, Lane 5: positive ES cell clone #5B2, Lane 9: positive ES cell clone #5B4, Lane 14: positive ES cell clone #5A7, Lane 17: positive ES cell clone #5B8, Lane 19: positive ES cell clone #5B9, Lane 22: positive ES cell clone #5A11, Lane 27: Positive control ES clone #6A10.
- Figure 15 5 ' PCR screening of ES cell clones for detection of correct homologous recombination event.
- the panel at the bottom is the same as the top panel after a longer migration of the gel .
- Lanes 1, 8 1 Kb ladder (NEBioLabs) ,
- Figure 16 Southern blot results for the detection of the 5' homologous recombination event.
- Figure 17 Figure 17 : Southern blot results for the detection of the 3 ' homologous recombination event. Lanes 1, 9: 1 Kb ladder (NEBioLabs),
- Lane 4 ES cell clone #5C12
- Lane 5 ES cell clone #6A3
- Lane 6 ES cell clone #6C3
- Lane 7 ES cell clone #6C10
- Lane 8 Wild type ES cell DNA.
- Figure 18 Screening of the Fl animals for the detection of the Cre-mediated excision event.
- the genotypes of the 7 pups (35437 to 35443 in lanes 2 to 8, respectively) derived from the breeding with Cre deleter mice were tested by PCR using the primer combination TOR2-N / TOR2-I1 to analyse the excision status of the Qpct allele.
- PCR using DNA from the targeted ES clone 5C12 (lane 11), wild type mouse tail (lane 10) and a 1:100 mixture (lane 12) was used as positive controls.
- PCR without template (lane 9) served as a negative control.
- M 1 kb DNA-Ladder (NEBioLabs)
- FIG. 19 Screening of the Fl animals for the detection of the non-excised targeted allele.
- the genotypes of the 7 pups 35437 to 35443 derived from the breeding with Cre deleter mouse were tested by PCR using the primer combination TOR2-H2/ TOR2-I2 (lanes 2 to 8, respectively) to analyse the presence of the neomycin cassette. PCR using DNA from the targeted ES clone 5C12 (lane 11) and its 1:100 dilution in wild type DNA lane 12) was used as positive control. PCR using wild type DNA (lane 10) and H2O (lane 9) served as negative control. M: 1 kb DNA-Ladder (NEBioLabs).
- Figure 20 Screening of the animals derived from the heterozygous constitutive Qpct Knock-out male, for the detection of the Cre- mediated excision event.
- the genotypes of the 12 pups (18242 to 18246, in lanes 2 to 6, and #18156, #18159 in lanes 7 and 8, respectively) derived from the breeding of the first heterozygous constitutive Qpct Knock-out male with wild type females were tested by PCR using the primer combination TOR2-N / TOR2-I1 to analyse the excision status of the Qpct allele. PCR using DNA from the targeted ES clone 5C12 (lane 9) , wild type mouse tail (lane 11) and a 1:100 mixture (lane 10) was used as positive controls.
- Lane 12 PCR without template (lane 12) served as a negative control.
- Lanes 1 and 13 1 kb DNA-Ladder (NEBioLabs)
- Figure 21 5' Southern blot screening of four Fl heterozygous Qpct Knock-out mice genomic DNA digested with BamHI .
- Lanes 1 and 7 1 kb DNA ladder (NEBioLabs) , Lane 2: 15 ⁇ g of genomic DNA from tail biopsy #35438, Lane 3: 15 ⁇ g of genomic DNA from tail biopsy #18156, Lane 4: 15 ⁇ g of genomic DNA from tail biopsy #18159, Lane 5: 15 ⁇ g of genomic DNA from tail biopsy #18244, Lane 6: 15 ⁇ g of wild type genomic DNA from C57B1/6 tail biopsies.
- Figure 22 Screening of the animals for the Flp-mediated excision event.
- the genotypes of the 7 pups 17971 to 17977 in lanes 2 to 8, respectively
- the genotypes of the 7 pups 17971 to 17977 in lanes 2 to 8, respectively
- PCR using DNA from the targeted ES clone 5C12 (lane 11), wild type mouse tail DNA (lane 10) and a 1:100 mixture of the two previously cited DNA were used as positive controls.
- PCR without template (lane 9) served as a negative control.
- Lanes 1 and 13 1 kb DNA-Ladder (NEBioLabs) .
- Figure 23 Screening of the animals for the detection of the non-excised targeted allele.
- the genotypes of the 7 pups 17971 to 17977 derived from the breeding of the Qpct targeted female with FIp deleter male were tested by PCR using the primer combination TOR2-H2/ TOR2-I2 (lanes 2 to 8, respectively) to analyse the presence of the neomycin cassette.
- PCR using DNA from the targeted ES clone 5C12 (lane 11) and its 1:100 dilution in wild type DNA (lane 12) were used as positive controls.
- PCR using wild type DNA (lane 10 served as negative control.
- Figure 24 Screening of the animals for the detection of the Flp-mediated excision event.
- the genotypes of the 12 pups (18825 to 18836 in lanes 2 to 13, respectively) derived from the breeding of the Qpct partially FIp excised male #17973 with wild type females were tested by PCR using the primer combination TOR2-N2/ TOR2-I4 to analyse the excision status of the Qpct allele.
- Lanes 1 and 14 1 kb DNA-Ladder (NEBioLabs) .
- Figure 25 Screening of the animals for the detection of the non-excised targeted allele.
- the genotypes of the 10 pups 18827 to 18836 derived from the breeding of the Qpct partially FIp excised male #17973 with wild type females were tested by PCR using the primer combination TOR2-H2/ TOR2-I2 (lanes 2 to 11, respectively) to analyse the presence of the neomycin cassette.
- PCR using DNA from the targeted ES clone (lane 14) and its 1:100 dilution in wild type DNA (lane 15) were used as positive controls.
- PCR using H2O (lane 12) and wild type DNA (lane 13) served as negative controls.
- Figure 26 3 ' Southern blot screening of three Fl heterozygous conditional Qpct Knock-out mice genomic DNA digested with Swal .
- Lanes 1 and 6 1 kb DNA ladder (NEBioLabs)
- Lane 2 15 ⁇ g of genomic DNA from tail biopsy #18823
- Lane 3 15 ⁇ g of genomic DNA from tail biopsy #18824,
- Lane 4 15 ⁇ g of genomic DNA from tail biopsy #18825,
- Lane 5 15 ⁇ g of wild type genomic DNA from C57B1/6 tail biopsies .
- Figure 27 Schematic organisation of the Qpct alleles in heterozygous animals of mouse line Pbd2.
- Figure 28 PCR genotyping assay for the Qpct locus in mouse line Pbd2.
- Lane 1 Molecular weight marker (100 bp ladder)
- Lane 2 PCR fragments generated on Pbd2 heterozygous animals
- Lane 3 PCR fragments generated on Pbd2 homozygous animals (Qpct knockout) .
- Figure 29 QC-activity in plasma of wild-type, heterozygous and homozygous knock-out animals with respect to the Qpct locus in mouse line Pbd2.
- Figure 30 The testosterone concentration in serum of male wild- type, male heterozygous and male homozygous knock-out animals with respect to the Qpct locus in mouse line Pbd2.
- FIG 31 The thyroxine (T4) concentration in serum of wild- type, heterozygous and homozygous knock-out animals with respect to the Qpct locus in mouse line Pbd2.
- the present invention pertains to
- a non-human animal comprising cells containing a DNA Qpct gene carrying a knock-out mutation.
- a screening method for biologically active agents that inhibit or promote Qpct production in vivo comprising: administering a test agent to the non-human animal of any of items 1 to 17, and determining the effect of the agent.
- a method of treatment or prevention of a Qpct-related disease comprising (a) administering the selected test agent of item 33;
- a pharmaceutical composition comprising the selected test agent of item 34.
- test agent as selected according to item 33 for the preparation of a medicament for the treatment and/or prevention of a Qpct-related disease.
- Modified cell comprising a Qpct-knockout gene for use in the production of compounds, which would be negatively affected by
- a screening method for biologically active compounds that inhibit or promote Qpct activity in vivo comprising steps of: i) administering a test compound to a non-human animal model, which is specific for the treatment of at least one disease selected from Mild Cognitive Impairment, Alzheimer's disease, neurodegeneration in Down Syndrome, Familial
- a pharmaceutical composition comprising the selected test agent according to any of items 42 to 54.
- test agent as selected according to any of items 42 to 54 for the preparation of a medicament for the treatment and/or prevention of a Qpct-related disease.
- a method of treatment or prevention of a Qpct-related disease comprising
- Qpct-related disease is selected from the group consisting of rheumatoid arthritis, atherosclerosis, restenosis, and pancreatitis .
- the non-human knock-out animal in particular the knock-out mouse as described above, is useful inter alia in the following aspects :
- Non-related diseases in this context encompasses e.g. a decreased or slowed-down yield/production rate and/or a decreased effectivity and/or an increased antigenicity.
- Such compounds could be e.g. antibodies, peptides, proteins etc . - target discovery, e.g. by determining the differences detected in the above knock-out animal like up- or down- regulation of a specific substance which could become a suitable drug target, - provision of an assay to determine the importance of certain polypeptides, e.g. A ⁇ peptide or TRH etc.,
- knock-out animal means a non-human animal, usually a mammal, which carries one or more genetic manipulations leading to deactivation of one or more genes.
- construct means a recombinant nucleic acid, generally recombinant DNA, that has been generated for the purpose of the expression of a specific nucleotide sequence (s), or is to be used in the construction of other recombinant nucleotide sequences.
- the recombinant nucleic acid can encode e.g. a chimeric or humanized polypeptide.
- Polypeptide here pertains to all possible amino acid sequences comprising more than 10 amino acids.
- operably linked means that a DNA sequence and a regulatory sequence (s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence (s) .
- operatively inserted means that a nucleotide sequence of interest is positioned adjacent a nucleotide sequence that directs transcription and translation of the introduced nucleotide sequence of interest.
- the Qpct polynucleotides comprising the gene of the present invention include Qpct cDNA and shall also include modified Qpct cDNA.
- a "modification" of a nucleic acid can include one or several nucleotide additions, deletions, or substitutions with respect to a reference sequence.
- a modification of a nucleic acid can include substitutions that do not change the encoded amino acid sequence due to the degeneracy of the genetic code, or which result in a conservative substitution. Such modifications can correspond to variations that are made deliberately, such as the addition of a Poly A tail, or variations which occur as mutations during nucleic acid replication .
- the term "substantially the same nucleotide sequence” refers to DNA having sufficient identity to the reference polynucleotide, such that it will hybridize to the reference nucleotide under moderately stringent, or higher stringency, hybridization conditions.
- DNA having "substantially the same nucleotide sequence" as the reference nucleotide sequence can have an identity ranging from at least 60% to at least 95% with respect to the reference nucleotide sequence.
- Moderately stringent hybridization refers to conditions that permit a target-nucleic acid to bind a complementary nucleic acid.
- the hybridized nucleic acids will generally have an identity within a range of at least about 60% to at least about 95%.
- Moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5x Denhart ' s solution, 5x saline sodium phosphate EDTA buffer (SSPE), 0.2% SDS (Aldrich) at about 42°C, followed by washing in 0.2x SSPE, 0.2% SDS (Aldrich), at about 42° C.
- High stringency hybridization refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at about 65° C, for example, if a hybrid is not stable in 0.018M NaCl at about 65° C, it will not be stable under high stringency conditions, as contemplated herein.
- High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5x Denhart ' s solution, 5x SSPE, 0.2% SDS at about 42° C, followed by washing in 0. Ix SSPE, and 0.1% SDS at about 65° C.
- the amino acid sequence encoded by the knock-out gene of the present invention can be a Qpct sequence from a human or the Qpct homologue from any species, preferably from a murine species.
- the amino acid sequence encoded by the knock-out gene of the present invention can also be a fragment of the Qpct amino acid sequence so long as the fragment retains some or all of the function of the full-length Qpct sequence.
- the sequence may also be a modified Qpct sequence.
- substitutions, deletions or additions which alter, add or delete a single amino acid or a small percentage of amino acids (typically less than 10%, more typically less than 5%, and still more typically less than 1%.)
- a "modification" of the amino acid sequence encompasses conservative substitutions of the amino acid sequence. Conservative substitution tables providing functionally similar amino acids are well known in the art. The following six groups each contain amino acids that are conservative substitutions for one another:
- Exemplary structural or functional characteristics include sequence identity or substantial similarity, antibody reactivity, the presence of conserved structural domains such as RNA binding domains or acidic domains.
- the invention further provides a DNA construct comprising the
- DNA construct refers to a specific arrangement of genetic elements in a DNA molecule.
- the invention also provides a DNA construct using polypeptides from other species as well as Qpct mutant non-human mammals expressing BACEl from non-human species.
- the DNA constructs can be engineered to be operatively linked to appropriate expression elements such as promoters or enhancers to allow expression of a genetic element in the DNA construct in an appropriate cell or tissue.
- appropriate expression elements such as promoters or enhancers to allow expression of a genetic element in the DNA construct in an appropriate cell or tissue.
- the use of the expression control mechanisms allows for the targeted delivery and expression of the gene of interest.
- the constructs of the present invention may be constructed using an expression cassette which includes in the 5 '-3' direction of transcription, a transcriptional and translational initiation region associated with gene expression in brain tissue, DNA encoding a mutant or wild-type Qpct protein, and a transcriptional and translational termination region functional in the host animal.
- One or more introns also can be present.
- the transcriptional initiation region can be endogenous to the host animal or foreign or exogenous to the host animal.
- DNA constructs described herein may be incorporated into vectors for propagation or transfection into appropriate cells to generate Qpct overexpressing mutant non-human mammals and are also comprised by the present invention.
