WO2009070746A2

WO2009070746A2 - Polymorphism in the human p22phox gene

Info

Publication number: WO2009070746A2
Application number: PCT/US2008/084997
Authority: WO
Inventors: Hernan E. Grenett; Nelida C. Olave; Paul E. Wolkowicz
Original assignee: The Uab Research Foundation
Priority date: 2007-11-26
Filing date: 2008-11-26
Publication date: 2009-06-04
Also published as: WO2009070746A3

Abstract

The present disclosure identifies a new polymorphism in the human p22phox gene promoter. The newly described polymorphism may be useful in methods of diagnosis of a disease and/or condition caused by and/or associated with the p22phox gene, increased lev-els of NADPH oxidase activity or increased production of one or more ROS. In addition, the newly described polymorphism may be useful in determining the susceptibility of a sub-ject to a disease and/or condition caused by and/or associated with the p22phox gene, in-creased levels of NADPH oxidase activity or increased production of one or more ROS.

Description

POLYMORPHISM IN THE HUMAN P22PHOX GENE

Inventors: Hernan E. Grenett, Nelida C. Olave and Paul E. Wolowicz

This application claims the benefit of US Provisional Patent Application No. 60/990,261, filed 11-26-2007.

STATEMENT REGARDING FEDERAL FUNDING

This work was funded in part by NIH grant PPG PO HL706010. The Federal Government has certain rights in the inventions disclosed herein. FIELD OF THE DISCLOSURE The present disclosure relates generally to polymorphic variants and methods of utilizing the same. The present disclosure relates specifically to polymorphic variants of the human p22phox gene and methods of utilizing the same. Methods of treatment for various disease states involving p22phox gene expression are also disclosed. BACKGROUND Reactive oxygen species (ROS) play an important role as signaling molecules in a number of cellular systems, including, but not limited to, vasculature cells (Yokoyama, et al., Ann. N. Y. Acad. Sci., 902:241-247, 2000; Rueckschloss, et al., Antioxid. Redox. Signal., 5:171-180, 2003; Dimova, et al., Antioxid. Redox. Signal., 6:777-791, 2004)). NADPH oxidase has been implicated in the production of ROS in a number of cellular systems. ROS encompass many oxygen species including singlet oxygen, superoxide anion (O₂ ^"), hydrogen peroxide (H₂O₂), and hydroxyl radicals (OH^") (Lander, H.M., FASEB J., 11 :118-124, 1997). Increased vascular ROS production, especially the superoxide anion, contributes significantly to the functional and structural alterations present in hypertension. Enhanced production of ROS, especially superoxide anion, decreases nitric oxide (NO) availability, which leads to impaired endothelial function by decreasing endothelium-dependent vasodilatation. Therefore, diminished NO availability can result from a decrease in NO synthase activity or from an increase in the oxidative inactivation of NO by ROS.

A plasma membrane-associated NADPH oxidase is present in a variety of cell types, including, but not limited to, endothelial cells (ECs), vascular smooth muscle cells (VSMCs) and fibroblasts, and is postulated to be an important source of ROS in the vasculature and contributes significantly to O₂ ^" in the vessel wall (Azumi, et al., Circulation, 100:1494-1498, 1999; Napoli et al., J. Cell. Biochem., 82:674-682, 2001). NADPH oxidase consists of two membrane-bound subunits p22phox and gp91phox and two cytosolic subunits p47phox and p67phox. p22-phox has been reported to be a critical component of the superoxide- generating vascular NADH/NADPH oxidase and superoxide anion formation that occurs in phagocytic cells, such as neutrophils, macrophages, and monocytes, and is important for the microbicidal activity of these cells. However, the production of superoxide anion is not Hm- ited to these cell types, and has been implicated in the pathogenesis of both hypertension, atherosclerosis and diabetes (Zalba et al., Antioxid Redox Signal., 7:1327-1336, 2005).

Enhanced vascular NADPH oxidase activity is associated with up-regulation of p22phox mRNA in several models of hypertension, including the spontaneously hypertensive rat (SHR) (Xu, et al., Hypertens. Res., 27:675-683, 2004). Moreover, increased ROS generation associates with augmented vascular NADPH oxidase activity in VSMCs isolated from the peripheral arteries of patients with hypertension (Zalba et al., Antioxid Redox Signal, 7:1327-1336, 2005).

Increased levels of p22phox have been identified in the vascular wall after balloon angioplasty, as well as in atherosclerosis, diabetes, hypertension, and have been associated with elevated ROS levels (Fortuno, et al., Exp. Physiol., 90:457-462, 2005). This suggests that increased levels of p22phox may be important in mediating increased NADPH oxidase activity and may contribute significantly to the process of vascular remodeling associated with pulmonary arterial hypertension (PAH) and other diseases. However, the mechanisms regulating the levels of p22phox expression in any of these conditions are not well under- stood.

The knowledge of the molecular defects causing inherited diseases, as well as the predisposition of a subject to genetic disorders, is rapidly increasing. Polymorphisms, which are defined as a change in only one or a few nucleotides in the nucleotide sequence of a gene, have been found to be associated with and/or to cause several types of hereditary ge- netic diseases. The increased understanding of the exact nature of the genetic defects associated with and/or causing such hereditary genetic diseases create a mechanism for the convenient diagnosis, prevention and/or treatment of such diseases.

The present disclosure identifies a new polymorphism in the human p22phox gene promoter. The newly described polymorphism is useful in determining the susceptibility of a subject to a disease or condition caused by and/or associated with increased expression of the p22phox gene, increased levels of NADPH oxidase activity or increased production of one or more ROS. Furthermore, the described polymorphism is useful in monitoring the sensitivity of a subject to therapeutic intervention and/or monitoring the progression of a disease or condition in a subject caused by and/or associated with increased expression of the p22phox gene, increased levels of NADPH oxidase activity or increased production of one or more ROS. In addition, the newly described polymorphism is useful in methods of diagnosis, including early diagnosis, of subjects who are suffering from or at risk for a disease state or condition caused by and/or associated with increased expression of the p22phox gene, increased levels of NADPH oxidase activity or increased production of one or more ROS. Still further, the described polymorphism is useful in determining a genotype of a subject with respect to the p22phox gene at position -536. Such information may be useful in determining the response of a subject to therapeutic intervention for treatment of a disease state or condition caused by and/or associated with increased expression of the p22phox gene, increased levels of NADPH oxidase activity or increased production of one or more ROS.

