WO2009077436A2 - Method for preparing protein conjugates - Google Patents

Abstract

An improved method for preparing protein conjugates comprises reacting primary amino groups of a first protein with a one group of a bifunctional linker and reacting a second protein with a second group on te same bifuntional linker to form a protein conjugate.

Description

METHOD FOR PREPARING PROTEIN CONJUGATES

The present invention relates to a method for the preparation of protein conjugates and to the conjugates prepared by the method. In particular, the invention relates to a method for preparing conjugates of a first protein and a second protein, in which the first protein may be, for example a targeting or binding protein such as a toxin, particularly a bacterial toxin. The second protein may be an antigen which is required to be delivered to a cell to which the first protein can bind. The method of the invention is particularly useful when either or both of the proteins have a limited number of free cysteine residues available for conjugation.

The development of vaccines which require a predominant induction of a cellular response remains a challenge. Because CD8+ T cells, the main effector cells of the cellular immune response, recognise antigens that are synthesised in pathogen-infected cells, successful vaccination requires the synthesis of immunogenic antigens in cells of the vaccine. This can be achieved with live attenuated vaccines but this type of vaccine also has significant limitations. Firstly, there is a risk of infection, which may occur either when vaccinated patients are immunosuppressed or if the pathogen itself can induce immunosuppression, as is the case, for example, with the human immunodeficiency virus. Secondly, some pathogens, for example hepatitis C virus, are difficult or impossible to grow in cell culture. Other existing vaccines such as inactivated whole-cell vaccines or alum adjuvanted recombinant protein subunit vaccines are notable poor inducers of CD8 responses.

Alternative approaches have been described, for example, antigen delivery using non-live vectors such as bacterial toxins. The shiga B vectorisation system is based on the non toxic B subunit of the shiga toxin (StxB). The B subunit of shiga toxin has a number of characteristics that make it useful as a vector for antigen presentation and these include absence of toxicity, low immunogenicity, targeting through the CD77 (Gb3) receptor and the ability to introduce cargo antigen into the MHC class I restricted antigen presentation pathway (Haicheur et al, (2003) Int. Immunol., 15, 1 161-1 171 ). In particular, the physical linkage of antigens to the B subunit of the Shiga toxin has been shown to induce detectable CD8 responses in mouse models (Haicheur et al, (2000) Int. Immunology, 165, 3301-3308).

StxB binds to the cellular toxin receptor, the glycosphingolipid globotriaosyl ceramide known as Gb3 or CD77. The B fragment is not toxic but conserves the intracellular transport characteristics of the holotoxin which in many Gb3 expressing cells is transported in a retrograde fashion from the plasma membrane via endosomes into the biosynthetic/secretory VB62609 2

pathway. It has been shown that StxB is able to target both dendritic cells and B cells and to direct antigen into the exogenous class-l restricted pathway.

WO 02/060937 relates to a modified B subunit of Shiga toxin in which a cysteine residue is added at the C-terminus of the mature StxB to give a derivative designated StxB-Cys. The authors comment that this protein, when purified from bacteria, carries the same internal disulfide bond as wild type StxB but that the sulfhydryl group on the C-terminal Cys is free, thus providing a means of linking the StxB-Cys protein to a molecule of interest.

However, although in theory the free sulfhydryl group should provide an ideal linkage point, the present inventors found that in practice, this is not the case. This appears to be because the StxB-Cys protein is folded in such a way that the sulfhydryl group on the C-terminal cysteine residue is poorly accessible. In the hands of the inventors, the yield of StxB-Cys protein conjugates has been very low, usually less than 10%. Clearly, this is a problem if a StxB-Cys conjugate is to be prepared on an industrial scale.

The present inventors have overcome the problem of low yields by providing a method for preparing a protein conjugate in which the proteins are linked in an alternative manner.

In the present invention, there is provided a process for the preparation of a conjugate comprising a first protein selected from Shiga toxin (StxB), the B subunit of E. coli heat labile enterotoxin (LTB) and cholera toxin B (CTB); and a second protein, the process comprising: a. reacting free primary amino groups of the first protein with a functional group A1 of a bifunctional linker wherein the functional group A1 is adapted to react with a primary amino moiety on the first protein;

b. reacting a free sulfhydryl or primary amine group of the second protein with a functional group A2 of the bifunctional linker, wherein functional group A2 is adapted to react with a sulfhydryl or primary amino moiety on the second protein.

Brief description of the sequence listing

SEQ ID NO:1 : TCC ATG ACG TTC CTG ACG TT (CpG 1826)

SEQ ID NO:2: TCT CCC AGC GTG CGC CAT (CpG 1758)

SEQ ID NO:3: ACC GAT GAC GTC GCC GGT GAC GGC ACC ACG SEQ ID NO:4: TCG TCG TTT TGT CGT TTT GTC GTT (CpG 2006)

SEQ ID NO:5: TCC ATG ACG TTC CTG ATG CT (CpG 1668) VB62609 3

SEQ ID NO:6: TCG ACG TTT TCG GCG CGC GCC G (CpG 5456)

SEQ ID No: 7 Shiga toxin B subunit (StxB)

SEQ ID No: 8 StxB-Cys polypeptide (variant with C-terminal Cys)

SEQ ID No: 9 LTB polypeptide SEQ ID No: 10 CTB polypeptide

SEQ ID No: 11 TT polypeptide

SEQ ID No: 12 gp120 polypeptide (HIV gp120 Clade B)

SEQ ID No: 13 F4 polypeptide HIV ( = HIV p24-RT-Nef-p17)

SEQ ID No: 14 P24 polypeptide SEQ ID No: 15 ovalbumin polypeptide

SEQ ID No: 16 LTB-Cys polypeptide (variant with C-terminal Cys)

SEQ ID NO: 17 Oligonucleotide LTBF3 for start codon (ATG) following by LTB N-terminal amino acids.

SEQ ID NO: 18 Oligonucleotide LTBR1 coding for the C-terminal LTB amino acids fused to a TGC codon (coding for a cysteine) in frame with the C terminal of

LTB coding sequence

SEQ ID NO: 19 p27 polypeptide

The method is particularly suitable for forming protein conjugates from a StxB, LTB and CTB as these either have no free cysteine residues or free cysteine residues which are poorly accessible, for example because of the folding of the protein. Therefore, using this method, the inventors have successfully overcome the problems encountered with the method of preparing conjugates of StxB described in WO 02/060937.

In the present specification, the B subunit of Shiga toxin (StxB) is as shown in SEQ ID NO: 7, the B subunit of E. coli heat labile enterotoxin (LTB) is as shown in SEQ ID NO: 9, cholera toxin B (CTB) is as shown in SEQ ID NO: 10. However, references to these proteins also encompass functional equivalents of these sequences, which are preferably at least 60% identical, and in increasing order of preference at least 70%, at least 80% , at least 90% and at least 95% identical to the sequences of SEQ ID NOs 7, 9 and 10 or alternatively may have up to twenty, more preferably up to ten substitutions, additions or deletions in the sequences of SEQ ID NOs 7, 9 and 10, provided that the activity of the first protein is retained.

The terms "identical" or percent "identity" in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 70% VB62609 4

identity, optionally 75%, 80%, 85%, 90%, or 95% (e.g. 98%) identity over a specified region), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. Such sequences are then said to be "substantially identical." This definition also refers to the compliment of a test sequence. Optionally, the identity exists over a region that is at least about 25 to about 50 amino acids or nucleotides in length, or optionally over a region that is 75-100 amino acids or nucleotides in length. Suitably the identity exists over the entire length of the reference sequence. Variant polynucleotide and polypeptide sequences having at least 70% identity, optionally 75%, 80%, 85%, 90%, or 95% (e.g. 98%) identity over a specified region of a reference sequence (e.g. the whole length) are of particular interest.

For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.

A "comparison window", as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 25 to 500, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted by, for example, the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981 ), by the homology alignment algorithm of Needleman & Wunsch, J. MoI. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl Acad. ScL USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wl), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology (Ausubel et ai, eds. 1995 supplement)).

