JP5002746B2 - Gene polymorphisms useful for predicting responsiveness to antidepressants - Google Patents

Abstract

Analysis is made on whether there is any correlation between the genetic polymorphisms in tryptophan hydroxylase-2 (TPH2) and the response to an anti-depressant agent. As a result, a genetic polymorphism useful for the prediction of the response to an anti-depressant is found in a promoter region of TPH2 gene, and it becomes possible to predict the response to an anti-depressant with good accuracy by using the genetic polymorphism. It is also found that genetic polymorphisms of dopamine D2 receptor (DRD2) and tyrosine hydroxylase (TH) are useful for the prediction of the response to an anti-depressant agent. The genetic polymorphisms are useful for the diagnosis or diagnosis in the treatment of depression using an anti-depressant agent, particularly a selective serotonin reuptake inhibitor (SSRI).

Description

  The present invention relates to a method for predicting reactivity to an antidepressant based on a genetic polymorphism of a subject. In particular, the present invention provides a technique useful for testing and diagnosis in drug treatment for the purpose of improving depression.

  In recent years, it has become common to recognize that depression is a familiar disease, as it is said that “depression is a cold of the heart”. So far, the biological hypotheses of the development of major depression include monoamine (serotonin, noradrenaline) nervous system dysfunction, hypothalamic-pituitary-adrenal (HPA) dysfunction (stress adaptation dysfunction), ecological rhythm abnormality, Abnormalities in neuroplasticity have been envisaged but have not yet been confirmed. Since the prevalence of depression relatives is higher than in general subjects, there is no doubt that some genetic predisposition exists in the pathogenesis. Depression can be considered as some kind of stress vulnerability, and the basis is the presence of monoamine nervous system, HPA system and neuroplasticity abnormalities, excessive stress effects, and the stress adaptation mechanism in the brain has collapsed It is assumed that the disease will occur.

  Currently, the antidepressant drug SSRI is used as a first-line drug for the treatment of depression, but it is known that there are great individual differences in the clinical effect. SSRI is an abbreviation for Selective Serotonin Reuptake Inhibitors, a new generation of antidepressant that selectively inhibits serotonin reuptake through the serotonin transporter at nerve endings. It is a name to point. In addition to this SSRI, SNRI can be mentioned as a new generation of antidepressant. SNRI is an abbreviation for serotonin & noradrenaline reuptake inhibitors (Selective) Serotonin & Noradorenaline Reuptake Inhibitors, and is a name that refers to a group of substances that selectively inhibit serotonin and noradrenaline reuptake.

  As described above, there is a large individual difference in the clinical effect of the antidepressant SSRI, but it is assumed that genetic factors are involved in the background of this individual difference, and there are many LPR of serotonin transporter, which is the site of action of SSRI. The type has been studied as the most influential factor (see Non-Patent Documents 1 and 2 below). Of these, Non-Patent Document 2 is based on the announcement by the present inventors, and the clinical effects of two typical antidepressants paroxetine and fluvoxamine belonging to SSRI, and the patient's genetic polymorphisms. When the genotype in the LPR polymorphism was s / s, it was reported that the clinical effect of paroxetine was higher than that of fluvoxamine.

In addition to this, studies have been conducted to predict SSRI reactivity from gene polymorphisms of various serotonin-related factors, but many have not reached a certain conclusion. Recently, tryptophan hydroxylase-2 (TPH2), a novel brain-specific variant, was discovered in tryptophan hydroxylase (TPH), which is responsible for the rate-limiting step of serotonin biosynthesis (Non-patent Document 3 below). Since then, various studies have been conducted on TPH2, and the following reports have been made so far.
(1) A polymorphism present in an exon of the TPH2 gene and reducing serotonin production by 80% in vitro has been reported (Non-patent Document 4 below). Many mutations were detected in patients with depression, suggesting that this mutation is an important region for the enzyme activity of TPH2 and may be involved in the development of depression.
(2) In addition, SNPs (single nucleotide polymorphisms) on exons and introns of the TPH2 gene have been reported (the following non-patent documents 5 and 6). In these reports, while the correlation between the SNP and the morbidity of depression is examined, the correlation with the antidepressant responsiveness is not examined.
(3) Recently, a correlation between a polymorphism in the promoter region of the TPH2 gene and schizophrenia and suicide has been investigated, and a report has been made that no correlation has been observed (Non-patent Document 7 below).
(4) Very recently, it has been reported that there is a correlation between polymorphisms related to the TPH2 gene and attention deficit hyperactivity disorder (ADHD) (Non-patent Documents 8 and 9 below).

Prog Neuropsychopharmacol Biol Psychiatry. 2005,29: 1062-1073 Int Clin Psychopharmacol. 2005,20: 151-156 Science. 2003,299: 76 Neuron. 2005,45: 11-16 Mol Psychiatry. 2004,9: 980-983 Mol Psychiatry. 2004,9: 1030-1036 Psychiatry Res. 2005,134: 195-198 Mol Psychiatry. 2005 Oct; 10 (10): 944-9. Mol Psychiatry. 2005 Dec; 10 (12): 1126-32.

  In pharmacotherapy aimed at improving depression, it is important to select the appropriate patients for safe and effective treatment. In particular, since there are large individual differences in the clinical effects of the antidepressant SSRI as described above, the SSRI responsiveness of the patient is objectively predicted at the initial stage of treatment, and drug treatment suitable for each individual patient is performed. The importance of this is pointed out.

  The present invention has been made in view of the above problems, that is, the importance of predicting antidepressant drug reactivity before administration, and its purpose is based on the polymorphism of a subject. The object is to provide a method for predicting responsiveness to antidepressants.

  The inventors of the present invention have conducted extensive research assuming the involvement of genetic factors in the cause of the large individual differences in the clinical effects of antidepressants, and so far the serotonin transporter, which is the site of action of the antidepressant SSRI, has been developed. We have reported that LPR polymorphisms contribute to this. Focusing on the amount of serotonin in the brain this time, we examined the gene polymorphisms of several serotonin-related factors, including the tryptophan hydroxylase-2 (TPH2), and examined the effect of antidepressants on clinical effects. As a result, the gene polymorphism present in the promoter region of the TPH2 gene is useful for predicting individual differences in the clinical effects of antidepressants, and the gene polymorphism can be used to accurately predict responsiveness to antidepressants. In addition, it has been found that by combining with the test results of other gene polymorphisms such as the above-mentioned LPR polymorphism, a more detailed reactivity prediction can be made, which contributes to the formulation of a treatment plan suitable for each individual patient.

  Furthermore, among the factors examined in the dopamine nervous system, the Taq1A polymorphism of the dopamine D2 receptor (DRD2) gene and the TCAT repeat polymorphism of the tyrosine hydroxylase (TH) gene are useful for predicting responsiveness to antidepressants. As a result, the present invention has been completed.