Furthermore, the present disclosure provides methods of treatment and prevention of diseases and conditions caused by and/or associated with increased expression of the p22phox gene, increased levels of NADPH oxidase activity or increased production of one or more ROS.

Exemplary diseases or conditions include, but are not limited to, hypertension, atherosclerosis, heart failure and/or diabetes. Forms of hypertension include, but are not limited to, severe hypertension, PAH, ET-I -dependent hypertension, salt-sensitive hypertensives, low renin hypertension and hypertension assocaited with obseity, insulin resistance and diabetes. Methods of detecting the newly described polymorphism, nucleic acid molecules useful in such methods and kits for the carrying out of such methods are disclosed.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. IA shows the wild-type sequence of the Tp22phox gene (SEQ ID NO. 2). FIG. IB shows the site of the Tp22phox SNP (position -536 in the 5' non-coding promoter region of the p22phox gene) and the nucleotide sequence 5' and 3' of the polymorphic loci (SEQ ID NO. 1).

FIG. 1C shows the sequence of one embodiment of a primer pair used to amplify a target polynucleotide sequence containing the Tp22phox SNP. The forward primer is designated SEQ ID NO. 3; the reverse primer is designated SEQ ID NO. 4.

FIG. ID shows an exemplary restriction fragment pattern generated by NIa III RFLP analysis using a target polynucleotide sequence generated using the primer pair of FIG. 1C; the Tp22phox SNP generates an additional NIa III restriction site (indicated by a double asterisk) that is not present in the wild-type p22phox gene. The C/C designation indicates a sub- ject homozygous for the C nucleotide at position -536 (i.e., lacking the Tp22phox SNP at both alleles); the T/T designation indicates a subject homozygous for the T nucleotide at position -536 (i.e., having the Tp22phox mutation in both alleles); and the C/T designation indicates a subject heterozygous for the T nucleotide at position -536 (i.e., having the Tp22phox SNP at one of the two alleles).

FIG. 2 shows an exemplary agarose gel showing the results of a RFLP analysis on a target polynucleotide sequence generated using the primer pair of FIG. 1C. Lane 1 is the molecular weight ladder; lanes 2-4 are C/C samples and generate restriction fragments of 173 and 46 base pairs; lanes 5-7 are C/T samples and generate restriction fragments of 173, 116, 57 and 46 base pairs; lanes 8-10 are T/T samples and generate restriction fragments of 116, 57 and 46 base pairs. FIGS. 3A and 3B show representative agarose gels showing the result of a RFLP analysis on a target polynucleotide sequence generated using the primer pair of FIG. 1C. Lane 1 of each gel is a molecular weight ladder; lanes 2-10 are as indicated; lengths of the restriction fragments generated are as described in FIG. 2. DETAILED DESCRIPTION Definitions

The terms "prevention", "prevent", "preventing", "suppression", "suppress" and "suppressing" as used herein refer to a course of action (such as administering a compound or pharmaceutical composition) initiated prior to the onset of a symptom, aspect, or charac- teristics of a disease or condition so as to prevent or reduce such symptom, aspect, or characteristics. Such preventing and suppressing need not be absolute to be useful.

The terms "treatment", "treat" and "treating" as used herein refers a course of action (such as administering a compound or pharmaceutical composition) initiated after the onset of a symptom, aspect, or characteristics of a disease or condition so as to eliminate or reduce such symptom, aspect, or characteristics. Such treating need not be absolute to be useful.

The term "in need of treatment" as used herein refers to a judgment made by a caregiver that a patient requires or will benefit from treatment. This judgment is made based on a variety of factors that are in the realm of a caregiver's expertise, but that includes the knowledge that the patient is ill, or will be ill, as the result of a disease or condition that is treatable by a method or compound of the disclosure.

The term "in need of prevention" as used herein refers to a judgment made by a caregiver that a patient requires or will benefit from prevention. This judgment is made based on a variety of factors that are in the realm of a caregiver's expertise, but that includes the knowledge that the patient will be ill or may become ill, as the result of a disease or condition that is preventable by a method or compound of the disclosure.

The term "individual", "subject" or "patient" as used herein refers to any animal, including mammals, such as mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or primates, and humans. The term may specify male or female or both, or exclude male or female.

The term "therapeutically effective amount" as used herein refers to an amount of a compound, either alone or as a part of a pharmaceutical composition, that is capable of having any detectable, positive effect on any symptom, aspect, or characteristics of a disease or condition. Such effect need not be absolute to be beneficial.

The term "pharmaceutically acceptable derivative" means any pharmaceutically acceptable salt, ester, salt of an ester, solvate or other derivative of a macrolide antibiotic of the present disclosure that, upon administration to a recipient, is capable of providing (directly or indirectly) a macrolide antibiotic of the disclosure or a metabolite or residue thereof. Par- ticularly favored derivatives are those that increase the bioavailability of the macrolide antibiotics of the disclosure when such macrolide antibiotics are administered to a patient (e.g., by allowing an orally administered compound to be more readily absorbed into the blood), enhance delivery of the macrolide antibiotic to a given biological compartment, increase solubility to allow administration by injection, alter metabolism or alter rate of excretion. In one embodiment, the derivative is a prodrug. Exemplary prodrug forms of macrolide antibiotics are described in U.S. Patent No. 6,809,080.

The term "pharmaceutically acceptable salt(s)", unless otherwise indicated, includes salts of acidic or basic groups that may be present in the macrolide antibiotics of the present disclosure. The terms "about" and "approximately" shall generally mean an acceptable degree of error or variation for the quantity measured given the nature or precision of the measurements. Typical, exemplary degrees of error or variation are within 20 percent (%), preferably within 10%, and more preferably within 5% of a given value or range of values. For biological systems, the term "about" refers to an acceptable standard deviation of error, preferably not more than 2-fold of a give value. Numerical quantities given herein are approximate unless stated otherwise, meaning that the term "about" or "approximately" can be inferred when not expressly stated. p22phox Activity As discussed above, increases in the cellular level of ROS exacerbates the vascular complications of numerous human diseases including, but not limited to, hypertension, diabetes, and atherosclerosis. The p22phox protein is a main regulator of the biosynthesis of ROS. Increases in p22phox gene expression and cell p22phox protein increase cell ROS pro- duction. P22phox gene expression and protein expression are regulated via a number of signaling mechanisms.