One example of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments to show relationship and percent sequence identity. It also plots a tree or dendogram showing the clustering VB62609 5

relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. MoI. Evol. 35:351-360 (1987). The method used is similar to the method described by Higgins & Sharp, CABIOS 5:151-153 (1989). The program can align up to 300 sequences, each of a maximum length of 5,000 nucleotides or amino acids. The multiple alignment procedure begins with the pairwise alignment of the two most similar sequences, producing a cluster of two aligned sequences. This cluster is then aligned to the next most related sequence or cluster of aligned sequences. Two clusters of sequences are aligned by a simple extension of the pairwise alignment of two individual sequences. The final alignment is achieved by a series of progressive, pairwise alignments. The program is run by designating specific sequences and their amino acid or nucleotide coordinates for regions of sequence comparison and by designating the program parameters. Using PILEUP, a reference sequence is compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps. PILEUP can be obtained from the GCG sequence analysis software package, e.g., version 7.0 (Devereaux et al., Nuc. Acids Res. 12:387-395 (1984).

Another example of algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J. MoI. Biol. 215:403-410 (1990), respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al., supra). These initial neighbourhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11 , an expectation (E) VB62609 6

or 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.

The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01 , and most preferably less than about 0.001.

In this specification, the terms "protein" also encompasses polypeptides and derivatives such as glycoproteins and glycosylated polypeptides or derivatives into which an additional functional group has been introduced to assist in reaction with a linker group.

The term "poorly accessible" when applied to cysteine residues or sulfhydryl groups means that fewer than 20% of the free cysteine residues or sulfhydryl groups in the protein are capable of reacting to form conjugates.

The terms "targeting protein" and "binding protein" both refer to proteins which bind selectively to a chosen protein or cell. Examples include antibodies specific to a targeted antigen, antigens to which a targeted antibody binds specifically and proteins which bind to a targeted receptor.

The term "carrier protein" refers to a protein to which one or preferably more than one other molecule is attached.

The term "functional equivalent" refers to a protein which is modified by substitution, deletion or addition of one or more residues but which retains the function of the original protein. For example, a functional equivalent of StxB is a modified protein which retains the ability of StxB to bind to the Gb3 receptor.

The steps of the process can be carried out in any order so that either the first protein is reacted with the bifunctional linker to form a protein-linker moiety, which is then reacted with the second VB62609 7

protein; or the second protein is reacted with the bifunctional linker to form a protein-linker moiety, which is then reacted with the first protein. Clearly, if functional group A2 is adapted to react with a primary amine group on the second protein, it will be necessary to protect one of functional groups A1 and A2 and to deprotect before the second reaction step.

When the functional group A2 is adapted to react with a free sulfhydryl group on the second protein, there is also the possibility that the two reaction steps (a) and (b) can be carried out simultaneously. However, this is less favourable as it is usually advantageous to purify the intermediate protein-linker moiety before proceeding with the second reaction step.

It is preferred that the first protein is the B subunit of Shiga toxin (StxB) or a functional equivalent thereof.

The second protein may have pharmacological activity, and examples of suitable second proteins include antigens or natural or synthetic hormones or other pharmaceutically active proteins.

In general, it is preferred that the second protein reacts via free cysteine residues or sulfhydryl groups, which may either be present in the native second protein or may have been introduced by modification of the second protein, for example by reaction of the carboxy terminus of the second protein with cysteamine or adipic acid dihydrazide in the presence of an activator such as 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDAC).

In some cases, however, the second protein, as well as the first protein may have no or very few free cysteine residues available for binding, either because the second protein is not a cysteine-rich protein or because most or all of the cysteine residues are cross linked or because the protein is folded in such a way that the cysteine residues are not available on the surface of the folded protein. When this is the case, the functional group A2 is chosen so that it is adapted to react with a primary amino moiety on the second protein.

The second protein may be an antigen, for example one which is required to be targeted to Gb3-expressing cells such that a CTL response is induced and conjugates including such antigens are particularly useful when the first protein is StxB or a functional equivalent thereof.

Antigens which are suitable for use as the second protein in the conjugates of the present invention include peptides or proteins encompassing one or more epitopes of interest. VB62609 8

Preferably, the second protein is selected such that the conjugate of the invention provides immunity against intracellular pathogens and/or other pathogens for which a CD8+ T cell response is desirable such as HIV, M. tuberculosis, Chlamydia spp., HBV, HCV, Plasmodium spp and Influenza. The present Invention also finds utility with antigens which can raise relevant immune responses against benign and proliferative disorders such as cancers.

The second protein may be an antigen which is capable of eliciting an immune response against a human pathogen. Examples include antigens derived from HIV-1 , (such as gag or fragments thereof, such as p24, tat, RT, nef, envelope such as gp120 or gp160, or fragments of any of these).

Antigens for HIV also include fusion proteins and variants thereof where at least two, preferably three polypeptides of HIV are fused into a larger protein. Preferred fusions include F4 polypeptide, which is a fusion of HIV p24-RT-Nef-p17 as discussed in WO2006/013106.

Further examples of suitable second proteins include antigens derived from human herpes viruses, such as gD or derivatives thereof or Immediate Early protein such as ICP27 from HSV1 or HSV2, cytomegalovirus ((esp Human)(such as gB or derivatives thereof), Rotaviral antigen, Epstein Barr virus (such as gp350 or derivatives thereof), Varicella Zoster Virus (such as gpl, Il and IE63), or from a hepatitis virus such as hepatitis B virus (for example Hepatitis B Surface antigen or a derivative thereof), or antigens from hepatitis A virus, hepatitis C virus and hepatitis E virus, or from other viral pathogens, such as paramyxoviruses: Respiratory Syncytial virus (such as F G and N proteins or derivatives thereof), parainfluenza virus, measles virus, mumps virus, human papilloma viruses (for example HPV 6, 11 , 16, 18, ) flaviviruses (e.g. Yellow Fever Virus, Dengue Virus, Tick-borne encephalitis virus, Japanese Encephalitis Virus) or Influenza virus purified or recombinant proteins thereof, such as HA, NP, NA, or M proteins, or combinations thereof), or derived from bacterial pathogens such as Neisseria spp, including N. gonorrhea and N. meningitidis (for example, transferrin-binding proteins, lactoferrin binding proteins, PiIC, adhesins); S. pyogenes (for example M proteins or fragments thereof, C5A protease,), S. agalactiae, S. mutans; H. ducreyi; Moraxella spp, including M catarrhalis, also known as Branhamella catarrhalis (for example high and low molecular weight adhesins and invasinsj; Bordetella spp, including B. pertussis (for example pertactin, pertussis toxin or derivatives thereof, filamenteous hemagglutinin, adenylate cyclase, fimbriae), B. parapertussis and B. bronchiseptica; Mycobacterium spp., including M. tuberculosis (for example ESAT6, Antigen 85A, -B or -C), M. bovis, M. leprae, M. avium, M. paratuberculosis, M. smegmatis; Legionella spp, including L. pneumophila; Escherichia spp, including enterotoxic E. coli (for VB62609 9

example colonization factors, heat-labile toxin or derivatives thereof, heat-stable toxin or derivatives thereof), enterohemorragic E. coli, enteropathogenic E. coli Vibrio spp, including V. cholera (for example cholera toxin or derivatives thereof; Shigella spp, including S. sonnei, S. dysenteriae, S. flexnerii; Yersinia spp, including Y. enterocolitica (for example a Yop protein) , Y. pestis, Y. pseudotuberculosis; Campylobacter spp, including C. jejuni (for example toxins, adhesins and invasins) and C. coli; Salmonella spp, including S. typhi, S. paratyphi, S. choleraesuis, S. enteritidis; Listeria spp., including L. monocytogenes; Helicobacter spp, including H. pylori (for example urease, catalase, vacuolating toxin); Pseudomonas spp, including P. aeruginosa; Staphylococcus spp., including S. aureus, S. epidermidis; Enterococcus spp., including E. faecalis, E. faecium; Clostridium spp., including C. tetani (for example tetanus toxin and derivative thereof), C. botulinum (for example botulinum toxin and derivative thereof,), C. difficile (for example Clostridium toxins A or B and derivatives thereof); Bacillus spp., including B. anthracis (for example botulinum toxin and derivatives thereof,); Corynebacterium spp., including C. diphtheriae (for example diphtheria toxin and derivatives thereof); Borrelia spp., including B. burgdorferi (for example OspA, OspC, DbpA, DbpB), B. garinii (for example OspA, OspC, DbpA, DbpB), B. afzelii (for example OspA, OspC, DbpA, DbpB,), B. andersonii (for example OspA, OspC, DbpA, DbpB), B. hermsii; Ehrlichia spp., including E. eqt// and the agent of the Human Granulocytic Ehrlichiosis; Rickettsia spp, including R. rickettsii; Chlamydia spp., including C. trachomatis (for example MOMP, heparin-binding proteins), C. pneumoniae (for example MOMP, heparin-binding proteins,), C. psittaci; Leptospira spp., including L. interrogans; Treponema spp., including T. pallidum (for example the rare outer membrane proteins,), T. denticola, T. hyodysenteriae; or derived from parasites such as Plasmodium spp., including P. falciparum and P. vivax; Toxoplasma spp., including T. gondii (for example SAG2, SAG3, Tg34); Entamoeba spp., including E. histolytica; Babesia spp., including B. microti; Trypanosoma spp., including T. cruzi; Giardia spp., including G. lamblia; Leshmania spp., including L. major; Pneumocystis spp., including P. carinii; Trichomonas spp., including T. vaginalis; Schisostoma spp., including S. mansoni, or derived from yeast such as Candida spp., including C. albicans; Cryptococcus spp., including C. neoformans.