That is, the present invention includes the following inventions A) to L) as industrially useful inventions.
A) Examining tryptophan hydroxylase-2 (TPH2) gene, dopamine D2 receptor (DRD2) gene, tyrosine hydroxylase (TH) gene, or one or more polymorphisms present in the vicinity thereof, A method for predicting the reactivity of a subject to an antidepressant based on the results.
The tryptophan hydroxylase-2 (tryptophan hydroxylase-2) is also called tryptophan hydroxyl group type 2 and is considered to be an enzyme responsible for the rate-limiting step of brain serotonin biosynthesis. In this specification, this enzyme is abbreviated as “TPH2”, and its gene is referred to as “TPH2 gene”.
The above-mentioned dopamine D2 receptor (Dopamine D2 receptor) is one of the subtypes of dopamine receptor. In this specification, this receptor is abbreviated as “DRD2”, and its gene is referred to as “DRD2 gene”. . The tyrosine hydroxylase is a dopamine biosynthesis-related enzyme that converts tyrosine to L-DOPA. In this specification, this enzyme is abbreviated as “TH”, and the gene is referred to as “TH gene”. ".
The present invention examines TPH2 gene, DRD2 gene, TH gene, or polymorphisms present in the vicinity thereof on the genome. In other words, this is the case where at least one polymorphism associated with these genes is detected. Means to inspect. It is not limited to testing for polymorphisms present in exon regions or intron regions of these genomic genes, but may be those for testing polymorphisms present in transcriptional regulatory regions such as promoter regions, control regions or untranslated regions. . In the present specification, “gene polymorphism” includes a polymorphism existing in such a promoter region and the like, and has a broad meaning of a polymorphism related to the gene.
Further, in the present invention, a method of examining a plurality of polymorphisms associated with any of the above three genes and predicting a subject's reactivity to an antidepressant based on the results is a preferable method. One polymorphism in which a correlation with reactivity to an antidepressant drug was observed in 1 may be examined, and reactivity may be predicted based on the result.

B) The method according to A) above, wherein the reactivity to a selective serotonin reuptake inhibitor (SSRI) or serotonin and noradrenaline reuptake inhibitor (SNRI) used as an antidepressant is predicted.
Representative examples of the antidepressant SSRI include paroxetine, fluvoxamine, fluoxetine, sertraline, etc. In addition, nefazodone, citalopram, dexfen Examples include fluramine (dexfenfluramine). On the other hand, examples of the antidepressant SNRI include milnacipran, and other examples include venlafaxine and duloxetine.
The present invention can be suitably used for predicting the reactivity to the above-mentioned antidepressant SSRI or SNRI, but has other serotonin reuptake inhibitory action (tricyclic antidepressant, tetracyclic antidepressant, etc.) It can also be used for predicting the reactivity to.

C) By examining at least one of the polymorphism present in the promoter region of the TPH2 gene, the Taq1A polymorphism of the DRD2 gene, and the TCAT repeat polymorphism of the TH gene, The method according to A) or B) above, wherein the reactivity is predicted.
As will be described later, the present inventors have made a polymorphism present in the promoter region of the TPH2 gene (rs11178997 gene polymorphism), a Taq1A polymorphism in the DRD2 gene (rs1800497 gene polymorphism), or a TCAT repeat polymorphism in the TH gene (TH By examining and determining tetranucleotide (TCAT) repeat polymorphism), it was clarified that each polymorphism alone can predict the therapeutic response to the antidepressant SSRI with high accuracy. Therefore, it is possible to predict treatment responsiveness to the antidepressant SSRI with high accuracy by examining or determining at least one of these gene polymorphisms directly or indirectly.

D) Further, the serotonin transporter gene, the serotonin receptor gene, or polymorphisms present in the vicinity thereof on the genome are examined, and the results are used to predict the reactivity of the subject to an antidepressant. The method according to A) above.
As described above, the above-mentioned “polymorphism existing in the vicinity thereof” means, in other words, a polymorphism related to the serotonin transporter gene (or serotonin receptor gene), that is, the promoter region of these genes. For example, a polymorphism existing in a transcription regulatory region, a control region, or an untranslated region may be examined.

E) The method according to D) above, wherein the LPR polymorphism associated with the serotonin transporter gene is examined, and the result is used to predict the reactivity of the subject to an antidepressant.
As described later, the present inventors have examined the above-mentioned rs11178997 polymorphism related to the TPH2 gene and the LPR polymorphism present in the promoter region of the serotonin transporter gene (Int Clin Psychopharmacol. 2005, 20: 151-156). It was clarified that the reactivity can be predicted more finely by combining with the test results of (see). Thus, it is preferable to predict the drug effect based on a plurality of gene polymorphisms, which contributes to the realization of appropriate drug treatment suitable for individual patients based on genomic information.

F) The method according to any one of A) to E) above, which is used for predicting the responsiveness of a patient to an antidepressant in a pharmacotherapy for the purpose of improving depression.
G) An antidepressant drug reactivity prediction support program for causing a computer to execute an antidepressant drug reactivity prediction of a subject based on the test result described in any of A) to E) above.
H) In the method described in A) above, the genetic polymorphism test comprises the steps of amplifying a gene region sandwiching the polymorphic site using genomic DNA prepared from the subject as a template, and the obtained amplified fragment. And genotyping.
I) A method for examining a genetic polymorphism using a genetic polymorphism testing instrument such as a DNA chip in the method described in A) above.
J) Oligonucleotide for genetic polymorphism testing used in the method described in I) above.
K) A genetic polymorphism testing kit used in the method described in A) above.
L) A method for screening an antidepressant using a tryptophan hydroxylase-2 (TPH2), dopamine D2 receptor (DRD2) gene or tyrosine hydroxylase (TH) gene as a target (drug discovery target).
According to the present analysis, a correlation was found between each polymorphism of TPH2, DRD2 and TH and antidepressant reactivity, and this result indicates that the expression of TPH2, DRD2 and TH based on these gene polymorphisms. It can be said that individual differences in the amount (or activity, etc.) affect the reactivity of antidepressants. Therefore, searching for substances that change TPH2, DRD2 or TH as a target (drug discovery target) and change its expression level or activity, etc., is used in combination with antidepressants such as SSRIs to develop drugs that improve their efficacy Useful for.