Endothelin-1 (ET-I) is a pleiotropic hormone produced primarily by the endothelium. Synthesis of ET-I is stimulated by the major signals of cardiovascular stress, such as vasoactive agents (angiotensin II, norepinephrine, vasopressin, and bradykinin), cytokines (e.g., tumor necrosis factor a and transforming growth factor β), and other factors, including thrombin and mechanical stress. ET-I induces vasoconstriction, is proinflammatory, promotes fibrosis, and has mitogenic potential, important factors in the regulation of vascular tone, arterial remodeling, and vascular injury. These effects are mediated via two receptor types, ET_A and ETβ. The role ET-I plays in normal cardiovascular homeostasis and in mild essential hypertension in humans is unclear. However, certain groups of essential hypertensive patients may have ET-I -dependent hypertension, including blacks (subjects of African descent), salt-sensitive hypertensives, patients with low renin hypertension, and those with obesity and insulin resistance. ET-I has also been implicated in severe hypertension, heart failure, atherosclerosis, and pulmonary hypertension. In all of these conditions, plasma immunoreactive ET levels are elevated and tissue ET-I expression is increased. Accordingly, it is becoming increasingly apparent that ET-I plays an important role in cardiovascular disease and in some forms of hypertension in humans. The role of ET- 1 and ROS in hypertension has been reviewed by Pollack (HypertensioniVolume 45(4)April 2005pp 477-480) Data from clinical trials using combined ET_A-ET_B receptor blockers have already demonstrated significant blood-pressure-lowering effects. Thus, targeting the endothelin system may have important therapeutic potential in the treatment of hypertension and other diseases. The compounds bosentan (ET_A-ET_B receptor blocker) and sixtasentan (ET_A receptor blocker) have shown promise. The present disclosure has identified a polymorphism in the promoter region of the human p22phox gene which results in an increase in the cellular expression of p22phox messenger RNA and protein. Specifically, subjects with the identified polymorphism shown increased gene expression after stimulation with ET-I . As a result, those individuals with the identified polymerphism in the promoter region of the p22phox gene show increased expres- sion of p22phox, increased levels of NADPH oxidase activity and increased production of one or more ROS, thereby exacerbating the certain diseases and conditions. Novel Polymorphic Marker

The present disclosure provides a new polymorphic marker in the p22phox gene. The polymorphism described occurs in the non-coding region of the human p22phox gene, specifically in the promoter region of the gene at a position 536 nucleotides 5' of the transcription initiation site. The p22phox gene is located on chromosome 16; the coding sequence begins at nucleic acid residue 5037 (see nucleotide sequence of p22phox, NG00729.1, GI: 163965415). The polymorphism occurs 536 bases upstream at position 4501. Any sequence upstream or downstream of the identified p22phox polymorphism may be used to generate probes and primers for the methods disclosed herein.

FIG. IA shows the wild-type p22phox gene nucleic acid sequence in the region surrounding -536. FIG. IB shows the nucleotide sequence of the identified polymorphism in the context of the wild-type sequence of FIG. IA wherein is T is substituted for the wild- type C (underlined) CCACGCC. In one embodiment, the polymorphism described results in the sequence CCATGCC with the underlined T being substituted for C in the wild-type sequence shown above. The polymorphism is hereinafter referred to as the Tp22phox polymorphism.

The flanking regions 5' and 3' to the Tp22phox polymorphism are shown in FIG. IB (SEQ ID NO. 1). SEQ ID NO. 1 shows the polymorphic substitution as disclosed above. The entire nucleic acid sequence of the p22phox gene and 1000 bases of upstream sequence is provided in SEQ ID NO. 5. The flanking sequences serve to aid in the identification of the precise location of the Tp22phox polymorphism in the human genome, and in addition serve to provide polynucleotide sequences, such as primers and probes, useful for performing methods of the disclosure. Such polynucleotide sequences can be selected from the sequences provided in SEQ ID NOS. 1, 2 and 5 as would be obvious to one of ordinary skill in the art.

The present disclosure further describes an isolated nucleic acid molecule comprising the Tp22phox polymorphism, or the complement thereof. In one embodiment, the isolated nucleic acid molecule comprising the Tp22phox polymorphism has the sequence CCATGCC, or the complement thereof. In an alternate embodiment, the isolated nucleic acid molecule comprising the Tp22phox polymorphism has the sequence X_nGCCATGX₁₁₁, or the complement thereof, where X_n and X_n, are integers from 0 to 1000 and can represent any nucleotide, natural or synthetic. In yet another alternate embodiment, the isolated nucleic acid molecule comprises SEQ ID NOS. 1 or 2, or a fragment thereof, where the nucleotide at position -536 5' of the transcription initiation site where said nucleotide is not C; in one embodiment, such nucleotide is T. The fragments may be any length desired; in one embodiment from 5 to 40 nucleotides. In addition, the present disclosure comprises at least one nucleic acid primer of the present disclosure useful in amplifying a target polynucleotide sequence comprising the Tp22phox polymorphism. Such primer may be selected from the sequence shown in SEQ ID NOS. 1, 2 and 5, or the complement thereof. In addition, any known nucleic acids 5' or 3 ' of the designated polymorphism may be used. As discussed below, the primers may be of any length desired, in one embodiment from 5 to 40 nucleotides. In a specific embodiment, the primers are at least one of SEQ ID NO. 3 or SEQ ID NO. 4. Methods of Detection

The described polymorphism is useful in determining a genotype of a subject with respect to the p22phox gene at position -536. Such information may be useful in determining the response of a subject to therapeutic intervention for treatment of a disease state or condition caused by and/or associated with increased expression of the p22phox gene, increased levels of NADPH oxidase activity or increased production of one or more ROS as discussed herein. Such methods comprise obtaining a nucleic acid sample from a subject and determining the identity of the nucleotide 536 bases upstream of the initiating codon of the p22phox gene (see above). The presence of a non-C base, in one embodiment a T, at a position 536 bases upstream of the initiating codon of the p22phox gene indicates the subject has at least one allele carrying the disclosed polymorphism. The disclosed method of detection may be used in other methods disclosed herein.

Subjects suspected of carrying a polymorphism described herein may be subject to methods of detection to diagnose the presence of the Tp22phox polymorphism. The methods of detection comprise obtaining a nucleic acid source from a subject and determining the identity of the nucleotide 536 bases upstream of the initiating codon of the p22phox gene (see above). The presence of a non-C base, in one embodiment a T, at a position 536 bases upstream of the initiating codon of the p22phox gene indicates the subject has at least one allele carrying the disclosed polymorphism.