Other specific antigens for M. tuberculosis are for example Tb Ra12, Tb H9, Tb Ra35, Tb38-1 , Erd 14, DPV, MTI, MSL, mTTC2 and hTCC1 (WO 99/51748).

Antigens for M. tuberculosis also include fusion proteins and variants thereof where at least two, preferably three polypeptides of M. tuberculosis are fused into a larger protein. Preferred fusions include Ra12-TbH9-Ra35 (as well as Ser to Ala mutants thereof which are described in WO 01/098460), Erd14-DPV-MTI, DPV-MTI-MSL, Erd14-DPV-MTI-MSL-mTCC2, Erd14-DPV- VB62609 10

MTI-MSL, DPV-MTI-MSL-mTCC2, TbH9-DPV-MTI (WO 99/51748).

Antigens for Chlamydia include for example the High Molecular Weight Protein (HMW) (WO 99/17741 ), ORF3 (EP 366 412), and putative membrane proteins (Pmps). Other Chlamydia antigens of the vaccine formulation can be selected from the group described in WO 99/28475. Other Chlamydia antigens include those known as CT089, CT858, CT875, MOMP, SWIB, CT622, PmpD (e.g PmpD passenger domain) and combinations thereof such as described in WO 2006/104890.

In other cases, the second protein may comprise an antigen derived from Streptococcus spp, including S. pneumoniae (for example, PsaA, PspA, streptolysin, choline-binding proteins) and the protein antigen Pneumolysin (Biochem Biophys Acta, 1989, 67, 1007; Rubins et al., Microbial Pathogenesis, 25, 337-342), and mutant detoxified derivatives thereof (WO 90/06951 ; WO 99/03884). Other preferred antigens are those derived from Haemophilus spp., including H. influenzae type B , non typeable H. influenzae, for example OMP26, high molecular weight adhesins, P5, P6, protein D and lipoprotein D, and fimbrin and fimbrin derived peptides (US 5,843,464) or multiple copy varients or fusion proteins thereof.

Derivatives of Hepatitis B Surface antigen are well known in the art and include, inter alia, those PreS1 , PreS2 S antigens set forth described in European Patent applications EP-A-414 374; EP-A-0304 578, and EP 198-474. In one preferred aspect, the conjugate of the invention comprises the HIV-1 antigen, gp120, especially when expressed in CHO cells. In a further embodiment, the conjugate of the invention comprises gD2t as hereinabove defined.

In a further embodiment of the present invention the conjugates may comprise as the second protein antigen derived from the Human Papilloma Virus (HPV) considered to be responsible for genital warts (ΗPV 6 or HPV 1 1 and others,), and the HPV viruses responsible for cervical cancer (HPV16, HPV18 and others;.

Particularly preferred forms of genital wart prophylactic, or therapeutic, conjugate comprise L1 protein, and fusion proteins comprising one or more antigens selected from the HPV proteins E1 , E2, E5, E6, E7, L1 , and L2.

Exemplary forms of fusion protein are: L2E7 as disclosed in WO 96/26277, and protein D(1/3)- E7 disclosed in WO99/10375. VB62609 11

A preferred HPV cervical infection or cancer, prophylaxis or therapeutic conjugate, composition may comprise HPV 16 or 18 antigens.

Particularly preferred HPV 16 antigens comprise the early proteins E6 or E7 in fusion with a protein D carrier to form Protein D - E6 or E7 fusions from HPV 16, or combinations thereof; or combinations of E6 or E7 with L2 (WO 96/26277).

Alternatively the HPV 16 or 18 early proteins E6 and E7, may be presented in a single molecule, preferably a Protein D- E6/E7 fusion. Such vaccine may optionally contain either or both E6 and E7 proteins from HPV 18, preferably in the form of a Protein D - E6 or Protein D - E7 fusion protein or Protein D E6/E7 fusion protein.

The conjugate of the present invention may additionally comprise antigens from other HPV strains, preferably from strains HPV 31 or 33.

Conjugates of the present invention may further comprise as the second protein antigens derived from parasites that cause Malaria, for example, antigens from Plasmodia falciparum including circumsporozoite protein (CS protein), RTS, S, MSP1 , MSP3, LSA1 , LSA3, AMA1 and TRAP. RTS is a hybrid protein comprising substantially all the C-terminal portion of the circumsporozoite (CS) protein of P.falciparum linked via four amino acids of the preS2 portion of Hepatitis B surface antigen to the surface (S) antigen of hepatitis B virus. Its full structure is disclosed in International Patent Application No. PCT/EP92/02591 , published under Number WO 93/10152 claiming priority from UK patent application No.9124390.7. When expressed in yeast RTS is produced as a lipoprotein particle, and when it is co-expressed with the S antigen from HBV it produces a mixed particle known as RTS₁S. TRAP antigens are described in International Patent Application No. PCT/GB89/00895, published under WO 90/01496. Plasmodia antigens that are likely candidates to be components of a multistage Malaria vaccine are P. falciparum MSP1 , AMA1 , MSP3, EBA, GLURP, RAP1 , RAP2, Sequestrin, PfEMPI , Pf332, LSA1 , LSA3, STARP, SALSA, PfEXPI , Pfs25, Pfs28, PFS27/25, Pfs16, Pfs48/45, Pfs230 and their analogues in Plasmodium spp eg P. vivax. One embodiment of the present invention is a conjugate wherein the antigen preparation comprises RTS₁S or CS protein or a fragment thereof such as the CS portion of RTS, S, in combination with one or more further malarial antigens. The one or more further malarial antigens may be selected for example from the group consisting of MPS1 , MSP3, AMA1 , LSA1 or LSA3.

In a further embodiment, the conjugate may also contain an anti-tumour antigen and be useful VB62609 12

for the immunotherapeutic treatment of cancers. For example, the adjuvant formulation finds utility with tumour rejection antigens such as those for prostrate, breast, colorectal, lung, pancreatic, renal or melanoma cancers. Exemplary antigens include MAGE 1 and MAGE 3 or other MAGE antigens (for the treatment of melanoma), PRAME, BAGE, or GAGE (Robbins and Kawakami, 1996, Current Opinions in Immunology 8, pps 628-636; Van den Eynde et al., International Journal of Clinical & Laboratory Research (submitted 1997); Correale et al. (1997), Journal of the National Cancer Institute 89, p293. Indeed these antigens are expressed in a wide range of tumour types such as melanoma, lung carcinoma, sarcoma and bladder carcinoma. Other tumour-specific antigens include, but are not restricted to tumour-specific gangliosides, Prostate specific antigen (PSA) or Her-2/neu, KSA (GA733), PAP, mammaglobin, MUC-1 , carcinoembryonic antigen (CEA), p501 S (prostein). The second protein may also comprise a tumour rejection antigen. In one aspect, the tumour antigen is Her-2/neu.

It is a particularly preferred aspect of the present invention that the conjugates comprise as the second protein a tumour antigen such as prostrate, breast, colorectal, lung, pancreatic, renal, ovarian or melanoma cancers. Accordingly, the conjugates may contain tumour-associated antigen, as well as antigens associated with tumour-support mechanisms (e.g. angiogenesis, tumour invasion). Additionally, antigens particularly relevant for vaccines in the therapy of cancer also comprise Prostate-specific membrane antigen (PSMA), Prostate Stem Cell Antigen (PSCA), tyrosinase, survivin, NY-ESO1 , prostase, PS108 (WO 98/50567), RAGE, LAGE, HAGE. Additionally said antigen may be a self peptide hormone such as whole length Gonadotrophin hormone releasing hormone (GnRH, WO 95/20600), a short 10 amino acid long peptide, useful in the treatment of many cancers, or in immunocastration.