  According to the present invention, the reactivity to an antidepressant can be predicted simply and quickly based on the gene polymorphisms of TPH2, DRD2, and TH. Therefore, in the treatment of depression using an antidepressant, It can be suitably used for predicting patient responsiveness to depression. As described above, the clinical effects of antidepressants, especially SSRIs, vary greatly from person to person. However, the severity of depression is likely to lead to suicide attempts. There has been a strong desire to perform an appropriate drug treatment suitable for individual patients by making an objective prediction at an early stage of treatment. The present invention makes it possible to predict the antidepressant drug responsiveness of a patient with high accuracy before administration, realize effective and safe depression treatment, and contribute to improvement of medical quality and improvement of treatment efficiency. Is.

It is a graph which shows the result of having investigated the correlation with the gene polymorphism (rs11178997 polymorphism) of TPH2 and the reactivity with an antidepressant SSRI. It is a graph which shows the result of having investigated the correlation with the reactivity with respect to the antidepressant drug SSRI and the gene polymorphism of TPH2 (rs11178997 polymorphism) in the group whose LPR polymorphism of a serotonin transporter gene is s / s. It is a graph which shows the result of having investigated the correlation with the reactivity with the antidepressant drug SSRI combining the said gene polymorphism (rs11178997 polymorphism) of said TPH2 and said LPR polymorphism. It is a figure explaining the polymorphism on DRD2 gene. It is a graph which shows the result of having investigated the correlation with Taq1A polymorphism (rs1800497 polymorphism) of the said DRD2 gene, and the reactivity with an antidepressant drug SSRI. It is a figure explaining the polymorphism on TH gene. It is a graph which shows the result of having investigated the correlation with the TCAT repeat polymorphism of the said TH gene, and the reactivity with respect to the antidepressant drug SSRI (paroxetine). It is a graph which shows the result of having investigated the correlation with the TCAT repeat polymorphism of the said TH gene, and the reactivity with respect to the antidepressant drug SSRI (fluvoxamine).

Hereinafter, preferred embodiments of the present invention will be described. In the present specification and drawings, when bases, amino acids, etc. are represented by abbreviations, the representation is based on abbreviations by IUPAC-IUB Commission on Biochemical Nomenclature or common abbreviations in the field, for example, the representation of DNA bases. Is as follows.
A or a: adenine, G or g: guanine, C or c: cytosine, T or t: thymine, R or r: adenine or guanine, M or m: adenine or cytosine, W or w: adenine or thymine, S or s: guanine or cytosine, K or k: guanine or thymine, Y or y: cytosine or thymine.

  In addition, numbers, numerical values, and other information related to gene polymorphisms, gene sequences, etc. are used in major gene databases available on the National Center for Biotechnology Information (NCBI) website, etc. Interpretation shall be made in consideration of numbers and numerical values.

[1] Gene polymorphism useful for predicting reactivity of antidepressants and prediction method using the same [1-1] Prediction of reactivity using TPH2 gene polymorphism As described above, the present inventors As a result of analyzing the relationship between the polymorphism of TPH2 and the reactivity to antidepressants, the gene polymorphism (rs11178997 polymorphism) useful for predicting the reactivity to antidepressant SSRI was identified as the promoter region of TPH2 gene. I found it. FIG. 1 is a graph showing that a significant correlation was observed between this rs11178997 polymorphism and reactivity to the antidepressant SSRI.

  The analysis method is roughly as follows. In other words, 100 patients (average age 43.7 ± 14.9) who were diagnosed as major depression or dysthymic disorder and obtained written consent, were randomly selected by the envelope method to use SSRI paroxetine or fluvoxamine. Assigned. The drug dose started at 20 mg and 50 mg, respectively, and could be increased to 40 mg and 150 mg, respectively, depending on the degree of symptom improvement. The clinical effect was evaluated over time by the Hamilton Depression Rating Scale (HAM-D) score, which is a scale of depression. The graph of FIG. 1 shows the results of 41 patients with depression who took fluvoxamine. The lower the “HAMD change rate (%)” on the vertical axis of the graph, the higher the improvement rate by the drug, that is, the higher the clinical effect.

Examination and determination of a patient's gene polymorphism (rs11178997 polymorphism) were performed by PCR after extracting genomic DNA from the peripheral blood of each patient (the examination method will be described later). Here, the above rs11178997 polymorphism will be explained. In the promoter region of the human chromosome 12 TPH2 gene, more specifically, when the translation start point of the TPH2 gene is “+1”, it is located upstream “−614”, and transcription When the start point is “+1”, the base at the position “−473” upstream thereof is a single nucleotide polymorphism (SNP) of T (thymine) or A (adenine) (Psychiatry Res. 2005,134 : 195-198). The base sequence of 51 nucleotides in length including the polymorphic site is shown below. In this base sequence, the rs11178997 polymorphism is located at the 26th position.
gattaccttatttgatcattacaca [T / A] tgtacgcttgtgtcaaaatatcaca

  The same sequence is also shown in SEQ ID NO: 1 in the sequence listing, but differs in that the base of the polymorphic site is represented by the universal code “w”. SEQ ID NO: 2 is a sequence in data registered and published with the number “rs11178997” in the SNP database, and the rs11178997 polymorphism is located at the 400th position in the sequence.

  As shown in FIG. 1, the “T / T” possessing group having the “T” allele in the rs11178997 polymorphism is homozygous for the “T / A” having the “T” allele and the “A” allele in heterogeneity. The clinical effect of fluvoxamine was higher than that of the possession group, and a significantly better therapeutic effect was obtained from the early stage of the second week after drug administration. In this analysis, no “A / A” holder having the “A” allele in a homozygote was detected. In the figure, “1/2”, “3/4”, and “5/6” indicate 1-2 weeks, 3-4 weeks, and 5-6 weeks, respectively, “n” indicates the number of patients in each group, “*”, “#” And “+” indicate p-values of t-test (the same applies to other graphs).

  Furthermore, the LPR polymorphism of the serotonin transporter gene of each patient was also examined. When the genotype of this LPR polymorphism is s / s, the results show that the clinical effect of fluvoxamine is significantly lower than that of the group carrying the “l” allele (Int Clin Psychopharmacol 2005, 20: 151-156). Therefore, in order to exclude the influence of the LPR polymorphism, the correlation between the rs11178997 polymorphism and the reactivity to fluvoxamine was examined in the s / s group which is a low improvement rate group. FIG. 2 is a graph showing the results. As shown in the figure, the tendency of the patient having rs11178997 polymorphism genotype “T / T” to respond well to fluvoxamine was maintained even in the s / s group.

  Thus, the rs11178997 polymorphism was shown to significantly correlate with reactivity to the SSRI drug fluvoxamine. Based on these results, the rs11178997 polymorphism of a depression patient is examined, and if the base of the polymorphic site is a genotype “T / T” having an allele of “T”, it is effective against SSRI. The reactivity can be predicted to be a responder. On the other hand, when the base of the polymorphic site is a genotype “T / A” or “A / A” having an allele of “A”, it is a non responder that has no effect on SSRI. The reactivity can be predicted to be a poor responder or a poor responder. Thus, by examining and determining the rs11178997 polymorphism, the patient's responsiveness (responsiveness) to antidepressants, ie whether the patient is a responder or a non-responder (or poor responder) before administration Can be predicted and thereby contribute to efficient and appropriate treatment of depression.

