WO2009077438A1

WO2009077438A1 - Method for preparing protein conjugates

Info

Publication number: WO2009077438A1
Application number: PCT/EP2008/067378
Authority: WO
Inventors: Ralph Leon Biemans; Pierre Duvivier
Original assignee: Glaxosmithkline Biologicals S.A.
Priority date: 2007-12-14
Filing date: 2008-12-12
Publication date: 2009-06-25
Also published as: GB0724360D0

Abstract

An improved method for preparing protein conjugates comprising reacting primary amino groups of a first protein with a first bifunctional linker to form a first protein-linker moiety; reacting a second protein with a second bifunctional linker to form a second protein-linker moiety and then reacting the first and second protein-linker moieties to form a protein conjugate.

Description

METHOD FOR PREPARING PROTEIN CONJUGATES

The present invention relates to a method for the preparation of protein conjugates and to the conjugates prepared by the method. In particular, the invention relates to a method for preparing conjugates of a first protein and a second protein, in which the first protein may be, for example a targeting or binding protein such as a toxin, particularly a bacterial toxin. The second protein may be an antigen which is required to be delivered to a cell to which the first protein can bind. The method of the invention is particularly useful when either or both of the proteins have a limited number of free cysteine residues available for conjugation.

The development of vaccines which require a predominant induction of a cellular response remains a challenge. Because CD8+ T cells, the main effector cells of the cellular immune response, recognise antigens that are synthesised in pathogen-infected cells, successful vaccination requires the presence of immunogenic antigens in cells of the vaccine. This can be achieved with live attenuated vaccines but this type of vaccine also has significant limitations. Firstly, there is a risk of infection, which may occur either when vaccinated patients are immunosuppressed or if the pathogen itself can induce immunosuppression, as is the case, for example, with the human immunodeficiency virus. Secondly, some pathogens, for example hepatitis C virus, are difficult or impossible to grow in cell culture. Other existing vaccines such as inactivated whole-cell vaccines or alum adjuvanted recombinant protein subunit vaccines are notable poor inducers of CD8 responses.

Alternative approaches have been described, for example, antigen delivery using non-live vectors such as bacterial toxins. The shiga B vectorisation system is based on the non toxic B subunit of the shiga toxin (StxB). The B subunit of shiga toxin has a number of characteristics that make it useful as a vector for antigen presentation and these include absence of toxicity, low immunogenicity, targeting through the CD77 (Gb3) receptor and the ability to introduce cargo antigen into the MHC class I restricted antigen presentation pathway (Haicheur et al, (2003) Int. Immunol., 15, 1 161-1 171 ). In particular, the physical linkage of antigens to the B subunit of the Shiga toxin has been shown to induce detectable CD8 responses in mouse models (Haicheur et al, (2000) Int. Immunology, 165, 3301-3308).

StxB binds to the cellular toxin receptor, the glycosphingolipid globotriaosyl ceramide known as Gb3 or CD77. The B fragment is not toxic but conserves the intracellular transport VB62590

characteristics of the holotoxin which in many Gb3 expressing cells is transported in a retrograde fashion from the plasma membrane via endosomes into the biosynthetic/secretory pathway. It has been shown that StxB is able to target both dendritic cells and B cells and to direct antigen into the exogenous class-l restricted pathway.

WO 02/060937 relates to a modified B subunit of Shiga toxin in which a cysteine residue is added at the C-terminus of the mature StxB to give a derivative designated StxB-Cys. The authors comment that this protein, when purified from bacteria, carries the same internal disulfide bond as wild type StxB but that the sulfhydryl group on the C-terminal Cys is free, thus providing a means of linking the StxB-Cys protein to a molecule of interest.

However, although in theory the free sulfhydryl group should provide an ideal linkage point, the present inventors found that in practice, this is not the case. This appears to be because the StxB-Cys protein is folded in such a way that the sulfhydryl group on the C-terminal cysteine residue is poorly accessible. In the hands of the inventors, the yield of StxB-Cys protein conjugates has been very low, usually less than 10%. Clearly, this is a problem if an StxB-Cys conjugate is to be prepared on an industrial scale.

The present inventors have overcome the problem of low yields by providing a method for preparing a protein conjugate in which the proteins are linked in an alternative manner.

In the present invention, there is provided a process for the preparation of a conjugate comprising a first protein and a second protein, the process comprising: a. reacting free primary amino groups of the first protein with a first bifunctional linker comprising functional groups A1 and A2 to form a first protein-linker moiety, wherein: the functional group A1 is adapted to react with a primary amino moiety on the first protein; and functional group A2 is either chosen such that it does not react with a primary amino moiety or is protected to prevent reaction with a primary amino moiety;

b. reacting free primary amino or sulfhydryl groups of the second protein with a second bifunctional linker comprising functional groups B1 and B2 to form a second protein-linker moiety, wherein: the functional group B1 is adapted to react with a primary amino or a sulfhydryl moiety VB62590

on the second protein; the functional group B2 is either chosen such that it does not react with a primary amino or sulfhydryl moiety or is protected to prevent reaction with a primary amino or sulfhydryl moiety;

c. optionally deprotecting either or both of functional groups A2 and B2;

d. reacting the first and the second protein-linker moieties to form a conjugate; wherein the reaction may comprise either reacting the first protein-linker moiety directly with the second protein-linker moiety or reacting both the first protein-linker moiety and the second moiety with an additional linker group.

Brief description of the sequence listing

SEQ ID NO:1 : TCC ATG ACG TTC CTG ACG TT (CpG 1826) SEQ ID NO:2: TCT CCC AGC GTG CGC CAT (CpG 1758)

SEQ ID NO:3: ACC GAT GAC GTC GCC GGT GAC GGC ACC ACG

SEQ ID NO:4: TCG TCG TTT TGT CGT TTT GTC GTT (CpG 2006)

SEQ ID NO:5: TCC ATG ACG TTC CTG ATG CT (CpG 1668)

SEQ ID NO:6: TCG ACG TTT TCG GCG CGC GCC G (CpG 5456) SEQ ID No: 7 Shiga Toxin B subunit (StxB)

SEQ ID No: 8 StxB-Cys polypeptide (variant with C-terminal Cys)

SEQ ID No: 9 LTB polypeptide

SEQ ID No: 10 CTB polypeptide

SEQ ID No: 11 TT polypeptide SEQ ID No: 12 gp120 polypeptide (HIV gp120 Clade B)

SEQ ID No: 13 F4 polypeptide ( = HIV p24-RT-Nef-p17)

SEQ ID No: 14 p24 polypeptide

SEQ ID No: 15 ovalbumin polypeptide

SEQ ID No: 16 LTB-Cys polypeptide (variant with C-terminal Cys) SEQ ID NO: 17 Oligonucleotide LTBF3 for start codon (ATG) following by LTB N-terminal amino acids.

SEQ ID NO: 18 Oligonucleotide LTBR1 coding for the C-terminal LTB amino acids fused to a TGC codon (coding for a cysteine) in frame with the C terminal of LTB coding sequence VB62590

The method is particularly suitable for forming protein conjugates from a first protein which either has no free cysteine residues or free cysteine residues which are poorly accessible, for example because of the folding of the protein. Therefore, using this method, the inventors have successfully overcome the problems encountered with the method of preparing conjugates of StxB described in WO 02/060937.

In this specification, the terms "protein" also encompasses polypeptides and derivatives such as glycoproteins and glycosylated polypeptides or derivatives into which an additional functional group has been introduced to assist in reaction with a linker group.

The term "poorly accessible" when applied to cysteine residues or sulfhydryl groups means that fewer than 20% of the free cysteine residues or sulfhydryl groups in the protein are capable of reacting to form conjugates.

The terms "targeting protein" and "binding protein" both refer to proteins which bind selectively to a chosen protein or cell. Examples include antibodies specific to a targeted antigen, antigens to which a targeted antibody binds specifically and proteins which bind to a targeted receptor.

The term "carrier protein" refers to a protein to which one or preferably more than one other molecule is attached.

The term "functional equivalent" refers to a protein which is modified by substitution, deletion or addition of one or more residues but which retains the function of the original protein. For example, a functional equivalent of StxB is a modified protein which retains the ability of StxB to bind to the Gb3 receptor.

In a preferred embodiment of the invention, the first and second protein-linker moieties react directly together to form a conjugate of the form:

Protein 1-linker-linker-Protein 2

In this embodiment, the functional group B2 is chosen such that it can be reacted with functional group A2 to form a conjugate of the first and second protein-linker moieties. VB62590

In an alternative embodiment, the first and second protein-linker moieties are reacted with a third linker moiety to form a conjugate of the form:

Protein 1-linker-linker-linker-Protein 2

In this embodiment, the third linker group has functional groups C1 and C2, wherein the functional group C1 is adapted to react with the functional group A2 of the first protein-linker moiety and the functional group C2 is adapted to react with the functional group B2 of the second protein-linker moiety.

The first and second proteins may be carrier proteins, targeting proteins or proteins having pharmacological activity, for example antigens or natural or synthetic hormones or other pharmaceutically active proteins.

In particular, the method is suitable for forming conjugates in which the first protein is a carrier, targeting or receptor binding protein in which free cysteine residues either do not exist or else are poorly accessible. This may be either because the protein is not a cysteine-rich protein or because most or all of the cysteine residues are cross linked or because the protein is folded in such a way that the cysteine residues are not available on the surface of the folded protein. Examples of suitable proteins include antibodies or non-live vaccine vectors such as bacterial toxin subunits. Particularly suitable bacterial toxin subunits which can be used as non-live vaccine vectors include the B subunit of Shiga toxin (StxB) as shown in SEQ ID NO: 7, the B subunit of E. coli heat labile enterotoxin (LTB) as shown in SEQ ID NO: 9, cholera toxin B (CTB) as shown in SEQ ID NO: 10, or functional equivalents of these, which are preferably at least 60% identical, and in increasing order of preference at least 70%, at least 80% , at least 90% and at least 95% identical to the sequences of SEQ ID NOs 7, 9 and 10. or alternatively, functional equivalents may have up to twenty, more preferably up to ten substitutions, additions or deletions in the sequences of SEQ ID NOs 7, 9 and 10, provided that the activity of the first protein is retained.

The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 70% identity, optionally 75%, 80%, 85%, 90%, or 95% (e.g. 98%) identity over a specified region), VB62590

when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. Such sequences are then said to be "substantially identical." This definition also refers to the compliment of a test sequence. Optionally, the identity exists over a region that is at least about 25 to about 50 amino acids or nucleotides in length, or optionally over a region that is 75-100 amino acids or nucleotides in length. Suitably the identity exists over the entire length of the reference sequence. Variant polynucleotide and polypeptide sequences having at least 70% identity, optionally 75%, 80%, 85%, 90%, or 95% (e.g. 98%) identity over a specified region of a reference sequence (e.g. the whole length) are of particular interest.

For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.

A "comparison window", as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 25 to 500, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted by, for example, the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981 ), by the homology alignment algorithm of Needleman & Wunsch, J. MoI. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl Acad. ScL USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wl), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds. 1995 supplement)).

One example of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments to show relationship VB62590

and percent sequence identity. It also plots a tree or dendogram showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. MoI. Evol. 35:351-360 (1987). The method used is similar to the method described by Higgins & Sharp, CABIOS 5:151-153 (1989). The program can align up to 300 sequences, each of a maximum length of 5,000 nucleotides or amino acids. The multiple alignment procedure begins with the pairwise alignment of the two most similar sequences, producing a cluster of two aligned sequences. This cluster is then aligned to the next most related sequence or cluster of aligned sequences. Two clusters of sequences are aligned by a simple extension of the pairwise alignment of two individual sequences. The final alignment is achieved by a series of progressive, pairwise alignments. The program is run by designating specific sequences and their amino acid or nucleotide coordinates for regions of sequence comparison and by designating the program parameters. Using PILEUP, a reference sequence is compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps. PILEUP can be obtained from the GCG sequence analysis software package, e.g., version 7.0 (Devereaux et al., Nuc. Acids Res. 12:387-395 (1984).

Another example of algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J. MoI. Biol. 215:403-410 (1990), respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al., supra). These initial neighbourhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- VB62590

8 scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11 , an expectation (E) or 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.

The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability

(P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01 , and most preferably less than about 0.001.

When the first protein is a carrier, targeting or binding protein, the second protein may be a pharmacologically active protein, peptide, glycoprotein or glycopeptide. In some cases, the second protein may react via free cysteine residues or sulfhydryl groups, which may either be present in the native second protein or may have been introduced by modification of the second protein, for example by reaction of the carboxy terminus of the second protein with cysteamine or adipic acid dihydrazide in the presence of an activator such as 1-ethyl-3-(3- dimethylaminopropyl) carbodiimide hydrochloride (EDAC).

In other cases, the second protein, as well as the first protein may have no or very few free cysteine residues available for binding, either because the second protein is not a cysteine-rich protein or because most or all of the cysteine residues are cross linked or because the protein is folded in such a way that the cysteine residues are not available on the surface of the folded protein. When this is the case, the functional group B1 is chosen so that it is adapted to react with a primary amino moiety on the second protein.

The method of the invention is particularly suitable for use with lysine rich proteins as these have a large number of free primary amino groups. Of course the linker may be reacted with the N-terminus of the protein if this is available. VB62590

The second protein may be an antigen, for example one which is required to be targeted to Gb3-expressing cells such that a CTL response is induced and conjugates including such antigens are particularly useful when the first protein is StxB or a functional equivalent thereof.

Antigens which are suitable for use as the second protein in the conjugates of the present invention include peptides or proteins encompassing one or more epitopes of interest. Preferably, the second protein is selected such that the conjugate of the invention provides immunity against intracellular pathogens and/or other pathogens for which a CD8+ T cell response is desirable such as HIV, M. tuberculosis, Chlamydia spp., HBV, HCV, Plasmodium spp and Influenza. The present Invention also finds utility with antigens which can raise relevant immune responses against benign and proliferative disorders such as cancers.

The second protein may be an antigen which is capable of eliciting an immune response against a human pathogen. Examples include antigens derived from HIV-1 , (such as gag or fragments thereof, such as p24, p17, tat, RT, nef, envelope such as gp120 or gp160, or fragments of any of these).

Antigens for HIV also include fusion proteins and variants thereof where at least two, preferably three polypeptides of HIV are fused into a larger protein. Preferred fusions include F4 polypeptide, which is a fusion of HIV p24-RT-Nef-p17 as discussed in WO2006/013106.