The method of the invention overcomes the unexpected problems encountered by the inventors in their attempt to conjugate proteins with poorly accessible free cysteine residues, especially StxB, with other proteins and the yields obtained in the reaction have risen from less than 10% using the method described in WO 02/060937 to as much as 30%.

Examples of suitable functional groups A1 and A2 which react with primary amino groups include N-hydroxy succinimide (NHS) esters or sulfo NHS esters.

When the second protein has cysteine residues which are accessible for reaction, the functional group A2 may be a group which reacts with sulfhydryl groups, for example maleimide.

Therefore, when the second protein has available sulfhydryl groups, the bifunctional linker may VB62609 13

comprise a group A1 , which is a NHS ester or a sulfo NHS ester, and a group A2, which is a maleimide group.

Alternatively, when the second protein reacts via primary amine groups, the functional group A2 may also be an NHS ester or a sulfo NHS ester. In this case, it will be necessary to protect either the group A1 or the group A2 with a suitable protecting group.

The art of protein coupling is well developed and therefore there are many commercially available bifunctional linkers comprising suitable A1 and A2 functional groups.

Examples of suitable linker moieties comprising an NHS ester or a sulfo NHS ester and a maleimide group include N-(α-maleimidoacetoxy) succinimide ester (AMAS), m- maleimidobutyryloxy succinimide ester (GMBS), N-(ε-maleimidocaproyloxy) succinimide ester (EMCS), m-maleimidobenzoyl-N-hydroxysuccinimidyl ester (MBS), succinimidyl-4-(N- maleimidomethyl) cyclohexane-1-carboxylate (SMCC), succinimidyl-4-(p-maleimidophenyl)- butyrate (SMPB), succinimidyl-6-(β-maleimidopropionamido)hexanoate (SMPH), sulfo AMAS, sulfo GMBS, sulfo EMCS, sulfo MBS, sulfo SMCC, sulfo SMPB and sulfo SMPH, all of which are commercially available.

The conjugate may include one or more additional proteins, optionally attached by the same method.

In a second aspect of the invention, there is provided a protein conjugate obtainable by the method of the first aspect of the invention.

The conjugate comprises a first protein selected from StxB, LTB and CTB linked via amino groups to a linker and a second protein linked via amino or sulfhydryl groups to the linker.

Preferred features of this aspect of the invention are as specified above for the method of the first aspect.

It is particularly preferred that the first protein is the B subunit of Shiga toxin (StxB) or a functional equivalent thereof.

The second protein may be an antigen to be introduced into the MHC class 1 -restricted antigen presentation pathway. Any one of a number of antigens may be used as described above. VB62609 14

Preferred linkers are as listed above for the first aspect of the invention.

In a further aspect of the invention, there is provided an immunogenic composition comprising a protein conjugate of the second aspect of the invention in which the first protein is StxB, LTC or CTB, together with a pharmaceutically acceptable carrier.

Furthermore, there is also provided a vaccine composition comprising a protein conjugate of the second aspect of the invention in which the first protein is StxB, LTC or CTB, together with a pharmaceutically acceptable carrier.

It is greatly preferred that the immunogenic and vaccine compositions also comprise an adjuvant (immunostimulant) as this can have a beneficial effect on the immune response.

The adjuvant is suitably selected from the group: a saponin, lipid A or a derivative thereof, an immunostimulatory oligonucleotide, an alkyl glucosaminide phosphate, or combinations thereof. A further suitable adjuvant is a metal salt in combination with another adjuvant. The adjuvant is suitably a Toll like receptor ligand in particular a ligand of a Toll like receptor 2, 3, 4, 7, 8 or 9, or a saponin, in particular Qs21. The adjuvant system suitably comprises two or more adjuvants from the above list. In particular the combinations suitably contain a saponin (in particular Qs21 ) adjuvant and/or a Toll like receptor 9 ligand such as a immunostimulatory oligonucleotide containing CpG or other immunostimulatory motifs such as CpR where R is a non-natural guanosine nucleotide. Other suitable combinations comprise a saponin (in particular QS21 ) and a Toll like receptor 4 ligand such as monophosphoryl lipid A or its 3 deacylated derivative, 3 D - MPL, or a saponin (in particular QS21 ) and a Toll like receptor 4 ligand such as an alkyl glucosaminide phosphate. Other suitable combinations comprise a TLR 3 or 4 ligand in combination with a TLR 8 or 9 ligand. In one embodiment, the toll like receptor ligand is a receptor agonist. In another embodiment, the toll like receptor ligand is a receptor antagonist. The term "ligand" as used throughout the specification and the claims is intended to mean an entity that can bind to the receptor and have an effect, either to upregulate or downregulate the activity of the receptor.

Particularly suitable adjuvants are combinations of 3D-MPL and QS21 (EP 0 671 948 B1 ), oil in water emulsions comprising 3D-MPL and QS21 (WO 95/17210, WO 98/56414), or 3D-MPL formulated with other carriers (EP 0 689 454 B1 ). Other preferred adjuvant systems comprise a combination of 3 D MPL , QS21 and a CpG oligonucleotide as described in US6558670, US6544518. VB62609 15

In an embodiment the adjuvant is a Toll like receptor (TLR) 4 ligand, preferably an ligand such as a lipid A derivative particularly monophosphoryl lipid A or more particularly 3 Deacylated monophoshoryl lipid A (3 D - MPL).

3 D -MPL is sold under the trademark MPL® by GlaxoSmithKline and primarily promotes CD4+ T cell responses with an IFN-g (Th1 ) phenotype. It can be produced according to the methods disclosed in GB 2 220 211 A. Chemically it is a mixture of 3-deacylated monophosphoryl lipid A with 3, 4, 5 or 6 acylated chains. Preferably in the compositions of the present invention small particle 3 D- MPL is used. Small particle 3 D -MPL has a particle size such that it may be sterile-filtered through a 0.22μm filter. Such preparations are described in International Patent Application No. WO 94/21292. Synthetic derivatives of lipid A are known and thought to be TLR

4 ligands including, but not limited to:

OM174 (2-deoxy-6-o-[2-deoxy-2-[(R)-3-dodecanoyloxytetra-decanoylamino]-4-o-phosphono-β- D-glucopyranosyl]-2-[(R)-3-hydroxytetradecanoylamino]-α-D- glucopyranosyldihydrogenphosphate), (WO 95/14026)

OM 294 DP (3S, 9 R) -3-[(R)-dodecanoyloxytetradecanoylamino]-4-oxo-5-aza-9(R)-[(R)-3- hydroxytetradecanoylamino]decan-1 ,10-diol,1 ,10-bis(dihydrogenophosphate) (WO99 /64301 and WO 00/0462 )

OM 197 MP-Ac DP ( 3S-, 9R) -3-[(R) -dodecanoyloxytetradecanoylaminoH-oxo-S-aza-θ-KR)^- hydroxytetradecanoylamino]decan-1 ,10-diol,1 -dihydrogenophosphate 10-(6-aminohexanoate) (WO 01/46127)

Other TLR4 ligands which may be used are alkyl Glucosaminide phosphates (AGPs) such as those disclosed in WO9850399 or US6303347 (processes for preparation of AGPs are also disclosed), or pharmaceutically acceptable salts of AGPs as disclosed in US6764840. Some AGPs are TLR4 agonists, and some are TLR4 antagonists. Both are thought to be useful as adjuvants.

Another suitable immunostimulant for use in the present invention is Quil A and its derivatives. Quil A is a saponin preparation isolated from the South American tree Quilaja Saponaria Molina and was first described as having adjuvant activity by Dalsgaard et al. in 1974 ("Saponin VB62609 16

adjuvants", Archiv. fur die gesamte Virusforschung, Vol. 44, Springer Verlag, Berlin, p243-254). Purified fragments of Quil A have been isolated by HPLC which retain adjuvant activity without the toxicity associated with Quil A (EP 0 362 278), for example QS7 and QS21 (also known as QA7 and QA21 ). QS-21 is a natural saponin derived from the bark of Quillaja saponaria Molina which induces CD8+ cytotoxic T cells (CTLs), Th1 cells and a predominant lgG2a antibody response and is a preferred saponin in the context of the present invention.