  The present invention is a method for predicting the antidepressant drug reactivity of a subject based on the test result of the TPH2 gene polymorphism (rs11178997 polymorphism). The test method is a method for directly testing the gene polymorphism. It is not limited to. For example, by examining other gene polymorphisms on the TPH2 gene that are linked to the rs11178997 polymorphism and form a haplotype, the rs11178997 polymorphism may be indirectly examined to predict antidepressant responsiveness. Can do. Moreover, since a correlation was found between the polymorphism of TPH2 and antidepressant reactivity in this analysis, antidepressant reactivity is predicted based on other gene polymorphisms present on the TPH2 gene. It is also possible.

  For example, the rs11178997 polymorphism is completely linked to the rs11178998 polymorphism (-52A / G) on the TPH2 gene, and when the rs11178998 polymorphism is the “A” allele, the rs11178997 polymorphism can be determined as the “T” allele. Thus, the rs11178997 polymorphism test may be tested with other linked mutations.

  When examining other gene polymorphisms on the TPH2 gene, the gene polymorphism is not limited to a single nucleotide polymorphism, for example, a polymorphism due to the presence or absence of a defective portion, that is, a specific polymorphism consisting of two or more bases. It may be a genotype having a difference between an insertion type having a base sequence and a deletion type lacking this base sequence. The present invention is not limited to a single nucleotide polymorphism, and may predict antidepressant drug reactivity based on a gene polymorphism based on the presence or absence of such a defective portion, or may be anti-defect based on other gene polymorphisms such as rearrangement. Depressant drug reactivity may be predicted.

  For genetic polymorphism testing and determination, for example, genomic DNA in a DNA sample prepared from the patient's blood is used as a template, the gene region sandwiching the polymorphic site is amplified by PCR, and the resulting amplified fragment is used as the basis. In addition, the genotype can be determined by a primer extension method or the like. The primer sequence used for the PCR method and the probe sequence used for the primer extension method can be designed with reference to the sequences shown in SEQ ID NOs: 1 and 2, for example. The genome sequence of TPH2 gene is registered and published in gene sequence databases such as GenBank with accession number “NC_000012 REGION: 70618893..70712488” (GeneID: 121278). NM_173353 ", etc., and may be designed with reference to the nucleotide sequences disclosed in these databases (especially when examining polymorphisms in the exon region or intron region of the TPH2 gene) ).

The above-described rs11178997 polymorphism was examined and determined using PCR-SSCP (single strand conformation polymorphism) as follows. First, for the PCR method, the PCR reaction solution (20 μl) was prepared by adding 60 ng of genomic DNA extracted from the patient's peripheral blood to the optimal buffer, enzyme, dNTP (each 0.2 mM), forward primer (0.5 μM) and reverse primer (0.5 μM). It was set as the composition containing. The sequences of the designed forward primer (TPH2 -473F) and reverse primer (TPH2 -473R) are as shown in the following (a) and (b), respectively. As PCR reaction conditions, 94 ° C. for 30 seconds, 50 ° C. for 30 seconds, and 72 ° C. for 30 seconds were used as one cycle, and DNA was amplified by performing this step for 35 cycles.
(a) 5'-GGCAATGGATATCTTGATTA-3 '(SEQ ID NO: 3)
(b) 5'-AACCTCAGTCTTTAAGCAAT-3 '(SEQ ID NO: 4)

  Next, the obtained PCR products were separated by a method called SSCP (single strand conformation polymorphism), and the gene difference was determined by the electrophoresis pattern. In this method, the PCR product was first diluted 4-fold with Tris buffer, and 6 μL of denaturing solution was added to 3 μL of this sample. The denaturing solution is a solution of 94% formamide, 0.05% xylene cyanol blue solution, 0.04% bromophenol blue. Next, the PCR product was heat-denatured by treatment at 95 ° C. for 5 minutes. Then, after electrophoresis using GeneGel Excel 12.5 / 24 kit (Amersham), silver staining was performed. Genetic differences were determined from the electrophoresis pattern obtained by this silver staining, and the genotype in the rs11178997 polymorphism was determined. Furthermore, in order to confirm the gene difference, the difference obtained by the SSCP method was also confirmed by the direct sequence method and the TaqMan method.

[1-2] Reactivity prediction using DRD2 gene polymorphism In recent years, not only serotonin and noradrenaline nervous system but also dopamine nervous system has been reported to affect the clinical effects of antidepressants. (Journal of Affective Disorders. 2005, 86: 37-45). Therefore, the present inventors conducted a search for factors of the dopamine nervous system as gene polymorphisms useful for predicting antidepressant responsiveness. As a result, the present inventors conducted studies on dopamine D2 receptor (DRD2) and tyrosine hydroxylase (TH). The gene polymorphism was correlated with the clinical effect of antidepressants.

  The correlation between the polymorphism of DRD2 and psychosis has been attracting attention and research has been advanced. For example, correlation between promoter region of DRD2 and polymorphism of 3′UTR region and schizophrenia (Human Molecular Genetics. 1997, 6: 577-582) and manic depression (Psychiatry Research. 1999, 86: 193-201) There is a report that examined. Moreover, it has been reported that the amount of ligand binding to DRD2 in the striatum was increased in responders to the antidepressant SSRI (Psychiatry Research. 1999, 90: 91-101). However, there is no report examining the relationship between the antidepressant reactivity and DRD2 gene polymorphism. Of course, there is no report on the correlation between the prevalence of major depression and the polymorphism.

  FIG. 4 shows typical gene polymorphisms of DRD2, among which -141C Ins / Del polymorphism in the promoter region, Taq1A polymorphism in the 3′UTR region (rs1800497 polymorphism), and exon 7 The Ser311Cys polymorphism has been studied in many diseases. FIG. 5 is a graph showing that as a result of analysis by the present inventors, a significant correlation was observed between Taq1A polymorphism and reactivity to antidepressant SSRI. The analysis method is the same as in the case of TPH2, and the graph in FIG. 5 shows the results of 41 depressed patients who took fluvoxamine. The lower the “HAMD change rate (%)” on the vertical axis of the graph, the higher the improvement rate by the drug, that is, the higher the clinical effect.