- One skilled in the art can select a vector based on desired properties, for example, for production of a vector in a particular cell such as a mammalian cell or a bacterial cell.
- Vectors can contain a regulatory element that provides tissue specific or inducible expression of an operatively linked nucleic acid.
- tissue-specific promoter or enhancer that allows expression of Qpct polypeptides in a desired tissue. It should be noted that tissue-specific expression as described herein does not require a complete absence of expression in tissues other than the preferred tissue. Instead, “cell-specific” or “tissue-specific” expression refers to a majority of the expression of a particular gene of interest in the preferred cell type or tissue.
- inducible promoters or enhancers can also be included in the vector for expression of a Qpct polypeptide or nucleic acid that can be regulated.
- inducible systems include, for example, tetracycline inducible System (Gossen & Bizard, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992); Gossen et al., Science, 268:17664769 (1995); Clontech, Palo Alto, Calif.); metallothionein promoter induced by heavy metals; insect steroid hormone responsive to ecdysone or related steroids such as muristerone (No et al . , Proc. Natl. Acad. Sci.
- MMTV mouse mammary tumor virus induced by steroids such as glucocorticoid and estrogen
- regulatory elements can be constitutive or regulated, depending upon the nature of the regulation, and can be regulated in a variety of tissues, or one or a few specific tissues.
- the regulatory sequences or regulatory elements are operatively linked to one of the polynucleotide sequences of the invention such that the physical and functional relationship between the polynucleotide sequence and the regulatory sequence allows transcription of the polynucleotide sequence.
- Vectors useful for expression in eukaryotic cells can include, for example, regulatory elements including the CAG promoter, the SV40 early promoter, the cytomegalovirus (CMV) promoter, the mouse mammary tumor virus
- MMTV MMTV steroid-inducible promoter
- Pgtf Moloney marine leukemia virus
- MMLV Moloney marine leukemia virus
- the vector can contain a selectable marker.
- a selectable marker refers to a genetic element that provides a selectable phenotype to a cell in which the selectable marker has been introduced.
- a selectable marker is generally a gene whose gene product provides resistance to an agent that inhibits cell growth or kills a cell.
- selectable markers can be used in the DNA constructs of the invention, including, for example, Neo, Hyg, hisD, Gpt and BIe genes, as described, for example in Ausubel et al . (Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999)) and U.S. Patent No. 5,981,830.
- Drugs useful for selecting for the presence of a selectable marker include, for example, G418 for Neo, hygromycin for Hyg, histidinol for hisD, xanthine for Gpt, and bleomycin for BIe (see Ausubel et al, supra, (1999); U.S. Patent No. 5,981,830).
- DNA constructs of the invention can incorporate a positive selectable marker, a negative selectable marker, or both (see, for example, U.S. Patent No. 5,981,830).
- the invention primarily provides a non-human knock-out animal whose genome comprises a knock-out Qpct gene.
- the DNA fragment can be integrated into the genome of an animal by any method known to those skilled in the art.
- the DNA molecule containing the desired gene sequence can be introduced into pluripotent cells, such as ES cells, by any method that will permit the introduced molecule to undergo recombination at its regions of homology.
- the DNA can be single or double stranded DNA, linear or circular.
- the zygote is a good target for microinjection, and methods of microinjecting zygotes are well known (see US 4,873,191) .
- Embryonal cells at various developmental stages can also be used to introduce genes for the production of knock-out animals. Different methods are used depending on the stage of development of the embryonal cell.
- Such transfected embryonic stem (ES) cells can thereafter colonize an embryo following their introduction into the blastocoele of a blastocyst-stage embryo and contribute to the germ line of the resulting chimeric animal (reviewed in Jaenisch, Science 240:1468-1474 (1988)).
- the transfected ES cells Prior to the introduction of transfected ES cells into the blastocoele, the transfected ES cells can be subjected to various selection protocols to enrich the proportion of ES cells that have integrated the knock-out gene if the knock-out gene provides a means for such selection.
- PCR can be used to screen for ES cells that have integrated the knock-out.
- retroviral infection can also be used to introduce knock-out genes into a non-human animal.
- the developing non- human embryo can be cultured in vitro to the blastocyst stage.
- the blastomeres can be targets for retroviral infection (Jaenisch, Proc. Nati. Acad. Sci. USA 73:1260-1264 (1976)) .
- Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Hogan et al . , supra, 1986) .
- the viral vector system used to introduce the knock-out is typically a replication-defective retrovirus carrying the knock-out (Jahner et al . , Proc. Natl.
- knock-out genes may be introduced into the germline by intrauterine retroviral infection of the mid-gestation embryo (Jahner et al . , supra, 1982) .
- retroviruses or retroviral vectors to create knock-out animals known to those of skill in the art involves the micro-injection of retroviral particles or mitomycin C-treated cells producing retrovirus into the perivitelline space of fertilized eggs or early embryos (WO 90/08832 (1990); Haskell and Bowen, MaI. Reprod. Dev. 40:386 (1995)) .
- knock-in technology is well known in the art as described e.g. in Casas et al . (2004) Am J Pathol 165, 1289-1300.
- founder animals can be bred, inbred, outbred, or crossbred to produce colonies of the particular animal.
- breeding strategies include, but are not limited to: outbreeding of founder animals with more than one integration site in order to establish separate lines; inbreeding of separate lines in order to produce compound transgenics that express the transgene at higher levels because of the effects of additive expression of each transgene; crossing of heterozygous transgenic mice to produce mice homozygous for a given integration site in order to both augment expression and eliminate the need for screening of animals by DNA analysis; crossing of separate homozygous lines to produce compound heterozygous or homozygous lines; breeding animals to different inbred genetic backgrounds so as to examine effects of modifying alleles on expression of the transgene and the effects of expression.
- the knock-out animals are screened and evaluated to select those animals having the phenotype of interest.
- Initial screening can be performed using, for example, Southern blot analysis or PCR techniques to analyze animal tissues to verify that integration of the knock-out gene has taken place.
- the level of mRNA expression of the knock-out gene in the tissues of the knock-out animals can also be assessed using techniques which include, but are not limited to, Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, and reverse transcriptase-PCR (rt-PCR) . Samples of the suitable tissues can be evaluated immunocytochemically using antibodies specific for Qpct or with a tag such as EGFP.
- knock-out non-human mammals can be further characterized to identify those animals having a phenotype useful in methods of the invention.
- knock-out non-human mammals overexpressing Qpct can be screened using the methods disclosed herein. For example, tissue sections can be viewed under a fluorescent microscope for die present of fluorescence, indicating the presence of the reporter gene.
- tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al . , (1987) Genes Dev. 1:268-277); lymphoid-specific promoters (Calame and Eaton (1988) Adv. Immunol. 43:235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J. 8:729-733) and immunoglobulins (Banerji et al . , (1983) Cell 33:729-740; Queen and Baltimore (1983) Cell 33:741-748), neuron-specific promoters
- albumin promoter liver-specific; Pinkert et al . , (1987) Genes Dev. 1:268-277
- lymphoid-specific promoters Calame and Eaton (1988) Adv. Immunol. 43:235-275
- T cell receptors Winoto and Baltimore (1989) EMBO J. 8:729-733
- the neurofilament promoter e.g., the neurofilament promoter, the Thy-1 promoter or the
- pancreas-specific promoters (Edlund et al . ,
- cardiac specific expression alpha myosin heavy chain promoter, Subramaniam, A, Jones WK, Gulick J,
- the invention further provides an isolated cell containing a DNA construct of the invention.
- the DNA construct can be introduced into a cell by any of the well-known transfection methods (Sambrook et al . , Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainview, N. Y. (1989); Ausubel et al . , supra, (1999)).
- the cell can be obtained by isolating a cell from a mutant non-human mammal created as described herein.
- the invention provides a cell isolated from a Qpct mutant non-human mammal of the invention, in particular, a Qpct mutant knock-out mouse.
- the cells can be obtained from a homozygous Qpct mutant non-human mammal such as a mouse or a heterozygous Qpct mutant non-human mammal such as a mouse .
- Effectors are defined as molecules that bind to enzymes and increase (i.e. promote) or decrease (i.e. inhibit) their activity in vitro and/or in vivo.
- Some enzymes have binding sites for molecules that affect their catalytic activity; a stimulator molecule is called an activator.
- Enzymes may even have multiple sites for recognizing more than one activator or inhibitor. Enzymes can detect concentrations of a variety of molecules and use that information to vary their own activities.
- Effectors can modulate enzymatic activity because enzymes can assume both active and inactive conformations: activators are positive effectors, inhibitors are negative effectors. Effectors act not only at the active sites of enzymes, but also at regulatory sites, or allosteric sites, terms used to emphasize that the regulatory site is an element of the enzyme distinct from the catalytic site and to differentiate this form of regulation from competition between substrates and inhibitors at the catalytic site (Darnell, J., Lodish, H. and Baltimore, D. 1990, Molecular Cell Biology 2"d Edition, Scientific American Books, New York, page 63) .
- each amino acid residue is represented by a one- letter or a three-letter designation, corresponding to the trivial name of the amino acid, in accordance with the following conventional list:
- QC glutaminyl cyclase
- EC 2.3.2.5 glutaminyl-peptidecyclotransferase
- the Qpct as used herin is a mammalian Qpct, more preferably a non-human Qpct, most preferably a murine Qpct.
- QC and QC-like enzymes have identical or similar enzymatic activity, further defined as QC activity.
- QC- like enzymes can fundamentally differ in their molecular structure from QC.
- QC activity is defined as intramolecular cyclization of N-terminal glutamine residues into pyroglutamic acid (pGlu*) or of N-terminal L-homoglutamine or L- ⁇ -homoglutamine to a cyclic pyro-homoglutamine derivative under liberation of ammonia. See schemes 1 and 2.
- EC as used herein comprises the side activity of QC and QC-like enzymes as glutamate cyclase (EC) , further defined as EC activity.
- EC activity as used herein is defined as intramolecular cyclization of N-terminal glutamate residues into pyroglutamic acid (pGlu*) by QC. See scheme 3.
- metal-dependent enzyme as used herein is defined as enzyme (s) that require a bound metal ion in order to fulfil their catalytic function and/or require a bound metal ion in order to form the catalytically active structure.
- Scheme 3 N-terminal cyclization of glutamyl peptides by QC (EC)
- Qpct-related disease refers to all those diseases, disorders or conditions that are modulated by Qpct.
- compositions of the present invention are particularly useful in the evaluation of effectors of Qpct and for the development of drugs and therapeutic agents for the treatment and prevention of amyloid-associated diseases such as Mild Cognitive Impairment, Alzheimer's disease, neurodegeneration in Down Syndrome, Familial Danish Dementia and Familial British Dementia.
- compositions of the present invention are also useful in the evaluation of effectors of Qpct and for the development of drugs and therapeutic agents for the treatment and prevention of chronic and acute inflammatory diseases, e.g. rheumatoid arthritis, atherosclerosis, restenosis, pancreatitis.
- chronic and acute inflammatory diseases e.g. rheumatoid arthritis, atherosclerosis, restenosis, pancreatitis.
- the knock-out animal or the cells of the knock-out animal of the invention can be used in a variety of screening assays.
- any of a variety of potential agents suspected of affecting Qpct and amyloid accumulation, as well as the appropriate antagonists and blocking therapeutic agents can be screened by administration to the knock-out animal and assessing the effect of these agents upon the function and phenotype of the cells and on the phenotype, i.e. the neurological phenotype, of the knock-out animals.
- Behavioral studies may also be used to test potential therapeutic agents, such as those studies designed to assess motor skills, learning and memory deficits.
- An example of such a test is the Morris Water maze (Morris (1981) Learn Motivat 12:239-260).
- behavioral studies may include evaluations of locomotor activity such as with the rotor-rod and the open field.
- a preferred embodiment of the present invention is directed to an in vivo animal model for examining the phenotypic consequences resulting from heterozygous or homozygous deficiency of the Qpct gene, wherein the animal model is a mammal having a heterozygous or homozygous disruption of the Qpct gene .
- the Qpct gene is of human origin, more preferably of murine origin.
- the Qpct gene according to the present invention may also be a recombinant gene.
- Most preferred according to the present invention is the murine Qpct gene of SEQ ID No. 22.
- the disruption of the murine Qpct gene may for instance be achieved by gene mutations, which lead to single amino acid deletions or replacements in the Qpct protein.
- Preferred according to the present invention are mutations in the Qpct gene, which lead to to the deletion in the Qpct protein of at least one of the amino acids selected from the group consisting of residues H141 and D160 in exon 3, residues E202 and E203 in exon 4, residue D249 in exon 5 and residue H331 in exon 7.
- the disruption of the Qpct gene can also be achieved by deletion of one or more exons .
- any single exon of the Qpct gene may lead to a Qpct gene disruption.
- Preferred according to the present invention is the deletion of exons 4 and/or 5 of the Qpct gene, more preferably of the murine Qpct gene.
- the murine Qpct gene has, after deletion of exons 4 and 5, the sequence of SEQ ID NO. 23.
- Qpct is involved in a variety of biological, medical or physiological processes or phenomena, including, but not limited to neurodegenerative diseases, e.g. Mild Cognitive Impairment, Alzheimer's disease, neurodegeneration in Down Syndrome, Familial Danish Dementia and Familial British Dementia; and chronic and acute inflammatory diseases, e.g. rheumatoid arthritis, atherosclerosis, restenosis, pancreatitis
- the animal model having heterozygous or homozygous deficiency of the Qpct gene is useful for studying mechanisms and/or etiology of the above-mentioned processes/phenomena.
- the animal model of the present invention having heterozygous or homozygous deficiency of the Qpct gene will be useful as a mammalian in vivo screening model for studying these and other processes/phenomena .