Particular formulations of QS21 have been described which are particularly suitable, these formulations further comprise a sterol (WO96/33739). The saponins forming part of the present invention may be separate in the form of micelles, mixed micelles (preferentially, but not exclusively with bile salts) or may be in the form of ISCOM matrices (EP 0 109 942 B1 ) , liposomes or related colloidal structures such as worm-like or ring-like multimeric complexes or lipidic/layered structures and lamellae when formulated with cholesterol and lipid, or in the form of an oil in water emulsion (for example as in WO 95/17210). The saponins may suitably be associated with a metallic salt, such as aluminium hydroxide or aluminium phosphate (WO 98/15287).

Suitably, the saponin is presented in the form of a liposome, ISCOM or an oil in water emulsion.

lmmunostimulatory oligonucleotides or any other Toll-like receptor (TLR) 9 ligand may also be used. The preferred oligonucleotides for use in adjuvants or vaccines of the present invention are CpG containing oligonucleotides, preferably containing two or more dinucleotide CpG motifs separated by at least three, more preferably at least six or more nucleotides. A CpG motif is a Cytosine nucleotide followed by a Guanine nucleotide. The CpG oligonucleotides of the present invention are typically deoxynucleotides. In a suitable embodiment the internucleotide in the oligonucleotide is phosphorodithioate, or more preferably a phosphorothioate bond, although phosphodiester and other internucleotide bonds are within the scope of the invention. Also included within the scope of the invention are oligonucleotides with mixed internucleotide linkages. Methods for producing phosphorothioate oligonucleotides or phosphorodithioate are described in US5,666,153, US5,278,302 and WO95/26204.

Examples of suitable oligonucleotides have the following sequences. The sequences preferably contain phosphorothioate modified internucleotide linkages.

OLIGO 1 (SEQ I D NO: 1 ): TCC ATG ACG TTC CTG ACG TT (CpG 1826) OLIGO 2 (SEQ ID NO:2): TCT CCC AGC GTG CGC CAT (CpG 1758) VB62609 17

OLIGO 3(SEQ ID NO:3): ACC GAT GAC GTC GCC GGT GAC GGC ACC ACG OLIGO 4 (SEQ ID NO:4): TCG TCG TTT TGT CGT TTT GTC GTT (CpG 2006) OLIGO 5 (SEQ ID NO:5): TCC ATG ACG TTC CTG ATG CT (CpG 1668) OLIGO 6 (SEQ ID NO:6): TCG ACG TTT TCG GCG CGC GCC G (CpG 5456)

Alternative CpG oligonucleotides may comprise the sequences above or be functional variants in that they have inconsequential deletions or additions thereto.

Alternative immunostimulatory oligonucleotides may comprise modifications to the nucleotides. For example, WO0226757 and WO03507822 disclose modifications to the C and G portion of a CpG containing immunostimulatory oligonucleotides.

The immunostimulatory oligonucleotides utilised in the present invention may be synthesized by any method known in the art (for example see EP 468520). Conveniently, such oligonucleotides may be synthesized utilising an automated synthesizer.

Examples of a TLR 2 ligand include peptidoglycan or lipoprotein. Imidazoquinolines, such as Imiquimod and Resiquimod are known TLR7 ligands. Single stranded RNA is also a known TLR ligand (TLR8 in humans and TLR7 in mice), whereas double stranded RNA and poly IC (polyinosinic-polycytidylic acid - a commercial synthetic mimetic of viral RNA). are exemplary of TLR 3 ligands. 3D-MPL is an example of a TLR4 ligand whilst CPG is an example of a TLR9 ligand.

Further preferred features are described in the Examples and in FIGURE 1 which is an HPLC chromatograph showing the formation of the p27(sulfo-GBMS)-StxB conjugate.

In the Examples, the following abbreviations are used:

StxB - Shiga toxin B subunit (SEQ ID NO: 7)

StxB-Cys - Shiga toxin B subunit with C-terminal cysteine residue (SEQ ID NO: 8) LTB - E. coli heat labile enterotoxin B subunit (SEQ ID No: 9); gp120 - gp 120 polypeptide (HIV gp120 Clade B) (SEQ ID NO: 12);

F4 - F4 polypeptide HIV ( = HIV p24-RT-Nef-p17) (SEQ ID No: 13) p27 - p27 SIV mac 251 protein

OVA - ovalbumin polypeptide (SEQ ID No: 15). LTB-Cys - E. coli heat labile enterotoxin B subunit with C-terminal cysteine residue (SEQ ID No:

16); VB62609 18

DTT - dithiothreitol;

GMBS - m-maleimidobutyryloxy succinimide ester sulfo-GMBS - sulfo- m-maleimidobutyryloxy succinimide ester MBS - m-maleimidobenzoyl-N-hydroxysuccinimidyl ester IPTG - isopropyl-β-D-thiogalactopyranoside.

Comparative Examples - Conjugation Reactions according to the method described in WO 02/060937

Scheme 1 illustrates a method similar to that described in WO 02/060937 for conjugating the modified protein StxB-Cys to a second protein. In this method, amino groups of the second protein are reacted with the bifunctional linker LC-SPDP, the resultant product is reduced with DCC to leave a free SH group and this is reacted with the free SH group on the C-terminal cysteine residue to give a disulfide-linked conjugate.

Scheme 1

Protein

Comparative Example 1 - OVA (sulfo-GMBS)-StxB Conjugate

In this comparative example, ovalbumin was derivatised by reacting the bifunctional linker sulfo- VB62609 19

GMBS with free amino groups. The OVA-sulfo-GMBS derivative was then reacted with the free SH group of StxB-Cys. The method was very similar to that described in Example 5 of WO 02/060937, except that sulfo-GMBS, rather than MBS was used as the bifunctional linker.

OVA-sulfo-GMBS derivatization:

10 mg of OVA were diluted at 5 mg/ml with DPBS [Gibco] (w/o Ca++, Mg++). An 80 fold molar excess of sulfo-GMBS were added in solid form to the solution. The solution was then left, under stirring, during 1 hour at room temperature before the purification on a PD10 column (Amersham) to remove by-process products. Interesting fractions were pooled and maleimide functions were determined by the Ellman assay (4.5 functions/ mole of OVA).

O VA -Six B conjuga tion :

3.3 mg of OVA-sulfo-GMBS derivative were mixed with 0.56 mg of StxB-cys (5 mole OVA/ 1 mole StxB). The solution was stirred during 1 hour at room temperature. Then the conjugate was injected on a HW50F column (Tosohaas) at a flow-rate of 0.67 ml/min and fractions of 1 ml were collected. Interesting fractions were selected by SDS-PAGE analysis (coomassie blue staining and western blot using antibodies against OVA or against StxB).

The yield of the OVA-StxB conjugate was very low, and in repeated experiments it was not possible to obtain a yield of greater than about 10%

Comparative Example 2 - gp120 (sulfo-GMBS)-LTB-cys

The method was similar to Comparative Example 1 except that, in this case, LTB was derivatised at its carboxy terminus with an additional cysteine residue to give the variant LTB- Cys.

Preparation of LTB-cys

The starting material was a plasmid called pBD95, carrying coding sequence of mLT, which is the complete sequence of LT toxin (A and B subunits) where A subunit was mutated for 2 amino acids.

Oligonucleotides LTBF3 (5' caccatgaataaagtaaaatgttatgttttat 3', SEQ ID NO: 17) and LTBR1 (5' gcactagagcttagcagttttccatactgattgccgca 3'; SEQ ID NO: 18) were designed for LTB coding sequence amplification. Oligonucleotide LTBF3 codes for start codon (ATG) following by LTB N-terminal amino acids; and oligonucleotide LTBR1 codes for the C-terminal LTB amino acids VB62609 20

fused to a TGC codon (coding for a cysteine) in frame with the C terminal of LTB coding sequence.

Using the LTBF3 and LTBR1 oligonucleotides, the coding sequence of the B subunit fused to a cysteine was amplified by PCR using plasmid pBD95 as template. The amplified fragment was then cloned in plasmid pET101 D TOPO. In this plasmid, insertion of LTB-cys coding sequence under control of T7 lacO promoter leads to LTB-cys protein synthesis after addition of IPTG in E.coli strain carrying DE3 prophage. The strain BL21 (DE3) transformed by this plasmid was called B2031.