  As shown in the figure, in the Taq1A polymorphism, the A2 allele possessing group (that is, the “A1 / A2” having the “A1” allele and the “A2” allele heterogeneously and the “A2 / H2” allele having the homozygous “A2 / A2” allele A2 ”) had a higher clinical effect of fluvoxamine than the“ A1 / A1 ”group having the A1 allele homologously, and a significantly better therapeutic effect was obtained from the early stage of the second week of drug administration. Note that “★” in the figure indicates that there was a significant difference between the A2 allele possessing group and the A1 allele homozygous group by repeated measure ANOVA (FIGS. 7 and 8 are also the same). Shows that there was a significant difference in the analysis).

  Thus, the Taq1A polymorphism was shown to significantly correlate with the reactivity to the SSRI drug fluvoxamine. Based on these results, the Taq1A polymorphism of depressed patients is examined, and if the polymorphism is in the A2 allele-bearing group (“A1 / A2” or “A2 / A2”), it has an effect on SSRI. Reactivity can be predicted to be a responder. On the other hand, when the polymorphism is the A1 allele homozygote group “A1 / A1”, the reactivity is predicted to be a non-responder that has no effect on SSRI or a poor responder (poor responder). be able to. Thus, by examining Taq1A polymorphism alone, it is possible to determine whether a patient is responsive to an antidepressant (therapeutic response), that is, whether the patient is a responder or a non-responder. This can contribute to efficient and appropriate treatment of depression.

The examination and determination of the Taq1A polymorphism was performed as follows using PCR-RFLP (Restriction Fragment Length Polymorphism) method. First, for the PCR method, the PCR reaction solution (20 μl) was prepared by adding 30 ng of genomic DNA extracted from the patient's peripheral blood to the optimal buffer, enzyme, dNTP (each 0.2 mM), forward primer (0.5 μM) and reverse primer (0.5 μM). It was set as the composition containing. The sequences of the designed forward primer (D2-Taq1A F) and reverse primer (D2-Taq1A R) are as shown in (a) and (b) below, respectively. As PCR reaction conditions, 94 ° C. for 30 seconds, 58 ° C. for 30 seconds, and 72 ° C. for 30 seconds were used as one cycle, and DNA was amplified by performing this step for 35 cycles.
(a) 5'-CCGTCGACCCTTCCTGAGTGTCATCA-3 '(SEQ ID NO: 5)
(b) 5'-CCGTCGACGGCTGGCCAAGTTGTCTA-3 '(SEQ ID NO: 6)
Next, 5 μl of the obtained PCR product was cleaved by reacting with 5 U restriction enzyme Taq I at 65 ° C. for 3 hours or more. Then, electrophoresis (100 V, 20 minutes) was performed on a 3% agarose gel, and determination was performed by EtBr staining.

  Of course, the Taq1A polymorphism inspection method is not limited to the above method. In addition to the method of directly examining the Taq1A polymorphism, the Taq1A polymorphism is indirectly examined by examining other gene polymorphisms on the DRD2 gene that are linked to the Taq1A polymorphism and form a haplotype, Anti-depressant responsiveness may be predicted. Furthermore, since a correlation was found between the polymorphism of DRD2 and antidepressant reactivity in this analysis, antidepressant reactivity is predicted based on other gene polymorphisms present on the DRD2 gene. It is also possible.

The base sequence of 201 nucleotides in length including the Taq1A polymorphic site is shown below. In this base sequence, the Taq1A polymorphic site is located at position 101, the A1 allele is “T” (thymine), and the A2 allele is “C” (cytosine). In testing Taq1A polymorphism, probes and primers can be designed based on this sequence information, and the polymorphism can be examined.
CCCTCTAGGAAGGACATGATGCCCTGCTTTCGGCTGCGGAGGGCCAGTTG
CAGGGGTGTGCAGCTCACTCCATCCTGGACGTCCAGCTGGGCGCCTGCCT
(T / C)
GACCAGCACTTTGAGGATGGCTGTGTTGCCCTTGAGGGCGGCCAGGTGGG
CGGGTGTCCAGCCCACCTTGTTGCGGGCGTGGACATTTGCGTGATGTTCT
The same sequence is also shown in SEQ ID NO: 7 in the sequence listing, but differs in that the base of the polymorphic site is represented by the universal code “Y”.

[1-3] Prediction of reactivity using TH gene polymorphism In addition to the above Taq1A (rs1800497) polymorphism, the present inventors have made a TCAT repeat polymorphism of tyrosine hydroxylase (TH) responsible for the rate-limiting step of dopamine biosynthesis. (TH tetranucleotide (TCAT) repeat polymorphism) was also found to be useful for predicting reactivity to antidepressants.

  FIG. 6 shows representative gene polymorphisms of TH. In the TH gene, the above-mentioned TCAT repeat polymorphism in intron 1 has been studied most frequently in relation to various diseases, but there is also a Val81Met polymorphism with amino acid substitution, which is correlated with schizophrenia. (Neuropsychiatric Genetics. 2003, 116B: 23-26, Molecular Psychiatry. 2001, 6: 315-319). In the TCAT repeat polymorphism, activation of the noradrenergic nervous system (Hypertension. 1999, 32: 676-682, Life Science. 1997, 61: 1341-1347) and reduced extroversion in healthy individuals (Neuroscience Research. 2006, 54) : 180-185). In addition, there was an association with the incidence of manic depression and major depression, but there was no correlation (American Journal of Medical Genetics. 1997,74: 176-178, 1999,88: 88-94) . As with the DRD2 polymorphism, there has been no report on the TCAT repeat polymorphism that examines the relationship with the antidepressant drug reactivity. The TCAT repeat polymorphism has 6 to 10 repeats (T6 to T10) alleles, 9 repeats for Japanese, and 10 repeats for Caucasian.

  FIG. 7 and FIG. 8 are graphs showing that a significant correlation was observed between the TCAT repeat polymorphism and reactivity to the antidepressant SSRI. The analysis method is the same as in the case of TPH2 and DRD2, but the graph in FIG. 7 shows the results for 39 depressed patients who took paroxetine, while the graph in FIG. 8 shows 41 depressed patients who took fluvoxamine. Is the result of

  As shown in FIG. 7, in the TCAT repeat polymorphism, a group having alleles other than 9 repeat alleles (that is, “9 + /” having 9 repeat alleles “9+” and other alleles “9-” in heterogeneity. "9- / 9-"), which has alleles other than 9- and 9 repeat alleles, has a higher clinical effect of paroxetine than the "9 + / 9 +" group, which has 9 repeat alleles. A significantly good therapeutic effect was obtained from the early stage of the second week after administration.

  On the other hand, regarding the clinical effect of fluvoxamine, the improvement rate in the above-mentioned two groups showed an opposite tendency. That is, as shown in FIG. 8, the “9 + / 9 +” group having 9 repeat alleles in the homology group has an allele other than 9 repeat alleles (“9 + / 9−” or “9− / 9”). -”), The clinical effect of fluvoxamine was significantly higher.