- an animal model is meant that an animal sufficiently like humans in its anatomy, physiology, or response to a pathogen to be used in medical research that is used to investigate a physio- or pathological circumstances in question.
- an animal model can be an exploratory model, aiming to understand a biological mechanism, e.g., amyloid beta peptide formation, or an explanatory model, aiming to understand a more or less complex biological problem.
- neurodegenerative diseases e.g. Mild Cognitive Impairment, Alzheimer's disease, neurodegeneration in Down Syndrome, Familial Danish Dementia and Familial British Dementia
- chronic and acute inflammatory diseases e.g.
- rheumatoid arthritis, atherosclerosis, restenosis, pancreatitis can be performed employing the heterozygous or homozygous Qpct knockout animals of the present invention.
- An effective screening for Qpct inhibitors, which are useful in the treatment of the aforementioned diseases, could be performed by treating existing animal models for the specific diseases with test compounds and comparing the results of such treatment with the effects of the Qpct gene disruption in the Qpct knockout animals.
- Preferred methods for screening for biologically active agents that inhibit or promote Qpct production in vivo thus comprise the following steps: i) administering a test compound to a non-human animal model, which is specific for the treatment of at least one disease selected from Mild Cognitive Impairment, Alzheimer's disease, neurodegeneration in Down Syndrome, Familial Danish Dementia, Familial British Dementia, rheumatoid arthritis, atherosclerosis, restenosis, and pancreatitis, ii) determining the effect of the test compound; iii) compare the effect of the test compound with the effect of the Qpct gene disruption in the Qpct knockout animal models, and iv) select test compounds that have an efficacy similar to the effect of the Qpct gene disruption on the specific disease.
- a test compound selected from Mild Cognitive Impairment, Alzheimer's disease, neurodegeneration in Down Syndrome, Familial Danish Dementia, Familial British Dementia, rheumatoid
- this method for screening of Qpct inhibitors.
- this method is used for the screening of Qpct inhibitors for the treatment of Alzheimer's disease or neurodegeneration in Down syndrome.
- this method is used for the screening of Qpct inhibitors for the treatment of Familial British Dementia or Familial Danish Dementia.
- this method is preferably used for the screening of Qpct inhibitors for the treatment of a disease selected from rheumatoid arthritis, atherosclerosis, restenosis, and pancreatitis .
- Qpct-inhibitors for the treatment of Alzheimer's Disease, Familial British Dementia or Familial Danish Dementia and, e.g. neurodegeneration in Down Syndrome can be tested in existing animal models of Alzheimer's disease.
- Suitable animal models of Alzheimer's Disease are reviewed in McGowan et al . , TRENDS in Genetics, Vol. 22, No. May 2006, pp 281-289, and are selected from PDAPP, Tg2576, APP23, TgCRND ⁇ , PSEN 1M i46v or PSEN 1M i46L, PSAPP, APP DutC h, BRI-A ⁇ 40 and BRI-A ⁇ 42, JNPL3, TaUp 3 OiS, Tau V 337 M , Tau R40 6w, rTg4510, H tau , TAPP, 3 x TgAD, as described below.
- PDAPP First mutant APP transgenic model with robust plaque pathology. Mice express a human APP cDNA with the Indiana mutation (APP V 717F) • Plaque pathology begins between 6-9 months in hemizygous PDAPP mice. There is synapse loss but no overt cell loss and not NFT pathology is observed. This model has been used widely in vaccination therapy strategies.
- Tg2576 Mice express mutant APP SWE under control of the hamster prion promoter. Plaque pathology is observed from 9 months of age. These mice have cognitive deficits but no cell loss or NFT pathology. It is one of the most widely used transgenic models.
- APP23 Mice express mutant APP SWE under control of the Thyl promoter. Prominent cerebrovascular amyloid, amyloid deposits are observed from 6 months of age and some hippocampal neuronal loss is associated with amyloid plaque formation.
- TgCRND8 Mice express multiple APP mutations (Swedish plus Indiana) . Cognitive deficits coincide with rapid extracellular plaque development at ⁇ 3 months of age. The cognitive deficits can be reversed by A ⁇ vaccination therapy.
- PSENIMI46V or PSENI M I46L (lines 6.2 and 8.9, respectively): These models where the first demonstration in vivo that mutant PSENl selectively elevates A ⁇ 42. No overt plaque pathology is observed.
- PSAPP Tg2576 x PSEN 1M i46L, PSEN1-A246E + APP SWE ) : Bigenic transgenic mice, addition of the mutant PSENl transgene markedly accelerated amyloid pathology compared with singly transgenic mutant APP mice, demonstrating that the PSENl-driven elevation of A ⁇ 42 enhances plaque pathology.
- APP Dutc h Mice express APP with the Dutch mutation that causes hereditary cerebral hemorrhage with amyloidosis-Dutch type in humans. APP DutC h mice develop severe congophilic amyloid angiopathy. The addition of a mutant PSENl transgene redistributes the amyloid pathology to the parenchyma indicating differing roles for A ⁇ 40 and A ⁇ 42 in vascular and parenchymal amyloid pathology.
- BRI-A ⁇ 40 and BRI-A ⁇ 42 Mice express individual A ⁇ isoforms without APP over-expression. Only mice expressing A ⁇ 42 develop senile plaques and CAA, whereas BRI-A ⁇ 40 mice do not develop plaques, suggesting that A ⁇ 42 is essential for plaque formation.
- JNPL3 Mice express 4R0N MAPT with the P301L mutation. This is the first transgenic model, with marked tangle pathology and cell loss, demonstrating that MAPT alone can cause cellular damage and loss. JNPL3 mice develop motor impairments with age owing to servere pathology and motor neutron loss in the spinal cord.
- Taup3ois Tansgenic mice expressing the shortest isoform of 4R MAPT with the P301S mutation. Homozygous mice develop severe paraparesis at 5-6 months of age with widespread neurofibrillary pathology in the brain and spinal cord and neuronal loss in the spinal cord.
- Tau V 33 7M Low level synthesis of 4R MAPT with the V337M mutation (1/10 endogenous MAPT) driven by the promoter of platelet- derived growth factor (PDGF) .
- PDGF platelet- derived growth factor
- Tau R 406w Mice expressing 4R human MAPT with the R406W mutation under control of the CAMKII promoter. Mice develop MAPT inclusions in the forebrain from 18 months of age and have impaired associative memory.
- rTg4510 Inducible MAPT transgenic mice using the TET-off system. Abnormal MAPT pathology occurs from one month of age. Mice have progressive NFT pathology and severe cell loss. Cognitive deficits are evident from 2.5 months of age. Turning off the transgene improves cognitive performance but NT pathology worsens. H tau ⁇ Transgenic mice expressing human genomic MAPT only (mouse MAPT knocked-out) . Htau mice accumulate hyperphosphorylated MAPT form 6 month and develop Thio-S-positive NFT by the time they are 15 months old.
- TAPP (Tg2576 x JNPL3) : Increased MAPT forebrain pathology in TAPP mice compared with JNPL3 suggesting mutant APP and/or A ⁇ can affect downstream MAPT pathology.
- 3xTgAD Triple transgenic model expressing mutant APP SWE , MAPT P3OIL on a PSENl M i46v ⁇ knock-in' background (PSNEl-KI). Mice develop plaques from 6 months and MAPT pathology from the time they are 12 months old, strengthening the hypothesis that APP or A ⁇ can directly influence neurofibrillary pathology.
- Non-human transgenic animals that overexpress Qpct, and which are useful in the screening method described above, are disclosed in WO 2008/087197.
- QC inhibitors could be applied via the drinking solution or chow, or any other conventional route of administration, e.g. orally, intravenously or subcutaneously .
- the efficacy of the Qpct inhibitors can be assayed by sequential extraction of A ⁇ using SDS and formic acid.
- SDS and formic acid fractions containing the highest A ⁇ concentrations can be analyzed using an ELISA quantifying total A ⁇ (x-42) or A ⁇ (x-40) as well as [pGlu 3 ] A ⁇ 3-40/42/43 or [pGlu 11 ] A ⁇ ll-40/42/43.
- Test compounds that are identified employing the screening method above and which are suitable for further pharmaceutical development should reduce the formation of [pGlu 3 ] A ⁇ 3-40/42/43 or [pGlu 11 ] A ⁇ ll-40/42/43.
- suitable test compounds are capable to reduce the formation of [pGlu 3 ] A ⁇ 3-40 and/or [pGlu 3 ]A ⁇ 3-42.
- An ELISA kit for the quantification of [pGlu 3 ] A ⁇ 3-42 is commercially available from IBL, Cat-no. JP27716.
- An ELISA for the quantification of [pGlu 3 ] A ⁇ 3-40 is described by Schilling et al . , 2008 (Schilling S, Appl T, Hoffmann T, Cynis H, Schulz K, Jagla W, Friedrich D, Wermann M, Buchholz M, Heiser U, von H ⁇ rsten S, Demuth HU. Inhibition of glutaminyl cyclase prevents pGlu-Abeta formation after intracortical/hippocampal microinjection in vivo/in situ. J Neurochem. 2008 Aug;106 (3) .1225-36.)
- Suitable behavioral test paradigms are, e.g. those, which address different aspects of hippocampus-dependent learning. Examples for such neurological tests are the Morris water maze test and the Fear Conditioning test looking at contextual memory changes (Comery, TA et al, (2005), J Neurosci 25:8898-8902; Jacobsen JS et al, (2006), Proc Natl. Acad. Sci USA 103:5161-5166).
- the animal model of inflammatory diseases can be an existing atherosclerosis animal model, e.g., apoE deficient mouse, or can be prepared, for example, by preparing a transgenic mouse having Qpct gene overexpression or gene deficiency with apoE deficient background.
- the apolipoprotein E knockout mouse model has become one of the primary models for atherosclerosis (Arterioscler Thromh Vase Biol., 24: 1006-1014, 2004; Trends Cardiovasc Med, 14: 187-190, 2004).
- the studies may be performed as described by Johnson et al . in Circulation, 111 : 1422-1430, 2005, or using modifications thereof.
- Apolipoprotein E-Deficient Mouse Model Apolipoprotein E is a component of several plasma lipoproteins, including chylomicrons, VLDL, and HDL. Receptor- mediated catabolism of these lipoprotein particles is mediated through the interaction of apoE with the LDL receptor (LDLR) or with LDLR-related protein (LRP) . ApoE-deficient mice exhibit hypercholesterolemia and develop complex atheromatous lesions similar to those seen in humans. The efficacy of the compounds of the present invention was also evaluated using this animal model .
- LDLR LDL receptor
- LRP LDLR-related protein
- mice thioglycollate-induced inflammation model in mice
- collagen- induced Arthritis Model in Rat e.g. the effects of the test compounds on rat carotid artery responses to the balloon catheter injury
- restenosis e.g. the effects of the test compounds on rat carotid artery responses to the balloon catheter injury
- the efficacy of the Qpct inhibitors can be assayed by measuring the inhibition of the chemotaxis of a human monocytic cell line (THP-I cells) induced by human MCP-I in vitro.
- the assay is described in example 16. This inhibitory effect has also been observed in vivo.
- Effective test compounds should show a reduced monocyte infiltration in a thioglycollate-induced inflammation model in mice.
- the methods of the invention can advantageously use cells isolated from a homozygous or heterozygous Qpct mutant non-human mammal, to study amyloid accumulation as well as to test potential therapeutic compounds.
- the methods of the invention can also be used with cells expressing Qpct such as a transfected cell line.
- a Qpct knock-out cell can be used in an in vitro method to screen compounds as potential therapeutic agents for treating A ⁇ associated disease.
- a compound is contacted with a Qpct knock-out cell, a transfected cell or a cell derived from a Qpct mutant non-human animal, and screened for alterations in a phenotype associated with expression of Qpct.
- the changes in A ⁇ production in the cellular assay and the knockout animal can be assessed by methods well known to those skilled in the art.
- a Qpct fusion polypeptide such as Qpct can be particularly useful for such screening methods since the expression of Qpct can be monitored by fluorescence intensity.
- Other exemplary fusion polypeptides include other fluorescent proteins, or modifications thereof, glutathione-S-transferase (GST) , maltose binding protein, poly His, and the like, or any type of epitope tag.
- GST glutathione-S-transferase
- Such fusion polypeptides can be detected, for example, using antibodies specific to the fusion polypeptides.
- the fusion polypeptides can be an entire polypeptide or a functional portion thereof so long as the functional portion retains desired properties, for example, antibody binding activity or fluorescence activity.
- the invention further provides a method of identifying a potential therapeutic agent for use in treating the diseases as mentioned above.
- the method includes the steps of contacting a cell containing the above DNA construct with a compound and screening the cell for the results to be observed, thereby identifying a potential therapeutic agent for use in treating Qpct-related diseases.
- the cell can be isolated from a knock-out non-human mammal having nucleated cells containing the Qpct DNA construct.
- the cell can contain a DNA construct comprising a nucleic acid encoding a green fluorescent protein fusion, or other fusion polypeptide, with a Qpct polypeptide.
- Qpct knock-out cells expressing a Qpct polypeptide can be used in a preliminary screen to identify compounds as potential therapeutic agents having activity that alters a phenotype associated with Qpct expression.
- an appropriate control cell can be used to compare the results of the screen.
- the effectiveness of compounds identified by an initial in vitro screen using Qpct knock-out cells can be further tested in vivo using the invention Qpct knock-out non-human mammals, if desired.
- the invention provides methods of screening a large number of compounds using a cell-based assay, for example, using high throughput screening, as well as methods of further testing compounds as therapeutic agents in an animal model of A ⁇ - related disorders.