In the disclosed methods, a nucleic acid source is obtained from a subject containing the p22phox gene, or its complement. The nucleic acid may be obtained from any source, such as, but not limited to, body cells, such as those present in peripheral blood, urine, saliva, blood, bucca, surgical specimen, and autopsy specimens. The nucleic acid containing the p22phox gene may be used directly. Alternatively, the nucleic acid containing the p22phox gene may be amplified enzymatically in vitro to create target polynucleotide sequence comprising the Tp22phox polymorphism through use of PCR (Saiki et al. Science 239:487-491, 1988) or other in vitro amplification methods such as, but not limited to, the ligase chain reaction (LCR) (Wu and Wallace, Genomics 4:560-569, 1989), strand displacement amplification (SDA) (Walker et al., Proc. Natl. Acad. Sci. U.S.A. 89:392-396, 1992), self-sustained sequence replication (3SR) (Fahy et al., PCR Methods Appl. 1 :25-33, 1992), prior to mutation analysis. The methodology for preparing nucleic acids in a form that is suitable for detection is well known in the art. The target polynucleotide sequence as used herein is a nucleotide sequence that includes the Tp22phox polymorphism, or the complement thereof.

The polymorphisms in the p22phox gene may be detected by any method known in the art. Many such methods are known in the art and given the teachings of the present disclosure as to the nature and the location of the Tp22phox polymorphism; it would be within the ordinary skill in the art to design methods of detecting the presence of the Tp22phox polymorphism. In one embodiment, the polymorphism may be detected using nucleic acid (DNA and/or RNA) based assays. The detection of the Tp22phox polymorphism in the p22phox gene or a target polynucleotide sequence derived from the p22phox gene, or the complement of the foregoing can be accomplished by a variety of methods including, but not limited to, restriction-fragment-length-polymorphism detection based on allele-specific re- striction-endonuclease cleavage (Kan and Dozy Lancet 112:910-912, 1978); hybridization with allele-specific oligonucleotide probes (Wallace et al., Nucl Acids Res 6:3543-3557, 1978) including immobilized oligonucleotides (Saiki et al., Proc. Natl. Acad. Sci. U.S.A. 86:6230-6234, 1989) or oligonucleotide arrays (Maskos and Southern, Nucl Acids Res 21 :2269-2270, 1993); allele-specific PCR (Newton et al., Nucl Acids Res 17:2503-2516, 1989); mismatch-repair detection (MRD) (Faham and Cox, Genome Res 5:474-482, 1995); binding of MutS protein (Wagner et al., Nucl Acids Res 23:3944-3948, 1995); denaturing- gradient gel electrophoresis (DGGE) (Fisher et al., Proc. Natl. Acad. Sci. U.S.A. 80:1579- 1583, 1983); single-strand-confirmation-polymorphism detection (Orita et al., Genomics 5:874-879, 1983); RNAase cleavage at mismatched base-pairs (Myers et al,. Science 230:1242, 1985); chemical (Cotton et al., Proc. Natl. Acad. Sci. U.S.A. 85:4397-4401, 1988) or enzymatic (Youil et al., Proc. Natl. Acad. Sci. U.S.A. 92:87-91, 1995) cleavage of hetero- duplex DNA; methods based on allele specific primer extension (Syvanen et al., Genomics 8:684-692, 1990); genetic bit analysis (GBA) (Nikiforov et al., Nucl Acids Res 22:4167- 4175, 1994); the oligonucleotide-ligation assay (OLA) (Landegren et al., Science 241 :1077, 1988); the allele-specific ligation chain reaction (LCR) (Barrany, Proc. Natl. Acad. Sci. U.S.A. 88:189-193, 1991); gap-LCR (Abravaya et al., Nucl Acids Res 23:675-682, 1995); radioactive and/or fluorescent DNA sequencing using standard procedures well known in the art; and peptide nucleic acid (PNA) assays (Orum et al., Nucl. Acids Res. 21 :5332-5356 (1993); Thiede et al., Nucl. Acids Res. 24:983-984, 1996). Restriction Fragment Length Polymorphism Detection

In one embodiment, the presence of the Tp22phox polymorphism is determined by restriction fragment length polymorphism (RFLP) analysis. As shown in FIG. 2, the pres- ence of the Tp22phox polymorphism creates an NIa III restriction site that is not present in the wild-type sequence (compare SEQ ID NO. 1 vs SEQ ID NO. 2). The presence of the newly created NIa III restriction site is created by the T to C substitution at position -536 (relative to the ATG start site) in the 5' un- translated region p22phox gene. In one embodiment, the presence of the newly created NIa III restriction site allows a determination of whether the Tp22phox polymorphism is present in one or both alleles of a subject and/or a nucleic acid sample obtained from a subject.

In this embodiment, a nucleic acid sample is obtained from a subject. The nucleic acid sample may be subject to amplification using any method known in the art if desired. In a specific embodiment, PCR is used. In this embodiment, at least one primer is used to am- plify a target polynucleotide sequence that contains the Tp22phox polymorphism. In a specific embodiment, a primer pair is used comprising a forward and a reverse primer 5' and 3', respectively, of the Tp22phox polymorphism. Any primer or primer pair may be used to amplify the target polynucleotide sequence. Such primer or primer pair may be generated using the nucleic acid sequence of the p22phox gene (SEQ ID NOS. 1, 2 and 5). The primer and/or primer pair may be any length desired. In one embodiment the length is selected from 5 to 40 nucleotides. Once the target polynucleotide sequence is amplified, the amplified target polynucleotide sequence may be subject to RFLP analysis using the restriction enzyme NIa III. Depending on the nature of the primer or primer pair used, the pattern of the RFLP analysis can be used to determine the presence of the Tp22phox polymorphism. In a specific embodiment of RFLP analysis, a nucleic acid sample is obtained from a subject. The nucleic acid sample is purified and prepared for amplification using techniques standard in the art. Single stranded nucleic acid comprising the sense strand was used as the template for amplification. To amplify the target polynucleotide sequence, a specific primer pair (comprising a forward primer 5 ' to the Tp22phox polymorphism and a reverse primer 3 ' to the Tp22phox SNP) was used as shown in FIG. 1C (SEQ ID NOS. 3 and 4). In this embodiment, the forward primer was GTCCCTGCATTCTGTGCTTT (SEQ ID NO. 3) and the reverse primer was GAACACCTCTGCACCCTGAT (SEQ ID NO. 4). In this embodiment, the forward and reverse primers were 20 mers; however, as discussed above, the primers may be of any length desired. Using the primers of SEQ ID NOS. 3 and 4, a 219 base pair amplification product (the target polynucleotide sequence) was produced. (FIG. ID).