Further examples of suitable second proteins include antigens derived from human herpes viruses, such as gD or derivatives thereof or Immediate Early protein such as ICP27 from HSV1 or HSV2, cytomegalovirus ((esp Human)(such as gB or derivatives thereof), Rotaviral antigen, Epstein Barr virus (such as gp350 or derivatives thereof), Varicella Zoster Virus (such as gpl, Il and IE63), or from a hepatitis virus such as hepatitis B virus (for example Hepatitis B Surface antigen or a derivative thereof), or antigens from hepatitis A virus, hepatitis C virus and hepatitis E virus, or from other viral pathogens, such as paramyxoviruses: Respiratory Syncytial virus (such as F G and N proteins or derivatives thereof), parainfluenza virus, measles virus, mumps virus, human papilloma viruses (for example HPV 6, 11 , 16, 18, ) flaviviruses (e.g. Yellow Fever Virus, Dengue Virus, Tick-borne encephalitis virus, Japanese Encephalitis Virus) or Influenza virus purified or recombinant proteins thereof, such as HA, NP, NA, or M proteins, or combinations thereof), or derived from bacterial pathogens such as Neisseria spp, including N. VB62590

10 gonorrhea and N. meningitidis (for example, transferrin-binding proteins, lactoferrin binding proteins, PiIC, adhesins); S. pyogenes (for example M proteins or fragments thereof, C5A protease,), S. agalactiae, S. mutans; H. ducreyi; Moraxella spp, including M catarrhalis, also known as Branhamella catarrhalis (for example high and low molecular weight adhesins and invasinsj; Bordetella spp, including B. pertussis (for example pertactin, pertussis toxin or derivatives thereof, filamenteous hemagglutinin, adenylate cyclase, fimbriae), B. parapertussis and B. bronchiseptica; Mycobacterium spp., including M. tuberculosis (for example ESAT6, Antigen 85A, -B or -C), M. bovis, M. leprae, M. avium, M. paratuberculosis, M. smegmatis; Legionella spp, including L. pneumophila; Escherichia spp, including enterotoxic E. coli (for example colonization factors, heat-labile toxin or derivatives thereof, heat-stable toxin or derivatives thereof), enterohemorragic E. coli, enteropathogenic E. coli Vibrio spp, including V. cholera (for example cholera toxin or derivatives thereof; Shigella spp, including S. sonnei, S. dysenteriae, S. flexnerii; Yersinia spp, including Y. enterocolitica (for example a Yop protein) , Y. pestis, Y. pseudotuberculosis; Campylobacter spp, including C. jejuni (for example toxins, adhesins and invasins) and C. coli; Salmonella spp, including S. typhi, S. paratyphi, S. choleraesuis, S. enteritidis; Listeria spp., including L. monocytogenes; Helicobacter spp, including H. pylori (for example urease, catalase, vacuolating toxin); Pseudomonas spp, including P. aeruginosa; Staphylococcus spp., including S. aureus, S. epidermidis; Enterococcus spp., including E. faecalis, E. faecium; Clostridium spp., including C. tetani (for example tetanus toxin and derivative thereof), C. botulinum (for example botulinum toxin and derivative thereof,), C. difficile (for example Clostridium toxins A or B and derivatives thereof); Bacillus spp., including B. anthracis (for example botulinum toxin and derivatives thereof,); Corynebacterium spp., including C. diphtheriae (for example diphtheria toxin and derivatives thereof); Borrelia spp., including B. burgdorferi (for example OspA, OspC, DbpA, DbpB), B. garinii (for example OspA, OspC, DbpA, DbpB), B. afzelii (for example OspA, OspC, DbpA, DbpB,), B. andersonii (for example OspA, OspC, DbpA, DbpB), B. hermsii; Ehrlichia spp., including £. eqt// and the agent of the Human Granulocytic Ehrlichiosis; Rickettsia spp, including R. rickettsii; Chlamydia spp., including C. trachomatis (for example MOMP, heparin-binding proteins), C. pneumoniae (for example MOMP, heparin-binding proteins,), C. psittaci; Leptospira spp., including L. interrogans; Treponema spp., including T. pallidum (for example the rare outer membrane proteins,), T. denticola, T. hyodysenteriae; or derived from parasites such as Plasmodium spp., including P. falciparum and P. vivax; Toxoplasma spp., including T. gondii (for example SAG2, SAG3, Tg34); Entamoeba spp., including E. histolytica; Babesia spp., including B. microti; Trypanosoma spp., including T. cruzi; Giardia spp., including G. lamblia; VB62590

11

Leshmania spp., including L. major; Pneumocystis spp., including P. carinii; Trichomonas spp., including T. vaginalis; Schisostoma spp., including S. mansoni, or derived from yeast such as Candida spp., including C. albicans; Cryptococcus spp., including C. neoformans.

Other specific antigens for M. tuberculosis are for example Tb Ra12, Tb H9, Tb Ra35, Tb38-1 , Erd 14, DPV, MTI, MSL, mTTC2 and hTCC1 (WO 99/51748).

Antigens for M. tuberculosis also include fusion proteins and variants thereof where at least two, preferably three polypeptides of M. tuberculosis are fused into a larger protein. Preferred fusions include Ra12-TbH9-Ra35 (as well as Ser to Ala mutants thereof which are described in WO 01/098460), Erd14-DPV-MTI, DPV-MTI-MSL, Erd14-DPV-MTI-MSL-mTCC2, Erd14-DPV- MTI-MSL, DPV-MTI-MSL-mTCC2, TbH9-DPV-MTI (WO 99/51748).

Antigens for Chlamydia include for example the High Molecular Weight Protein (HMW) (WO 99/17741 ), ORF3 (EP 366 412), and putative membrane proteins (Pmps). Other Chlamydia antigens of the vaccine formulation can be selected from the group described in WO 99/28475. Other Chlamydia antigens include those known as CT089, CT858, CT875, MOMP, SWIB, CT622, PmpD (e.g PmpD passenger domain) and combinations thereof such as described in WO 2006/104890.

In other cases, the second protein may comprise an antigen derived from Streptococcus spp, including S. pneumoniae (for example, PsaA, PspA, streptolysin, choline-binding proteins) and the protein antigen Pneumolysin (Biochem Biophys Acta, 1989, 67, 1007; Rubins et al., Microbial Pathogenesis, 25, 337-342), and mutant detoxified derivatives thereof (WO 90/06951 ; WO 99/03884). Other preferred antigens are those derived from Haemophilus spp., including H. influenzae type B , non typeable H. influenzae, for example OMP26, high molecular weight adhesins, P5, P6, protein D and lipoprotein D, and fimbrin and fimbrin derived peptides (US 5,843,464) or multiple copy varients or fusion proteins thereof.

Derivatives of Hepatitis B Surface antigen are well known in the art and include, inter alia, those PreS1 , PreS2 S antigens set forth described in European Patent applications EP-A-414 374; EP-A-0304 578, and EP 198-474. In one preferred aspect, the conjugate of the invention comprises the HIV-1 antigen, gp120, especially when expressed in CHO cells. In a further embodiment, the conjugate of the invention comprises gD2t as hereinabove defined. VB62590

12

In a further embodiment of the present invention the conjugates may comprise as the second protein antigen derived from the Human Papilloma Virus (HPV) considered to be responsible for genital warts (ΗPV 6 or HPV 1 1 and others/ and the HPV viruses responsible for cervical cancer (HPV16, HPV18 and others/

Particularly preferred forms of genital wart prophylactic, or therapeutic, conjugate comprise L1 protein, and fusion proteins comprising one or more antigens selected from the HPV proteins E1 , E2, E5, E6, E7, L1 , and L2.

Exemplary forms of fusion protein are: L2E7 as disclosed in WO 96/26277, and protein D (1/3)- E7 disclosed in WO99/10375.

A preferred HPV cervical infection or cancer, prophylaxis or therapeutic conjugate, composition may comprise HPV 16 or 18 antigens.

Particularly preferred HPV 16 antigens comprise the early proteins E6 or E7 in fusion with a protein D carrier to form Protein D - E6 or E7 fusions from HPV 16, or combinations thereof; or combinations of E6 or E7 with L2 (WO 96/26277).

Alternatively the HPV 16 or 18 early proteins E6 and E7, may be presented in a single molecule, preferably a Protein D- E6/E7 fusion. Such vaccine may optionally contain either or both E6 and E7 proteins from HPV 18, preferably in the form of a Protein D - E6 or Protein D - E7 fusion protein or Protein D E6/E7 fusion protein.

The conjugate of the present invention may additionally comprise antigens from other HPV strains, preferably from strains HPV 31 or 33.

Conjugates of the present invention may further comprise as the second protein antigens derived from parasites that cause Malaria, for example, antigens from Plasmodia falciparum including circumsporozoite protein (CS protein), RTS, S, MSP1 , MSP3, LSA1 , LSA3, AMA1 and TRAP. RTS is a hybrid protein comprising substantially all the C-terminal portion of the circumsporozoite (CS) protein of P. falciparum linked via four amino acids of the preS2 portion of Hepatitis B surface antigen to the surface (S) antigen of hepatitis B virus. Its full structure is VB62590

13 disclosed in International Patent Application No. PCT/EP92/02591 , published under Number WO 93/10152 claiming priority from UK patent application No.9124390.7. When expressed in yeast RTS is produced as a lipoprotein particle, and when it is co-expressed with the S antigen from HBV it produces a mixed particle known as RTS₁S. TRAP antigens are described in International Patent Application No. PCT/GB89/00895, published under WO 90/01496.

Plasmodia antigens that are likely candidates to be components of a multistage Malaria vaccine are P. falciparum MSP1 , AMA1 , MSP3, EBA, GLURP, RAP1 , RAP2, Sequestrin, PfEMPI , Pf332, LSA1 , LSA3, STARP, SALSA, PfEXPI , Pfs25, Pfs28, PFS27/25, Pfs16, Pfs48/45, Pfs230 and their analogues in Plasmodium spp eg P. vivax. One embodiment of the present invention is a conjugate wherein the antigen preparation comprises RTS, S or CS protein or a fragment thereof such as the CS portion of RTS₁S, in combination with one or more further malarial antigens. The one or more further malarial antigens may be selected for example from the group consisting of MPS1 , MSP3, AMA1 , LSA1 or LSA3.

In a further embodiment, the conjugate may also contain an anti-tumour antigen and be useful for the immunotherapeutic treatment of cancers. For example, the adjuvant formulation finds utility with tumour rejection antigens such as those for prostrate, breast, colorectal, lung, pancreatic, renal or melanoma cancers. Exemplary antigens include MAGE 1 and MAGE 3 or other MAGE antigens (for the treatment of melanoma), PRAME, BAGE, or GAGE (Robbins and Kawakami, 1996, Current Opinions in Immunology 8, pps 628-636; Van den Eynde et al., International Journal of Clinical & Laboratory Research (submitted 1997); Correale et al. (1997), Journal of the National Cancer Institute 89, p293. Indeed these antigens are expressed in a wide range of tumour types such as melanoma, lung carcinoma, sarcoma and bladder carcinoma. Other tumour-specific antigens include, but are not restricted to tumour-specific gangliosides, Prostate specific antigen (PSA) or Her-2/neu, KSA (GA733), PAP, mammaglobin, MUC-1 , carcinoembryonic antigen (CEA), p501 S (prostein). The second protein may also comprise a tumour rejection antigen. In one aspect, the tumour antigen is Her-2/neu.

Other exemplary tumour associated antigens include Prostate-specific membrane antigen (PSMA), Prostate Stem Cell Antigen (PSCA), tyrosinase, survivin, NY-ESO1 , prostase, PS108 (WO 98/50567), RAGE, LAGE, HAGE. Additionally said antigen may be a self peptide hormone such as whole length Gonadotrophin hormone releasing hormone (GnRH, WO 95/20600), a short 10 amino acid long peptide, useful in the treatment of many cancers, or in immunocastration. VB62590

14

The method of the invention overcomes the unexpected problems encountered by the inventors in their attempt to conjugate proteins with poorly accessible free cysteine residues, especially StxB, with other proteins and the yields obtained in the reaction have risen from less than 10% using the method described in WO 02/060937 to more than 30% in most instances, and in some cases up to nearly 100%.

Examples of suitable functional groups A1 and B1 which react with primary amino groups include N-hydroxy succinimide (NHS) esters or sulfo-NHS esters.

If the second protein has cysteine residues which are accessible for reaction, the functional group B1 may be a group which reacts with sulfhydryl groups, for example maleimide.

As mentioned above, in one embodiment, A2 and B2 are chosen such that they react together to form a conjugate of the first and second protein-linker moieties. Therefore, in this case, A2 and B2 groups can be given in pairs, although it is not important which of the pair is A2 and which is B2. Examples of suitable pairs of A2 and B2 groups include maleimide and sulfhydryl, which may be protected, for example as a pyridylthio group.

Therefore, the first bifunctional linker may comprise a group A1 , which is a NHS ester or a sulfo- NHS ester, and a group A2, which is a maleimide group; and the second bifunctional linker may comprise a group B1 , which is a NHS ester or a sulfo-NHS ester, and a group B2, which is a protected sulfhydryl group.

Alternatively, A2 may be a protected sulfhydryl group and B2 may be a maleimide group.

In one embodiment of the invention, A2 is a sulfhydryl or protected sulfhydryl groups. and B2 ir not a sulfhydryl or protected sulfhydryl group. In a further embodiment of the invention A2 is not a sulfhydryl or protected sulfhydryl group and B2 is a sulfhydryl or protected sulfhydryl group.

A particularly suitable form of protection for sulfhydryl groups is a pyridylthio group, which can be removed by reaction with dithiothreitol (DTT).

The art of protein coupling is well developed and therefore there are many commercially VB62590

15 available bifunctional linkers comprising suitable A1 and A2 or B1 and B2 functional groups.

In the case where the second protein has available cysteine groups, it may be possible to attach the linker to these. In this case, a second linker could be used in which both B1 and B2 are maleimide groups.

In an alternative embodiment discussed above, the first and second protein-linker moieties are reacted with a third linker moiety having functional groups C1 and C2, wherein the functional group C1 is adapted to react with the functional group A2 of the first protein-linker moiety and the functional group C2 is adapted to react with the functional group B2 of the second protein- linker moiety.

Therefore, one of the groups A2 and C1 may be a maleimide group, while the other of A2 and C1 may be a sulfhydryl group, which may be protected until it is required to react. Similarly, one of the groups B2 and C2 may be a maleimide group, while the other of B2 and C2 may be a sulfhydryl group, which may be protected until it is required to react.

In a preferred case, the groups A2 and B2 are both protected sulfhydryl groups, and the third linker is a bis maleimide moiety so that both C1 and C2 are maleimide groups. The sulfhydryl groups A2 and B2 are preferably protected until they are required to react with the maleimide moieties.

Examples of suitable linker moieties comprising an NHS ester or a sulfo-NHS ester and a maleimide group include N-(α-maleimidoacetoxy) succinimide ester (AMAS), m- maleimidobutyryloxy succinimide ester (GMBS), N-(ε-maleimidocaproyloxy) succinimide ester (EMCS), m-maleimidobenzoyl-N-hydroxysuccinimidyl ester (MBS), succinimidyl-4-(N- maleimidomethyl) cyclohexane-1-carboxylate (SMCC), succinimidyl-4-(p-maleimidophenyl)- butyrate (SMPB), succinimidyl-6-(β-maleimidopropionamido)hexanoate (SMPH), sulfo-AMAS, sulfo-GMBS, sulfo-EMCS, sulfo-MBS, sulfo-SMCC, sulfo-SMPB and sulfo-SMPH, all of which are commercially available.

Examples of linker moieties comprising an NHS ester or a sulfo-NHS ester and a pyridylthio (protected SH) group include N-succinimidyl-3-(2-pyridylthio)propionate (SPDP), N-succinimidyl- 6-(3'-(2-pyridyldithio) propionamido)-hexanoate (LC-SPDP), 4-succinimdyloxycarbonyl-methyl- VB62590

16 α-[2-pyridyldithio]-toluene (SMPT), sulfo-SPDP, sulfo-LC-SPDP and sulfo-SMPT.