- the present invention also provides a new method for the treatment of Mild Cognitive Impairment (MCI), Alzheimer's disease, Familial Danish Dementia, Familial British Dementia and neurodegeneration in Down syndrome.
- MCI Mild Cognitive Impairment
- the pGlu formation is an important event in the development and progression of the disease, since the modified amyloid ⁇ -peptides, ADan and ABri show an enhanced tendency to amyloid aggregation and toxicity, likely worsening the onset and progression of the disease. (Russo, C. et al. 2002 J Neurochem 82, 1480-1489; Ghiso, J. et al. 2001 Amyloid 8, 277-284).
- glutamic acid is present as an N-terminal amino acid.
- Qpct is involved in the formation of pyroglutamic acid that favors the aggregation of amyloid ⁇ -peptides .
- an inhibition of Qpct leads to a prevention of the precipitation of the plaque-forming [pGlu 3 ] A ⁇ 3-40/42/43 or [pGlu 11 ] A ⁇ ll-40/42/43, causing the onset and progression of Alzheimer's disease and Down Syndrome.
- Glutamate is found in positions 3, 11 and 22 of the amyloid ⁇ - peptide.
- the mutation from glutamic acid (E) to glutamine (Q) in position 22 (corresponds to amino acid 693 of the amyloid precursor protein APP770, Swissprot entry: P05067) has been described as the so-called Dutch type cerebroarterial amyloidosis mutation.
- ⁇ -amyloid peptides with a pyroglutamic acid residue in position 3, 11 and/or 22 have been described to be more cytotoxic and hydrophobic than A ⁇ l-40/42/43 (Saido T. C. 2000 Medical Hypotheses 54(3): 427-429).
- the multiple N-terminal variations can be generated by the ⁇ - secretase enzyme ⁇ -site amyloid precursor protein-cleaving enzyme (BACE) at different sites (Huse J. T. et al . 2002 Biol. Chem. 277 (18): 16278-16284), and/or by aminopeptidase processing.
- BACE ⁇ -site amyloid precursor protein-cleaving enzyme
- the N-terminal Glu-residue in Glu-containing peptides is predominantly bivalently charged at neutral pH.
- Glutamate exhibits pK a -values of about 4.2 and 7.5 for the ⁇ -carboxylic and for the CC-amino moiety, respectively, i.e. at neutral pH and above, although the ⁇ -amino nitrogen is in part or fully unprotonated and nucleophilic, the ⁇ -carboxylic group is unprotonated, and so exercising no electrophilic carbonyl activity. Hence, intramolecular cyclization is impossible.
- the kinetically determined pKa-value of 7.55 +/- 0.02 is in excellent agreement with that of the OC- amino group of Glu- ⁇ 3NA, determined by titration (7.57 + 0.05).
- -/K ] y [ ) of the Qpct-catalyzed glutamate cyclization might be in the range of l*10 5 - l*10 6 fold slower than the one for glutamine cyclization.
- the nonenzymatic turnover of both model substrates Glu- ⁇ NA and GIn- ⁇ NA is negligible, being conform with the observed negligible pGlu-peptide formation.
- an acceleration of at least 10 8 can be estimated from the ratio of the enzymatic versus non-enzymatic rate constants (comparing the second-order rate constants for the enzyme catalysis with the respective nonenzymatic cyclization first-order rate constants the catalytic proficiency factor is 10 9 -10 10 M "1 for the GIn- and the Glu-conversion, respectively) .
- the conclusion from these data is, that in vivo only an enzymatic path resulting pGlu- formations seems conceivable.
- the present invention provides the use of activity-decreasing effectors of Qpct, as selected with use of the present inventive animal model, for the suppression of pGlu-Amyloid peptide formation in Mild Cognitive Impairment, Alzheimer's disease, Down Sydrome, Familial Danish Dementia and Familial British Dementia.
- the present invention provides the use of activity-increasing effectors of Qpct, as selected with use of the present inventive animal model, for the stimulation of gastrointestinal tract cell proliferation, especially gastric mucosal cell proliferation, epithelial cell proliferation, the differentiation of acid-producing parietal cells and histamine- secreting enterochromaffin-like (ECL) cells, and the expression of genes associated with histamine synthesis and storage in ECL cells, as well as for the stimulation of acute acid secretion in mammals by maintaining or increasing the concentration of active [pGlu-L] -Gastrin.
- gastrointestinal tract cell proliferation especially gastric mucosal cell proliferation, epithelial cell proliferation, the differentiation of acid-producing parietal cells and histamine- secreting enterochromaffin-like (ECL) cells, and the expression of genes associated with histamine synthesis and storage in ECL cells, as well as for the stimulation of acute acid secretion in mammals by maintaining or increasing the concentration of active [pGlu-L] -Gastrin.
- the present invention provides the use of activity-decreasing effectors of Qpct, as selected with use of the present inventive animal model, for the suppression of pGlu-cytokine function, preferably chemokine function, most preferably monocyte chemoattractant function in Alzheimer's disease, Down Sydrome, Familial Danish Dementia and Familial British Dementia, atherosclerosis and restenosis.
- pGlu-cytokine function preferably chemokine function, most preferably monocyte chemoattractant function in Alzheimer's disease, Down Sydrome, Familial Danish Dementia and Familial British Dementia, atherosclerosis and restenosis.
- Alzheimer's disease Yamamoto, M., et al . , (2005) Am. J Pathol.
- lung fibrosis Inoshima, I., et al . , (2004)
- MCP-I might also play a role in gestosis (Katabuchi, H., et al . ,
- the mature form of human and rodent MCP-I is post- translationally modified by Glutaminyl Cyclase (Qpct) to possess an N-terminal pyroglutamyl (pGlu) residue.
- the N-terminal pGlu modification makes the protein resistant against N-terminal degradation by aminopeptidases, which is of importance, since chemotactic potency of MCP-I is mediated by its N-terminus (Van Damme, J., et al . , (1999) Chem Immunol 72, 42-56).
- Artificial elongation or degradation leads to a loss of function although MCP-I still binds to its receptor (CCR2) (Proost, P., et al .
- Inhibitors of Glutaminyl Cyclase are small orally available compounds, which target the important step of pGlu-formation at the N-terminus of MCP-I (Cynis, H., et al . , (2006) Biochim.Biophys .Acta 1764, 1618-1625; Buchholz, M., et al . , (2006) J Med Chem 49, 664-677).
- the N-terminus of MCP-I is not protected by a pGlu-residue .
- the N- terminus possesses a glutamine-proline motif, which is prone to cleavage by dipeptidylpeptidases, e.g. dipeptidylpeptidase 4 and fibroblast activating protein (FAP, Seprase) , which are abundant on the endothelium and within the blood circulation.
- dipeptidylpeptidases e.g. dipeptidylpeptidase 4 and fibroblast activating protein (FAP, Seprase)
- FAP fibroblast activating protein
- the present invention provides the use of activity decreasing effectors of Qpct, as selected with use of the present inventive animal model, for the treatment of duodenal ulcer disease and gastric cancer with or without Helicobacter pylori in mammals by decreasing the conversion rate of inactive [GIn ⁇ ] Gastrin to active [pGlu-L] Gastrin .
- Neurotensin is a neuropeptide implicated in the pathophysiology of schizophrenia that specifically modulates neurotransmitter systems previously demonstrated to be misregulated in this disorder.
- Clinical studies in which cerebrospinal fluid (CSF) NT concentrations have been measured revealed a subset of schizophrenic patients with decreased CSF NT concentrations that are restored by effective antipsychotic drug treatment.
- CSF cerebrospinal fluid
- NT systems in the mechanism of action of antipsychotic drugs.
- the behavioural and biochemical effects of centrally administered NT remarkably resemble those of systemically administered antipsychotic drugs, and antipsychotic drugs increase NT neurotransmission. This concatenation of findings led to the hypothesis that NT functions as an endogenous antipsychotic.
- the present invention provides the use of activity increasing effectors of Qpct, as selected with use of the present inventive animal model, for the preparation of antipsychotic drugs and/or for the treatment of schizophrenia in mammals.
- the effectors of Qpct either maintain or increase the concentration of active [pGlu-L] neurotensin .
- FPP Fertilization promoting peptide
- TRH thyrotrophin releasing hormone
- FPP initially stimulates nonfertilizing
- the present invention provides the use of activity-lowering effectors of Qpct, as selected with the present inventive animal model, for the preparation of fertilization prohibitive drugs and/or to reduce the fertility in mammals.
- the activity lowering effectors of Qpct decrease the concentration of active [pGlu ⁇ -JFPP, leading to a prevention of sperm capacitation and deactivation of sperm cells.
- activity-increasing effectors of Qpct are able to stimulate fertility in males and to treat infertility.
- the present invention provides the use of effectors of Qpct, as selected with use of the present inventive animal model, for the preparation of a medicament for the treatment of pathophysiological conditions, such as suppression of proliferation of myeloid progenitor cells, neoplasia, inflammatory host responses, cancer, malign metastasis, melanoma, psoriasis, rheumatoid arthritis, atherosclerosis, lung fibrosis, liver fibrosis, renal fibrosis, graft rejection, acquired immune deficiency syndrom, impaired humoral and cell- mediated immunity responses, leukocyte adhesion and migration processes at the endothelium.
- pathophysiological conditions such as suppression of proliferation of myeloid progenitor cells, neoplasia, inflammatory host responses, cancer, malign metastasis, melanoma, psoriasis, rheumatoid arthritis, atherosclerosis, lung fibrosis, liver fibros
- the present invention provides the use of effectors of Qpct, as selected with use of the present inventive animal model, for the preparation of a medicament for the treatment of impaired food intake and sleep-wakefulness, impaired homeostatic regulation of energy metabolism, impaired autonomic function, impaired hormonal balance and impaired regulation of body fluids.
- the biochemical properties of polyglutamine repeats suggest one possible explanation: endolytic cleavage at a glutaminyl-glutaminyl bond followed by pyroglutamate formation may contribute to the pathogenesis through augmenting the catabolic stability, hydrophobicity, amyloidogenicity, and neurotoxicity of the polyglutaminyl proteins (Saido, T . C . ; Med Hypotheses (2000) Mar; 54 (3) : 427-9) .
- the present invention therefore provides the use of effectors of Qpct, as selected with the present inventive animal model, for the preparation of a medicament for the treatment of Parkinson disease and Huntington's disease.
- the present invention provides a general way to reduce or inhibit the enzymatic activity of Qpct by using the test agent selected above.
- the agents selected by the above-described screening methods can work by decreasing the conversion of at least one substrate of Qpct (negative effectors, inhibitors) , or by increasing the conversion of at least one substrate of Qpct (positive effectors, activators) .
- the compounds of the present invention can be converted into acid addition salts, especially pharmaceutically acceptable acid addition salts.
- the salts of the compounds of the invention may be in the form of inorganic or organic salts.
- the compounds of the present invention can be converted into and used as acid addition salts, especially pharmaceutically acceptable acid addition salts.
- the pharmaceutically acceptable salt generally takes a form in which a basic side chain is protonated with an inorganic or organic acid.
- Representative organic or inorganic acids include hydrochloric, hydrobromic, perchloric, sulfuric, nitric, phosphoric, acetic, propionic, glycolic, lactic, succinic, maleic, fumaric, malic, tartaric, citric, benzoic, mandelic, methanesulfonic, hydroxyethanesulfonic, benzenesulfonic, oxalic, pamoic, 2- naphthalenesulfonic, p-toluenesulfonic, cyclohexanesulfamic, salicylic, saccharinic or triflu-oroacetic acid. All pharmaceutically acceptable acid addition salt forms of the compounds of the present invention are intended to be embraced by the scope
- the compounds according to this invention may accordingly exist as enantiomers. Where the compounds possess two or more chiral centers, they may additionally exist as diastereomers . It is to be understood that all such isomers and mixtures thereof are encompassed within the scope of the present invention. Furthermore, some of the crystalline forms of the compounds may exist as polymorphs and as such are intended to be included in the present invention. In addition, some of the compounds may form solvates with water (i.e. hydrates) or common organic solvents, and such solvates are also intended to be encompassed within the scope of this invention . The compounds, including their salts, can also be obtained in the form of their hydrates, or include other solvents used for their crystallization.
- the present invention provides a method of preventing or treating a condition mediated by modulation of the Qpct enzyme activity in a subject in need thereof which comprises administering any of the compounds of the present invention or pharmaceutical compositions thereof in a quantity and dosing regimen therapeutically effective to treat the condition.
- the present invention includes the use of the compounds of this invention, and their corresponding pharmaceutically acceptable acid addition salt forms, for the preparation of a medicament for the prevention or treatment of a condition mediated by modulation of the Qpct activity in a subject.
- the compound may be administered to a patient by any conventional route of administration, including, but not limited to, intravenous, oral, subcutaneous, intramuscular, intradermal, parenteral and combinations thereof.
- the invention relates to pharmaceutical compositions, that is to say, medicaments, that contain at least one compound of the invention or salts thereof, optionally in combination with one or more pharmaceutically acceptable carriers and/or solvents.
- compositions may, for example, be in the form of parenteral or enteral formulations and contain appropriate carriers, or they may be in the form of oral formulations that may contain appropriate carriers suitable for oral administration. Preferably, they are in the form of oral formulations .
- the effectors of Qpct activity administered according to the invention may be employed in pharmaceutically administrable formulations or formulation complexes as inhibitors or in combination with inhibitors, substrates, pseudosubstrates, inhibitors of Qpct expression, binding proteins or antibodies of those enzyme proteins that reduce the Qpct protein concentration in mammals.
- the compounds of the invention make it possible to adjust treatment individually to patients and diseases, it being possible, in particular, to avoid individual intolerances, allergies and side-effects.