For all RFLP analysis described herein, the RFLP analysis was performed according to the following procedure. Nucleic acid containing the p22phox gene was provided. The nucleic acid was subject to amplification by PCR as follows. Each PCR reaction contained 15 μl of PCR master mix ( 2X Highfidelity Master Mix, USB), 5 μl of genomic DNA, 1 μl of forward (SEQ ID NO. 3) and reverse (SEQ ID NO. 4) primers mix (10 mM each), 9 μl of H₂O for a 30 μl total volume. PCR was performed using under the following conditions: 94 ⁰C for 3 min., followed by 30 cycles of 94 ⁰C for 45 sec, 58 ⁰C for 45 sec, and 68 ⁰C for 45 sec, followed by one cycle of 68 ⁰C for 3 min. The restriction digest was performed on 8 μl of PCR product by adding 2 μl of restriction buffer, 9 μl of H₂O, and 1 μl of NIa III (0.3 units) for a total volume of 20 μl. The reaction was carried out at 37 ⁰C for 18 hours. The product of the restriction digest (5 μl) was separated on a 6% polyacrylamide gel (100 volts for 1 hour). The gel was stained with ethidium bromide and photographed using a Kodak system. The target polynucleotide sequence for all individuals will contain one NIa III restriction site (designated by an asterisk). On incubation with the NIa III restriction enzyme, individuals with a C at position -536 in both alleles of the p22phox gene (homozygous for wild- type, designated C/C) will yield restriction fragments of 173 and 46 base pairs (FIG. ID). On incubation with the NIa III restriction enzyme, individuals with a T at position -536 in both alleles of the p22phox gene (homozygous for the Tp22phox polymorphism, designated T/T) will yield restriction fragments of 116, 57 and 46 base pairs due to the presence of the newly created NIa III restriction site (designated by a double asterisk) created by the C to T substitution (FIG. ID). On incubation with the NIa III restriction enzyme, individuals with a C at position -536 in one allele and a T at position -536 in the other allele of the p22phox gene (heterozygous for the Tp22phox polymorphism, designated C/T) will yield restriction fragments of 173, 116, 57 and 46 base pairs (FIG. ID). Therefore, by examining the pattern of restriction fragments produced by RFLP analysis of the target polynucleotide sequence, the presence of the Tp22phox polymorphism can be determined in both alleles of the subject. FIGS. 2 shows an agarose gels illustrating the results of the RFLP analysis on representative samples. In this experiment, the presence or absence of the Tp22phox polymorphism was known. Samples were obtained, prepared and subject to PCR amplification as described above. Target polynucleotide sequences obtained were subject to RFLP analysis also as described above. As can be seen, sample homozygous for C (designated C/C, lanes 2-4), and therefore lacking the Tp22phox polymorphism on both alleles, yielded restriction fragments of 173 and 46 base pairs; samples homozygous for the T substitution (designated T/T, lanes 5-7), and therefore incorporating the Tp22phox polymorphism on both alleles, yielded restriction fragments of 116, 57 and 46 base pairs; and samples heterozygous for the T substitution (designated C/T, lanes 8-10), and therefore having the Tp22phox polymorphism on one allele, yielded restriction fragments of 173, 116, 57 and 46 base pairs. Lane 1 contained a molecular weight ladder.

FIGS. 3 A and 3B show agarose gels illustrating the results of the RFLP analysis on representative samples. Samples were obtained, prepared and subject to PCR amplification as described above. Target polynucleotide sequences obtained were subject to RFLP analysis also as described above. In this experiment, the presence or absence of the Tp22phox polymorphism was not known. As can be seen in FIGS. 3A and 3B, the restriction fragments produced by the described RFLP analysis can be used to classify the subjects from which the samples were obtained as C/C, T/T, or C/T. In FIG. 3A, the samples in lanes 3, 5, 9 and 10 are C/C, the samples in lanes 2 and 4 are T/T and the samples in lanes 6 and 8 are C/T. In FIG. 3B, the samples in lanes 2, 9 and 10 are C/C, the sample in lane 5 is T/T and the samples in lanes 3, 6, 7 and 8 are C/T.

Therefore, RFLP analysis may be used to determine the presence of the Tp22phox polymorphism in a subject. Other Detection Methods

The present disclosure provides for alternate methods of detecting a polymorphism described herein. In one embodiment of such an alternate method, detection of the Tp22phox polymorphism is accomplished using a specific binding pair member. As used herein, the term "specific binding pair member" refers to a molecule that specifically binds or selectively hybridizes to another member of a specific binding pair. One component of the binding pair member may include, for example, probes, primers, polynucleotides, antibodies, etc. that may bind at or near the site of the Tp22phox polymorphism in the p22phox gene. For example, a specific binding pair member includes a primer, a probe or other nucleic acid sequence that selectively hybridizes to a target polynucleotide sequence that includes the Tp22phox polymoφhism, or that hybridizes to target polynucleotide sequence that includes the Tp22phox polymorphism loci. The binding site of the primer, probe or other nucleic acid sequence may include the site of the polymoφhism, or may be adjacent or near the site of the polymorphism. In one embodiment, a probe or primer is used having the sequence of X_nGCCATGX_m, or the complement thereof, where X_n and X_m are integers from 0 to 1000 and can represent any nucleotide, natural or synthetic, SEQ ID NO. 2 or the complement thereof.

As used herein, the term "specific interaction," or "specifically binds" or the like means that two molecules form a complex that is relatively stable under physiologic condi- tions. The term is used herein in reference to various interactions, including, for example, the interaction of an antibody that binds the p22phox gene or a target polynucleotide sequence amplified from the p22phox gene. According to methods of the disclosure, an antibody may preferentially bind a particular modified nucleotide that is incorporated into or near a polymorphic site, such as a SNP site, for only certain nucleotide occurrences at the SNP site, for example using a primer extension assay. Alternatively, such an antibody may bind a three dimensional structure at or near a polymoφhic site, such as a SNP site. A specific interaction can be characterized by a dissociation constant of at least about 1 X 10^"6 M, at least about I X lO^"7 M, at least about I X lO^"8 M, or at least about 1 X 10^"9 M or 1 X 10^"10 M or greater. A specific interaction generally is stable under physiological conditions, including, for example, conditions that occur in a living individual, as well as conditions that occur in a cell culture such or an assay described herein.