Examples of linker moieties comprising two maleimide functional groups include 1 ,2- bismaleimidoethane (BMOE), 1 ,4-bis-maleimidobutane (BMB), 1 ,4-bismaleimidyl-2,3- dihydroxybutane (BMDB), bis-maleimidohexane (BMH), bis-maleimide (PEO)₂ (BM(PEO)₂) and bis-maleimide (PEO)₃ (BM(PEO)₃), where PEO is a polyethyloxy spacer group and is well known to those of skill in the art.

The conjugate may include one or more additional proteins, optionally attached by the same method.

In a second aspect of the invention, there is provided a protein conjugate obtainable by the method of the first aspect of the invention.

The conjugate comprises a first protein linked via amino groups to a first linker and a second protein linked via amino or sulfhydryl groups to a second linker, wherein the first and second linker are covalently joined.

Preferred features of this aspect of the invention are as specified above for the method of the first aspect.

It is particularly preferred that the first protein is the B subunit of Shiga toxin (StxB), the B subunit of E. coli heat labile enterotoxin (LTB) or the B subunit of cholera toxin (CTB) or a functional equivalent of any of these. Most preferably, the first protein is StxB or a functional equivalent thereof.

When the first protein is StxB, LTB or CTB or a functional equivalent thereof, the second protein may be an antigen to be introduced into the MHC class 1 -restricted antigen presentation pathway. Any one of a number of antigens may be used as described above.

Preferred first, second and third linkers are as listed above for the first aspect of the invention and it is particularly preferred that both the first and second linkers are joined to the first and second proteins via the reaction of a primary amino group on the protein with an NHS or sulfo- NHS ester. It is also particularly preferred that the first and second linkers are joined to one VB62590

17 another via the reaction between a sulfhydryl group and a maleimide group, one of which is on the first and one on the second linker moiety.

In a further aspect of the invention, there is provided an immunogenic composition comprising a protein conjugate of the second aspect of the invention in which the first protein is StxB, LTC or CTB, together with a pharmaceutically acceptable carrier.

Furthermore, there is also provided a vaccine composition comprising a protein conjugate of the second aspect of the invention in which the first protein is StxB, LTC or CTB, together with a pharmaceutically acceptable carrier.

It is greatly preferred that the immunogenic composition and the vaccine composition both also comprise an adjuvant (immunostimulant) as this can have a beneficial effect on the immune response.

The adjuvant is suitably selected from the group: a saponin, lipid A or a derivative thereof, an immunostimulatory oligonucleotide, an alkyl glucosaminide phosphate, or combinations thereof. A further suitable adjuvant is a metal salt in combination with another adjuvant. The adjuvant is suitably a Toll like receptor ligand in particular a ligand of a Toll like receptor 2, 3, 4, 7, 8 or 9, or a saponin, in particular Qs21. The adjuvant system suitably comprises two or more adjuvants from the above list. In particular the combinations suitably contain a saponin (in particular Qs21 ) adjuvant and/or a Toll like receptor 9 ligand such as a immunostimulatory oligonucleotide containing CpG or other immunostimulatory motifs such as CpR where R is a non-natural guanosine nucleotide. Other suitable combinations comprise a saponin (in particular QS21 ) and a Toll like receptor 4 ligand such as monophosphoryl lipid A or its 3 deacylated derivative, 3 D - MPL, or a saponin (in particular QS21 ) and a Toll like receptor 4 ligand such as an alkyl glucosaminide phosphate. Other suitable combinations comprise a TLR 3 or 4 ligand in combination with a TLR 8 or 9 ligand. In one embodiment, the toll like receptor ligand is a receptor agonist. In another embodiment, the toll like receptor ligand is a receptor antagonist. The term "ligand" as used throughout the specification and the claims is intended to mean an entity that can bind to the receptor and have an effect, either to upregulate or downregulate the activity of the receptor.

Particularly suitable adjuvants are combinations of 3D-MPL and QS21 (EP 0 671 948 B1 ), oil in VB62590

18 water emulsions comprising 3D-MPL and QS21 (WO 95/17210, WO 98/56414), or 3D-MPL formulated with other carriers (EP 0 689 454 B1 ). Other preferred adjuvant systems comprise a combination of 3 D MPL, QS21 and a CpG oligonucleotide as described in US6558670, US6544518.

In an embodiment the adjuvant is a Toll like receptor (TLR) 4 ligand, preferably an ligand such as a lipid A derivative particularly monophosphoryl lipid A or more particularly 3 Deacylated monophoshoryl lipid A (3 D - MPL).

3 D -MPL is sold under the trademark MPL® by GlaxoSmithKline and primarily promotes CD4+ T cell responses with an IFN-g (Th1 ) phenotype. It can be produced according to the methods disclosed in GB 2 220 211 A. Chemically it is a mixture of 3-deacylated monophosphoryl lipid A with 3, 4, 5 or 6 acylated chains. Preferably in the compositions of the present invention small particle 3 D- MPL is used. Small particle 3 D -MPL has a particle size such that it may be sterile-filtered through a 0.22μm filter. Such preparations are described in International Patent Application No. WO 94/21292. Synthetic derivatives of lipid A are known and thought to be TLR 4 ligands including, but not limited to:

OM174 (2-deoxy-6-o-[2-deoxy-2-[(R)-3-dodecanoyloxytetra-decanoylamino]-4-o-phosphono-β- D-glucopyranosyl]-2-[(R)-3-hydroxytetradecanoylamino]-α-D- glucopyranosyldihydrogenphosphate), (WO 95/14026)

OM 294 DP (3S, 9 R) -3-[(R)-dodecanoyloxytetradecanoylamino]-4-oxo-5-aza-9(R)-[(R)-3- hydroxytetradecanoylamino]decan-1 ,10-diol,1 ,10-bis(dihydrogenophosphate) (WO99 /64301 and WO 00/0462 )

OM 197 MP-Ac DP ( 3S-, 9R) -3-[(R) -dodecanoyloxytetradecanoylaminoH-oxo-S-aza-θ-KR)^- hydroxytetradecanoylamino]decan-1 ,10-diol,1 -dihydrogenophosphate 10-(6-aminohexanoate) (WO 01/46127)

Other TLR4 ligands which may be used are alkyl Glucosaminide phosphates (AGPs) such as those disclosed in WO9850399 or US6303347 (processes for preparation of AGPs are also disclosed), or pharmaceutically acceptable salts of AGPs as disclosed in US6764840. Some AGPs are TLR4 agonists, and some are TLR4 antagonists. Both are thought to be useful as VB62590

19 adjuvants.

Another suitable immunostimulant for use in the present invention is Quil A and its derivatives. Quil A is a saponin preparation isolated from the South American tree Quilaja Saponaria Molina and was first described as having adjuvant activity by Dalsgaard et al. in 1974 ("Saponin adjuvants", Archiv. fur die gesamte Virusforschung, Vol. 44, Springer Verlag, Berlin, p243-254). Purified fragments of Quil A have been isolated by HPLC which retain adjuvant activity without the toxicity associated with Quil A (EP 0 362 278), for example QS7 and QS21 (also known as QA7 and QA21 ). QS-21 is a natural saponin derived from the bark of Quillaja saponaria Molina which induces CD8+ cytotoxic T cells (CTLs), Th1 cells and a predominant lgG2a antibody response and is a preferred saponin in the context of the present invention.

Particular formulations of QS21 have been described which are particularly suitable, these formulations further comprise a sterol (WO96/33739). The saponins forming part of the present invention may be separate in the form of micelles, mixed micelles (preferentially, but not exclusively with bile salts) or may be in the form of ISCOM matrices (EP 0 109 942 B1 ), liposomes or related colloidal structures such as worm-like or ring-like multimeric complexes or lipidic/layered structures and lamellae when formulated with cholesterol and lipid, or in the form of an oil in water emulsion (for example as in WO 95/17210). The saponins may suitably be associated with a metallic salt, such as aluminium hydroxide or aluminium phosphate (WO 98/15287).

Suitably, the saponin is presented in the form of a liposome, ISCOM or an oil in water emulsion.

lmmunostimulatory oligonucleotides or any other Toll-like receptor (TLR) 9 ligand may also be used. The preferred oligonucleotides for use in adjuvants or vaccines of the present invention are CpG containing oligonucleotides, preferably containing two or more dinucleotide CpG motifs separated by at least three, more preferably at least six or more nucleotides. A CpG motif is a Cytosine nucleotide followed by a Guanine nucleotide. The CpG oligonucleotides of the present invention are typically deoxynucleotides. In a suitable embodiment the internucleotide in the oligonucleotide is phosphorodithioate, or more preferably a phosphorothioate bond, although phosphodiester and other internucleotide bonds are within the scope of the invention. Also included within the scope of the invention are oligonucleotides with mixed internucleotide linkages. Methods for producing phosphorothioate oligonucleotides or phosphorodithioate are VB62590

20 described in US5,666,153, US5,278,302 and WO95/26204.

Examples of suitable oligonucleotides have the following sequences. The sequences preferably contain phosphorothioate modified internucleotide linkages.

OLIGO 1 (SEQ I D NO: 1 ): TCC ATG ACG TTC CTG ACG TT (CpG 1826) OLIGO 2 (SEQ ID NO:2): TCT CCC AGC GTG CGC CAT (CpG 1758) OLIGO 3(SEQ ID NO:3): ACC GAT GAC GTC GCC GGT GAC GGC ACC ACG OLIGO 4 (SEQ ID N0:4): TCG TCG TTT TGT CGT TTT GTC GTT (CpG 2006) OLIGO 5 (SEQ ID NO:5): TCC ATG ACG TTC CTG ATG CT (CpG 1668)

OLIGO 6 (SEQ ID NO:6): TCG ACG TTT TCG GCG CGC GCC G (CpG 5456)

Alternative CpG oligonucleotides may comprise the sequences above or be functional variants in that they have inconsequential deletions or additions thereto.

Alternative immunostimulatory oligonucleotides may comprise modifications to the nucleotides. For example, WO0226757 and WO03507822 disclose modifications to the C and G portion of a CpG containing immunostimulatory oligonucleotides.

The immunostimulatory oligonucleotides utilised in the present invention may be synthesized by any method known in the art (for example see EP 468520). Conveniently, such oligonucleotides may be synthesized utilising an automated synthesizer.

Examples of a TLR 2 ligand include peptidoglycan or lipoprotein. Imidazoquinolines, such as Imiquimod and Resiquimod are known TLR7 ligands. Single stranded RNA is also a known TLR ligand (TLR8 in humans and TLR7 in mice), whereas double stranded RNA and poly IC (polyinosinic-polycytidylic acid - a commercial synthetic mimetic of viral RNA). are exemplary of TLR 3 ligands. 3D-MPL is an example of a TLR4 ligand whilst CPG is an example of a TLR9 ligand.

Further preferred features are described in the Examples and in the drawings in which:

FIGURE 1 is an HPLC chromatograph showing the formation of the p24(LC-SPDP)-StxB(sulfo- GMBS) conjugate. VB62590

21

FIGURE 2 is an HPLC chromatograph showing the formation of the p24(sulfo-GMBS)-StxB(LC- SPDP) conjugate.

FIGURE 3 is an HPLC chromatograph showing the formation of the p24(LC-SPDP)-LTB (sulfo- GMBS) conjugate.

In the Examples, the following abbreviations are used:

StxB - Shiga toxin B subunit (SEQ ID NO: 7)

StxB-Cys - Shiga toxin B subunit with C-terminal cysteine residue (SEQ ID NO: 8) LTB - E. coli heat labile enterotoxin B subunit (SEQ ID No: 9);

CTB - cholera toxin B subunit (SEQ ID No: 10)

TT - tetanus toxin (SEQ ID No: 11 ); gp120 - gp 20 polypeptide (HIV gp120 Clade B) (SEQ ID NO: 12);

F4 - F4 polypeptide HIV ( = HIV p24-RT-Nef-p17) (SEQ ID No: 13) p24 - p24 polypeptide HIV (SEQ ID No: 14)

OVA - ovalbumin polypeptide (SEQ ID No: 15).

LTB-Cys - E. coli heat labile enterotoxin B subunit with C-terminal cysteine residue (SEQ ID No:

16);

DTT - dithiothreitol; GMBS - m-maleimidobutyryloxy succinimide ester sulfo-GMBS - sulfo- m-maleimidobutyryloxy succinimide ester

SPDP - N-succinimidyl-3-(2-pyridylthio)propionate;

LC-SPDP - N-succinimidyl-6-(3'-(2-pyridyldithio) propionamido)-hexanoate;

BM(PEO)₃- bis-maleimide (PEO)₃, where PEO is a polyethyloxy spacer group. MBS - m-maleimidobenzoyl-N-hydroxysuccinimidyl ester

Comparative Examples - Conjugation Reactions according to the method described in WO 02/060937

Scheme 1 illustrates a method similar to that described in WO 02/060937 for conjugating the modified protein StxB-Cys to a second protein. In this method, amino groups of the second VB62590

22 protein were reacted with the bifunctional linker LC-SPDP, the resultant product was reduced with DTT to leave a free SH group and this was reacted with the free SH group on the C- terminal cysteine residue to give a disulfide-linked conjugate.

Scheme 1

Protein

Comparative Example 1 - OVA (sulfo-GMBS)-StxB Conjugate In this comparative example, ovalbumin was derivatised by reacting the bifunctional linker sulfo- GMBS with free amino groups. The OVA-sulfo-GMBS derivative is then reacted with the free SH group of StxB-Cys. The method was very similar to that described in Example 5 of WO 02/060937, except that sulfo-GMBS, rather than MBS was used as the bifunctional linker.

OVA-sulfo-GMBS deήvatization:

10 mg of OVA were diluted at 5 mg/ml with DPBS ([Gibco] w/o Ca++, Mg++). An 80 fold molar excess of sulfo-GMBS were added in solid form to the solution. The solution was then left, under stirring, during 1 hour at room temperature before the purification on a PD10 column VB62590

23

(Amersham) to remove by-products. Interesting fractions were pooled and maleimide functions were determined by the Ellman assay (4.5 functions/ mole of OVA).

O VA -Six B conjuga tion : 3.3 mg of OVA-sulfo-GMBS derivative were mixed with 0.56 mg of StxB-cys (5 mole OVA/ 1 mole StxB-cys). The solution was stirred during 1 hour at room temperature. Then the conjugate was injected on a HW50F column (Tosohaas) at a flow-rate of 0.67 ml/min and fractions of 1 ml were collected. Interesting fractions were selected by SDS-PAGE analysis (coomassie blue staining and western blot using antibodies against OVA or against StxB).

The yield of the OVA-StxB conjugate was very low, and in repeated experiments it was not possible to obtain a yield of greater than about 10%.

Comparative Example 2 - gp120 (sulfo-GMBS)-LTB-cys

The method is similar to Comparative Example 1 except that, in this case, LTB was derivatised at its carboxy terminus with an additional cysteine residue to give the variant LTB-Cys.

Preparation ofLTB-cys The starting material was a plasmid called pBD95, carrying coding sequence of ml_T, which is the complete sequence of LT toxin (A and B subunits) where A subunit iwa mutated at 2 amino acids.