- the compounds also exhibit differing degrees of activity as a function of time.
- the physician providing treatment is thereby given the opportunity to respond differently to the individual situation of patients: he is able to adjust precisely, on the one hand, the speed of the onset of action and, on the other hand, the duration of action and especially the intensity of action .
- a preferred treatment method according to the invention represents a new approach for the prevention or treatment of a condition mediated by modulation of the Qpct enzyme activity in mammals. It is advantageously simple, susceptible of commercial application and suitable for use, especially in the treatment of diseases that are based on unbalanced concentration of physiological active Qpct substrates in mammals and especially in human medicine.
- the compounds may be advantageously administered, for example, in the form of pharmaceutical preparations that contain the active ingredient in combination with customary additives like diluents, excipients and/or carriers known from the prior art.
- they can be administered parenterally (for example i.v. in physiological saline solution) or enterally (for example orally, formulated with customary carriers) .
- one or more doses of the compounds can be given per day in order to achieve the desired normalisation of the blood glucose values.
- a dosage range in humans may be in the range of from about 0.01 mg to 250.0 mg per day, preferably in the range of about 0.01 to 100 mg of compound per kilogram of body weight.
- gastrointestinal tract cell proliferation preferably proliferation of gastric mucosal cells, epithelial cells, acute acid secretion and the differentiation of acid producing parietal cells and histamine- secreting enterochromaffin-like cells.
- the prevent invention provides a method for the regulation and control of male fertility and the use of activity lowering effectors of Qpct for the preparation of contraceptive medicaments for males.
- the compounds used according to the invention can accordingly be converted in a manner known per se into conventional formulations, such as, for example, tablets, capsules, dragees, pills, suppositories, granules, aerosols, syrups, liquid, solid and cream-like emulsions and suspensions and solutions, using inert, non-toxic, pharmaceutically suitable carriers and additives or solvents.
- the therapeutically effective compounds are preferably present in a concentration of approximately from 0.1 to 80 % by weight, more preferably from 1 to 50 % by weight, of the total mixture, that is to say, in amounts sufficient for the mentioned dosage latitude to be obtained.
- the substances can be used as medicaments in the form of dragees, capsules, biteable capsules, tablets, drops, syrups or also as suppositories or as nasal sprays.
- the formulations may be advantageously prepared, for example, by extending the active ingredient with solvents and/or carriers, optionally with the use of emulsifiers and/or dispersants, it being possible, for example, in the case where water is used as diluent, for organic solvents to be optionally used as auxiliary solvents .
- excipients useful in connection with the present invention include: water, non-toxic organic solvents, such as paraffins (for example natural oil fractions) , vegetable oils
- solid carriers such as, for example, natural powdered minerals (for example highly dispersed silica, silicates) , sugars (for example raw sugar, lactose and dextrose) ; emulsifiers, such as non-ionic and anionic emulsifiers (for example polyoxyethylene fatty acid esters, polyoxyethylene fatty alcohol ethers, alkylsulphonates and arylsulphonates) , dispersants (for example lignin, sulphite liquors, methylcellulose, starch and polyvinylpyrrolidone) and lubricants (for example magnesium stearate, talcum, stearic acid and sodium lauryl sulphate) and optionally flavourings.
- natural powdered minerals for example highly dispersed silica, silicates
- sugars for example raw sugar, lactose and dextrose
- emulsifiers such as non-ionic and anionic emulsifiers (for example polyoxy
- Administration may be carried out in the usual manner, preferably enterally or parenterally, especially orally.
- tablets may contain in addition to the mentioned carriers further additives such as sodium citrate, calcium carbonate and calcium phosphate, together with various additives, such as starch, preferably potato starch, gelatin and the like.
- lubricants such as magnesium stearate, sodium lauryl sulphate and talcum, can be used concomitantly for tabletting.
- various taste correctives or colourings can be added to the active ingredients in addition to the above-mentioned excipients.
- solutions of the active ingredients using suitable liquid carriers can be employed.
- the murine Qpct gene encodes for glutaminyl cyclase, which is responsible for the presence of pyroglutamyl residues in many neuroendocrine peptides.
- the mouse Qpct gene is located on chromosome 17 and extends over 37.5 kb .
- the C57BL/6 mouse sequence is available on the Ensembl database (www.ensembl.org, ENSMUSG00000024084) .
- cDNA sequence NM 128770 the exon/intron organisation of the gene was established.
- This mouse gene consists in 7 exons interrupted by 6 introns .
- the translation initiation site is located in the first exon and the stop codon is located in exon 7.
- the Ensembl database search also revealed the presence of the PRKCN gene, located on the same strand, 40 kb upstream of the Qpct gene. No genes are known or predicted within the 80 kb region downstream of Qpct gene, nor on the complementary strand. The targeting of the Qpct locus is thus not predicted to influence any other gene expression.
- Two isoforms are known for the murine QPCT protein. These two isoforms (362 and 313 aa, respectively) are translated from two mRNAs : one containing all the exons (AK045974) and a splice variant in which exon 2 is spliced out (BC020023) .
- exon 3 residues important for the catalytic function of the protein are known in exon 3 (residue H141, see figure 2), exon 4 (E202 and E203) and exon 7 (H331). Residues important for binding to the substrate were also characterised in exon 3 (D160) and exon 5 (D249) .
- the aim of the present invention - the generation of both constitutive and conditional Qpct Knock-out models - has been achieved by flanking the targeted region with two LoxP sites, allowing its ubiquitous or tissue specific deletion following Cre-recombinase action.
- Qpct exons 4 and 5 were targeted.
- Substrate binding residue D248 encoded in exon 5 is deleted. • Reduced size of the targeted region to be deleted. This increases the probability of the homologous recombination step and allows efficient Cre-mediated recombination.
- the knock-out results in a frame shift leading to the generation of an early stop codon in exon 6 and thus in the loss of the N terminal part of the protein.
- LoxP site flanking the Qpct exons 4 and 5.
- One of these LoxP sites will be inserted in intron 3, in the long homology arm.
- the second LoxP site will be inserted in intron 5.
- This LoxP site will be associated with the neomycin selection cassette (see below) .
- a Diphtheria Toxin A (DTA) negative selection cassette will also be included at one extremity of the targeting vector in order to enhance the homologous recombination event at the 5' of the targeting vector
- the first step of the project consisted of the cloning of about 12 kb mouse genomic DNA fragment encompassing Qpct exons 4 to 6. This material was used to generate the homology arms required for the construction of the targeting vector. As illustrated in figure 4, it was cloned as two overlapping fragments:
- BAC clones were isolated by screening of a murine 129-mouse BAC DNA library (CT7/Invitrogen) with a 544 bp probe containing Qpct exon 5. These BAC clones are localised on membrane 201 of the library (Invitrogen/ResGen, BAC membrane order Cat# 96051) . The clones are referenced 201L13 and 201L14
- Three primer sets were designed for the amplification of each homology fragment.
- the three primer pairs were tested for each amplification and the optimal combination was selected for the amplification of the Qpct homology arms.
- the amplifications were performed on the 201L13 BAC clone with 15 PCR cycles in order to reduce the risk of mutations introduced during the amplification .
- thermostable Taq polymerase "Expand long template PCR system” kit (Roche Diagnostics) .
- PCR matrix the amplifications were performed using the 201L13 BAC vector (Invitrogen/ResGen, BAC clone order Cat#
- TOR2-A1 5' GTAGCTGGGATTACAGGAATGTGCC 3' 1
- TOR2-B1 5' GTCCTGAAGTTTGAGAACCACTGGC 3' 2 Amplification of the 3' short homology arm
- TOR2-C3 5' GCTAACTTTGCTAAGTCAGGAGGCC 3' 3
- TOR2-D3 5' TCTACCTCACACCAGTCAGAATGGC 3' 4
- sequences obtained from the 3 clones containing the 129Sv/Pas genetic background PCR amplified Al/Bl fragment were first aligned with each other to identify putative mutations introduced by the PCR amplification.
- the 129Sv/Pas sequences generated were aligned with the C57BL/6 sequence available in a public database. This enabled the determination of the polymorphism between the C57BL/6 and 129Sv/Pas strains in the region of interest.
- One of the sequenced clones presented no mutation in the whole amplified region. This clone has been chosen for the following cloning steps and is referred to as TOR2-TOPO-LA.
- the fragment of the Qpct DNA sequence, which is contained in the TOR2-TOPO-LA clone is represented by the sequence of SEQ ID NO. 24.
- the two other clones presented 2 and 5 mutations, respectively.
- Sequence deletions 5 small regions (between 1 and 22 bp long) are absent in the 129Sv/Pas sequence compared to the C57BL/6 one. These deletions are all located in intron 3.
- Sequence insertions 3 small regions (between 1 and 9 bp long) are present only in the 129Sv/Pas sequence. Two of these insertions are located in intron 3, the last one is inserted in intron 4.
- sequences obtained from the 3 clones containing the 129Sv/Pas genetic background PCR amplified C3/D3 fragment were first aligned with each other to identify putative mutations introduced by the PCR amplification.
- the 129Sv/Pas sequences generated were aligned with the C57BL/6 sequence available in a public database. This enabled the determination of the polymorphism between the C57BL/6 and the 129Sv/Pas strains in the region of interest.
- Two of the sequenced clones presented no mutation in the whole amplified region. One of these two clones was chosen for the following cloning steps and is referred to as TOR2-TOPO-SA.
- the fragment of the Qpct DNA sequence, which is contained in the TOR2-TOPO-SA clone is represented by the sequence of SEQ ID NO. 25.
- the third clone sequenced presented 2 mutations.
- Sequence insertion a 28-bp region is present only in the 129Sv/Pas sequence, in a region presenting some repeats.
- the targeting vector construction strategy and screening strategies were designed based on the sequence generated from the cloning of Qcpt exons 3 to 6.
- the global strategy for the final targeting vector construction is depicted schematically in figure 5. This construction can be sub-divided into 8 steps (circled numbers in figure 5) performed in parallel.
- Steps Ia and Ib The 5' and 3' homology arms were PCR amplified from mouse 129Sv/Pas genomic DNA.
- the short arm of homology contains an extended region (indicated as a green dotted line in 3b figure 5) that is not present in the final targeting vector (see 4a and 5a, figure 5) .
- Steps 2a and 2b The two homology arms were subcloned in pScript vectors containing a modified linker with all the restriction sites used for the construction of the targeting vector.
- Step 3a A distal LoxP site was introduced at the Bsgl site in intron 3. This distal LoxP site was introduced together with a Swal and BamHI restriction sites located downstream of the LoxP site. The restriction sites are used for the detection of the distal LoxP site in ES cell clones and for the Southern analysis of the clones.
- Step 3b An FRT-PGK-neomycin-FRT-LoxP positive selection cassette, proven to be efficient in ES cells, was subcloned into intron 5, upstream of the extended 3' homology arm. This step leads to the generation of the positive control vector subsequently used for PCR screening set up (see below) .
- Step 4 The 5' long homology arm, containing the distal LoxP site, was cloned together with the 3' short arm of homology. This latter short arm is shortened at its final size, ending at the Notl site in intron 6.
- TOR2-LSA vector The resulting vector, referred to as TOR2-LSA vector, was used as a targeting vector and was electroporated in ES cells.
- Step 5 Sub-cloning of a Diphteria Toxin A (DTA) negative selection cassette upstream of the 5' long homology arm.
- DTA Diphteria Toxin A
- the TOR2-LSA vector (vector without DTA) was electroporated into ES cells while trying to subclone the DTA cassette. Indeed, the DTA selection cassette helps to counterselect the ES cell clones in which the targeting vector has been integrated randomly in the genome, but is not mandatory.
- the targeting vector displays the following features:
- Homology arms isogenic with the ES cell line that will be used (129Sv/Pas) .
- the FRT-flanked selection cassette can be removed using the FIp recombinase .
- the distal LoxP site is introduced at a reduced distance (3 kb) from the neomycin selection cassette. This favours its integration during the homologous recombination step.
- the screening strategy is based on an initial PCR screening for a 3' targeting event, then a PCR screening for a 5' targeting event. The clones identified by PCR will then be confirmed by Southern blot analysis.
- the initial screening for detection of the expected integration of the targeting vector is achieved by PCR amplification over the 3' short arm of homology.
- This PCR is performed using a forward primer (TOR2-H, figure 6) hybridizing in the neomycin selection cassette and a reverse primer (TOR2-I, figure 6) located downstream of the targeting vector homology sequence. Because of its localisation, this primer set allows unequivocal and specific detection of the 3' integration of the targeting vector in the Qpct locus.
- H/I primers Three sets of H/I primers (TOR2-H1/TOR2-I1 to TOR2-H3/TOR2-I3, see below) were designed to optimise the quality of the screening. This screening was first set up on a positive control vector (see below and figure 6), on wild type 129Sv/Pas genomic DNA and on positive control vector diluted in genomic DNA as follows :
- (*) 1 copy equivalent genome of control DNA is the weight of control DNA containing the same number of copies as in 150 ng of genomic DNA.
- 1 copy equivalent genome length of control vector (bp) x 150/6.109 bp.
- 1 copy equivalent genome is 2.0 10-4 ng.
- This procedure allows to set-up a PCR screening which is sensitive enough to detect 1 copy equivalent genome of control
- Taq polymerase from the "Expand long template PCR system” kit (Roche diagnostics) .
- Buffer 3 (10 Denaturing 94°C 30s 35x
- TOR2-H1/TOR2-I1 primer set 3284 bp TOR2-H2/TOR2-I2 primer set: 2900 bp TOR2-H3/TOR2-I3 primer set: 3555 bp
- the three sets of primers were tested on serial dilutions of the positive control vector plasmid TOR2-C+ spiked in genomic DNA extracted from wild type 129Sv/Pas ES cells as described above.