Expression of the recombinant protein:

Preculture was performed overnight in LBT medium supplemented with ampicillin and 0.5 % glucose. Culture was obtained by preculture dilution in fresh LBT medium supplemented with ampicillin. When OD reached 1.0, expression of recombinant protein is induced with IPTG 1 mM final, and bacterial cells were harvested after 4 hours induction for purification of LTB-cys.

Purification of LTB-cvs subunit from E CoIi Ivsate:

1 I bacterial pellet OD₍₆₂0) 50 in [Gibco] DPBS w/o CaMg buffer was extracted by French press;

After 30' centrifugation 500Og, supernatant was harvested and treated with 50000 u benzonase 1 h RT. Insoluble fraction was eliminated by centrifugation 30' 1500Og and 0.22 μm filtration. Clarified supernatant is loaded on XK16/20 column containing 20 ml DPBS w/o CaMg buffer pre-equilibrated immobilized galactose resin, and washed with same buffer until OD drops to basal level. LTB is eluted by 1 M galactose in DPBS w/o CaMg buffer. Finally, LTB cys was dialysed intensively against DPBS w/o CaMg buffer and endotoxins were removed by Acticlean resin incubation

QP 120-sulfo-GMBS derivatization gp120 protein was activated with a 25X fold excess of sulfo-GMBS. The solution was then left, under stirring, during 1 hour (room temperature) before the purification on a PD10 column to remove by-products. Interesting fractions are pooled and maleimide functions were determined by the Ellman assay (13 functions/ mole of gp120).

QP120-LTB-Cvs conjugation:

O.δmg of gp120-sulfo-GMBS derivative were mixed with 1.8 mg of LTB-Cys and stirred during 1 hour at room temperature. Residual maleimide functions were then quenched with an excess of VB62609 21

cysteine. The solution was stirred during 30 minutes.

Once again the yield of the conjugate was very low using this method, typically not greater than about 10%.

In contrast to the methods described in the Comparative Examples, the inventors have devised an alternative coupling method, which is described in the Examples below.

The Examples make use of a preferred group of linkers, GMBS and its derivatives, for example sulfo-GMBS. Sulfo-GMBS is water-soluble heterobifunctional cross-linker that contains N- hydoxysuccinimide (NHS) ester and maleimide groups that allow covalent conjugation of amine- and sulfhydryl-containing molecules. NHS esters react with primary amines contained on the protein to form amide bonds, while the maleimides react with sulfhydryl groups at pH 7.4 to form stable thioether bonds.

Example 1 - p27-StxB-cvs (sulfo-GMBS) conjugate

This conjugate was formed according to the method shown in Scheme 2. In this method, sulfo- GMBS is reacted with free amino groups on StxB to produce a protein-linker moiety, which is then reacted with the SIV protein p27 to give the required protein conjugate.

Scheme 2 - Conjugation of StxB via free amino residues

HS Protein

StxB-sulfo-GMBS derivatization:

6mg of StxB-cys (lot 18) were diluted at 2mg/ml with DPBS. A three fold molar excess of sulfo- GMBS were added in solid form to the solution. The solution was then left, under stirring, during VB62609 22

1 hour (room temperature) before the purification on two PD10 columns to remove by-products. Interesting fractions were pooled and maleimide functions were determined by the Ellman assay (3.6 functions/ mole of StxB).

p27-StxB conjugation:

4.3 mg of StxB-sulfo-GMBS derivative were mixed with 2.98mg of p27 (1 mole p27/ 1 mole StxB). The solution was stirred during 1 hour at room temperature. Residual sulfhydryl functions were quenched with an iodoacetamide excess (25X). The mixture was left 10 minutes under stirring. Maleimide functions were then quenched with an excess of cysteine. The solution was stirred during 30 minutes before the purification on a HW50F column (Tosohaas). An HPLC chromatograph of the conjugate before purification is shown in Figure 1.

A yield of 31.2% was obtained after purification for the best conjugate produced by this approach.

Example 2 - F4(sulfo-GMBS)-StxB conjugate

This example was similar to Example 1 except that F4 was used as the second protein in place of p27.

StxB-cvs-sulfo-GMBS derivatization:

8mg of StxB, at 3.3 mg/ml in a 5OmM/ pH7.2 phosphate buffer were added to a five fold molar excess of sulfo-GMBS (solid form). After dissolution, the solution was then left, under stirring, during 1 hour (room temperature) before the purification on a PD10 column to remove byproducts. Interesting fractions were pooled and maleimide functions were determined by the Ellman assay (6.9 functions/ mole of StxB-cys).

F4-StxB-cys conjugation:

F4 protein was eluted on PD10 columns to exchange the buffer (1OmM Tris-0.4M Arg-pH7.0) and concentrated on a 1OkDa membrane.

StxB-sulfo-GMBS derivative was mixed with the F4 protein. The solution was stirred during 15 minutes at room temperature. Residual sulfhydryl functions were quenched with an iodoacetamide excess. The mixture was left 10 minutes under stirring. Maleimide functions were then quenched with an excess of cysteine. The solution was stirred during 30 minutes before the purification on a Sephacryl S300HR column. VB62609 23

Purification of the conjugate:

The conjugate was injected on a S300HR column (Pharmacia XK16/40) at a flow-rate of 1 ml/min. It was eluted in a 1 OmM Tris- 0.4M Arg/ pH7.0 buffer. Fractions were taken each minute and injected on a TSK4000PWxl HPLC column and pooled as a function of the purity (removal of unbound STxB and p27 products: fractions 27-31 )

The yield obtained over a number of experiments was, on average, about 20%.

Example 3 - p27 (sulfo-GMBS)-LTB conjugate

L TB-sulfo-GMBS derivatization:

LTB protein was activated with a 17.5X fold molar excess of sulfo-GMBS. The solution was then left, under stirring, during 1 hour (room temperature) before the purification on a PD10 column (10OmM PO₄/ pH6.8) to remove by-products. Interesting fractions were pooled (6 maleimide functions/ mole of LTB).

LTB-p27 conjugation:

5.9 mole of concentrated p27 were mixed with 1 mole of LTB. The solution was stirred during 1 hour at room temperature and then quenched with a 25X molar excess of cysteine (30 minutes) followed by quenching sulphydryl groups of p27 by 25x fold excess of iodoacetamide for 30 minutes.

Formation of the conjugate was observed by HPLC, from which it appeared that the yield was comparable to that for Examples 1 and 2.

Example 4 - In vivo testing of conjugates formed using 2 linkers

Conjugates were tested in vivo in combination with an adjuvant to determine their immunogenicity after conjugation using the method of the present invention, lmmunogenicity was also determined in the absence of an adjuvant and compared to antigen in combination with an adjuvant.

Reagents and medium

Formulations summarized and described below were used to vaccinate 6 -8 week old C57BL/B6 (H2Kb), female mice (10/group). The mice received two injections spaced 14 days apart and were bled during weeks 1 , 3 and 4 (for actual bleed days see study design, due to technical VB62609 24

problem for one experiment, mice were also bled exceptionally week 5 (21 days after 2^nd injection)). The mice were vaccinated intramuscularly (injection into the left gastrocnemius muscle of a final volume of 50 μl) with ex-tempo formulation. A heterologous prime boost using recombinant adenovirus (coding for protein in use for conjugation) and adjuvanted protein was used as control group, the adenovirus was injected at a dose of 5 x 10^*8 VP.

FIGURE -> study design

1st i

DO D7 D14 D21 D28

Partial bleeding : PBLs/sera

• ag specific cytokine producing T cell frequency

• Ab titer

Preparation of formulation: ADJUVANT SYSTEM A (ASA) and ADJUVANT SYSTEM B (ASB):

A mixture of lipid (such as phosphatidylcholine either from egg-yolk or synthetic) and cholesterol and 3 D-MPL in organic solvent, was dried down under vacuum (or alternatively under a stream of inert gas). An aqueous solution (such as phosphate buffered saline) was then added, and the vessel agitated until all the lipid was in suspension. This suspension was then microfluidised until the liposome size was reduced to about 100 nm, and then sterile filtered through a 0.2 μm filter. Typically the cholesterohphosphatidylcholine ratio was 1 :4 (w/w), and the aqueous solution was added to give a final cholesterol concentration of 5 to 50 mg/ml. The liposomes have a defined size of 100 nm and are referred to as SUV (for small unilamelar vesicles). QS21 in aqueous solution was added to the SUV. PBS composition was Na2HPO4: 8.1 mM; KH2PO4: 1.47 mM; KCI: 2.7 mM; NaCI: NaCI: 137 mM pH 7.4. This mixture is referred as ASA. When TLR9-L (CpG 2006) is add-mix to AS1 , it was at a final concentration of 100 or 1000 μg/ml according to the antigen model and is referred to ASB. VB62609 25

The AS was diluted in the presence of the antigen. 3 D-MPL and QS21 were all at a final concentration of 10 or 100 μg/ml +/- CpG according to the antigen model. This formulation is denoted "antigen ASA or antigen ASB according to the absence or presence of CpG within the formulation".