As used herein, the term "selective hybridization" or "selectively hybridizes," refers to hybridization under moderately stringent or highly stringent conditions such that a nucleotide sequence preferentially associates with a target polynucleotide sequence over other nu- cleotide sequences to a large enough extent to be useful in identifying the Tp22phox polymoφhism. It will be recognized that some amount of non-specific hybridization is unavoidable, but is acceptable provide that hybridization to a target polynucleotide sequence is sufficiently selective such that it can be distinguished over the non-specific cross-hybridization, for example, at least about 2-fold more selective, at least about 3 -fold more selective, at least about 5-fold more selective, or at least about 10-fold more selective, as determined, for example, by an amount of labeled oligonucleotide that binds to target polynucleotide sequence as compared to a nucleic acid molecule other than the target polynucleotide sequence, particularly a substantially similar (i.e., homologous) nucleic acid molecule other than the target polynucleotide sequence. Conditions that allow for selective hybridization can be determined empirically, or can be estimated based, for example, on the relative GC: AT content of the hybridizing oligonucleotide and the sequence to which it is to hybridize, the length of the hybridizing oligonucleotide, and the number, if any, of mismatches between the oligonucleotide and sequence to which it is to hybridize. An example of progressively higher stringency conditions is as follows: 0.2 X

SSC/0.1% SDS at about room temperature (low stringency conditions); 0.2 X SSC/0.1% SDS at about 42. degree C (moderate stringency conditions); and 0.2 X SSC at about 68. degree C (high stringency conditions). Washing can be carried out using only one of these conditions, e.g., high stringency conditions, or each of the conditions can be used, e.g., for 10-15 minutes each, in the order listed above, repeating any or all of the steps listed. However, as mentioned above, optimal conditions will vary, depending on the particular hybridization reaction involved, and can be determined empirically. For discussions of nucleic acid probe design and annealing conditions, see, for example, Sambrook et al., Molecular Cloning: a Laboratory Manual (2nd ed.), VoIs. 1-3, Cold Spring Harbor Laboratory, (1989) or Current Protocols in Molecular Biology, F. Ausubel et al., ed. Greene Publishing and Wiley- Interscience, New York (1987).

Therefore, the present disclosure provides for nucleic acid molecules and antibodies that can be used in a method of the present disclosure. Such nucleic acid molecules may be primers or probes useful in one or more methods of the present disclosure. As a means of example and not limitation, such a probe or primers may have the sequence of In one embodiment, a probe or primer is used having the sequence of X_nGCCATGX_n,, or the complement thereof, where X_n and X_m are integers from 0 to 1000 and can represent any nucleotide, natural or synthetic, SEQ ID NO. 2 or the complement thereof and be useful in methods such as, but not limited to, allele-specific PCR, allele specific primer extension, oligonucleotide- ligation assay (OLA) (Landegren et al., Science 241 :1077, 1988); the allele-specific ligation chain reaction or be useful as an allele-specific oligonucleotide probes. The person of ordinary skill in the art would be able to design additional nucleic acid molecules using the teachings of the present disclosure, specifically the nature and location of the Tp22phox polymorphism. Methods of Diagnosis

The present disclosure provides methods and compositions for diagnosing a subject as suffering from or at risk for a disease or condition caused by and/or associated with the Tp22phox polymorphism, increased levels of NADPH oxidase activity or increased production of one or more ROS. Such methods comprise obtaining a nucleic acid sample from a subject and determining the identity of the nucleotide 536 bases upstream of the initiating codon of the p22phox gene (see above). The presence of a non-C base, in one embodiment a T, at a position 536 bases upstream of the initiating codon of the p22phox gene indicates the subject has at least one allele carrying the disclosed polymorphism. The presence of the Tp22phox polymorphism in one or both alleles indicates the subject is suffering from or at risk for a disease or condition caused by and/or associated with the Tp22phox polymorphism, increased levels of NADPH oxidase activity or increased production of one or more ROS. Exemplary diseases or conditions include, but are not limited to, hypertension, atherosclerosis, heart failure and/or diabetes. Forms of hypertension include, but are not limited to, severe hypertension, PAH, ET-I -dependent hypertension, salt-sensitive hypertension, low renin hypertension and hypertension associated with obesity, insulin resistance and diabetes. In one embodiment, the disease state or condition is hypertension.

In addition, the present disclosure provides methods and compositions for determining susceptibility of a subject to a disease or condition caused by and/or associated with in- creased expression of the p22phox gene, increased levels of NADPH oxidase activity or increased production of one or more ROS. Such methods comprise obtaining a nucleic acid sample from a subject and determining the identity of the nucleotide 536 bases upstream of the initiating codon of the p22phox gene (see above). The presence of a non-C base, in one embodiment a T, at a position 536 bases upstream of the initiating codon of the p22phox gene indicates the subject has at least one allele carrying the disclosed polymorphism. The presence of the Tp22phox polymorphism in one or both alleles indicates the subject is susceptible to a disease or condition caused by and/or associated with the Tp22phox polymorphism, increased levels of NADPH oxidase activity or increased production of one or more ROS. Exemplary diseases or conditions include, but are not limited to, hypertension, athero- sclerosis, heart failure and/or diabetes. Forms of hypertension include, but are not limited to, severe hypertension, PAH, ET- 1 -dependent hypertension, salt-sensitive hypertension, low renin hypertension and hypertension associated with obesity, insulin resistance and diabetes. In one embodiment, the disease state or condition is hypertension.