  Thus, the TCAT repeat polymorphism significantly correlates with reactivity to the antidepressant SSRI. Based on these results, TCAT repeat polymorphisms in depressed patients are examined, and if the polymorphism is in the “9 + / 9 +” group with 9 repeat alleles homozygously, than fluvoxamine (or similar) It can be predicted that the treatment responsiveness is higher for the patient taking the antidepressant drug showing the above tendency. On the other hand, in the case where the polymorphism has an allele other than 9 repeat alleles (“9 + / 9-” or “9- / 9-”), paroxetine (or an antibacterial tendency similar to that of fluvoxamine). It can be predicted that taking the (depressant) is more responsive to the patient. Thus, by examining the TCAT repeat polymorphism, the patient's responsiveness (therapeutic responsiveness) to the antidepressant used, that is, whether the drug can be expected to have a more therapeutic effect on the patient before administration. Can be predicted and thereby contribute to efficient and appropriate treatment of depression.

The examination and determination of the TCAT repeat polymorphism were performed as follows using the PCR method. First, for PCR, the PCR reaction solution (20 μl) contains optimal buffer, enzyme, dNTP (each 0.2 mM), forward primer (1 μM) and reverse primer (1 μM) in 60 ng of genomic DNA extracted from patient peripheral blood. It was set as the composition. The sequences of the designed forward primer (TH 1F) and reverse primer (TH 1R) are as shown in (a) and (b) below. As PCR reaction conditions, 94 ° C. for 30 seconds, 58 ° C. for 30 seconds, and 72 ° C. for 30 seconds were used as one cycle, and DNA was amplified by performing 40 cycles.
(a) 5'-CAGCTGCCCTAGTCAGCAC-3 '(SEQ ID NO: 8)
(b) 5'-GCTTCCGAGTGCAGGTCACA-3 '(SEQ ID NO: 9)
Next, the obtained PCR product was electrophoresed using a capillary, and the difference of 4 bp was observed and judged.

  Of course, the inspection method for the TCAT repeat polymorphism is not limited to the above method. In addition to the method of directly testing the TCAT repeat polymorphism, the TCAT repeat polymorphism is indirectly detected by examining other gene polymorphisms on the TH gene that are linked to the TCAT repeat polymorphism and form a haplotype. You may test to predict antidepressant responsiveness. Furthermore, since this analysis found a correlation between the TH gene polymorphism and antidepressant reactivity, it predicts antidepressant reactivity based on other gene polymorphisms present on the TH gene. It is also possible.

The base sequence of 234 nucleotides in length including the TCAT repeat polymorphic site is shown below. This sequence is a sequence of 9 repeat alleles, and the site in parenthesis corresponds to the polymorphic site. In testing for a TCAT repeat polymorphism, probes and primers can be designed based on this sequence information, and the polymorphism can be tested.
AGCTCATGGTGGGGGGTCCTGGGCAAATAGGGGGCAAAATTCAAAGGGTA
TCTGGGCTCTGGGGTGATTCCCATTGGCCTGTTCCTCCCTTATTTCCC
(TCAT / TCAT / TCAT / TCAT / TCAT / TCAT / TCAT / TCAT / TCAT)
TCACCATGGAGTCTGTGTTCCCTGTGACCTGCACTCGGAAGCCCTGTGTA
CAGGGGACTGTGTGGGCCAGGCTGGATAATCGGGAGCTTTTCAGCCCACA
The same sequence (9 repeat allele) is also shown in SEQ ID NO: 10 of the sequence listing.

[1-4] Reactivity prediction using multiple gene polymorphisms The present invention examines at least one polymorphism associated with TPH2 gene, DRD2 gene or TH gene and predicts reactivity to antidepressant drugs However, a method of examining a plurality of gene polymorphisms related to these genes and predicting the reactivity to an antidepressant based on the test results is a preferable method. A method of predicting the reactivity to an antidepressant by combining a related gene polymorphism with another gene polymorphism is also a preferable method.

  For example, FIG. 3 is a graph showing the results of examining the correlation between the TPH2 gene polymorphism (rs11178997 polymorphism) and the test results of the LPR polymorphism and the patient's response to the antidepressant fluvoxamine. . In the figure, “wild” and “hetero” indicate that the genotype of the rs11178997 polymorphism is “T / T” and “T / A”, respectively, and “l / s”, “l / l”, and “s / s”. Indicates the genotype of the LPR polymorphism. As shown in the figure, the combination of “l / l” and “wild” has the highest therapeutic response, while the combination of “s / s” and “hetero” has the highest therapeutic response. It was low. Each combination of “s / s” and “wild”, “l / s” and “hetero”, “l / s” and “wild” shows intermediate therapeutic responsiveness between them and is constant for SSRI. The reactivity can be predicted to be a responder that shows an effect. Thus, by combining the test results of a plurality of gene polymorphisms, it is possible to predict the reactivity more finely.