Organ collection

PBLs Isolation

Blood was taken from retro-orbital vein (50 μl per mouse, 10 mice per group) and directly diluted in RPMI + heparin (LEO) medium. PBLs were isolated through a lymphoprep gradient

(CEDERLANE). Cells were then washed, counted and finally were re-suspended at ad hoc dilution in a ad hoc buffer (see below).

Immunological assays

Intracellular cytokine Staining (ICS).

ICS assay assessed the antigen-specific T-cell frequency that were cytokine producing T-cells either CD8 and CD4. ICS was performed on blood samples taken as described above. This assay includes two steps: ex vivo stimulation and staining. Ex vivo lymphocyte stimulation is performed in complete medium which is RPMI 1640 (Biowitaker) supplemented with 5% FCS (Harlan, Holland), 1 μg/ml of each anti-mouse antibodies CD49d and CD28 (BD, Biosciences), 2 mM L-glutamine, 1 mM sodium pyruvate, 10 μg/ml streptamycin sulfate, 10 units/ml penicillin G sodium (Gibco), 10 μg/ml streptamycin 50 μM B-ME mercaptoethanol and 100X diluted nonessential amino -acids , all these additives are from Gibco Life technologies. Peptide stimulations were always performed at 37°C, 5% CO2. STEP 1 : ex vivo stimulation

For ex vivo stimulation, 5 to 10 105 PBLs were re-suspended in complete medium supplemented with a pool of peptides (15-mers overlap by 1 1 encompassing the whole protein sequence) present at a concentration of 1 μg/ml for each.

Ova model: 5 to 10 10⁵ PBLs were re-suspended in complete medium supplemented a pool of 17 15-mer ova peptides (encompassing 11 different MHC classl-restricted peptides and 6 MHC classll-restricted peptides) present at a concentration of each 1 μg/ml. After 2 hours, 1 μg/ml Brefeldin-A (BD, Biosciences) was added for 16 hours and cells were collected after a total of 18 hours. VB62609 26

SIV-p27 model: 5 to 10 10⁵ PBLs were re-suspended in complete medium supplemented a pool of 59 15-mer SIV-p27 peptides (encompassing the whole protein sequence) present at a concentration of each 1 μg/ml. After 2 hours, 1 μg/ml Brefeldin-A (BD, Biosciences) was added for 16 hours and cells were collected after a total of 18 hours.

HIV-F4 model: 5 to 10 10⁵ PBLs were re-suspended in complete medium supplemented a pool of 15-mer peptides encompassing each of the F4 components, F4 is a fusion protein including 4 HIV-antigens: p24 protein, RT protein, p17 protein and nef protein). These 15-mers peptide were present at a concentration of each 1 μg/ml. After 2 hours, 1 μg/ml Brefeldin-A (BD, Biosciences) was added for 16 hours and cells were collected after a total of 18 hours.

After 2 hours, 1 μg/ml Brefeldin-A (BD, Biosciences) was added for 16 hours and cells were collected after a total of 18 hours.

STEP 2: staining

Directly after stimulation, PBLs are stained. Briefly cells were washed once and then stained with anti-mouse antibodies all purchased at BD, Biosciences; all further steps were performed on ice. The cells were first incubated for 10 min. in 50μl of CD16/32 solution (1/50 f.c, FACS buffer). 50μl of T cell surface marker mix was added (1/100 CD8a perCp, 1/100 CD4 APC Cy7) and the cells were incubated for 20 min. before being washed. Cells were fixed & permeabilised in 200μl of perm/fix solution (BD, Biosciences), washed once in perm/wash buffer (BD, Biosciences) before being stained at 4°C with anti IFNg-APC, anti-TNFa-PE and anti IL2-FITC either for 2 hours or overnight . Data were analysed using a FACS, 15000 events within the gate of living CD8 are acquired per test. Excel graphs are showing the frequency of antigen- specific cytokine producing T-cells (naϊve cytokine producing T-cells has been substracted). Frequencies are expressed in percentage of cytokine producers within each of the T-cell populations: CD8+ and CD4+ T-cells.

Antigen specific antibody titre: (pooled-sera) analysis of antigen-specific IgG (ELISA).

Serological analysis was assessed 15 days after second injection. Mice (10 per group) were bled by retro-orbital puncture.

A. Coating Step (different according to the antigen model): VB62609 27

Plate that are used are 96 well-plates (NUNC, lmmunosorbant plates), their coating is different according to the antigen model:

SIV-p27 model: Anti-SIV-p27 total IgG were measured by ELISA. 96 well-plates were coated with antigen overnight at 4°C (1 OOμl per well of SIV-p27 solution 5μg/ml in PBS).

STxBcys model: Anti-STxB-cys total IgG were measured by ELISA. 96 well-plates were coated with antigen overnight at 4°C (1 OOμl per well of STxB-cys solution 2μg/ml in PBS).

LTxBcys model: Anti-LTxB-cys total IgG were measured by ELISA. 96 well-plates were coated with antigen overnight at 4°C (1 OOμl per well of LTxB-cys solution 2μg/ml in PBS).

HIV-F4 model : Anti F4 (fusion protein: RT,Nef,P24,P17) total IgG were measured by Elisa. 96 well-plates were coated with antigen overnight at 4°C (100 μl per well of F4co solution 0.25μg/ml).

B. Saturation step

After overnight antigen-coating, the plates were washed in wash buffer (PBS / 0.1 % Tween 20 (Merck)) and saturated with 100-200μl of saturation buffer (PBS / 0.1% Tween 20 / 1% BSA) for 1 hour at 37°C.

C. Sera dilution

After saturation step, 50-100 μl of diluted mouse serum was added and incubated for 60-90 minutes at 37°C.

D. Revelation step (different according to the antigen model):

• SIV-p27, STxBcys and LTxBcys model.

After three washes, the plates were incubated for another hour at 37°C with 100 μl of biotinylated anti-mouse total IgG (Amersham) diluted 1000 times in saturation buffer. After incubation 96w plates were washed again as described above. A solution of streptavidin peroxydase (Amersham) diluted 1000 times in saturation buffer was added, 100 μl per well. The last wash was a 5 steps wash in wash buffer. VB62609 28

Finally, 100 μl OPDA (37.5 μl ml Citrate de Na - 0.05% tween - pH4.5 + 15 mg OPDA + 37.5 μl H2O2 added extempo) per well was added and the plate were kept in the dark at room temperature for 20 minutes.

To stop the reaction, 100 μl of H₂SO₄ 2N was added per well. The absorbance was read at a wavelength of 490/630 nm by an Elisa plate reader from BIORAD. Results were calculated using the softmax-pro software,

• HIV-F4, HIV-24 model.

After three washes, the plates were incubated for another hour at 37°C with 100 μl of biotinylated anti-mouse total IgG (Dako) diluted 4000 times in saturation buffer. After incubation

96w plates were washed again as described above. A solution of streptavidin peroxydase

(Dako) diluted 4000 times in saturation buffer was added, 100 μl per well. The last wash was a

5 steps wash in wash buffer.

Finally, 100 μl OPDA (37.5 μl ml Citrate de Na - 0.05% tween - pH4.5 + 15 mg OPDA + 37.5 μl H2O2 added extempo) per well was added and the plate were kept in the dark at room temperature for 20 minutes.

To stop the reaction, 100 μl of H₂SO₄ 2N was added per well. The absorbance was read at a wavelength of 490/630 nm by an Elisa plate reader from BIORAD. Results were calculated using the softmax-pro software,

Results

The results presented herein are those following the second immune response and thus demonstrate a clear advantage following the second immunisation of the conjugates in combination with an adjuvant when compared adjuvant or conjugate alone. 4.1 LTB-cys -GP120 (SGMBS)

For the particular case of LTcys-conjugate (produced by the method of the prior art) in the GP120 antigen model, Figures 2A and 2B shown that the conjugate did not induce detectable T-cell response in vivo. Anitbody studies were not performed.