Furthermore, the described polymorphism is useful in monitoring the sensitivity of a subject to therapeutic intervention and/or monitoring the progression of a disease or condition in a subject caused by and/or associated with increased expression of the p22phox gene, increased levels of NADPH oxidase activity or increased production of one or more ROS. Such methods comprise obtaining a nucleic acid sample from a subject and determining the identity of the nucleotide 536 bases upstream of the initiating codon of the p22phox gene (see above). The presence of a non-C base, in one embodiment a T, at a position 536 bases upstream of the initiating codon of the p22phox gene indicates the subject has at least one allele carrying the disclosed polymorphism. The presence of the Tp22phox polymorphism in one or both alleles indicates the subject is suffering from, at risk for, or susceptible to a disease or condition caused by and/or associated with the Tp22phox polymorphism, increased levels of NADPH oxidase activity or increased production of one or more ROS. Exemplary diseases or conditions include, but are not limited to, hypertension, atherosclerosis, heart failure and/or diabetes. Forms of hypertension include, but are not limited to, severe hypertension, PAH, ET-I -dependent hypertension, salt-sensitive hypertension, low renin hypertension and hypertension associated with obesity, insulin resistance and diabetes. In one embodiment, the disease state or condition is hypertension.

Still further, the described polymorphism is useful in determining when a therapeutic regimen comprising blocking the activity of the ET_A and/or ET_B receptor or reducing the levels of ET-I should be administered to a subject. Such therapeutic regimens are effective in treating disease states or conditions caused by and/or associated with increased expression of the p22phox gene, increased levels of NADPH oxidase activity or increased production of one or more ROS in that they decrease ET-I dependent expression of the p22phox gene. In one embodiment, the method allows a caregiver to determine if such therapeutic regimens would be optimally effective. As discussed above, those subjects carrying the Tp22phox mutation in at least one allele show increased transcription of the p22phox gene and increased production of ROS which contributes to the initiation and/or progression of the disease states or conditions discussed herein. Such subjects carrying the Tp22phox mutation in at least one allele would therefore benefit from therapeutic interventions that block the ET_A and/or ET_B receptor or reduce the levels of ET-I. Such methods comprise obtaining a nucleic acid sample from a subject and determining the identity of the nucleotide 536 bases upstream of the initiating codon of the p22phox gene (see above). The presence of a non-C base, in one embodiment a T, at a position 536 bases upstream of the initiating codon of the p22phox gene indicates the subject has at least one allele carrying the disclosed polymorphism. The presence of the Tp22phox polymorphism in one or both alleles indicates the subject is suffering from, at risk for, or susceptible to a disease or condition caused by and/or associated with the Tp22phox polymorphism, increased levels of NADPH oxidase activity or increased production of one or more ROS and would be responsive to a therapeutic regimen comprising blocking the activity of the ET_A and/or ET_B receptor or reducing the levels of ET-I. ET_A and/or ET_B receptor could be blocked with small molecule inhibitors such as, but not limited to, bosentan and sixtasentan. ET-I expression and/or activity could be reduced by decreasing expression of the gene encoding ET-I, such as through siRNA therapy. The disclosed method may further comprise administering a therapeutic regimen that comprises blocking the activity of the ET_A and/or ET_B receptor or reducing the levels of ET-I . Exemplary diseases or conditions include, but are not limited to, hypertension, atherosclerosis, heart failure and/or diabetes. Forms of hypertension include, but are not limited to, severe hypertension, PAH, ET-I -dependent hypertension, salt-sensitive hypertension, low renin hypertension and hypertension associated with obesity, insulin resistance and diabetes. In one embodiment, the disease state or condition is hypertension. In the above methods, any of the methods described herein or known in the art may be used to determine the presence or absence of the Tp22phox polymorphism. As one example, RFLP analysis may be used. As another example, a probe specific for the Tp22phox polymorphism may be used. Kits The present disclosure also relates to kits, which can be used, for example, to perform a method of the disclosure. Therefore, in one embodiment of the present disclosure, a kit is provided for identifying the occurrence the Tp22phox polymorphism.

A kit may be provided for amplification of a target polynucleotide sequence and subsequent detection by RFLP. In one embodiment, such a kit may comprise at least one primer for the amplification of a target polynucleotide sequence comprising the Tp22phox polymorphism. In a specific embodiment 2 primers (i.e., a primer pair comprising a forward and a reverse primer) are provided. Such primers or primer pairs may be useful in amplification reactions, such as, but not limited to, PCR. The primer or primer pair can be selected such that they can be used to determine the identity of the nucleotide at a position corresponding to nucleotide -536 of SEQ ID NO:1. In a specific embodiment, the primers may have the sequence of SEQ ID NOS. 3 and 4. Furthermore, such a kit may comprise the reagents for RFLP analysis, such as but not limited to a specific restriction endonuclease, such as, but not limited to NIa III.

The present disclosure also contemplates kits for other detection methods as well. Such a kit can include an isolated primer, primer pair, probe, or other specific binding pair member of the present invention, or a combination thereof. The kit can further include reagents for amplifying a polynucleotide using a primer pair. Furthermore, the reagents can include at least one detectable label, which can be used to label the isolated oligonucleotide probe, primer, primer pair, or other specific binding pair member, or can be incorporated into a product generated using the isolated oligonucleotide probe, primer, primer pair, or specific binding pair member.

Any kit of the present disclosure may also contain a standard (for example a positive or negative control) that can be examined in parallel with a sample from a subject (for exam- pie, a nucleic acid sequence that lacks and/or contains the Tp22phox polymorphism). Furthermore, any kit of the present disclosure may also contain for example, ancillary reagents for performing a method of the invention, including, for example, one or more detectable labels, which can be used to label a probe or primer or can be incorporated into a product generated using the probe or primer (e.g., an amplification product); one or more poly- merases, which can be useful for a method that includes a primer extension or amplification procedure, or other enzyme or enzymes (e.g., a ligase or an endonuclease), which can be useful for performing RFLP analysis, or other methods of the present disclosure; and/or one or more buffers or other reagents that are necessary to or can facilitate performing a method of the invention. The primers or probes can be included in a kit in a labeled form, for example with a label such as biotin or an antibody. Any kit of the present disclosure may also include instructions for using the probes or primers to perform a method of the present invention.

The foregoing description illustrates and describes the compounds and methods of the present disclosure. Additionally, the disclosure shows and describes only certain embodiments of the nucleic acids and methods but, as mentioned above, it is to be understood that the teachings of the present disclosure are capable of use in various other combinations, modifications, and environments and is capable of changes or modifications within the scope of the inventive concept as expressed herein, commensurate with the above teachings and/or the skill or knowledge of the relevant art. The embodiments described hereinabove are further intended to explain best modes known of practicing the invention and to enable others skilled in the art to utilize the invention in such, or other, embodiments and with the various modifications required by the particular applications or uses of the invention. Accordingly, the description is not intended to limit the invention to the form disclosed herein. All references cited herein are incorporated by reference as if fully set forth in this disclosure.