Oligonucleotides LTBF3 (5' caccatgaataaagtaaaatgttatgttttat 3', SEQ ID NO: 17) and LTBR1 (5' gcactagagcttagcagttttccatactgattgccgca 3'; SEQ ID NO: 18) were designed for LTB coding sequence amplification. Oligonucleotide LTBF3 codes for start codon (ATG) following by LTB N-terminal amino acids; and oligonucleotide LTBR1 codes for the C-terminal LTB amino acids fused to a TGC codon (coding for a cysteine) in frame with the C terminal of LTB coding sequence.

Using the LTBF3 and LTBR1 oligonucleotides, the coding sequence of the B subunit fused to a cysteine was amplified by PCR using plasmid pBD95 as template. The amplified fragment was then cloned in plasmid pET101 D TOPO. In this plasmid, insertion of LTB-cys coding sequence under control of T7 lacO promoter leads to LTB-cys protein synthesis after addition of IPTG in VB62590

24

E. coli strain carrying DE3 prophage. The strain BL21 (DE3) transformed by this plasmid was called B2031.

Expression of the recombinant protein: Preculture was performed overnight in LBT medium supplemented with ampicillin and 0.5 % glucose. Culture was obtained by preculture dilution in fresh LBT medium supplemented with ampicillin. When OD reached 1.0, expression of recombinant protein was induced with IPTG 1 mM final, and bacterial cells were harvested after 4 hours induction for purification of LTB-cys.

Purification of LTB-cvs subunit from E. coli Ivsate:

1 I bacterial pellet OD₍₆₂0) 50 in DPBS (Gibco) w/o CaMg buffer was extracted by French press;

After 30' centrifugation 500Og, supernatant was harvested and treated with 50000 u benzonase

1 h RT. Insoluble fraction was eliminated by centrifugation 30' 1500Og and 0.22 μm filtration.

Clarified supernatant was loaded on XK16/20 column containing 20 ml DPBS w/o CaMg buffer pre-equilibrated immobilized galactose resin, and washed with same buffer until OD drops to basal level. LTB is eluted by 1 M galactose in DPBS w/o CaMg buffer. Finally, LTB-cys was dialysed intensively against DPBS w/o CaMg buffer and endotoxins were removed by Acticlean resin incubation.

QP 120-sulfo-GMBS derivatization gp120 protein was activated with a 25x fold excess of sulfo-GMBS. The solution was then left, under stirring, during 1 hour (room temperature) before the purification on a PD10 column to remove by-products. Interesting fractions were pooled and maleimide functions were determined by the Ellman assay (13 functions/ mole of gp120).

QP120-LTB-Cvs conjugation:

O.δmg of gp120-sulfo-GMBS derivative were mixed with 1.8 mg of LTB-Cys and stirred during 1 hour at room temperature. Residual maleimide functions were then quenched with an excess of cysteine. The solution was stirred for 30 minutes.

Once again the yield of the conjugate was very low using this method, typically not greater than about 10%.

In contrast to the methods described in the Comparative Examples, the inventors have devised VB62590

25 an alternative coupling method, which is described in the Examples below.

Many of the Examples make use of two preferred groups of linkers, the first of which is SPDP, and its variants LC-SPDP, sulfo-SPDP and sulfo-LC-SPDP. The second especially preferred group of linkers is GMBS and sulfo-GMBS.

The SPDP reagents are a unique group of amine- and sulfhydryl-reactive heterobifunctional cross-linkers. They produce disulfide containing linkages that may be cleaved later with reducing agents such as dithiothreitol (DTT). Reactions are performed in phosphate buffer (pH7.2) during 1 or 2 hours. SPDP has limited aqueous solubility and must be dissolved in organic solvents before adding it to a reaction mixture, in contrast to sulfo-LC-SPDP, which is water-soluble and may be directly added to aqueous reaction mixtures. The excess of reagent was eliminated by gel filtration. Interesting fractions are pooled and concentrated if needed. Protein-SPDP derivative can be stored at 4°C before treatment with DTT.

In most cases, cross-links created using SPDP reagents can be cleaved with DTT at pH4.5, without reducing native protein disulfide bonds. Higher pH can also be used if the isoelectic point of the protein is close to 4.5.

Sulfo-GMBS is water-soluble heterobifunctional cross-linker that contains N-hydoxysuccinimide (NHS) ester and maleimide groups that allow covalent conjugation of amine- and sulfhydryl- containing molecules. NHS esters react with primary amines contained on the protein to form amide bonds, while the maleimides react with sulfhydryl groups at pH 7.4 to form stable thioether bonds.

This conjugation can be used if sulfydryl groups are absent or unavailable for conjugation in both proteins. For instance, ihe present inventors have found that StxB-cys sulfydryl groups to be essentially unavailable.

Example 1 - p24(LC-SPDP)-StxB-cvs (sulfo-GMBS) conjugate:

This conjugate was formed according to the method shown in Scheme 2.

In this method, sulfo-GMBS is reacted with free amino groups on StxB to produce a first protein- VB62590

26 linker moiety. LC-SPDP is reacted with free amino groups on the protein to produce a second protein-linker moiety. The protecting group on the second protein-linker moiety is removed by reaction with DTT and the two protein-linker moieties reacted to give the required protein conjugate.

Scheme 2 - Conjugation of StxB via free amino residues

(StxB-cvs)-sulfo-GMBS derivatization:

4.0mg of StxB-cys were added to a 25x molar excess of sulfo-GMBS. The solution was mixed during 1 hour at room temperature. The StxB-sulfo-GMBS was then purified on a PD10 column to remove by-products. Interesting fractions then were pooled.

P24-LC-SPDP derivatization:

10mg of p24 were added to a 2Ox molar excess of LC-SPDP. The solution is mixed during 1 hour at room temperature. This was then purified on 2 PD10 columns to remove by-products. Interesting fractions were pooled and characterized. This product can be stored at 4°C prior to reduction by DTT. VB62590

27

Before the conjugation, the p24-LC-SPDP was subjected to reduction. 0.2mg of DTT was added per mg of p24. The solution was stirred during 1 hour at room temperature. The product was then purified on a PD10 column (5OmM PO4/ pH7.2). Interesting fractions were pooled and concentrated prior to conjugation.

p24 (LC-SPDP)-StxB-cys (sulfo-GMBS) conjugation:

StxB(cys)-sulfo-GMBS were mixed with p24-SH and stirred 1 hour at room temperature. The conjugate was quenched with cysteine (30 minutes), followed by the addition of iodoacetamide (30 minutes). The conjugate was clarified and then dialyzed against a 5OmM phosphate buffer/pH7.2 using a 3500Da cut off membrane. It was finally sterile filtered on a 0.22μm membrane before characterization.

Figure 1 is an HPLC chromatograph showing the formation of the p24(LC-SPDP)-StxB(sulfo- GMBS) conjugate. Separate runs showing unconjugated StxB-cys and p24 are superimposed.

The yield of conjugate as assessed in a TSK300 column was 80 to 100% (HPLC analysis, before purification) which is a considerable improvement on the yield obtained with the method of WO02/060937.

Example 2 - p24(sulfo-GMBS)-StxB-cvs(LC-SPDP) conjugate

This is similar to Example 1 except that the linkers were reversed so that StxB reacts with LC- SPDP to form a first protein-linker moiety and the protein p24 was reacted with sulfo-GMBS to form a second protein-linker moiety.

StxB-cvs-LC-SPDP derivatization:

7mg of StxB-cys of a solution at 2.2mg/ml (lot 12) were added to a 25x molar excess of LC- SPDP. The solution is mixed during 1 hour at room temperature and then purified on a PD10 column to remove by-products. Interesting fractions were pooled and characterized. This product can be stored at 4°C prior to reduction by DTT.

Before the conjugation, the StxB-LC-SPDP was subjected to reduction. 0.2mg of DTT were added per mg of StxB-cys. The solution was stirred during 1 hour at room temperature. The product was then purified on a PD10 column (5OmM PO₄/ pH7.2). Interesting fractions were pooled and concentrated prior conjugation. VB62590

28

p24-Sulfo-GMBS derivatization:

5.3mg of p24 (lot 002) were added to a 25x molar excess of sulfo-GMBS. The solution is mixed during 1 hour at room temperature. This was then purified on a PD10 column to remove by- products. Interesting fractions then were pooled.

D24 (Sulfo-GMBS)-StxB (LC-SPDP) conjugation:

4.4mg of StxB-(cys)-SH were mixed with 2.7mg of p24-sulfo-GMBS and stirred 1 hour at room temperature. The conjugate was quenched with cysteine (30 minutes), followed by the addition of iodoacetamide (30 minutes). The conjugate was clarified and then dialyzed (3500Da cut off membrane) against a 5OmM phosphate buffer/pH7.2. It was finally sterile filtered on a 0.22μm membrane before characterization.

Once again, the conjugation yield was 80 to 100% using these coupling conditions.

Double linker conjugates (P24-StxB) showed intracellular trafficking, but this analysis is not quantitative (data not shown).

Example 3 - qp120 (Sulfo-GMBS)-TT (SPDP)

In this example, tetanus toxoid (TT) was used as an example protein for conjugation. In a reaction similar to that of Example 2, TT was reacted with SPDP to form a first protein-linker moiety and the protein gp120 is reacted with sulfo-GMBS to form a second protein-linker moiety.

gp 120-sulfo-GMBS derivatization: gp120 protein was activated with a 25x fold molar excess of sulfo-GMBS. The solution was then left, under stirring, for 1 hour (room temperature) before the purification on a PD10 column to remove by products. Interesting fractions are pooled and maleimide functions were determined by the Ellman assay (13 functions/ mole of gp120).

TT-SPDP derivatization: VB62590

29

TT protein was derivatized with a 15x fold molar excess of SPDP. The solution was then left, under stirring, for 80 minutes (room temperature) before the purification on a S200HR column to remove by products. Interesting fractions were pooled.

TT-SPDP was then reduced with DTT (0.7mg/mg TT) and stirred during 1 hour at room temperature before the purification on a PD10 column to remove by-products. Fractions which contained the reduced product (TT-SH) were pooled.

gp120-TT conjugation:

1 mole of gp120-sulfo-GMBS was mixed with 1 mole of TT-SH (5OmM PO₄/pH7.2). The solution was stirred for 1 hour at room temperature. Residual maleimide functions were quenched with an excess of cysteine (25x). The mixture was left for 30 minutes under stirring. Residual sulfhydryl functions were then quenched with an iodoacetamide excess (25x). The mixture was left for 30 minutes under stirring. The product was dialyzed against a phosphate buffer (5OmM PO₄/ pH7.2) and sterile filtered on a 0.22μm membrane.

Similar to the previous two examples, the yield obtained for the best conjugate produced by this method was about 90% (HPLC analysis before purification) [data now shown].

Example 4 - qp120 (LC-SPDP)-TT (SPDP) In this example, the example protein TT was derivatised with SPDP to form a first protein-linker moiety. The protein gp120 was derivatised with LC-SPDP to form a second protein-linker moiety which was then reduced to form a reduced protein-linker moiety designated gp120-SH. The two protein-linker moieties were reacted together to form a disulfide bond linking the two moieties.

QD120-LC-SPDP derivatization: gp120 protein was activated with a 25x fold molar excess of LC-SPDP. The solution was then left, under stirring for 1 hour (room temperature) before the purification on a PD10 column to remove by-products (5OmM PO₄/ pH7.2). Interesting fractions were pooled.

gp120-LC-SPDP derivative was then reduced with DTT (0.7mg/mg gp120) and stirred during 1 hour at room temperature before the purification on a PD10 column to remove by-products. Fractions which contained the gp120-SH were pooled. VB62590

30

TT-SPDP derivatization:

TT protein was derivatized with a 15X fold molar excess of SPDP. The solution was then left, under stirring, during 60 minutes (room temperature) before purification on a PD10 column to remove by-products. Interesting fractions were pooled.

QD120-TT conjugation:

1 mole of gp120-SH was mixed with 1 mole of TT-SPDP (5OmM PO₄/pH7.2). The solution was stirred during 1 hour at room temperature. Residual sulfhydryl functions were then quenched with an iodoacetamide excess (25x). The mixture was left 30 minutes under stirring.

The product was dialyzed against a phosphate buffer (5OmM PO₄/ pH7.2, 3500Da cut off membrane) and sterile filtered on a 0.22μm membrane.

The yield obtained by this conjugation method was lower than for the method of Examples 1 to 3, and over a number of experiments averaged about 10%.

Example 5 - qp120 (LC-SPDP)-BM(PECMS-TT (SPDP)

This Example describes a method in which a first and a second protein-linker moiety were linked via a third linker moiety. In this case, TT was reacted with SPDP and then reduced with DTT to form a first protein-linker moiety designated TT-SH. gp120 was reacted with LC-SPDP and then reduced to form a second protein-linker moiety designated TT-SH in a manner similar to that described in Example 4. However, the first and second protein-linker moieties were not reacted directly together as in Example 4. Instead, they were both reacted with a third linker moiety, in this case BM(PEO)₃, which comprises two maleimide groups separated by three polyethyloxy spacer groups. The maleimide groups of BM(PEO)₃ react with the SH groups on the first and second protein-linker moieties.

0012Q-LC-SPDP derivatization: gp120 protein was activated with a 25x fold molar excess of LC-SPDP. The solution was then left, under stirring, for 1 hour (room temperature) before the purification on a PD10 column to remove by-products (5OmM PO₄/ pH7.2). Interesting fractions were pooled.

gp120-LC-SPDP derivative was then reduced with DTT (0.7mg/mg gp120) and stirred during 1 VB62590

31 hour at room temperature before the purification on a PD10 column to remove by-products. Fractions which contained the gp120-SH were pooled. gp120-SH derivative was mixed with a 25x molar excess of BM(PEO)₃ The solution was then left, under stirring, during 1 hour (room temperature) before the purification on a PD10 column to remove by-products (5OmM PO₄/ pH7.2). Interesting fractions were pooled. TT-SPDP derivatization:

TT protein was derivatized with a 15X fold molar excess of SPDP. The solution was then left, under stirring, during 60 minutes (room temperature) before the purification on a PD10 column to remove by-products. Interesting fractions were pooled. TT-SPDP was then reduced with DTT (0.7mg/mg TT) and stirred during 1 hour at room temperature before the purification on a PD10 column to remove by-products. Fractions which contained the TT-SH were pooled.

Conjugation: TT-SH derivative was mixed with the gp120-LC-SPDP^*-BM(PEO)₃ and stirred during 1 hour at room temperature. Residual sulfhydryl functions were then quenched with an iodoacetamide excess (25x). The mixture was left 30 minutes under stirring.

The product was dialyzed (3500 Da cut-off) against a phosphate buffer (5OmM PO4/ pH7.2) and sterile filtered on a 0.22μm membrane.

As with the previous example, the yield for this experiment was lower than 10%

Example 6 - p24 (LC-SPDP)- LTB (sulfo-GMBS) conjugate This example was carried out in a manner similar to that described for Example 1 but using LTB instead of StxB-cys.