- the primer set TOR2-H2/TOR2-I2 gave the optimal results and was selected for the screening. As illustrated in figure 7, TOR2- H2/TOR2-I2 primers give rise to the detection of the expected 2.9 kb band.
- the PCR sensitivity allows the detection of 0.1 copy equivalent genome (lanes 2 and 6 in figure 7), fulfilling the PCR set up requirement. Furthermore, specificity of the PCR reaction is validated since no signal is observed on genomic DNA extracted from wild type 129Sv/Pas ES cells (see lane 10 in figure 7) .
- Primer set TOR2-H2/TOR2-I2 was tested under conditions similar to recombinant genomic structure. This was achieved by transfecting TOR2-C+ positive control vector into ES cell. This protocol has been established to test the specificity of the primers and the sensitivity of the PCR reaction. The results are illustrated in figure 8.
- TOR2-J2/TOR2-K2 primers were designed to detect the expected integration of the 5' end of the targeting vector.
- the forward primer (TOR2-J2, figure 9) is located upstream of the long arm of homology and the reverse primer (TOR2-K2, figure 9) is located in intron 4. Because of its localisation, this primer set allows unequivocal and specific detection of the 5' integration of the targeting vector in the Qpct locus.
- Taq polymerase from the "Expand long template PCR system” kit (Roche diagnostics) .
- TOR2-J2 5' GCCTTCTAAGTAGCTGGGATTACAGG 3' 11
- TOR2-K2 5' GAGACCCATACAGAGAATCTTGAGGG 3' 12
- the expected 4.6 kb band is observed after amplification on genomic DNA (extracted from ES cells and tail biopsies), using GX2633-TOR2-J2/GX2634-TOR2-K2 primers. This validates the PCR screening for the detection of the distal LoxP site both in ES cells and on tail biopsies.
- Both 5' and 3' Southern blots were performed using restriction enzymes cutting upstream of the 5' homology arm or downstream of the 3' homology arm (figure 11) .
- the K and R probe sequences were BLASTed against murine genomic databases in order to select the probes with the best specificity based on in silico analysis. Southern blots were set up on wild type genomic DNA in order to validate probe specificity before proceeding to the confirmation screening itself.
- Southern blot analysis to test the 5' end homologous recombination is based on a BamHI digestion of the genomic DNA and detection using a 482 bp 5' internal K probe located in intron 3 (see figure 11) .
- This K probe is Avrll / Sacl subcloned from the TOR2-TOPO-LA vector.
- Wild type genomic DNA digested by BamHI and hybridized with the designed K probe gives a band, the size is around 13.2 kb, while recombinated genomic DNA is expected to give a 8.9 kb band (see figure 11) .
- Pre-hybridisation and hybridisation 4xSSC, 1% SDS, 0.5% skimmed milk, 2OmM EDTA, lOO ⁇ g/ml herring sperm, at 65°C for 18 h. Washings: 2 times 3XSSC, 1% SDS at 65°C for 15 min, then 2 times 0.5xSSC, 1% SDS at 65°C for 15 min.
- TOR2-TOPO-LA vector is digested by Avrll / Sacl enzymes to obtain 3 fragments at 8231, 2588 and 482 bp
- the K probe is obtained by purification of the 482 bp fragment .
- Southern blot analysis to test the 3' end homologous recombination is based on a Swal digestion of the genomic DNA and detection using a 406 bp 3' internal R probe located in exon 6 (see figure 11) .
- This R probe is amplified by PCR using TOR2- Rl and TOR2-R2 primers (see below) .
- Wild type genomic DNA digested by Swal and hybridized with the designed R probe gives a band whose size is about 6 kb, while recombinated genomic DNA is expected to give a 10.5 kb band (see figure 11) .
- Pre-hybridisation and hybridisation 4xSSC, 1% SDS, 0.5% skimmed milk, 2OmM EDTA, lOO ⁇ g/ml herring sperm, at 65°C for 18 h. Washings: 2 times 3XSSC, 1% SDS at 65°C for 15 min, then 2 times 0.5xSSC, 1% SDS at 65°C for 15 min.
- TOR2-R1 5' GGGCTTTCTCAGTGTTCTTAACATTCC 3 ⁇ 13 TOR2-R2 5' TCTATCATTGATTCTCAGGATGCGG 3 ⁇ 14
- the Flp-mediated excision enables the deletion of the neomycin cassette. This deletion can be performed in vitro, by transfection of the targeted ES cell clones with a validated Flp-expressing plasmid, or in vivo, by breeding the Qpct targeted animals with ubiquitous Flp-expressing mice.
- the Cre- mediated deletion of the Qpct exons 4 and 5, leading to the Qpct Knock-out mouse line will be performed in vivo.
- TOR2-N/TOR2-I1 primers were designed for the detection of Cre- mediated excision events.
- the forward primer TOR2-I1 is located in the long arm of homology, upstream of the neomycin cassette
- the forward primer TOR2-N is located downstream of the 3' short arm of homology.
- this PCR allows an unequivocal detection of the Cre-mediated excision of the exons 4-5 and neomycin selection cassette.
- TOR2-N2/TOR2-I4 primers were designed for the detection of Flp- mediated excision events.
- the forward primer TOR2-N2 is located in the long arm of homology, right upstream of the neomycin cassette ( Figure 13) .
- the forward primer TOR2-I4 is located in the short homology arm, downstream of the neomycin cassette.
- this PCR allows the detection of the Flp-mediated excision of the neomycin selection cassette. Since this PCR is using primers located internally to the targeting vector, the genotyping of the animals has to be confirmed by Southern blot analysis. Cre-mediated excision PCR conditions:
- Taq polymerase from the "Expand long template PCR system” kit (Roche Diagnostics) .
- GX2147-TOR2-N 5' AGAGAATGACCACTGCTGAGGATG 3' 15
- GX2140-TOR2-I2 5' TGTGGGACATCAATGAGAGGAGAG 3' 1 6
- Taq polymerase from the "Expand long template PCR system” kit (Roche Diagnostics) .
- GX4354-TOR2-N2 5' TTGGTAAGCATCCAGTTACTAAAGAGC 3' 17
- GX4353-TOR2-I4 5' GCAATCGGTTTTAATCACAGTAAGG 3'
- TOR2-LSA plasmid was digested by Notl to obtain its linearization.
- the 13.6 kb resulting fragment was purified by phenol/chloroform extraction followed by ethanol precipitation. This preparation was then used for ES cell electroporation .
- the linear TOR2-LSA plasmid was transfected into ES cells according to the following electroporation procedures: 100x10 ES cells in the presence of 100 ⁇ g of linearized plasmid, 800 Volt, 300 ⁇ F. Positive selection was started 48 hours after electroporation, by addition of 200 ⁇ g/ml of G418.
- the screening for the detection of the homologous recombination event at the 5' end of the targeting vector was performed using TOR2-J2 (GX2633) and TOR2-K2 (GX2634) primers (see figure 9) .
- the forward primer (GX2633-TOR2-J2) is located upstream of the targeting vector and the reverse primer (GX2634) is located in the long homology arm, downstream of the distal LoxP site (see figure 9) .
- a Swal digestion of the PCR product enables to discriminate between wild type and targeted alleles and to detect the presence of the distal LoxP site inside the long homology arm
- the 11 positive clones #6A3, #6C3, 6C10, 5B8, 5C5 5C12, 10A9, 10B2, 11B4, 12A2 and 15B2 are thus positive for both 5' and 3' PCR screening. This demonstrated that these clones underwent the expected recombination event on both the 5' long homology arm and the 3' short homology arm. Furthermore, the presence of the LoxP site at the targeted Qpct locus was demonstrated by the Swal digestion of the PCR product. This point is crucial to allow the future deletion of exons 4 and 5 under Cre-recombinase action, and thus the Qpct gene Knock-Out.
- the 11 positive clones were re-amplified in 24-well plates and further analysed by Southern blot at the 5' and 3' sides of the targeting vector.
- the 11 positive ES cell clones identified by PCR were further tested by 5' Southern blot.
- This 5' Southern blot is based on a BamHI digestion of the genomic DNA and detection using a 482 bp probe, 5 'K probe, located in intron 3, in the long homology arm
- the 11 ES cell clones were then tested by 3' Southern blot.
- the 3' Southern blot is based on a Swal digestion of the genomic DNA and detection using a 406 bp 3' internal R probe located in exon 6 (see Example 4, 1.2 and Figure 5) .
- the 7 ES cell clones #5B8, #5C5, #5C12, #6A3 #6C3, #10B2 and #15B2 were thus confirmed by Southern blot as correctly targeted at both 5' and 3' ends of the targeting vector.
- the last 4 clones #6C10, 10A9, 11B4 and 12A2 were also confirmed as correctly targeted at both 5 ' and 3 ' ends of the targeting vector but these clones present an additional random integration of the targeting vector at an unknown locus.
- Recipient blastocysts were isolated from pregnant C57BL/6 females (Health status SPF- Specific Pathogens free) . Based on morphological features, the ES cell clones #5C5, #5C12, #6A3, #6C3, #15B2, #10B2 and #11B4 were selected to be injected into blastocysts .
- Clone #10B2 was injected into 30 blastocysts and did not give rise to any pup.
- Clone #11B4 was injected into 30 blastocysts and gave rise to 4 pups. 3 chimeras were identified: • 3 male chimeras with a percentage of chimerism of 75%, 35% and 8%.
- Table 1 below compiles the results of the ES cell blastocyst injection sessions performed and the chimera generation.
- Table 1 Results from ES cell clones #6A3 , #6C3, #5C12, #5C5, #15B2 , #10B2 and #11B4 blastocyst injections As the female chimeras have a low probability of germ line transmission, the female chimeras obtained were not selected for further breeding.
- the four males at 20% (clone #6A3, 2 chimeras), 30% (clone #6C3) and 35 % (clone #5C12) were selected for the breeding phase.
- germline transmission was obtained from one of these chimeras before the last chimera generated (75% of chimerism, clones #15B2 and #11B4) were sexually mature, these latter chimeras were not used in the following breeding phase.
- chimeric males (displaying 20% to 35% chimerism), generated in the previous phase by blastocyst injection of the ES clone #6A3, #6C3 and #5C12, were mated with wild type C57BL/6J females (health status SOPF - Specific and Opportunist Pathogen Free) to investigate whether the targeted ES cells have contributed to the germ layer.
- the chimeras were also bred with FIp or Cre "deleter" females (health status SOPF - Specific and Opportunist Pathogen Free) to obtain the deletion of the neomycin selection cassette or Qpct exons 4-5 and selection cassette, respectively.
- Table 2 Reporting results of chimera breeding.
- WT wild type
- Het targeted heterozygote carrying the targeted Qpct allele
- Het partially Cre-excised heterozygote carrying the Cre-mediated excised Qpct allele and the targeted Qpct allele
- Het Cre-excised heterozygote carrying the Cre- mediated excised Qpct allele.
- mice coat colour markers were used.
- the coat colour marker of the 129Sv/Pas ES cells is dominant over the black coat colour of the C57BL/6J mice. Therefore, mating the chimeras with C57BL/6J mice should yield either black pups, when the germ cells of the chimera are derived from the C57BL/6J cells, or agouti-coloured pups, when the ES cells have contributed to the germ cells.
- agouti pups in the Fl generation when using C57BL/6J mice for breeding is thus evidence for the germline transmission of the ES cells.
- ES cells only one copy of the autosomal target gene is targeted and consequently, assuming germ line transmission occurs, 50 % of the resulting agouti offspring should receive the mutated chromosome from the ES cells and 50 % should receive the wild type chromosome.
- the Fl animals derived from this male chimera and the 129Sv/Pas CMV-Cre #91 female were genotyped to identify heterozygous mice carrying the constitutive Knock-out allele.
- the female background is 129Sv/Pas, the mouse coat colour markers cannot be used. All the Fl animals #34709 to 34716 and 35437 to 35443 were thus genotyped as described below.
- DNA was prepared from tail biopsies, taken from the 15 resulting pups and was genotyped by two different PCR strategies: • Cre-excision PCR (see figure 18) for the detection of the Cre-mediated excision of the LoxP flanked region within the targeted Qpct allele. This PCR yields an amplification product of different size depending on the template used: wild type, targeted or Cre-excised allele.
- the Cre-excision PCR was performed using a forward primer TOR2-N hybridizing in the 5' homology arm, upstream of the distal LoxP site, and a reverse primer TOR2-I1 hybridizing downstream of exon 6 (see figure 13) . Because of its localisation, this primer pair allows the specific detection of the Cre mediated excision event .
- the Cre-excised allele yields an amplification product of 4.4 kb using the above primer pair, whereas the targeted (non-excised) allele yields an amplification product of 9.2 kb (see figure 13) . Since both primers hybridize on the wild type non-targeted allele, a further amplification product of 7.3 kb will be obtained from all animals corresponding to the wild type allele.
- a representative example of the genotyping PCR results is illustrated in figure 18. As shown in figure 18, the PCR always favours the amplification of the allele yielding the smaller PCR product. The large size of amplification product of the heterozygous wild type or the heterozygous targeted allele may result in a poor amplification efficiency.
- the genotyping by Cre-excision PCR indicated that among the 15 tested animals born, 2 animals (#35437 and #35438) carry the Cre-excised allele. The other 13 tested animals were either wild type mice or carry the targeted allele. This latter targeted allele was not unequivocally detected by this PCR strategy, because of the preferential amplification of the shorter PCR products corresponding to the Cre-excised and wild type alleles.
- the 3' PCR screening was performed using a forward primer TOR2- H2 located within the neomycin selection cassette and a reverse primer TOR2-I2 hybridizing downstream (see figure 6) .