Claims

CLAIMSWhat is claimed:

1. A kit for detecting the Tp22phox polymorphism in a test sample, comprising at least one of a first primer to amplify a target polynucleotide sequence containing the Tp22phox polymorphism and a second primer to amplify a target polynucleotide sequence containing the Tp22phox polymorphism.

2. The kit of claim 1, wherein the first primer has the sequence of SEQ ID 3 and the second primer has the sequence of SEQ ID 4.

3. The kit of claim 2, further comprising a restriction endonuclease.

4. The kit of claim 3 , wherein the restriction endonuclease is N 1 a III.

5. The kit of claim 4, further comprising at least one of the following: instructions for determining the presence of the Tp22 polymorphism, a detectable label, a polymerase, an ancillary reagent, a positive control, and a negative control.

6. A kit for detecting the Tp22phox polymorphism, comprising a specific binding pair member that selectively hybridizes with a target polynucleotide sequence containing the Tp22phox polymorphism or a complement thereof.

7. The method of claim 6 wherein the specific binding pair member is an oligonucleotide probe.

8. The method of claim 6 wherein the oligonucleotide probe selectively hybridizes with the Tp22phox polymorphism.

9. The kit of claim 6 wherein the specific binding pair member comprise a detectable label.

10. The kit of claim 6 further comprising at least one of the following: instructions for determining the presence of the Tp22 polymorphism, a detectable label, an ancillary reagent, a positive control, and a negative control.

11. A method of determining whether a subject at least one allele of a subject contains a Tp22phox polymorphism, said method comprising the steps of: a. obtaining a nucleic acid sample from a subject; and b. determining the identity of the nucleotide at a position 536 bases upstream of the initiating codon of the p22phox gene.

12. The method of claim 1 1 wherein a T at the position indicates the presence of the Tp22phox polymorphism.

13. The method of claim 1 1 wherein said determining is accomplished by restriction fragment length polymorphism or hybridization with allele-specific oligonucleotide probes.

14. A method for diagnosing a subject as suffering from or at risk for a disease or condi- tion caused by or associated with a Tp22phox polymorphism, increased levels of

NADPH oxidase activity or increased production of one or more ROS, the method comprising the steps of: a. obtaining a nucleic acid sample from a subject; and b. determining if at least one allele of the subject contains the Tp22phox polymor- phism.

15. The method of claim 14 wherein said determining step comprises determining the identity of the nucleotide at a position 536 bases upstream of the initiating codon of the p22phox gene and wherein a T at the position indicates the presence of the Tp22phox polymorphism.

16. The method of claim 14 wherein the presence of the Tp22phox polymorphism indicates the subject is suffering from or at risk for a disease or condition caused by or associated with a Tp22phox polymorphism, increased levels of NADPH oxidase activity or increased production of one or more ROS.

17. The method of claim 14 wherein said determining step is accomplished by restriction fragment length polymorphism or hybridization with allele-specific oligonucleotide probes.

18. The method of claim 14 where the disease or condition is selected from the group consisting of: hypertension, atherosclerosis, heart failure and diabetes.

19. The method of claim 18 where the hypertension is selected from the group consisting of: severe hypertension, pulmonary arterial hypertension, ET-I -dependent hypertension, salt-sensitive hypertension, low renin hypertension and hypertension associated with obesity, insulin resistance and diabetes.

20. A method for determining susceptibility of a subject to a disease or condition caused by and/or associated with increased expression of the p22phox gene, increased levels of NADPH oxidase activity or increased production of one or more ROS, the method comprising the steps of: a. obtaining a nucleic acid sample from a subject; and b. determining if at least one allele of the subject contains the Tp22phox polymorphism.

21. The method of claim 20 wherein said determining step comprises determining the identity of the nucleotide at a position 536 bases upstream of the initiating codon of the p22phox gene and wherein a T at the position indicates the presence of the Tp22phox polymorphism.

22. The method of claim 20 wherein the presence of the Tp22phox polymorphism indicates the subject is susceptible to a disease or condition caused by or associated with a Tp22phox polymorphism, increased levels of NADPH oxidase activity or increased production of one or more ROS.

23. The method of claim 20 wherein said determining step is accomplished by restriction fragment length polymorphism or hybridization with allele-specific oligonucleotide probes.

24. The method of claim 20 where the disease or condition is selected from the group consisting of: hypertension, atherosclerosis, heart failure and diabetes.

25. The method of claim 23 where the hypertension is selected from the group consisting of: severe hypertension, pulmonary arterial hypertension, ET-I -dependent hypertension, salt-sensitive hypertension, low renin hypertension and hypertension associated with obesity, insulin resistance and diabetes.

26. A method for determining when a therapeutic regimen comprising blocking the activity of the ET_A and/or ET_B receptor or reducing the levels of ET-I should be administered to a subject, said method comprising the steps of: a. obtaining a nucleic acid sample from a subject; and b. determining if at least one allele of the subject contains the Tp22phox polymorphism.

27. The method of claim 26 wherein said determining step comprises determining the identity of the nucleotide at a position 536 bases upstream of the initiating codon of the p22phox gene and wherein a T at the position indicates the presence of the Tp22phox polymorphism.

28. The method of claim 26 wherein the presence of the Tp22phox polymorphism indicates the subject indicates the therapeutic regimen should be administered.

29. The method of claim 26 wherein the therapeutic regimen comprises administration of a antagonist of the ET_A, ET_B or both ET_A and ET_B receptors.

30. The method of claim 29 where the antagonist is bosetan or sixtasentan.

31. The method of claim 28 wherein said administration reduces expression of the p22phox gene, decreases levels of NADPH oxidase activity or decreases production of one or more ROS.

32. The method of claim 26 wherein said determining step is accomplished by restriction fragment length polymorphism or hybridization with allele-specifϊc oligonucleotide probes.

33. The method of claim 26 where the disease or condition is selected from the group consisting of: hypertension, atherosclerosis, heart failure and diabetes.

34. The method of claim 33 where the hypertension is selected from the group consisting of: severe hypertension, pulmonary arterial hypertension, ET-I -dependent hypertension, salt-sensitive hypertension, low renin hypertension and hypertension associated with obesity, insulin resistance and diabetes.