D24-LC-SPDP derivatization: p24 protein, in a 5OmM PO₄/ pH7.2 buffer, was activated with a 2Ox fold molar excess of LC- SPDP. The solution was then left, under stirring, during 1 hour (room temperature) before the purification on a PD10 column to remove by-products (5OmM PO₄/ pH7.2). Interesting fractions were pooled.

p24-LC-SPDP derivative was then reduced with DTT (0.2mg/mg p24) and stirred during 1 hour VB62590

32 at room temperature before the purification on a PD10 column to remove by-products. Fractions which contained the p24-SH were pooled and concentrated to reach a concentration superior to 4mg/ml.

L TB-sulfo-GMBS derivatization:

LTB protein was activated with a 25x fold molar excess of sulfo-GMBS. The solution was then left, under stirring, during 1 hour (room temperature) before the purification on a PD10 column to remove by-products. Interesting fractions were pooled.

Conjugation:

1 mole of p24-SH was mixed with 1 mole of LTB-sulfo-GMBS (5OmM PO4/pH7.2). The solution was stirred during 1 hour at room temperature. Residual maleimide functions were quenched with a 25x molar excess of cysteine. The solution was left 30 minutes under stirring. Residual sulfhydryl functions were then quenched with an iodoacetamide excess (25x). The mixture was left 30 minutes under stirring.

Figure 3 is an HPLC chromatograph showing the formation of the p24(LC-SPDP)-LTB (sulfo- GMBS) conjugate - free LTB ad p24 are superimposed.

The average yield for conjugates formed by this method was greater than 50%.

Example 7 - Ova (sulfo-GMBS)-StxB-cvs (LC-SPDP) This example was carried out using a method similar to that of Example 2 but using ovalbumin in place of p24.

Ova-sulfo-GMBS derivatization

Ovalbumin was purified on a HW50F (10OmM PO₄/ pH8) column to remove aggregates and then was activated was a 2OX fold excess of sulfo-GMBS. The solution was then left, under stirring, during 1 hour (room temperature) before the purification on 2 PD10 columns (10OmM PO₄/pH8) to remove by-products. Interesting fractions were pooled.

StxB-cys-LC-SPDP derivatization: VB62590

33

StxB protein was activated with a 2Ox fold molar excess of LC-SPDP. The solution was then left, under stirring, during 1 hour (room temperature) before the purification on a PD10 column to remove by-process products (5OmM PO₄/ pH7.2). Interesting fractions are pooled.

StxB-cys-LC-SPDP derivative was then reduced with DTT (0.2mg/ml StxB-cys) and stirred during 1 hour at room temperature before the purification on PD10 columns to remove byproducts. Fractions which contained the p24-SH were pooled.

Conjugation: Activated Ovalbumin was added during 10 minutes in the solution of activated StxB-cys (molar ratio: 1/1 ). The solution was then stirred 1 hour at room temperature, lodoacetamide was added and the solution was stirred during 10 minutes before the addition of cysteine. The solution was still stirred during 30 minutes

The solution was concentrated and injected on a HW50F column to purify the conjugate.

Fractions containing only the conjugate were pooled and sterile filtered on a 0.22μm membrane.

The yield of conjugate in this experiment was generally about 13-20%.

Example 7 - In vivo testing of conjugates formed using 2 linkers

Conjugates were tested in vivo in combination with an adjuvant to determine their immunogenicity after conjugation using the method of the present invention, lmunogenicity was also determined in the absence of an adjuvant and compared to antigen in combination with an adjuvant.

Reagents and medium

Formulations summarized and described below were used to vaccinate 6 -8 week old C57BL/B6 (H2Kb), female mice (10/group). The mice received two injections spaced 14 days apart and were bled during weeks 1 , 3 and 4 (for actual bleed days see study design, due to technical problem for one experiment, mice were also bled exceptionally week 5 (21 days after 2^nd injection)). The mice were vaccinated intramuscularly (injection into the left gastrocnemius muscle of a final volume of 50 μl) with ex-tempo formulation. A heterologous prime boost using VB62590

34 recombinant adenovirus (coding for protein in use for conjugation) and adjuvanted protein was used as control group, the adenovirus was injected at a dose of 5 x 10^*8 VP.

FIGURE -> study design

1st injection ₂nd injection

(IM) (IM)

DO D7 D14 D21 D28

Partial bleeding: PBLs/sera

• ag specific cytokine producing T cell frequency

• Ab titer

Preparation of formulation: ADJUVANT SYSTEM A (ASA) and ASDJUVANT SYSTEM B (ASB):

A mixture of lipid (such as phosphatidylcholine either from egg-yolk or synthetic) and cholesterol and 3 D-MPL in organic solvent, was dried down under vacuum (or alternatively under a stream of inert gas). An aqueous solution (such as phosphate buffered saline) was then added, and the vessel agitated until all the lipid was in suspension. This suspension was then microfluidised until the liposome size was reduced to about 100 nm, and then sterile filtered through a 0.2 μm filter. Typically the cholesterohphosphatidylcholine ratio was 1 :4 (w/w), and the aqueous solution was added to give a final cholesterol concentration of 5 to 50 mg/ml. The liposomes have a defined size of 100 nm and are referred to as SUV (for small unilamelar vesicles). QS21 in aqueous solution was added to the SUV. PBS composition was Na2HPO4: 8.1 mM; KH2PO4: 1.47 mM; KCI: 2.7 mM; NaCI: NaCI: 137 mM pH 7.4. This mixture is referred as ASA. When TLR9-L (CpG 2006) is add-mix to ASA, it was at a final concentration of 100 or 1000 μg/ml according to the antigen model and is referred to ASB. VB62590

35

The AS was diluted in the presence of the antigen. 3 D-MPL and QS21 were all at a final concentration of 10 or 100 μg/ml +/- CpG according to the antigen model. This formulation is denoted "antigen ASA or antigen ASB according to the absence or presence of CpG within the formulation". Organ collection

PBLs Isolation

Blood was taken from retro-orbital vein (50 μl per mouse, 10 mice per group) and directly diluted in RPMI + heparin (LEO) medium. PBLs were isolated through a lymphoprep gradient (CEDERLANE). Cells were then washed, counted and finally were re-suspended at ad hoc dilution in a ad hoc buffer (see below).

Immunological assays Intracellular cytokine Staining (ICS).

ICS assay assessed the antigen-specific T-cell frequency that were cytokine producing T-cells either CD8 and CD4. ICS was performed on blood samples taken as described above. This assay includes two steps: ex vivo stimulation and staining. Ex vivo lymphocyte stimulation is performed in complete medium which is RPMI 1640 (Biowitaker) supplemented with 5% FCS (Harlan, Holland), 1 μg/ml of each anti-mouse antibodies CD49d and CD28 (BD, Biosciences), 2 mM L-glutamine, 1 mM sodium pyruvate, 10 μg/ml streptamycin sulfate, 10 units/ml penicillin G sodium (Gibco), 10 μg/ml streptamycin 50 μM B-ME mercaptoethanol and 100X diluted non- essential amino -acids , all these additives are from Gibco Life technologies. Peptide stimulations were always performed at 37°C, 5% CO2.

STEP 1 : ex vivo stimulation

For ex vivo stimulation, 5 to 10 105 PBLs were re-suspended in complete medium supplemented with a pool of peptides (15-mers overlap by 1 1 encompassing the whole protein sequence) present at a concentration of 1 μg/ml for each.

Ova model: 5 to 10 10⁵ PBLs were re-suspended in complete medium supplemented a pool of 17 15-mer ova peptides (encompassing 11 different MHC classl-restricted peptides and 6 MHC classll-restricted peptides) present at a concentration of each 1 μg/ml. After 2 hours, 1 μg/ml VB62590

36

Brefeldin-A (BD, Biosciences) was added for 16 hours and cells were collected after a total of 18 hours.

HIV-p24 model: 5 to 10 10⁵ PBLs were re-suspended in complete medium supplemented a pool of 15-mer HIV-p24 peptides (encompassing the whole protein sequence) present at a concentration of each 1 μg/ml. After 2 hours, 1 μg/ml Brefeldin-A (BD, Biosciences) was added for 16 hours and cells were collected after a total of 18 hours.

After 2 hours, 1 μg/ml Brefeldin-A (BD, Biosciences) was added for 16 hours and cells were collected after a total of 18 hours.

STEP 2: staining

Directly after stimulation, PBLs are stained. Briefly cells were washed once and then stained with anti-mouse antibodies all purchased at BD, Biosciences; all further steps were performed on ice. The cells were first incubated for 10 min. in 50μl of CD16/32 solution (1/50 f.c, FACS buffer). 50μl of T cell surface marker mix was added (1/100 CD8a perCp, 1/100 CD4 APC Cy7) and the cells were incubated for 20 min. before being washed. Cells were fixed & permeabilised in 200μl of perm/fix solution (BD, Biosciences), washed once in perm/wash buffer (BD,

Biosciences) before being stained at 4°C with anti IFNg-APC, anti-TNFa-PE and anti IL2-FITC either for 2 hours or overnight . Data were analysed using a FACS, 15000 events within the gate of living CD8 are acquired per test. Excel graphs are showing the frequency of antigen- specific cytokine producing T-cells (naϊve cytokine producing T-cells has been substracted). Frequencies are expressed in percentage of cytokine producers within each of the T-cell populations: CD8+ and CD4+ T-cells.

Antigen specific antibody titre: (pooled-sera) analysis of antigen-specific IgG (ELISA).

Serological analysis was assessed 15 days after second injection. Mice (10 per group) were bled by retro-orbital puncture. A. Coating Step (different according to the antigen model):

Plate that are used are 96 well-plates (NUNC, lmmunosorbant plates), their coating is different according to the antigen model:

Ova model: Anti-ova total IgG were measured by ELISA. 96 well-plates were coated with antigen overnight at 4°C (50μl per well of Ova solution 10μg/ml in PBS). VB62590

37

STxBcys model: Anti-STxB-cys total IgG were measured by ELISA. 96 well-plates were coated with antigen overnight at 4°C (1 OOμl per well of STxB-cys solution 2μg/ml in PBS).

LTxBcys model: Anti-LTxB-cys total IgG were measured by ELISA. 96 well-plates were coated with antigen overnight at 4°C (1 OOμl per well of LTxB-cys solution 2μg/ml in PBS). HIV-p24 model : Anti P24 total IgG were measured by Elisa. 96 well-plates were coated with antigen overnight at 4°C (100 μl per well of P24 solution 0.125μg/ml).

B. Saturation step

After overnight antigen-coating, the plates were washed in wash buffer (PBS / 0.1 % Tween 20 (Merck)) and saturated with 100-200μl of saturation buffer (PBS / 0.1% Tween 20 / 1% BSA) for 1 hour at 37°C.

C. Sera dilution

After saturation step, 50-100 μl of diluted mouse serum was added and incubated for 60-90 minutes at 37°C.

D. Revelation step (different according to the antigen model):

• ova model

After three washes, the plates were incubated for another hour at 37°C with 50 μl of biotinylated anti-mouse total IgG (Amersham) diluted 1000 times in saturation buffer. After incubation 96w plates were washed again as described above. A solution of streptavidin peroxydase (Amersham) diluted 1000 times in saturation buffer was added, 50μl per well. The last wash was a 5 steps wash in wash buffer.

Finally, 50μl of TMB (3,3',5,5'-tetramethylbenzidine in an acidic buffer - concentration of H₂O₂ is 0.01 % - BIORAD) per well was added and the plates were kept in the dark at room temperature for 10 minutes

To stop the reaction, 50 μl of H₂SO₄ 0.4N was added per well. The absorbance was read at a wavelength of 450/630 nm by an Elisa plate reader from BIORAD. Results were calculated using the softmax-pro software, VB62590

38 Results

The results presented herein are those following the second immune response and thus demonstrate a clear advantage following the second immunisation of the conjugates in combination with an adjuvant when compared adjuvant or conjugate alone. 7.1 STxB-cys (SGMBS)-P24(LCSPDP)

Figures 4A and 4B clearly show that the conjugate formed using 2 linkers induced not only a CD8 response but also a CD4 response. The frequency of cytokine producing T-cells induced by the adjuvanted STxB-conjugate was shown to be much higher than the one induced by the adjuvanted protein or non-adjuvanted conjugate. Figure 4C shows STxB-conjugate was also shown to be potent at inducing antigen-specific antibody response. Both anti-p24 and anti-STxB antibodies were detectable. Again, antibody titres induced by adjuvanted conjugates of the invention were shown to be much higher than the one induced by the adjuvanted protein or non- adjuvanted conjugate.

7.2 STXB(LCSPDP) - P24(SGMBS)

Figures 5A and 5B clearly show that a different conjugate formed using 2 linkers induced not only a CD8 response but also a CD4 response. The frequency of cytokine producing T-cells induced by the adjuvanted STxB-conjugate was shown to be much higher than the one induced by the adjuvanted protein or non-adjuvanted conjugate. Figure 5C shows STxB-conjugate was also shown to be potent at inducing antigen-specific antibody response. Both anti-p24 and anti- STxB antibodies were detectable. Again, antibody titres induced by adjuvanted conjugates of the invention were shown to be much higher than the one induced by the adjuvanted protein or non-adjuvanted conjugate.

7.3 LTB(SGMBS) - P24(LCSPDP)

Figures 6A and 6B show in the case of this particular LTB-conjugate of the invention, the conjugate did induce CD8 and CD4 responses, but the frequency of cytokine producing T-cells induce by the adjuvanted LTB-conjugate was not shown to be higher than the one induced by the adjuvanted-protein.

The LTB-conjugate of the invention was also shown to be potent at inducing antigen-specific antibody response. Both anti-p24 and anti-LTB antibodies were detectable (Figure 6C). VB62590

39

7.4 STXB(LCSPDP) - OVA (SGMBS)

In an ova model, adjuvanted-protein induced CD8 response in vivo, nevertheless the frequency of cytokine producing T-cells induce by the adjuvanted STxB-conjugate (formed using a double linker) was shown to be higher than the one induced by the adjuvanted-ovalbumin (Figures 7A and 7B). The STxB-conjugate was also shown to be potent at inducing antigen-specific antibody response. Both anti-ova and anti-STxB antibodies were detectable (Figure 7C).

7.5 STxB(LCSPDP)-p24(SGMBS) compared to StxB -cys-p24 (SGMBS)

The conjugates of the invention (designated DL) were compared against conjugates formed using one linker linked to the C-terminal cysteine of StxB-cys (designated DC). Figures 8A and 8B clearly show that whatever the process (DL or DC), the conjugate induced both CD8 and CD4 responses. The frequency of cytokine producing T-cells induce by the two different adjuvanted STxB-conjugates was shown to be much higher than the one induced by the adjuvanted-protein. Both STxB-conjugates (DL and DC) were also shown to be similarly potent at inducing high antigen-specific antibody response. For both conjugates the anti-p24 antibody titre was much higher than the anti-STxB antibody titre (Figure 8C).