- the primer sequences and the optimised PCR condition are listed in tables 4 and 5.
- this primer set allows the specific detection of the targeted, non-excised Qpct allele, yielding an amplification product of 2900 bp in size in heterozygous offspring carrying the targeted, but non-excised Qpct allele.
- a representative example of the genotyping PCR results is illustrated in figure 19.
- the genotyping by 3' PCR screening indicated that among the 15 tested animals born, 2 animals (#35437 and #35441) carry the targeted allele.
- this male is the first heterozygous constitutive Qpct Knock-out mouse characterised.
- This heterozygous male was then mated with wild type females in order to generate more heterozygous constitutive Qpct Knock-out animals. The results are described below in Example 11.
- the female #35441 carries the wild type allele and the targeted non-excised allele but not the Cre-excised allele.
- This female is thus a heterozygous Qpct targeted animal in which the Qpct targeted region is floxed and still contains the neomycin selection cassette.
- This female #35441 was mated with a Flp-expressing male, in order to obtain the in vivo excision of the selection cassette. The results are described below in Example 12.
- the first heterozygous constitutive Qpct Knock-out mouse generated (see Example 10) was mated with wild type females in order to generate several heterozygous constitutive Qpct Knock- out animals.
- Table 3 Reporting results of first heterozygous constitutive Qpct Knockout animal breeding. The genotype of the animals is given in bracket (see also text below) .
- WT wild type; Het Cre-excised: heterozygote carrying the Cre-mediated excised Qpct allele.
- Cre-excision PCR (see figure 20, ⁇ 13.2) for the detection of the Cre-mediated excision of the LoxP flanked region within the targeted Qpct allele. This PCR yields an amplification product of different size depending on the template used: wild type, targeted or Cre-excised allele. • 3' PCR screening (see ⁇ 13.3) that was already used for the detection of a homologous recombination event in ES cells.
- This PCR strategy detects the non-excised, targeted Qpct allele carrying the exons 4 and 5 flanked by the LoxP-FRT- neomycin-FRT cassette and the distal LoxP site.
- the Cre-excision PCR was performed using a forward primer TOR2-N hybridizing in the 5' homology arm, upstream of the distal LoxP site, and a reverse primer TOR2-I1 hybridizing downstream of exon 6 (see figure 13) . Because of its localisation, this primer pair allows the specific detection of the Cre mediated excision event .
- the Cre-excised allele yields an amplification product of 4.4 kb using the above primer pair, whereas the targeted (non-excised) allele yields an amplification product of 9.2 kb (see figure 13) . Since both primers hybridize to the wild type non-targeted allele, a further amplification product of 7.3 kb will be obtained from all animals corresponding to the wild type allele.
- a representative example of the genotyping PCR results is illustrated in figure 20.
- the genotyping by Cre-excision PCR indicated that among the 12 tested animals born, 3 animals (#18244, #18156 and #18159) carry the Cre-excised allele. The other 9 tested animals are wild type mice .
- the Southern blot analysis confirmed the PCR results and gave an ultimate demonstration of the genotype of these animals: the 4 males #35438, #18156, #18159 and #18244 are heterozygous constitutive Qpct Knock-out animals .
- Table 4 Results of the heterozygous targeted Qpct female with FIp- expressing male breeding.
- Het partially Flp-excised heterozygote carrying the Flp-mediated excised Qpct allele and the targeted Qpct allele.
- the Flp-excision PCR was performed using a forward primer TOR2- N2 hybridizing in the long 5' homology arm, upstream of the neomycin selection cassette, and a reverse primer TOR2-I4 hybridizing in the short 3' homology arm, downstream of the neomycin selection cassette (see figure 13, Example 5.2). Due to the primer set localisation, this PCR allows the detection of the Flp-mediated excision of the neomycin selection cassette.
- the Flp-excised allele should yield an amplification product of 538 bp using the above primer pair, whereas the targeted (non- excised) allele should yield an amplification product of 2211 bp (see figure 13) . Since both primers hybridize to the wild type non-targeted allele, a further amplification product of 419 bp will be obtained from all animals corresponding to the wild type allele.
- the genotyping PCR results are illustrated in figure 22.
- the genotyping by Flp-excision PCR indicated that among the 7 tested animals born, 4 animals (#17973, #17974, #1796 and #17977) carried the Flp-excised allele.
- the other 3 animals tested were either wild type mice or carried the targeted allele
- the genotyping by 3' PCR screening indicated that among the 7 tested animals born, 6 animals (#17972 to #17977) carry the targeted allele.
- the male #17971 carried only the wild type Qpct allele. This animal was sacrificed.
- the animals #17972 and #17975 carried the wild type allele and the targeted non-excised allele but not the Flp-excised allele. These 2 animals are thus heterozygous Qpct targeted animal in which the Qpct targeted region is floxed and still contains the neomycin selection cassette. These animals were sacrificed.
- mice 4 males #17973 and #17974 and 2 females #17976 and #17977 yielded amplification products corresponding to the Flp-mediated excised allele, wild type allele and Qpct targeted allele. This suggests that these mice carry an incomplete excision of the neomycin selection cassette, meaning that they consist in a mosaic of excised and non-excised cell types. These animals were then bred with wild type mice in order to generate the heterozygous conditional Qpct Knock-out mouse line.
- Table 5 Results of the heterozygous partially FIp excised Qpct male with wild type females breeding.
- Het partially Flp-excised heterozygote carrying the Flp-mediated excised Qpct allele and the targeted Qpct allele; Het Flp-excised: heterozygote carrying the Flp-mediated excised Qpct allele.
- the Flp-excision screening was performed as previously described using the TOR2-N2/TOR2-I4 PCR.
- the Flp-excised allele yields an amplification product of 538 bp using the above primer pair, whereas the targeted (non-excised) allele yields an amplification product of 2211 bp (see figure 13) . Since both primers hybridize to the wild type non-targeted allele, a further amplification product of 419 bp will be obtained from all animals corresponding to the wild type allele.
- a representative example of the genotyping PCR results is illustrated in figure 24.
- the genotyping by Flp-excision PCR indicated that among the 14 tested animals, 8 animals (#18823, #18824, #18825, #18826, #18828, #18830, #18833 and #18836) carried the Flp-excised allele.
- the other 6 tested animals were either wild type mice or carry the targeted allele.
- the genotyping by 3' PCR screening indicated that among the 14 tested animals born, 3 animals (#18826, #18829 and #18833) carry the targeted allele.
- the animals #18827, #18831, #18832, #18834 and #18835 carry only the wild type Qpct allele. These animals were sacrificed.
- the animal #18829 carried the wild type allele and the targeted non-excised allele but not the Flp-excised allele. This animal is thus a heterozygous Qpct targeted animal in which the Qpct targeted region is floxed and still contains the neomycin selection cassette. This animal was sacrificed.
- mice #18826 and #18833 yielded amplification products corresponding to the Flp-mediated excised allele, wild type allele and Qpct targeted allele. This suggests that these mice carried an incomplete excision of the neomycin selection cassette, meaning that they consist in a mosaic of excised and non-excised cell types. These animals were sacrificed. Finally, 6 animals (5 males #18823, #18824, #18825, #18828, #18830 and the female #18836) yielded amplification products corresponding to both the FIp excised allele and the wild- type allele. These mice thus carry a complete excision of the neomycin selection cassette and are pure heterozygous conditional Qpct Knock-out animals. An ultimate Southern blot confirmation of this genotype was performed on these animals .
- the 3' Southern blot screening strategy was used to further test the genotype of the three Fl heterozygous conditional Qpct Knock-out animals and confirm the PCR genotyping.
- This 3' Southern blot is based on a Swal digestion of the genomic DNA and detection using a 406 bp 3' internal R probe (3'R probe) (see Exampled 4, 1.2, 7, 1.2 and Figure 11).
- the inventors succeeded in the amplification, cloning and sequencing of the two homology arms needed for the generation of the TOR2-HR targeting vector.
- the targeting and positive control vectors were generated following state of the art methodologies and according to the strategy presented above.
- the seven ES cell clones 5C5, #5C12, #6A3 #6C3, #15B2, #10B2 and #11B4 were selected for the blastocyst injections. These ES cell clones were injected and re-implanted into a total of 374 blastocysts, giving rise to a total of 17 male chimeras with the following rate of chimerism:
- Qpct targeted heterozygous animals.
- the chimeras were also bred with FIp or Cre deleter females (health status SOPF - Specific and Opportunist Pathogen Free) to obtain the deletion of the neomycin selection cassette and Qpct exons 4-5 and selection cassette, respectively.
- mouse embryonal stem cells derived from line 129SvPas
- clones were selected which carried in the genome
- ES cells were injected into blastocycts and chimeras were generated via embryo transfer.
- the chimeras were mated to Flp-expressing animals followed by breeding of the pups with Cre-expressing animals for deletion of Qpctl exons 4 and 5.
- Pups were identified which are heterozygous for the Qpct locus and carry a Qpct allele where exons 4 and 5 are deleted in addition to the wildtype allele (Fig. 27) .
- These animals served as the founders for mouse line Pbd2.
- the wildtype allele can be detected as an approx. 735 bp fragment whereas the targeted knockout allele is detected as an approx. 525 bp fragment (s. Fig. 28) .
- the Qpct-activity in the plasma was determined, applying a method, which is based on detection of formation of L-pGlu-beta- naphthylamine from L-glutaminyl-beta-naphthylamine catalyzed by Qpct in plasma (Cynis, H. et al . 2006 Biochim Biophys Acta 1764, 1618-1625) . Briefly, the assay is based on conversion of H-GIn- ⁇ NA to pGlu- ⁇ NA. The sample consisted of 50 ⁇ M H-Gln- ⁇ NA in 25mM MOPS, pH 7.0, 0. ImM N-Ethylmaleinimide (NEM) and enzyme solution in a final volume of ImI.
- NEM N-Ethylmaleinimide
- Substrate and NEM were pre-incubated for 15min at 30 0 C.
- the sample was centrifuged at 4°C for 20min at l ⁇ .OOOxg.
- the reaction was started by addition of lOO ⁇ l plasma sample.
- the reaction mix was further incubated at 30 0 C and constantly shaken at 300rpm in a thermomixer (Eppendorf, Germany) .
- Test samples were removed at time points of 0, 5, 10, 15, 22, 30 and 45min.
- the reaction was immediately stopped by boiling for 4min.
- Test samples were cooled on ice and stored at -20 0 C. For analysis, samples were thawed on ice and centrifuged at 4°C for 20min at 16,000xg.
- Testosterone (6,17- dodecahydrocyclopenta [a] phenanthren-3- one) is the principal male sex hormone and a steroid hormone, which is primarily secreted in the testes of males and the ovaries of females. Testosterone is also secreted by the adrenal glands. Testosterone plays a key role in health and well-being as well as in sexual functioning. The release of sexual hormones from the gonads is regulated by the hypophyseal hormones LH and FSH. The release of these pituitary hormones, in turn, is stimulated by the hypothalamic hormone gonadotropin-releasing hormone (GnRH) .
- GnRH hypothalamic hormone gonadotropin-releasing hormone
- GnRH Gonadotropin-releasing hormone
- GnRH is secreted from parvicellular neurons in the arcuate nucleus into the median eminence. GnRH then enters the hypophyseal portal system, traveling in the long vein until reaching the anterior pituitary, where it acts on gonadotropes to release LH
- GnRH is N- terminally modified by pGlu and is therefore a substrate of Qpct. A reduction of the pGlu-formation at the N-terminus of GnRH is intended to result in deactivation of the hormone and, consequently, in disturbance of the HPG axis and deregulated testosterone concentrations.
- the effect of depletion of Qpct on the testosterone concentration is depicted in figure 30.
- the concentration of testosterone in serum of male mice was determined applying a competitive ELISA method (IBL, Hamburg, Germany, Cat. -no. RE52631). The determinations were performed according to the instructions of the manufacturer. The results show no difference in the testosterone concentration between wild-type and QPCT knock-out mice. Even a total loss of QPCT does not result in disturbance of the gonadal hormone, proving that pharmacological inhibition of Qpct does not result in unwanted side effects on the reproductive axis.
- Thyroxine (3, 5, 3 ' , 5 ' -tetraiodothyronine, T 4 ) is a hormone, which is secreted by the follicular cells of the thyroid gland. T 4 plays a role in the control of metabolic processes. Thyroxine increases cardiac output, heart rate and the basal metabolic rate and potentiates brain development. The secretion of the thyroid hormones thyroxin and triiodothyronine (T 3 ) is regulated via the hypothalamic-pituitary-thyroid axis. The hypothalamus senses low circulating levels of thyroid hormone and responds by releasing thyrotropin releasing hormone (TRH) .
- TRH thyrotropin releasing hormone
- the tripeptide TRH is N-terminally modified by pGlu and is therefore a substrate of Qpct.
- the TRH stimulates the pituitary to produce thyroid stimulating hormone (TSH) .
- TSH thyroid stimulating hormone
- the TSH stimulates the thyroid to produce thyroid hormones.
- a reduction of the pGlu-formation at the N-terminus of TRH is intended to result in deactivation of the hormone and, consequently, in disturbance of the HPT axis and deregulated thyroxine concentrations.
- FIG. 31 The effect of depletion of Qpct on the thyroxine concentration is depicted in figure 31.
- concentration of thyroxine in plasma of the mice was determined applying a competitive ELISA method (IBL, Hamburg, Germany, Cat. -no. RE55261). The determinations were performed according to the instructions of the manufacturer.