In addition, the following polymorphisms (1) to (6) related to the serotonin receptor (HTR) subtype (1A, 2A, 3A, 3B) and reactivity to the antidepressant SSRI Since a correlation was also recognized, it is a preferable method to predict the reactivity to an antidepressant by combining the gene polymorphism of TPH2, DRD2 or TH and the gene polymorphism of serotonin receptor.
(1) HTR1A 272Gly / Asp: rs1800042
CTGGGCGTGG AGAGCAAGGC TGGGG
(G / A)
TGCTCTGTGC GCCAATGGCG CGGTG
(2) HTR1A -1019C / G: rs6295
GTTGTTGTCGTCGTTGTTCGTTTGTTTTTGGAGACGGAGTCTCGCTCTGT
CGCCCAGGCTGGAGTGCAATGGCGCGAGAACGGAGGTAGCTTTTTAAAAA
(C / G)
GAAGACACACTCGGTCTTCTTCCATCAATTAGCAATAATTGGGAGACTGA
CCCAGGACTGTTCACCTTCCCATTCAGGCTCCCTATGCTTCCTTTTCTCA
(3) HTR2A-1438A / G: rs6311
TAAGTGGCACTGTGGTAATTTTTTAGGCTGAAGGGTGAAGAGAGAACATA
AATAAGGCTAGAAAACAGTATGTCCTCGGAGTGCTGTGAGTGTC
(T / C)
GGCACTTCCATCCAAAGCCAACAGTGTTTGTGTCCAGAGTGGAATTACTG
ACATTGGCCACATAGGCTCAGGGTGGCTAGGCACGTCTGTGGTGATAACT
CTGATAAACTATTAGCACTATTTTTATTTAATAGATACACCATTGAACTG
GCTTATTTTCTTCAGCAGAAATATGCCACCCAGATATTATTCAAAACCTC
ACATGTGGTAGGAAATAAGTTGGTTTCGCAGTACCAATTTTTTTCCCCCA
CCAGTAATGACAACTTGCCTTACTTGTAAAGAAAGCCCTTTCCCAAGTAG
GTTTCTAAAGGAGGCAGTTCGATCTCTCTCTTTTTGCAGGCATGAAAATA
TTTTCCTCAATAGTTGGGTTTTGCTACAGTTCTATCACCTTCTGTTCTTC
ACATTCTCCCTGGACAAATTCAACCACTCTCATGCCTTCAATATGTTTGT
GGCCAAGTCTGTACCTTCATAGCTGATTATTTCTCTCAGTTCCAGACCTA
(4) HTR2A 102T / C: rs6313
GCCTCAGTGTTACAGAGTGTGGGTACATCAAGGTGAATGGTGAGCAGAAAC
TATAACCTGTTAGTCCTTCTACACCTCATCTGCTACAAGTTCTGGCTTAGA
CATGGATATTCTTTGTGAAGAAAATACTTCTTTGAGCTCAACTACGAACTC
CCTAATGCAATTAAATGATGACACCAGGCTCTACAGTAATGACTTTAACTC
(T / C)
GGAGAAGCTAACACTTCTGATGCATTTAACTGGACAGTCGACTCTGAAAA
TCGAACCAACCTTTCCTGTGAAGGGTGCCTCTCACCGTCGTGTCTCTCCT
TACTTCATCTCCAGGAAAAAAACTGGTCTGCTTTACTGACAGCCGTAGTG
ATTATTCTAACTATTGCTGGAAACATACTCGTCATCATGGCAGTGTCCCTA
(5) HTR3A 178C / T: rs1062613
CAGGCTGGCTGGGACATGAGGTTGGCAGAGGGCAGGCAAGCTGGCCCTTG
GTGGGCCTCG
(C / T)
CCTGAGCACTCGGAGGCACTCCTATGCTTGGAAAGCTCGCTATGCTGCTG
TGGGTCCAGC
(6) HTR3B -100_-102AAG ins / del
GTGTTTACAAAATAGCACCAGTAAGGATAGCATCAACTGGCAAACGGAG
(AAG /-)
GAGGAGAACAGAGTGGAGAGGAACCCTGTTAGGAGAAATTGAGCGGCATT
CCATCT

  The sequences described under each of the gene polymorphisms in (1) to (6) above are base sequences in the vicinity of that including the polymorphic site, and the site in parenthesis corresponds to the polymorphic site. These base sequences are also described in SEQ ID NOs: 11 to 16 in the sequence listing, respectively, but in the sequence listing, the base of the polymorphic site is represented by one letter by the universal code. The gene polymorphism of (6) above is a polymorphism depending on the presence or absence of a defective portion, and SEQ ID NO: 16 describes the nucleotide sequence of the insertion type (ins). In addition, the gene polymorphism (HTR2A-1438A / G) in (3) above is a number when converted into a reverse complemented strand, and thus is T / C in the above sequence (same in SEQ ID NO: 13).

  A specific correlation between each of the gene polymorphisms (1) to (6) of the serotonin receptor (HTR) and the therapeutic response to the antidepressant SSRI will be described as follows. First, with regard to the polymorphism (HTR1A 272Gly / Asp: rs1800042) of (1), a tendency toward an early improvement rate was observed among Asp allele holders. In addition, for the polymorphism (HTR1A-1019C / G: rs6295) in (2), the improvement rate tends to be high in the C / C group. For the polymorphism (HTR2A-1438A / G: rs6311) in (3), A tendency for a high improvement rate was observed in the G / G group. The polymorphism (HTR2A 102T / C: rs6313) in (4) was completely linked to the polymorphism in (3) above (linkage disequilibrium), so a trend toward a high improvement rate was observed in the C / C group. It was. Regarding the polymorphism (HTR3A 178C / T: rs1062613) in (5), the improvement rate tends to be high in the C / C group, but for the polymorphism (HTR3B -100_-102AAG ins / del) in (6), ins / There was a tendency for a high improvement rate in the ins group.

  In addition, a logistic analysis was conducted on the antidepressants SSRIs fluvoxamine and paroxetine for each drug. First, when the logistic analysis was performed on the clinical effect of fluvoxamine and the three gene polymorphisms (the rs11178997 polymorphism, the Taq1A polymorphism and the LPR polymorphism) with each factor, the odds ratio was 3.50 (rs11178997), 4.58 (Taq1A) However, the odds ratio was 32.86, and the prediction rate of reactivity to fluvoxamine was further improved. Similarly, paroxetine clinical effect and two gene polymorphisms (rs11178997 polymorphism and TCAT repeat polymorphism) were analyzed by combining the two polymorphisms, and the odds ratio was 15.5. The rate has improved. Thus, a method of predicting reactivity to an antidepressant by combining a plurality of gene polymorphisms is a preferred method.

  When predicting the reactivity of an antidepressant drug by combining test results of a plurality of gene polymorphisms, it is preferable to take care not to make the prediction method too complicated. For example, the prediction method based on discriminant analysis and the prediction method based on a decision tree as disclosed in the specification of International Application No. PCT / JP2006 / 312519 are performed when the reactivity prediction is performed by combining the test results of a plurality of gene polymorphisms. This is the preferred method.

  It is preferable to perform each prediction method described above using a program, and the present invention includes such an antidepressant drug reactivity prediction support program. That is, the prediction support program of the present invention predicts a patient's therapeutic response to an antidepressant to be used, based on (1) one or more gene polymorphisms related to any of TPH2, DRD2 and TH. (2) A method for predicting reactivity to an antidepressant by combining one or more gene polymorphisms related to any of TPH2, DRD2 and TH with an LPR polymorphism of a serotonin transporter gene, (3) A method for predicting responsiveness to an antidepressant by combining one or more gene polymorphisms related to any of TPH2, DRD2 and TH and a serotonin receptor gene polymorphism, etc. This causes the computer to perform an antidepressant drug reactivity prediction of the subject from the test result of the genetic polymorphism. The program of the present invention can be provided as a computer-readable recording medium on which the program is recorded. Such recording media include magnetic storage media such as flexible disks, hard disks, and magnetic tapes, optical storage media such as CD-ROM, CD-R, CD-RW, DVD-ROM, DVD-RAM, and DVD-RW, Examples include, but are not limited to, electric storage media such as RAM and ROM, and magnetic / optical storage media such as MO.