VB62590

40

SEQUENCE LISTING

SEQ ID NO 1 - tccatgacgt tcctgacgtt

SEQ ID NO 2 - tctcccagcg tgcgccat

SEQ ID NO 3 - accgatgacg tcgccggtga cggcaccacg SEQ ID NO 4 - tcgtcgtttt gtcgttttgt cgtt

SEQ ID NO 5 - tccatgacgt tcctgatgct

SEQ ID NO 6 - tcgacgtttt cggcgcgcgc eg

SEQ ID NO 7

Thr Pro Asp Cys VaI Thr GIy Lys VaI GIu Tyr Thr Lys Tyr Asn Asp 1 5 10 15

Asp Asp Thr Phe Thr VaI Lys VaI GIy Asp Lys GIu Leu Phe Thr Asn 20 25 30

Arg Trp Asn Leu GIn Ser Leu Leu Leu Ser Ala GIn lie Thr GIy Met 35 40 45

Thr VaI Thr lie Lys Thr Asn Ala Cys His Asn GIy GIy GIy Phe Ser 50 55 60

GIu VaI He Phe Arg 65

SEQ ID NO

Thr Pro Asp Cys VaI Thr GIy Lys VaI GIu Tyr Thr Lys Tyr Asn Asp 1 5 10 15

Asp Asp Thr Phe Thr VaI Lys VaI GIy Asp Lys GIu Leu Phe Thr Asn 20 25 30

Arg Trp Asn Leu GIn Ser Leu Leu Leu Ser Ala GIn He Thr GIy Met 35 40 45

Thr VaI Thr He Lys Thr Asn Ala Cys His Asn GIy GIy GIy Phe Ser 50 55 60

GIu VaI He Phe Arg Cys 65 70 VB62590

41

SEQ I D NO 9

Ala Pro GIn Ser lie Thr GIu Leu Cys Ser GIu Tyr Arg Asn Thr GIn 1 5 10 15

lie Tyr Thr lie Asn Asp Lys lie Leu Ser Tyr Thr GIu Ser Met Ala 20 25 30

GIy Lys Arg GIu Met VaI lie lie Thr Phe Lys Ser GIy Ala Thr Phe 35 40 45

GIn VaI GIu VaI Pro GIy Ser GIn His lie Asp Ser GIn Lys Lys Ala 50 55 60

lie GIu Arg Met Lys Asp Thr Leu Arg lie Thr Tyr Leu Thr GIu Thr 65 70 75 80

Lys lie Asp Lys Leu Cys VaI Trp Asn Asn Lys Thr Pro Asn Ser lie 85 90 95

Ala Ala lie Ser Met GIu Asn 100

SEQ ID NO 10

Thr Pro GIn Asn lie Thr Asp Leu Cys Ala GIu Tyr His Asn Thr GIn 1 5 10 15

lie Tyr Thr Leu Asn Asp Lys lie Phe Ser Tyr Thr GIu Ser Leu Ala 20 25 30

GIy Lys Arg GIu Met Ala lie lie Thr Phe Lys Asn GIy Ala lie Phe 35 40 45

GIn VaI GIu VaI Pro GIy Ser GIn His lie Asp Ser GIn Lys Lys Ala 50 55 60

lie GIu Arg Met Lys Asp Thr Leu Arg lie Ala Tyr Leu Thr GIu Ala 65 70 75 80

Lys VaI GIu Lys Leu Cys VaI Trp Asn Asn Lys Thr Pro His Ala lie 85 90 95 VB62590

42

Ala Ala lie Ser Met Ala Asn

100

SEQ ID NO 11

<210> 11

<211> 1315

<212> PRT

<213> Clostridium tetani

<400> 11

Met Pro lie Thr lie Asn Asn Phe Arg Tyr Ser Asp Pro VaI Asn Asn 1 5 10 15

Asp Thr lie lie Met Met GIu Pro Pro Tyr Cys Lys GIy Leu Asp lie 20 25 30

Tyr Tyr Lys Ala Phe Lys lie Thr Asp Arg lie Trp lie VaI Pro GIu 35 40 45

Arg Tyr GIu Phe GIy Thr Lys Pro GIu Asp Phe Asn Pro Pro Ser Ser 50 55 60

Leu lie GIu GIy Ala Ser GIu Tyr Tyr Asp Pro Asn Tyr Leu Arg Thr 65 70 75 80

Asp Ser Asp Lys Asp Arg Phe Leu GIn Thr Met VaI Lys Leu Phe Asn 85 90 95

Arg lie Lys Asn Asn VaI Ala GIy GIu Ala Leu Leu Asp Lys lie lie 100 105 110

Asn Ala lie Pro Tyr Leu GIy Asn Ser Tyr Ser Leu Leu Asp Lys Phe 115 120 125

Asp Thr Asn Ser Asn Ser VaI Ser Phe Asn Leu Leu GIu GIn Asp Pro 130 135 140

Ser GIy Ala Thr Thr Lys Ser Ala Met Leu Thr Asn Leu lie lie Phe 145 150 155 160

GIy Pro GIy Pro VaI Leu Asn Lys Asn GIu VaI Arg GIy lie VaI Leu 165 170 175 VB62590

43

Arg VaI Asp Asn Lys Asn Tyr Phe Pro Cys Arg Asp GIy Phe GIy Ser 180 185 190

lie Met GIn Met Ala Phe Cys Pro GIu Tyr VaI Pro Thr Phe Asp Asn 195 200 205

VaI lie GIu Asn lie Thr Ser Leu Thr lie GIy Lys Ser Lys Tyr Phe 210 215 220

Gin Asp Pro Ala Leu Leu Leu Met His GIu Leu lie His VaI Leu His 225 230 235 240

GIy Leu Tyr GIy Met GIn VaI Ser Ser His GIu lie lie Pro Ser Lys 245 250 255

GIn GIu He Tyr Met GIn His Thr Tyr Pro He Ser Ala GIu GIu Leu 260 265 270

Phe Thr Phe GIy GIy GIn Asp Ala Asn Leu He Ser He Asp He Lys 275 280 285

Asn Asp Leu Tyr GIu Lys Thr Leu Asn Asp Tyr Lys Ala He Ala Asn 290 295 300

Lys Leu Ser GIn VaI Thr Ser Cys Asn Asp Pro Asn He Asp He Asp 305 310 315 320

Ser Tyr Lys GIn He Tyr GIn GIn Lys Tyr GIn Phe Asp Lys Asp Ser 325 330 335

Asn GIy GIn Tyr He VaI Asn GIu Asp Lys Phe GIn He Leu Tyr Asn 340 345 350

Ser He Met Tyr GIy Phe Thr GIu He GIu Leu GIy Lys Lys Phe Asn 355 360 365

He Lys Thr Arg Leu Ser Tyr Phe Ser Met Asn His Asp Pro VaI Lys 370 375 380

He Pro Asn Leu Leu Asp Asp Thr He Tyr Asn Asp Thr GIu GIy Phe 385 390 395 400 Asn He GIu Ser Lys Asp Leu Lys Ser GIu Tyr Lys GIy GIn Asn Met

405 410 415 VB62590

44

Arg VaI Asn Thr Asn Ala Phe Arg Asn VaI Asp GIy Ser GIy Leu VaI 420 425 430

Ser Lys Leu lie GIy Leu Cys Lys Lys lie lie Pro Pro Thr Asn lie 435 440 445

Arg GIu Asn Leu Tyr Asn Arg Thr Ala Ser Leu Thr Asp Leu GIy GIy 450 455 460

GIu Leu Cys lie Lys lie Lys Asn GIu Asp Leu Thr Phe lie Ala GIu 465 470 475 480

Lys Asn Ser Phe Ser GIu GIu Pro Phe GIn Asp GIu lie VaI Ser Tyr 485 490 495

Asn Thr Lys Asn Lys Pro Leu Asn Phe Asn Tyr Ser Leu Asp Lys lie 500 505 510

lie VaI Asp Tyr Asn Leu GIn Ser Lys lie Thr Leu Pro Asn Asp Arg 515 520 525

Thr Thr Pro VaI Thr Lys GIy lie Pro Tyr Ala Pro GIu Tyr Lys Ser 530 535 540

Asn Ala Ala Ser Thr lie GIu lie His Asn lie Asp Asp Asn Thr lie 545 550 555 560

Tyr GIn Tyr Leu Tyr Ala GIn Lys Ser Pro Thr Thr Leu GIn Arg lie 565 570 575

Thr Met Thr Asn Ser VaI Asp Asp Ala Leu lie Asn Ser Thr Lys lie 580 585 590

Tyr Ser Tyr Phe Pro Ser VaI lie Ser Lys VaI Asn GIn GIy Ala GIn 595 600 605

GIy lie Leu Phe Leu GIn Trp VaI Arg Asp lie lie Asp Asp Phe Thr 610 615 620

Asn GIu Ser Ser GIn Lys Thr Thr lie Asp Lys lie Ser Asp VaI Ser 625 630 635 640

Thr lie VaI Pro Tyr lie GIy Pro Ala Leu Asn lie VaI Lys GIn GIy VB62590

45

645 650 655

Tyr GIu GIy Asn Phe lie GIy Ala Leu GIu Thr Thr GIy VaI VaI Leu 660 665 670

Leu Leu GIu Tyr lie Pro GIu lie Thr Leu Pro VaI lie Ala Ala Leu 675 680 685

Ser lie Ala GIu Ser Ser Thr GIn Lys GIu Lys lie lie Lys Thr lie 690 695 700

Asp Asn Phe Leu GIu Lys Arg Tyr GIu Lys Trp lie GIu VaI Tyr Lys 705 710 715 720

Leu VaI Lys Ala Lys Trp Leu GIy Thr VaI Asn Thr GIn Phe GIn Lys 725 730 735

Arg Ser Tyr GIn Met Tyr Arg Ser Leu GIu Tyr GIn VaI Asp Ala lie 740 745 750

Lys Lys lie lie Asp Tyr GIu Tyr Lys lie Tyr Ser GIy Pro Asp Lys 755 760 765

GIu GIn lie Ala Asp GIu lie Asn Asn Leu Lys Asn Lys Leu GIu GIu 770 775 780

Lys Ala Asn Lys Ala Met lie Asn lie Asn lie Phe Met Arg GIu Ser 785 790 795 800

Ser Arg Ser Phe Leu VaI Asn GIn Met lie Asn GIu Ala Lys Lys GIn 805 810 815

Leu Leu GIu Phe Asp Thr GIn Ser Lys Asn lie Leu Met GIn Tyr lie

820 825 830

Lys Ala Asn Ser Lys Phe lie GIy lie Thr GIu Leu Lys Lys Leu GIu 835 840 845

Ser Lys lie Asn Lys VaI Phe Ser Thr Pro lie Pro Phe Ser Tyr Ser 850 855 860

Lys Asn Leu Asp Cys Trp VaI Asp Asn GIu GIu Asp lie Asp VaI lie 865 870 875 VB62590

46

Leu Lys Lys Ser Thr lie Leu Asn Leu Asp lie Asn Asn Asp lie lie 885 890 895

Ser Asp lie Ser GIy Phe Asn Ser Ser VaI lie Thr Tyr Pro Asp Ala 900 905 910

GIn Leu VaI Pro GIy lie Asn GIy Lys Ala lie His Leu VaI Asn Asn 915 920 925

GIu Ser Ser GIu VaI lie VaI His Lys Ala Met Asp lie GIu Tyr Asn 930 935 940

Asp Met Phe Asn Asn Phe Thr VaI Ser Phe Trp Leu Arg VaI Pro Lys 945 950 955 960

VaI Ser Ala Ser His Leu GIu GIn Tyr GIy Thr Asn GIu Tyr Ser lie 965 970 975

lie Ser Ser Met Lys Lys His Ser Leu Ser lie GIy Ser GIy Trp Ser 980 985 990

VaI Ser Leu Lys GIy Asn Asn Leu lie Trp Thr Leu Lys Asp Ser Ala 995 1000 1005

GIy GIu VaI Arg GIn lie Thr Phe Arg Asp Leu Pro Asp Lys Phe 1010 1015 1020

Asn Ala Tyr Leu Ala Asn Lys Trp VaI Phe lie Thr lie Thr Asn 1025 1030 1035 Asp Arg Leu Ser Ser Ala Asn Leu Tyr lie Asn GIy VaI Leu Met 1040 1045 1050

GIy Ser Ala GIu lie Thr GIy Leu GIy Ala lie Arg GIu Asp Asn 1055 1060 1065

Asn lie Thr Leu Lys Leu Asp Arg Cys Asn Asn Asn Asn GIn Tyr 1070 1075 1080

VaI Ser lie Asp Lys Phe Arg lie Phe Cys Lys Ala Leu Asn Pro 1085 1090 1095

Lys GIu lie GIu Lys Leu Tyr Thr Ser Tyr Leu Ser lie Thr Phe 1100 1105 1110 VB62590

47

Leu Arg Asp Phe Trp GIy Asn Pro Leu Arg Tyr Asp Thr GIu Tyr 1115 1120 1125

Tyr Leu lie Pro VaI Ala Ser Ser Ser Lys Asp VaI GIn Leu Lys 1130 1135 1140

Asn lie Thr Asp Tyr Met Tyr Leu Thr Asn Ala Pro Ser Tyr Thr 1145 1150 1155

Asn GIy Lys Leu Asn lie Tyr Tyr Arg Arg Leu Tyr Asn GIy Leu 1160 1165 1170

Lys Phe lie lie Lys Arg Tyr Thr Pro Asn Asn GIu lie Asp Ser 1175 1180 1185

Phe VaI Lys Ser GIy Asp Phe lie Lys Leu Tyr VaI Ser Tyr Asn 1190 1195 1200

Asn Asn GIu His lie VaI GIy Tyr Pro Lys Asp GIy Asn Ala Phe 1205 1210 1215

Asn Asn Leu Asp Arg lie Leu Arg VaI GIy Tyr Asn Ala Pro GIy 1220 1225 1230

lie Pro Leu Tyr Lys Lys Met GIu Ala VaI Lys Leu Arg Asp Leu 1235 1240 1245

Lys Thr Tyr Ser VaI GIn Leu Lys Leu Tyr Asp Asp Lys Asn Ala 1250 1255 1260

Ser Leu GIy Leu VaI GIy Thr His Asn GIy GIn lie GIy Asn Asp 1265 1270 1275

Pro Asn Arg Asp lie Leu lie Ala Ser Asn Trp Tyr Phe Asn His 1280 1285 1290

Leu Lys Asp Lys lie Leu GIy Cys Asp Trp Tyr Phe VaI Pro Thr 1295 1300 1305

Asp GIu GIy Trp Thr Asn Asp 1310 1315 VB62590

48

SEQ I D NO 12

Met Lys VaI Lys GIu Thr Arg Lys Asn Tyr GIn His Leu Trp Arg Trp 1 5 10 15

GIy Thr Met Leu Leu GIy Met Leu Met lie Cys Ser Ala Ala GIu GIn 20 25 30

Leu Trp VaI Thr VaI Tyr Tyr GIy VaI Pro VaI Trp Lys GIu Ala Thr 35 40 45

Thr Thr Leu Phe Cys Ala Ser Asp Ala Lys Ala Tyr Asp Thr GIu VaI 50 55 60

His Asn VaI Trp Ala Thr His Ala Cys VaI Pro Thr Asp Pro Asn Pro 65 70 75 80

GIn GIu VaI VaI Leu GIy Asn VaI Thr GIu Tyr Phe Asn Met Trp Lys 85 90 95

Asn Asn Met VaI Asp GIn Met His GIu Asp lie lie Ser Leu Trp Asp 100 105 110

GIn Ser Leu Lys Pro Cys VaI Lys Leu Thr Pro Leu Cys VaI Thr Leu 115 120 125

Asp Cys Asp Asp VaI Asn Thr Thr Asn Ser Thr Thr Thr Thr Ser Asn 130 135 140

GIy Trp Thr GIy GIu lie Arg Lys GIy GIu lie Lys Asn Cys Ser Phe 145 150 155 160

Asn lie Thr Thr Ser lie Arg Asp Lys VaI GIn Lys GIu Tyr Ala Leu 165 170 175

Phe Tyr Asn Leu Asp VaI VaI Pro lie Asp Asp Asp Asn Ala Thr Thr 180 185 190

Lys Asn Lys Thr Thr Arg Asn Phe Arg Leu lie His Cys Asn Ser Ser 195 200 205

VaI Met Thr GIn Ala Cys Pro Lys VaI Ser Phe GIu Pro He Pro He 210 215 220 VB62590