- EXAMPLE 16 TRANSWELL CHEMOTAXIS ASSAY
- Human acute monocytic leukaemia cell line THP-I was cultured in RPMI1640, 10 % FBS, in a humidified atmosphere of 5% CO2 at
- the chemotactic assay was performed using 24-well TransWell plates with a pore size of 5 ⁇ m (Corning) . 600 ⁇ l of chemoattractant solution were applied to the lower chamber. Serum-free RPMI was applied as negative control. THP-I cells were harvested and resuspended in RPMI1640 in a concentration of l*10 6 cells / 100 ⁇ l and applied in 100 ⁇ l aliquots to the upper chamber. Cells were allowed to migrate towards the chemoattractant for 2 h at 37°C.
- chemotactic index was calculated by dividing cells migrated to the stimulus from cells migrated to the negative control.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Veterinary Medicine (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Molecular Biology (AREA)
- Environmental Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Animal Husbandry (AREA)
- Physics & Mathematics (AREA)
- Biodiversity & Conservation Biology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Rheumatology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Cardiology (AREA)
- Immunology (AREA)
- Hospice & Palliative Care (AREA)
- Heart & Thoracic Surgery (AREA)
- Vascular Medicine (AREA)
- Pain & Pain Management (AREA)
- Psychiatry (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2710494A CA2710494A1 (en) | 2008-01-14 | 2009-01-14 | Mouse models carrying a knock-out mutation of the glutaminyl cyclase gene |
| NZ586665A NZ586665A (en) | 2008-01-14 | 2009-01-14 | MOUSE MODELS CARRYING A KNOCK-OUT MUTATION OF THE GLUTAMINYL CYCLASE GENE (Qpct) |
| JP2010541803A JP2011511622A (ja) | 2008-01-14 | 2009-01-14 | グルタミニルシクラーゼ遺伝子のノックアウト変異を有するマウスモデル |
| AU2009204864A AU2009204864A1 (en) | 2008-01-14 | 2009-01-14 | Mouse models carrying a knock-out mutation of the glutaminyl cyclase gene |
| EP09702062.2A EP2238252B1 (en) | 2008-01-14 | 2009-01-14 | Mouse models carrying a knock-out mutation of the glutaminyl cyclase gene |
| IL206484A IL206484A0 (en) | 2008-01-14 | 2010-06-20 | Mouse models carrying a knock-out mutation of the glutaminyl cyclase gene |
| ZA2010/04367A ZA201004367B (en) | 2008-01-14 | 2010-06-21 | Mouse models carrying a knock-out mutation of the glutaminyl cyclase gene |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US2078408P | 2008-01-14 | 2008-01-14 | |
| US61/020,784 | 2008-01-14 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2009090190A1 true WO2009090190A1 (en) | 2009-07-23 |
| WO2009090190A9 WO2009090190A9 (en) | 2010-08-26 |
Family
ID=40427980
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2009/050387 Ceased WO2009090190A1 (en) | 2008-01-14 | 2009-01-14 | Mouse models carrying a knock-out mutation of the glutaminyl cyclase gene |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US9462793B2 (enExample) |
| EP (1) | EP2238252B1 (enExample) |
| JP (1) | JP2011511622A (enExample) |
| AU (1) | AU2009204864A1 (enExample) |
| CA (1) | CA2710494A1 (enExample) |
| IL (1) | IL206484A0 (enExample) |
| NZ (1) | NZ586665A (enExample) |
| WO (1) | WO2009090190A1 (enExample) |
| ZA (1) | ZA201004367B (enExample) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3174987B1 (en) * | 2014-08-01 | 2023-10-11 | The Johns Hopkins University | Mrgprx2/mrgprb2 expressing cell based assay to detect pseudo-allergic drug reactions and to identify blockers to prevent the adverse reactions |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4873191A (en) | 1981-06-12 | 1989-10-10 | Ohio University | Genetic transformation of zygotes |
| EP1262552A1 (en) * | 2001-05-23 | 2002-12-04 | Genoptera, LLC | Polynucleotides encoding insect glutaminyl cyclase and uses thereof |
| WO2008034891A2 (en) * | 2006-09-21 | 2008-03-27 | Probiodrug Ag | Novel genes related to glutaminyl cyclase |
| WO2008087197A1 (en) * | 2007-01-19 | 2008-07-24 | Probiodrug Ag | In vivo screening models for treatment of alzheimer's disease and other qpct-related disorders |
Family Cites Families (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2874751B2 (ja) | 1986-04-09 | 1999-03-24 | ジェンザイム・コーポレーション | 希望する蛋白質をミルク中へ分泌する遺伝子移植動物 |
| US4873316A (en) | 1987-06-23 | 1989-10-10 | Biogen, Inc. | Isolation of exogenous recombinant proteins from the milk of transgenic mammals |
| US5175384A (en) | 1988-12-05 | 1992-12-29 | Genpharm International | Transgenic mice depleted in mature t-cells and methods for making transgenic mice |
| GB8901778D0 (en) | 1989-01-27 | 1989-03-15 | Univ Court Of The University O | Manipulatory technique |
| US5602299A (en) | 1992-09-23 | 1997-02-11 | Mount Sinai School Of Medicine Of The City University Of New York | Transgenic animal models for neurodegenerative disease |
| JPH07132033A (ja) | 1993-11-12 | 1995-05-23 | Hoechst Japan Ltd | アルツハイマー病モデルトランスジェニック動物 |
| US6066778A (en) | 1996-11-06 | 2000-05-23 | The Regents Of The University Of Michigan | Transgenic mice expressing APC resistant factor V |
| US5981830A (en) | 1997-05-30 | 1999-11-09 | Schering Aktiengesellschaft | Knockout mice and their progeny with a disrupted hepsin gene |
| US6948038B2 (en) * | 2001-07-24 | 2005-09-20 | Microsoft Corporation | System and method for backing up and restoring data |
| MXPA05011861A (es) | 2003-05-05 | 2006-02-17 | Probiodrug Ag | Uso de efectores de ciclasas de glutamato y glutaminil. |
| US7371871B2 (en) | 2003-05-05 | 2008-05-13 | Probiodrug Ag | Inhibitors of glutaminyl cyclase |
| US7732162B2 (en) | 2003-05-05 | 2010-06-08 | Probiodrug Ag | Inhibitors of glutaminyl cyclase for treating neurodegenerative diseases |
| US8338120B2 (en) | 2003-05-05 | 2012-12-25 | Probiodrug Ag | Method of treating inflammation with glutaminyl cyclase inhibitors |
| NZ572274A (en) | 2003-05-05 | 2009-06-26 | Probiodrug Ag | Use of effectors of glutaminyl and glutamate cyclases |
| EA010108B1 (ru) | 2003-10-15 | 2008-06-30 | Пробиодруг Аг | Применение эффекторов глутаминил- и глутаматциклаз |
| CA2544573A1 (en) | 2003-11-03 | 2005-06-02 | Probiodrug Ag | Combinations useful for the treatment of neuronal disorders |
| US20050171112A1 (en) | 2003-11-03 | 2005-08-04 | Probiodrug Ag | Combinations useful for the treatment of neuronal disorders |
| US7667044B2 (en) | 2003-11-03 | 2010-02-23 | Probiodrug Ag | Compounds for the treatment of neurological disorders |
| KR101099206B1 (ko) | 2004-02-05 | 2011-12-27 | 프로비오드룩 아게 | 신규한 글루타미닐 시클라제 저해제 |
| US8420684B2 (en) | 2006-11-09 | 2013-04-16 | Probiodrug Ag | Inhibitors of glutaminyl cyclase |
| US7741354B2 (en) | 2006-11-09 | 2010-06-22 | Probiodrug Ag | Inhibitors of glutaminyl cyclase |
| EP2091948B1 (en) | 2006-11-30 | 2012-04-18 | Probiodrug AG | Novel inhibitors of glutaminyl cyclase |
| US7803810B2 (en) | 2007-03-09 | 2010-09-28 | Probiodrug Ag | Inhibitors |
| US8772508B2 (en) | 2007-04-18 | 2014-07-08 | Probiodrug Ag | Inhibitors of glutaminyl cyclase |
| WO2008128982A1 (en) | 2007-04-18 | 2008-10-30 | Probiodrug Ag | Thioxoquinazolinone derivatives as glutaminyl cyclase inhibitors |
| US9512082B2 (en) | 2007-04-18 | 2016-12-06 | Probiodrug Ag | Inhibitors of glutaminyl cyclase |
| DK2160380T3 (da) | 2007-04-18 | 2014-06-30 | Probiodrug Ag | Cyano-guanidin derivater som glutaminyl cyclase inhibitorer |
| US8202897B2 (en) | 2007-04-18 | 2012-06-19 | Probiodrug Ag | Inhibitors of glutaminyl cyclases |
| US9656991B2 (en) | 2007-04-18 | 2017-05-23 | Probiodrug Ag | Inhibitors of glutaminyl cyclase |
| JP5676249B2 (ja) | 2007-04-20 | 2015-02-25 | プロビオドルグ エージー | グルタミニルシクラーゼ阻害剤としてのアミノピリジン誘導体 |
| EP2195336B1 (en) | 2007-09-12 | 2015-01-21 | Probiodrug AG | Transgenic mice |
-
2009
- 2009-01-14 EP EP09702062.2A patent/EP2238252B1/en not_active Not-in-force
- 2009-01-14 AU AU2009204864A patent/AU2009204864A1/en not_active Abandoned
- 2009-01-14 WO PCT/EP2009/050387 patent/WO2009090190A1/en not_active Ceased
- 2009-01-14 JP JP2010541803A patent/JP2011511622A/ja active Pending
- 2009-01-14 NZ NZ586665A patent/NZ586665A/en not_active IP Right Cessation
- 2009-01-14 CA CA2710494A patent/CA2710494A1/en not_active Abandoned
- 2009-01-14 US US12/353,463 patent/US9462793B2/en not_active Expired - Fee Related
-
2010
- 2010-06-20 IL IL206484A patent/IL206484A0/en unknown
- 2010-06-21 ZA ZA2010/04367A patent/ZA201004367B/en unknown
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4873191A (en) | 1981-06-12 | 1989-10-10 | Ohio University | Genetic transformation of zygotes |
| EP1262552A1 (en) * | 2001-05-23 | 2002-12-04 | Genoptera, LLC | Polynucleotides encoding insect glutaminyl cyclase and uses thereof |
| WO2008034891A2 (en) * | 2006-09-21 | 2008-03-27 | Probiodrug Ag | Novel genes related to glutaminyl cyclase |
| WO2008087197A1 (en) * | 2007-01-19 | 2008-07-24 | Probiodrug Ag | In vivo screening models for treatment of alzheimer's disease and other qpct-related disorders |
Non-Patent Citations (5)
| Title |
|---|
| BINDER, E. B. ET AL., BIOL PSYCHIATRY, vol. 50, 2001, pages 856 - 872 |
| CYNIS H ET AL: "Inhibition of glutaminyl cyclase alters pyroglutamate formation in mammalian cells", BIOCHIMICA ET BIOPHYSICA ACTA (BBA) - PROTEINS & PROTEOMICS, ELSEVIER, vol. 1764, no. 10, 1 October 2006 (2006-10-01), pages 1618 - 1625, XP025123183, ISSN: 1570-9639, [retrieved on 20061001] * |
| FAESSLER R ET AL: "KNOCKOUT MICE: HOW TO MAKE THEM AND WHY. THE IMMUNOLOGICAL APPROACH", INTERNATIONAL ARCHIVES OF ALLERGY AND IMMUNOLOGY,, vol. 106, no. 4, 1 April 1995 (1995-04-01), pages 323 - 334, XP001088815, ISSN: 1018-2438 * |
| MORRIS, LEARN MOTIVAT, vol. 12, 1981, pages 239 - 260 |
| SCHILLING STEPHAN ET AL: "Isolation, catalytic properties, and competitive inhibitors of the zinc-dependent murine glutaminyl cyclase", BIOCHEMISTRY, vol. 44, no. 40, October 2005 (2005-10-01), pages 13415 - 13424, XP002519613, ISSN: 0006-2960 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2009090190A9 (en) | 2010-08-26 |
| CA2710494A1 (en) | 2009-07-23 |
| AU2009204864A1 (en) | 2009-07-23 |
| US20090183267A1 (en) | 2009-07-16 |
| EP2238252B1 (en) | 2013-07-31 |
| EP2238252A1 (en) | 2010-10-13 |
| ZA201004367B (en) | 2011-08-31 |
| JP2011511622A (ja) | 2011-04-14 |
| NZ586665A (en) | 2011-12-22 |
| IL206484A0 (en) | 2010-12-30 |
| US9462793B2 (en) | 2016-10-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8283517B2 (en) | Transgenic mouse models of Aβ overexpression | |
| US20080200567A1 (en) | In vivo screening models for treatment of alzheimer's disease and other qpct-related disorders | |
| US9462793B2 (en) | Mouse carrying a knock-out mutation of the Qpct-gene | |
| EP2432314B1 (en) | Mouse models carrying a knock-out mutation of the qpctl-gene | |
| US9277737B2 (en) | Mouse models carrying a knock-out mutation of the QPCTL-gene | |
| TOWER | Schilling et al.(43) Pub. Date: Jul. 16, 2009 | |
| US20150150225A1 (en) | Transgenic mouse expressing human isoglutaminyl cyclotransferase | |
| US20130052203A1 (en) | In vivo screening models for treatment of qc-related disorders | |
| Stephan5Halle et al. | Demuth et al.(43) Pub. Date: Oct. 31, 2013 | |
| Graubner et al. | Graubner | |
| HK1146735A (en) | Transgenic mice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09702062 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2710494 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009204864 Country of ref document: AU Ref document number: 586665 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010541803 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2009204864 Country of ref document: AU Date of ref document: 20090114 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009702062 Country of ref document: EP |