4.2 STxB (S-GMBS) - p27

Figures 3A and 3B clearly show that the conjugate of the invention not only induced a CD8 response but also a CD4 response. The frequency of cytokine producing T-cells induce by the adjuvanted STxB-conjugate was shown to be much higher than the one induced by the VB62609 29

adjuvanted-protein. STxB-conjugate was also shown to be potent at inducing p27-specific antibody response. Both anti-p27 and anti-STxB antibodies were detectable (Figure 3C).

4.3 StxB (S-GMBS) - F4

Figures 4A and 4B show that the adjuvanted conjugate of the invention induced both CD8 and CD4 response. The frequency of cytokine producing T-cells induced by the adjuvanted STxB- conjugate was shown to be higher than the one induced by the adjuvanted-protein.

STxB-conjugate was also shown to be potent at inducing high antigen-specific antibody response (Figure 4C).

4.4 LTB (S-GMBS) - p27

Figures 5A and 5B show that the adjuvanted LTB-conjugate of the invention induced CD8 and CD4 T-cell responses. The frequency of cytokine producing T-cells induce by the adjuvanted LTB-conjugate was shown to be much higher than the one induced by the adjuvanted-protein.

LTB-conjugate was also shown to be potent at inducing high antigen-specific antibody response. Both anti-p27 and anti-LTB antibodies were detectable (Figure 5C).

Claims

VB62609 30CLAIMS

1. A process for the preparation of a conjugate comprising a first protein selected from Shiga toxin (StxB), the B subunit of E. coli heat labile enterotoxin (LTB) and cholera toxin B (CTB); and a second protein, the process comprising:

a. reacting free primary amino groups of the first protein with a functional group A1 of a bifunctional linker wherein the functional group A1 is adapted to react with a primary amino moiety on the first protein;

b. reacting free sulfhydryl or primary amino groups of the second protein with a functional group A2 of the bifunctional linker, wherein functional group A2 is adapted to react with a sulfhydryl or primary amino moiety on the second protein.

2. A process as claimed in claim 1 , wherein the first protein is reacted with the bifunctional linker to form a protein-linker moiety, which is then reacted with the second protein.

3. A process as claimed in claim 1 , wherein the second protein is reacted with the bifunctional linker to form a protein-linker moiety, which is then reacted with the first protein.

4. A process as claimed in any one of claims 1 to 3, wherein the functional group A2 is adapted to react with a primary amino group on the second protein; one of functional groups A1 and A2 is protected and the process further comprises the step of deprotecting the protected functional group before the second reaction step (b).

5. A process as claimed in any one of claims 1 to 3 wherein the functional group A2 is adapted to react with a free sulfhydryl group on the second protein.

6. A process as claimed in claim 5, wherein the second protein has been modified (prior to conjugation) to introduce one or more additional free sulfhydryl groups.

7. A process as claimed in claim 5 or claim 6, wherein the two reaction steps (a) and (b) is carried out simultaneously.

8. A process as claimed in any one of claims 1 to 7, wherein the first protein is the B subunit of Shiga toxin (StxB) or a functional equivalent thereof. VB62609 ³¹

9. A process as claimed in any one of claims 1 to 8, wherein the second protein is a pharmacologically active protein, peptide, glycoprotein or glycopeptide.

10. A process as claimed in claim 9, wherein the second protein is selected from antigens derived from HIV-1 , human herpes viruses, cytomegalovirus Rotaviral antigen, Epstein Barr virus, Varicella Zoster Virus, a hepatitis virus or from other viral pathogens, such as paramyxoviruses: Respiratory Syncytial virus, parainfluenza virus, measles virus, mumps virus, human papilloma viruses, flaviviruses or Influenza virus, purified or recombinant proteins thereof, such as HA, NP, NA, or M proteins, or combinations thereof; or derived from bacterial pathogens such as Neisseria spp, including N. gonorrhea and N. meningitides, S. pyogenes, S. agalactiae, S. mutans; H. ducreyi; Moraxella spp, including M catarrhalis, also known as Branhamella catarrhalis; Bordetella spp, including B. pertussis, B. parapertussis and B. bronchiseptica; Mycobacterium spp., including M. tuberculosis, M. bovis, M. leprae, M. avium, M. paratuberculosis, M. smegmatis; Legionella spp, including L. pneumophila; Escherichia spp, including enterotoxic E. coli, Shigella spp, including S. sonnei, S. dysenteriae, S. flexnerii; Yersinia spp, including Y. enterocolitica (for example a Yop protein) , Y. pestis, Y. pseudotuberculosis; Campylobacter spp, including C. jejuni and C. coli; Salmonella spp, including S. typhi, S. paratyphi, S. choleraesuis, S. enteritidis; Listeria spp., including L. monocytogenes; Helicobacter spp, including H. pylori, Pseudomonas spp, including P. aeruginosa; Staphylococcus spp., including S. aureus, S. epidermidis; Enterococcus spp., including E. faecalis, E. faecium; Clostridium spp., including C. tetani, C, C. difficile; Bacillus spp., including B. anthracis; Corynebacterium spp., including C. diphtheriae; Borrelia spp., including B. burgdorferi (for example OspA, OspC, DbpA, DbpB), B. garinii; B. afzelii; B. andersonii; B. hermsii; Ehrlichia spp., including E. equi and the agent of the Human Granulocytic Ehrlichiosis; Rickettsia spp, including R. rickettsii; Chlamydia spp., including C. trachomatis; C. pneumoniae; C. psittaci; Leptospira spp., including L. interrogans; Treponema spp., including T. pallidum; T. denticola, T. hyodysenteriae; or derived from parasites such as Plasmodium spp., including P. falciparum; Toxoplasma spp., including T. gondii (for example SAG2, SAG3, Tg34); Entamoeba spp., including E. histolytica; Babesia spp., including B. microti; Trypanosoma spp., including T. cruzi; Giardia spp., including G. lamblia; Leshmania spp., including L. major; Pneumocystis spp., including P. carinii; Trichomonas spp., including T. vaginalis; Schisostoma spp., including S. mansoni, or derived from yeast such as Candida spp., including C. albicans; Cryptococcus spp., including C. neoformans.

11. A process as claimed in any one of claims 1 to 10 wherein the group A1 is an N-hydroxy VB62609 ³²

succinimide (NHS) ester or a sulfo NHS ester.

12. A process as claimed in any one of claims 1 to 11 , wherein the group A2 is an N-hydroxy succinimide (NHS) ester or a sulfo NHS ester.

13. A process as claimed in any one of claims 1 to 11 , wherein the group A2 is maleimide.

14. A process as claimed in claim 13, wherein the bifunctional linker is N-(α- maleimidoacetoxy) succinimide ester (AMAS), m-maleimidobutyryloxy succinimide ester (GMBS), N-(ε-maleimidocaproyloxy) succinimide ester (EMCS), m-maleimidobenzoyl-N- hydroxysuccinimidyl ester (MBS), succinimidyl-4-(N-maleimidomethyl) cyclohexane-1- carboxylate (SMCC), succinimidyl-4-(p-maleimidophenyl)-butyrate (SMPB), succinimidyl-6-(β- maleimidopropionamido) hexanoate (SMPH), sulfo AMAS, sulfo GMBS, sulfo EMCS, sulfo MBS, sulfo SMCC, sulfo SMPB or sulfo SMPH.

15. A process as claimed in any one of claims 1 to 14, further including attaching one or more additional proteins.

16. A protein conjugate obtainable by a process as claimed in any one of claims 1 to 15.

17. A protein conjugate comprising a first protein selected from StxB, LTB and CTB linked via amino groups to a linker and a second protein linked via amino or sulfhydryl groups to the linker.

18. A protein conjugate as claimed in claim 17, wherein the second protein is an antigen selected from those listed in claim 10.

19. An immunogenic composition comprising a protein conjugate as claimed in any one of claims 16 to 18 together with a pharmaceutically acceptable carrier.

20. A vaccine composition comprising a protein conjugate as claimed in any one of claims 16 to 18 together with a pharmaceutically acceptable carrier.

21. An immunogenic composition as claimed in claim 19 or a vaccine composition as claimed in claim 20, further comprising an adjuvant. VB62609 ³³

22. An immunogenic or vaccine composition according to claim 21 wherein the adjuvant is selected from saponin, lipid A or a derivative thereof, an immunostimulatory oligonucleotide, an alkyl glucosaminide phosphate, and combinations thereof.