[2] Method for examining gene polymorphism In the present invention, methods for examining gene polymorphisms of TPH2, DRD2, and TH and other gene polymorphisms are not particularly limited, and polymorphisms on genes are directly or indirectly determined. Conventionally known methods that can be investigated automatically can be applied, and methods developed in the future may be used. Since the method of examining gene polymorphism by the PCR method used in this analysis is a simple method and has good accuracy, this method will be briefly described below.

  The DNA sample to be used for the examination may be purified and extracted from an arbitrary organ / tissue / cell (including blood, cells in amniotic fluid, cells obtained by culturing the collected tissue, etc.) according to a conventional method. As long as gene amplification by the PCR method is possible, the DNA purification / extraction step may be omitted or simplified.

  Next, for the identification (genotyping) of the genotype based on the polymorphic site, PCR is performed using the genomic DNA in the DNA sample prepared by the above method as a template, and the gene region sandwiching the polymorphic site is amplified. . Thereafter, based on the obtained amplified fragment, the genotype is determined by the Primer extension method (primer extension method), the PCR-RFLP method, or the method of examining the length of the amplified fragment by electrophoresis.

  Each condition in the PCR method, reagents and primers to be used are not particularly limited. In addition, the genetic polymorphism test may use a method other than the PCR method. If it is a method that can directly or indirectly test a polymorphism on a gene, a method of testing a base in a single nucleotide polymorphism (SNP) (SNP typing), a method of testing a polymorphism based on the presence or absence of a defective portion, Various conventionally known methods can be applied (see, for example, the document “Post-sequence genomics (1) SNP gene polymorphism strategy” (Nakayama Shoten)).

  As an example, an inspection method using a genetic polymorphism inspection instrument such as a DNA chip can be mentioned. This method produces a DNA chip (or similar instrument) on which a probe for testing gene polymorphisms of TPH2, DRD2 and TH, or a probe for testing other gene polymorphisms is arranged on a substrate. This is a method of typing genes by using the DNA chip or the like according to the presence or absence of a hybridization signal between a gene sample from a subject and a probe. As the probe, an oligonucleotide consisting of a base sequence in the vicinity including the base of the polymorphic site (for example, about 8 to 30 nucleotides in length) or a complementary sequence thereof can be used. Here, “DNA chip” mainly means a synthetic DNA chip that uses a synthesized oligonucleotide as a probe, but an affixed DNA microarray that uses cDNA such as a PCR product as a probe may also be used. Good. Such a DNA chip containing a probe for TPH2, DRD2 and TH gene polymorphism assay can be used as a reactivity prediction chip for an antidepressant SSRI.

  In addition, point mutation detection methods such as PCR-SSCP method and Allele specific PCR method may be used as genetic polymorphism testing methods, and other amplification methods (eg, RCA method) other than PCR method may be used. It may be used. Alternatively, after DNA amplification, the base sequence of the amplified fragment may be directly determined by a base sequence determination device (sequencer) or the like, and gene typing may be performed.

  Of course, genetic polymorphism testing may be performed based on polymorphisms present in intron sequences, control sequences, etc., in addition to coding sequences encoding proteins. If the polymorphism (mutation) is a mutation on the coding sequence, the polymorphism (mutation) can be detected based on cDNA prepared from RNA or mRNA. Furthermore, if it is a polymorphism (mutation) with amino acid substitution, the polymorphism (mutation) may be detected from the amino acid sequence of the protein.

  The gene polymorphism testing kit of the present invention uses primers or probes designed based on these gene sequences or their neighboring sequences in order to directly or indirectly test TPH2, DRD2 and TH gene polymorphisms. (1) Enzymes and reagents used for sample preparation, (2) Enzymes and reagents used for reverse transcription reaction, (3) Enzymes and reagents used for PCR method, (4) Base sequence One or two or more of enzymes, reagents, and the like used for determination may be included.

[3] Screening method of the present invention According to the present analysis, a correlation was found between TPH2, DRD2 and TH gene polymorphisms and antidepressant reactivity. It can be said that individual differences in the expression levels (or activities, etc.) of TPH2, DRD2 and TH based on this affect the reactivity of antidepressants. Therefore, the development of efficient antidepressants by targeting TPH2, DRD2 or TH as a target (drug discovery target) and searching for substances that affect the expression level, activity, binding to other substances, etc. It can be expected to develop drugs that can be used in combination with antidepressants such as SSRIs to improve their efficacy. The present invention includes such an antidepressant screening method targeting TPH2, DRD2 and TH.

  As the screening method of the present invention, various conventionally known methods for examining gene / protein expression levels, changes in protein activity, binding between molecules, and the like can be applied and are not particularly limited. Moreover, you may use the screening method newly developed after this invention. Any of in vitro and in vivo screening systems may be used, and screening may be performed with a cell-free system. In addition to human-derived genes and proteins used for screening, those derived from mice or other animals may be used. Of course, screening may be performed using information on the three-dimensional structure of the protein.

  As described above, the present invention relates to a method for predicting the reactivity of a subject to an antidepressant based on genetic polymorphisms of TPH2, DRD2, and TH. It can be used for testing, diagnosis, etc. in the treatment of depression used.

Claims (10)

  The rs11178997 polymorphism present in the promoter region of the tryptophan hydroxylase-2 (TPH2) gene is directly or indirectly examined, and based on the results, the base of the polymorphic site is homozygous to have an allele with “T”. / T ”holder predicts that the base of the polymorphic site is more responsive to antidepressants than those with an allele of“ A ”.   The method of claim 1, wherein the responsiveness to a selective serotonin reuptake inhibitor (SSRI) or serotonin and noradrenaline reuptake inhibitor (SNRI) used as an antidepressant is predicted.   The method according to claim 2, wherein the reactivity to fluvoxamine used as an antidepressant is predicted.   Furthermore, the serotonin transporter gene, the serotonin receptor gene, or a polymorphism existing in the vicinity thereof on the genome is examined, and the result is used to predict the responsiveness of the subject to an antidepressant. Item 2. The method according to Item 1.   The method according to claim 4, wherein the LPR polymorphism associated with the serotonin transporter gene is examined, and the result is used to predict the responsiveness of the subject to an antidepressant.   The method according to claim 1, wherein the method is used for predicting a patient's responsiveness to an antidepressant in a pharmacotherapy for improving depression.   2. The method according to claim 1, wherein the genetic polymorphism is examined by a step of amplifying a gene region sandwiching the polymorphic site using genomic DNA prepared from the subject as a template, and the obtained amplified fragment. Determining the genotype. The method of claim 1, wherein, a method for inspecting a genetic polymorphism using a DNA chip.   The oligonucleotide for a genetic polymorphism test | inspection used for the method of Claim 8.   A genetic polymorphism testing kit used in the method according to claim 1.

Images