49

His Tyr Cys Ala Pro Ala GIy Phe Ala lie Leu Lys Cys Asn Asn Lys 225 230 235 240

Thr Phe Asp GIy Lys GIy Leu Cys Thr Asn VaI Ser Thr VaI GIn Cys 245 250 255

Thr His GIy He Arg Pro VaI VaI Ser Thr GIn Leu Leu Leu Asn GIy 260 265 270

Ser Leu Ala GIu GIu GIu VaI VaI He Arg Ser Asp Asn Phe Met Asp 275 280 285

Asn Thr Lys Thr He He VaI GIn Leu Asn GIu Ser VaI Ala He Asn 290 295 300

Cys Thr Arg Pro Asn Asn Asn Thr Arg Lys GIy He His He GIy Pro 305 310 315 320

GIy Arg Ala Phe Tyr Ala Ala Arg Lys He He GIy Asp He Arg GIn

325 330 335

Ala His Cys Asn Leu Ser Arg Ala GIn Trp Asn Asn Thr Leu Lys GIn 340 345 350

He VaI He Lys Leu Arg GIu His Phe GIy Asn Lys Thr He Lys Phe 355 360 365

Asn GIn Ser Ser GIy GIy Asp Pro GIu He VaI Arg His Ser Phe Asn 370 375 380

Cys GIy GIy GIu Phe Phe Tyr Cys Asp Thr Thr GIn Leu Phe Asn Ser 385 390 395 400

Thr Trp Asn GIy Thr GIu GIy Asn Asn Thr GIu GIy Asn Ser Thr He

405 410 415

Thr Leu Pro Cys Arg He Lys GIn He He Asn Met Trp GIn GIu VaI 420 425 430

GIy Lys Ala Met Tyr Ala Pro Pro He GIy GIy GIn He Arg Cys Ser

435 440 445

Ser Asn He Thr GIy Leu Leu Leu Thr Arg Asp GIy GIy Thr GIu GIy VB62590

50

450 455 460

Asn GIy Thr GIu Asn GIu Thr GIu lie Phe Arg Pro GIy GIy GIy Asp 465 470 475 480

Met Arg Asp Asn Trp Arg Ser GIu Leu Tyr Lys Tyr Lys VaI VaI Lys 485 490 495

VaI GIu Pro Leu GIy VaI Ala Pro Thr Arg Ala Lys Arg Arg VaI VaI 500 505 510

GIn Arg

SEQ ID NO 13

Met VaI lie VaI GIn Asn lie GIn GIy GIn Met VaI His GIn Ala lie 1 5 10 15

Ser Pro Arg Thr Leu Asn Ala Trp VaI Lys VaI VaI GIu GIu Lys Ala 20 25 30

Phe Ser Pro GIu VaI lie Pro Met Phe Ser Ala Leu Ser GIu GIy Ala 35 40 45

Thr Pro GIn Asp Leu Asn Thr Met Leu Asn Thr VaI GIy GIy His GIn 50 55 60

Ala Ala Met GIn Met Leu Lys GIu Thr lie Asn GIu GIu Ala Ala GIu 65 70 75 80

Trp Asp Arg VaI His Pro VaI His Ala GIy Pro He Ala Pro GIy GIn

85 90 95

Met Arg GIu Pro Arg GIy Ser Asp He Ala GIy Thr Thr Ser Thr Leu 100 105 HO

GIn GIu GIn He GIy Trp Met Thr Asn Asn Pro Pro He Pro VaI GIy 115 120 125

GIu He Tyr Lys Arg Trp He He Leu GIy Leu Asn Lys He VaI Arg 130 135 140

Met Tyr Ser Pro Thr Ser He Leu Asp He Arg GIn GIy Pro Lys GIu VB62590

51

145 150 155 160

Pro Phe Arg Asp Tyr VaI Asp Arg Phe Tyr Lys Thr Leu Arg Ala GIu 165 170 175

Gin Ala Ser GIn GIu VaI Lys Asn Trp Met Thr GIu Thr Leu Leu VaI 180 185 190

GIn Asn Ala Asn Pro Asp Cys Lys Thr lie Leu Lys Ala Leu GIy Pro 195 200 205

Ala Ala Thr Leu GIu GIu Met Met Thr Ala Cys GIn GIy VaI GIy GIy 210 215 220

Pro GIy His Lys Ala Arg VaI Leu His Met GIy Pro lie Ser Pro lie 225 230 235 240

GIu Thr VaI Ser VaI Lys Leu Lys Pro GIy Met Asp GIy Pro Lys VaI 245 250 255

Lys GIn Trp Pro Leu Thr GIu GIu Lys lie Lys Ala Leu VaI GIu lie 260 265 270

Cys Thr GIu Met GIu Lys GIu GIy Lys lie Ser Lys lie GIy Pro GIu 275 280 285

Asn Pro Tyr Asn Thr Pro VaI Phe Ala lie Lys Lys Lys Asp Ser Thr 290 295 300

Lys Trp Arg Lys Leu VaI Asp Phe Arg GIu Leu Asn Lys Arg Thr GIn 305 310 315 320

Asp Phe Trp GIu VaI GIn Leu GIy lie Pro His Pro Ala GIy Leu Lys

325 330 335

Lys Lys Lys Ser VaI Thr VaI Leu Asp VaI GIy Asp Ala Tyr Phe Ser 340 345 350

VaI Pro Leu Asp GIu Asp Phe Arg Lys Tyr Thr Ala Phe Thr lie Pro 355 360 365

Ser lie Asn Asn GIu Thr Pro GIy lie Arg Tyr GIn Tyr Asn VaI Leu 370 375 380 VB62590

52

Pro GIn GIy Trp Lys GIy Ser Pro Ala lie Phe GIn Ser Cys Met Thr 385 390 395 400

Lys lie Leu GIu Pro Phe Arg Lys GIn Asn Pro Asp lie VaI lie Tyr 405 410 415

GIn Tyr Met Asp Asp Leu Tyr VaI GIy Ser Asp Leu GIu lie GIy GIn 420 425 430

His Arg Thr Lys lie GIu GIu Leu Arg GIn His Leu Leu Arg Trp GIy 435 440 445

Leu Thr Thr Pro Asp Lys Lys His GIn Lys GIu Pro Pro Phe Leu Lys 450 455 460

Met GIy Tyr GIu Leu His Pro Asp Lys Trp Thr VaI GIn Pro lie VaI 465 470 475 480

Leu Pro GIu Lys Asp Ser Trp Thr VaI Asn Asp lie GIn Lys Leu VaI

485 490 495

GIy Lys Leu Asn Trp Ala Ser GIn lie Tyr Pro GIy lie Lys VaI Arg 500 505 510

GIn Leu Cys Lys Leu Leu Arg GIy Thr Lys Ala Leu Thr GIu VaI lie 515 520 525

Pro Leu Thr GIu GIu Ala GIu Leu GIu Leu Ala GIu Asn Arg GIu lie 530 535 540 Leu Lys GIu Pro VaI His GIy VaI Tyr Tyr Asp Pro Ser Lys Asp Leu 545 550 555 560

He Ala GIu He GIn Lys GIn GIy GIn GIy GIn Trp Thr Tyr GIn He 565 570 575

Tyr GIn GIu Pro Phe Lys Asn Leu Lys Thr GIy Lys Tyr Ala Arg Met

580 585 590

Arg GIy Ala His Thr Asn Asp VaI Lys GIn Leu Thr GIu Ala VaI GIn 595 600 605

Lys He Thr Thr GIu Ser He VaI He Trp GIy Lys Thr Pro Lys Phe 610 615 620 VB62590

53

Lys Leu Pro lie GIn Lys GIu Thr Trp GIu Thr Trp Trp Thr GIu Tyr 625 630 635 640

Trp GIn Ala Thr Trp lie Pro GIu Trp GIu Phe VaI Asn Thr Pro Pro 645 650 655

Leu VaI Lys Leu Trp Tyr GIn Leu GIu Lys GIu Pro lie VaI GIy Ala 660 665 670

GIu Thr Phe Tyr VaI Asp GIy Ala Ala Asn Arg GIu Thr Lys Leu GIy 675 680 685

Lys Ala GIy Tyr VaI Thr Asn Arg GIy Arg GIn Lys VaI VaI Thr Leu 690 695 700

Thr Asp Thr Thr Asn GIn Lys Thr GIu Leu GIn Ala lie Tyr Leu Ala 705 710 715 720

Leu GIn Asp Ser GIy Leu GIu VaI Asn lie VaI Thr Asp Ser GIn Tyr 725 730 735

Ala Leu GIy lie lie GIn Ala GIn Pro Asp GIn Ser GIu Ser GIu Leu 740 745 750

VaI Asn GIn lie lie GIu GIn Leu lie Lys Lys GIu Lys VaI Tyr Leu 755 760 765

Ala Trp VaI Pro Ala His Lys GIy lie GIy GIy Asn GIu GIn VaI Asp 770 775 780

Lys Leu VaI Ser Ala GIy lie Arg Lys VaI Leu Ala Met GIy GIy Lys 785 790 795 800

Trp Ser Lys Ser Ser VaI VaI GIy Trp Pro Thr VaI Arg GIu Arg Met 805 810 815

Arg Arg Ala GIu Pro Ala Ala Asp GIy VaI GIy Ala Ala Ser Arg Asp 820 825 830

Leu GIu Lys His GIy Ala lie Thr Ser Ser Asn Thr Ala Ala Thr Asn 835 840 845 VB62590

54

Ala Ala Cys Ala Trp Leu GIu Ala GIn GIu GIu GIu GIu VaI GIy Phe 850 855 860

Pro VaI Thr Pro GIn VaI Pro Leu Arg Pro Met Thr Tyr Lys Ala Ala 865 870 875 880

VaI Asp Leu Ser His Phe Leu Lys GIu Lys GIy GIy Leu GIu GIy Leu 885 890 895

lie His Ser GIn Arg Arg GIn Asp lie Leu Asp Leu Trp lie Tyr His 900 905 910

Thr GIn GIy Tyr Phe Pro Asp Trp GIn Asn Tyr Thr Pro GIy Pro GIy 915 920 925

VaI Arg Tyr Pro Leu Thr Phe GIy Trp Cys Tyr Lys Leu VaI Pro VaI 930 935 940

GIu Pro Asp Lys VaI GIu GIu Ala Asn Lys GIy GIu Asn Thr Ser Leu 945 950 955 960

Leu His Pro VaI Ser Leu His GIy Met Asp Asp Pro GIu Arg GIu VaI 965 970 975

Leu GIu Trp Arg Phe Asp Ser Arg Leu Ala Phe His His VaI Ala Arg 980 985 990

GIu Leu His Pro GIu Tyr Phe Lys Asn Cys Arg Pro Met GIy Ala Arg 995 1000 1005

Ala Ser VaI Leu Ser GIy GIy GIu Leu Asp Arg Trp GIu Lys lie 1010 1015 1020

Arg Leu Arg Pro GIy GIy Lys Lys Lys Tyr Lys Leu Lys His lie 1025 1030 1035

VaI Trp Ala Ser Arg GIu Leu GIu Arg Phe Ala VaI Asn Pro GIy 1040 1045 1050

Leu Leu GIu Thr Ser GIu GIy Cys Arg GIn lie Leu GIy GIn Leu 1055 1060 1065

GIn Pro Ser Leu GIn Thr GIy Ser GIu GIu Leu Arg Ser Leu Tyr 1070 1075 1080 VB62590

55

Asn Thr VaI Ala Thr Leu Tyr Cys VaI His GIn Arg He GIu He 1085 1090 1095

Lys Asp Thr Lys GIu Ala Leu Asp Lys He GIu GIu GIu GIn Asn 1100 1105 1110

Lys Ser Lys Lys Lys Ala GIn GIn Ala Ala Ala Asp Thr GIy His 1115 1120 1125

Ser Asn GIn VaI Ser GIn Asn Tyr 1130 1135

SEQ ID NO 14

Met Pro He VaI GIn Asn He GIn GIy GIn Met VaI His GIn Ala He 1 5 10 15

Ser Pro Arg Thr Leu Asn Ala Trp VaI Lys VaI VaI GIu GIu Lys Ala 20 25 30

Phe Ser Pro GIu VaI He Pro Met Phe Ser Ala Leu Ser GIu GIy Ala 35 40 45

Thr Pro GIn Asp Leu Asn Thr Met Leu Asn Thr VaI GIy GIy His GIn 50 55 60

Ala Ala Met GIn Met Leu Lys GIu Thr He Asn GIu GIu Ala Ala GIu 65 70 75 80

Trp Asp Arg VaI His Pro VaI His Ala GIy Pro He Ala Pro GIy GIn

85 90 95 VB62590

56

Met Arg GIu Pro Arg GIy Ser Asp lie Ala GIy Thr Thr Ser Thr Leu 100 105 110

GIn GIu GIn lie GIy Trp Met Thr Asn Asn Pro Pro lie Pro VaI GIy 115 120 125

GIu lie Tyr Lys Arg Trp lie lie Leu GIy Leu Asn Lys lie VaI Arg 130 135 140

Met Tyr Ser Pro Thr Ser lie Leu Asp lie Arg GIn GIy Pro Lys GIu 145 150 155 160

Pro Phe Arg Asp Tyr VaI Asp Arg Phe Tyr Lys Thr Leu Arg Ala GIu 165 170 175

GIn Ala Ser GIn GIu VaI Lys Asn Trp Met Thr GIu Thr Leu Leu VaI 180 185 190

GIn Asn Ala Asn Pro Asp Cys Lys Thr lie Leu Lys Ala Leu GIy Pro 195 200 205

Ala Ala Thr Leu GIu GIu Met Met Thr Ala Cys GIn GIy VaI GIy GIy 210 215 220

Pro GIy His Lys Ala Arg VaI Leu 225 230

SEQ ID NO 15

Met GIy Ser lie GIy Ala Ala Ser Met GIu Phe Cys Phe Asp VaI Phe 1 5 10 15 VB62590

57

Lys GIu Leu Lys VaI His His Ala Asn GIu Asn lie Phe Tyr Cys Pro 20 25 30

lie Ala lie Met Ser Ala Leu Ala Met VaI Tyr Leu GIy Ala Lys Asp 35 40 45

Ser Thr Arg Thr GIn lie Asn Lys VaI VaI Arg Phe Asp Lys Leu Pro 50 55 60

GIy Phe GIy Asp Ser He GIu Ala GIn Cys GIy Thr Ser VaI Asn VaI 65 70 75 80

His Ser Ser Leu Arg Asp He Leu Asn GIn He Thr Lys Pro Asn Asp 85 90 95

VaI Tyr Ser Phe Ser Leu Ala Ser Arg Leu Tyr Ala GIu GIu Arg Tyr 100 105 HO

Pro He Leu Pro GIu Tyr Leu GIn Cys VaI Lys GIu Leu Tyr Arg GIy 115 120 125

GIy Leu GIu Pro He Asn Phe GIn Thr Ala Ala Asp GIn Ala Arg GIu 130 135 140

Leu He Asn Ser Trp VaI GIu Ser GIn Thr Asn GIy He He Arg Asn 145 150 155 160

VaI Leu GIn Pro Ser Ser VaI Asp Ser GIn Thr Ala Met VaI Leu VaI 165 170 175

Asn Ala He VaI Phe Lys GIy Leu Trp GIu Lys Thr Phe Lys Asp GIu 180 185 190

Asp Thr GIn Ala Met Pro Phe Arg VaI Thr GIu GIn GIu Ser Lys Pro 195 200 205 VaI GIn Met Met Tyr GIn He GIy Leu Phe Arg VaI Ala Ser Met Ala 210 215 220

Ser GIu Lys Met Lys He Leu GIu Leu Pro Phe Ala Ser GIy Thr Met 225 230 235 240 VB62590

58

Ser Met Leu VaI Leu Leu Pro Asp GIu VaI Ser GIy Leu GIu GIn Leu 245 250 255

GIu Ser lie lie Asn Phe GIu Lys Leu Thr GIu Trp Thr Ser Ser Asn 260 265 270

VaI Met GIu GIu Arg Lys lie Lys VaI Tyr Leu Pro Arg Met Lys Met 275 280 285

GIu GIu Lys Tyr Asn Leu Thr Ser VaI Leu Met Ala Met GIy lie Thr 290 295 300

Asp VaI Phe Ser Ser Ser Ala Asn Leu Ser GIy lie Ser Ser Ala GIu 305 310 315 320

Ser Leu Lys lie Ser GIn Ala VaI His Ala Ala His Ala GIu lie Asn 325 330 335

GIu Ala GIy Arg GIu VaI VaI GIy Ser Ala GIu Ala GIy VaI Asp Ala 340 345 350

Ala Ser VaI Ser GIu GIu Phe Arg Ala Asp His Pro Phe Leu Phe Cys 355 360 365 lie Lys His lie Ala Thr Asn Ala VaI Leu Phe Phe GIy Arg Cys VaI 370 375 380

Ser Pro 385

SEQ ID NO 16

Ala Pro GIn Ser lie Thr GIu Leu Cys Ser GIu Tyr Arg Asn Thr GIn 1 5 10 15

lie Tyr Thr lie Asn Asp Lys lie Leu Ser Tyr Thr GIu Ser Met Ala 20 25 30

GIy Lys Arg GIu Met VaI He He Thr Phe Lys Ser GIy Ala Thr Phe 35 40 45

GIn VaI GIu VaI Pro GIy Ser GIn His He Asp Ser GIn Lys Lys Ala 50 55 60 VB62590

59 lie GIu Arg Met Lys Asp Thr Leu Arg lie Thr Tyr Leu Thr GIu Thr 65 70 75 80

Lys lie Asp Lys Leu Cys VaI Trp Asn Asn Lys Thr Pro Asn Ser lie

85 90 95

Ala Ala lie Ser Met GIu Asn Cys 100

SEQ ID NO 17 - caccatgaat aaagtaaaat gttatgtttt at SEQ ID NO 18 - gcactagagc ttagcagttt tccatactga ttgccgca

Claims

VB6259060 CLAIMS

1. A process for the preparation of a conjugate comprising a first protein and a second protein, the process comprising a. reacting free primary amino groups of the first protein with a first bifunctional linker comprising functional groups A1 and A2 to form a first protein-linker moiety, wherein: the functional group A1 is adapted to react with a primary amino moiety on the first protein; and functional group A2 is either chosen such that it does not react with a primary amino moiety or is protected to prevent reaction with a primary amino moiety;

b. reacting free primary amino or sulfhydryl groups of the second protein with a second bifunctional linker comprising functional groups B1 and B2 to form a second protein-linker moiety, wherein: the functional group B1 is adapted to react with a primary amino or a sulfhydryl moiety on the second protein; the functional group B2 is either chosen such that it does not react with a primary amino or sulfhydryl moiety or is protected to prevent reaction with a primary amino or sulfhydryl moiety;

c. optionally deprotecting either or both of functional groups A2 and B2;

d. reacting the first and the second protein-linker moieties to form a conjugate; wherein the reaction may comprise either reacting the first protein-linker moiety directly with the second protein-linker moiety through A2 and B2, respectively or reacting both the first protein-linker moiety and the second moiety with an additional linker group linking A2 and B2.

2. A process as claimed in claim 1 , wherein the first protein either has no free cysteine residues or free cysteine residues which are poorly accessible.

3. A process as claimed in claim 1 or claim 2 wherein the first and second protein-linker moieties react directly together to form a conjugate of the form: VB62590

61 Protein 1-linker-linker-Protein 2.

4. A process as claimed in claim 3, wherein the functional group B2 is chosen such that it can be reacted with functional group A2 to form a conjugate of the first and second protein- linker moieties.

5. A process as claimed in claim 1 or claim 2 wherein the first and second protein-linker moieties are reacted with a third linker moiety to form a conjugate of the form:

Protein 1-linker-linker-linker-Protein 2.

6. A process as claimed in claim 5, wherein the third linker group has functional groups C1 and C2, wherein the functional group C1 is adapted to react with the functional group A2 of the first protein-linker moiety and the functional group C2 is adapted to react with the functional group B2 of the second protein-linker moiety.

7. A process as claimed in any one of claims 1 to 6, wherein the first and second proteins are carrier proteins, targeting proteins or proteins having pharmacological activity, for example antigens or natural or synthetic hormones or other pharmaceutically active proteins.

8. A process as claimed in claim 7, wherein the first protein is a carrier, targeting or receptor binding protein in which free cysteine residues either do not exist or else are poorly accessible.

9. A process as claimed in claim 8 wherein the first protein is an antibody or a non-live vaccine vector.

10. A process as claimed in claim 10, wherein the non-live vaccine vector is a bacterial subunit.

11. A process as claimed in claim 10, wherein the bacterial toxin subunit is the B subunit of Shiga toxin (StxB), the B subunit of E. coli heat labile enterotoxin (LTB), cholera toxin B (CTB) or functional equivalents thereof. VB62590

62

12. A process as claimed in any one of claims 8 to 11 , wherein the second protein is a pharmacologically active protein, peptide, glycoprotein or glycopeptide.

13. A process as claimed in claim 12, wherein the second protein is selected from antigens derived from HIV-1 , human herpes viruses, cytomegalovirus Rotaviral antigen, Epstein Barr virus, Varicella Zoster Virus, a hepatitis virus or from other viral pathogens, such as paramyxoviruses: Respiratory Syncytial virus, parainfluenza virus, measles virus, mumps virus, human papilloma viruses, flaviviruses or Influenza virus, purified or recombinant proteins thereof, such as HA, NP, NA, or M proteins, or combinations thereof; or derived from bacterial pathogens such as Neisseria spp, including N. gonorrhea and N. meningitides, S. pyogenes, S. agalactiae, S. mutans; H. ducreyi; Moraxella spp, including M catarrhalis, also known as Branhamella catarrhalis; Bordetella spp, including B. pertussis, B. parapertussis and B. bronchiseptica; Mycobacterium spp., including M. tuberculosis, M. bovis, M. leprae, M. avium, M. paratuberculosis, M. smegmatis; Legionella spp, including L. pneumophila; Escherichia spp, including enterotoxic E. coli, Shigella spp, including S. sonnei, S. dysenteriae, S. flexnerii; Yersinia spp, including Y. enterocolitica (for example a Yop protein) , Y. pestis, Y. pseudotuberculosis; Campylobacter spp, including C. jejuni and C. coli; Salmonella spp, including S. typhi, S. paratyphi, S. choleraesuis, S. enteritidis; Listeria spp., including L. monocytogenes; Helicobacter spp, including H. pylori, Pseudomonas spp, including P. aeruginosa; Staphylococcus spp., including S. aureus, S. epidermidis; Enterococcus spp., including E. faecalis, E. faecium; Clostridium spp., including C. tetani, C, C. difficile; Bacillus spp., including B. anthracis; Corynebacterium spp., including C. diphtheriae; Borrelia spp., including B. burgdorferi (for example OspA, OspC, DbpA, DbpB), B. garinii; B. afzelii; B. andersonii; B. hermsii; Ehrlichia spp., including E. equi and the agent of the Human Granulocytic Ehrlichiosis; Rickettsia spp, including R. rickettsii; Chlamydia spp., including C. trachomatis; C. pneumoniae; C. psittaci; Leptospira spp., including L. interrogans; Treponema spp., including T. pallidum; T. denticola, T. hyodysenteriae; or derived from parasites such as Plasmodium spp., including P. falciparum; Toxoplasma spp., including T. gondii (for example SAG2, SAG3, Tg34); Entamoeba spp., including E. histolytica; Babesia spp., including B. microti; Trypanosoma spp., including T. cruzi; Giardia spp., including G. lamblia; Leshmania spp., including L. major; Pneumocystis spp., including P. carinii; Trichomonas spp., including T. vaginalis; Schisostoma spp., including S. mansoni, or derived from yeast such as Candida spp., including C. albicans; Cryptococcus spp., including C. neoformans. VB62590

63

14. A process as claimed in any one of claims 1 to 13, wherein functional groups A1 and/or B1 react with primary amino groups and are selected from N-hydroxy succinimide (NHS) esters and sulfo-NHS esters.

15. A process as claimed in any one of claims 1 to 14, wherein the functional group B1 is a maleimide group.

16. A process as claimed in claim 4 or in any one of claims 7 to 15 when dependent on claim 3 or claim 4, wherein one of A2 and B2 is a maleimide group and the other of A2 and B2 is optionally a protected sulfhydryl group.

17. A process as claimed in claim 16 wherein the first bifunctional linker comprises a group A1 , which is a NHS ester or a sulfo-NHS ester, and a group A2, which is a maleimide group; and the second bifunctional linker comprises a group B1 , which is a NHS ester or a sulfo-NHS ester, and a group B2, which is a protected sulfhydryl group.

18. A process as claimed in claim 16 wherein the first bifunctional linker comprises a group A1 , which is a NHS ester or a sulfo-NHS ester, and a group A2, which is a protected sulfhydryl group; and the second bifunctional linker comprises a group B1 , which is a NHS ester or a sulfo- NHS ester, and a group B2, which is a maleimide group.

19. A process as claimed in claim 6 or any one of claims 7 to 15 when dependent on claim 5 or claim 6, wherein one of the groups A2 and C1 is a maleimide group, while the other of A2 and C1 is an optionally protected sulfhydryl group; and/or one of the groups B2 and C2 is a maleimide group, while the other of B2 and C2 is an optionally protected sulfhydryl group.

20. A process as claimed in claim 19, wherein the groups A2 and B2 are both protected sulfhydryl groups, and the third linker is a bis maleimide moiety so that both C1 and C2 are maleimide groups.

21. A process as claimed in any one of claims 1 to 20 wherein the first, second and/or third linker comprises an NHS ester or a sulfo-NHS ester and a maleimide group and is selected from N-(α-maleimidoacetoxy) succinimide ester (AMAS), m-maleimidobutyryloxy succinimide ester VB62590

64

(GMBS), N-(ε-maleimidocaproyloxy) succinimide ester (EMCS), m-maleimidobenzoyl-N- hydroxysuccinimidyl ester (MBS), succinimidyl-4-(N-maleimidomethyl) cyclohexane-1- carboxylate (SMCC), succinimidyl-4-(p-maleimidophenyl)-butyrate (SMPB), succinimidyl-6-(β- maleimidopropionamido)hexanoate (SMPH), sulfo-AMAS, sulfo-GMBS, sulfo-EMCS, sulfo- MBS, sulfo-SMCC, sulfo-SMPB and sulfo-SMPH.

22. A process as claimed in any one of claims 1 to 21 wherein the first, second or third linker comprises an NHS ester or a sulfo-NHS ester and a pyridylthio (protected SH) group and is selected from N-succinimidyl-3-(2-pyridylthio)propionate (SPDP), N-succinimidyl-6-(3'-(2- pyridyldithio) propionamido)-hexanoate (LC-SPDP), 4-succinimdyloxycarbonyl-methyl-α-[2- pyridyldithio]-toluene (SMPT), sulfo-SPDP, sulfo-LC-SPDP and sulfo-SMPT.

23. A process as claimed in any one of claims 1 to 22, wherein the second or the third linker comprises two maleimide functional groups and is selected from 1 ,2-bismaleimidoethane (BMOE), 1 ,4-bis-maleimidobutane (BMB), 1 ,4-bismaleimidyl-2,3-dihydroxybutane (BMDB), bis- maleimidohexane (BMH), bis-maleimide (PEO)₂ (BM(PEO)₂) and bis-maleimide (PEO)₃ (BM(PEO)₃), where PEO is a polyethyloxy spacer group and is well known to those of skill in the art.

24. A process as claimed in any one of claims 1 to 23, further including attaching one or more additional proteins.

25. A protein conjugate obtainable by a method as claimed in any one of claims 1 to 24.

26. A protein conjugate comprising a first protein linked via amino groups to a first linker and a second protein linked via amino or sulfhydryl groups to a second linker, wherein the first and second linker are covalently joined.

27. A protein conjugate as claimed in claim 26, wherein the first and second protein-linker moieties react directly together to form a conjugate of the form:

Protein 1-linker-linker-Protein 2.

28. A protein conjugate as claimed in claim 26 wherein the first and second protein-linker VB62590

65 moieties are reacted with a third linker moiety to form a conjugate of the form:

Protein 1-linker-linker-linker-Protein 2.

29. A protein conjugate as claimed in any one of claims 26 to 28, wherein the first protein is the B subunit of Shiga toxin (StxB), the B subunit of E. coli heat labile enterotoxin (LTB), tetanus toxoid (TT) or a functional equivalent of any of these.

30. A protein conjugate as claimed in claim 29, wherein the second protein is an antigen selected from those listed in claim 13.

31. An immunogenic composition comprising a protein conjugate as claimed in any one of claims 25 to 30, in which the first protein is StxB, LTC or CTB, together with a pharmaceutically acceptable carrier.

32. A vaccine composition comprising a protein conjugate as claimed in any one of claims 25 to 30, in which the first protein is StxB, LTC or CTB, together with a pharmaceutically acceptable carrier.

33. An immunogenic composition as claimed in claim 31 or a vaccine composition as claimed in claim 32, further comprising an adjuvant.

34. An immunogenic or vaccine composition according to claim 33 wherein the adjuvant is selected from saponin, lipid A or a derivative thereof, an immunostimulatory oligonucleotide, an alkyl glucosaminide phosphate, and combinations thereof.