WO2009066071A2

WO2009066071A2 - Antisense oligonucleotides for the modulation of gene expression and methods relating to the use thereof

Info

Publication number: WO2009066071A2
Application number: PCT/GB2008/003887
Authority: WO
Inventors: Simon Plyte; Alessandra Saccani; Saverio Minucci
Original assignee: Congenia S.R.L; Cripps, Joanna
Priority date: 2007-11-20
Filing date: 2008-11-19
Publication date: 2009-05-28
Also published as: WO2009066071A3; GB0722759D0

Abstract

The invention relates to oligonucleotides, in particular siRNA molecules, for modulating the expression of p66 shc. Disclosed herein are specific siRNA molecules which target mammalian p66shc mRNA and can be used in modulation of a signal transduction pathway that regulates stress response and lifespan in mammalian cells.

Description

ANTISENSE OLIGONUCLEOTIDES FOR THE MODULATION OF GENE EXPRESSION AND METHODS RELATING TO THE USE THEREOF

Field, of the invention

The present invention relates to oligonucleotides, in particular siRNA molecules, for modulating the expression of p66shc. Specifically, but not exclusively, the invention provides materials and methods for use in modulation of a signal transduction pathway that regulates stress response and lifespan in mammalian cells .

Background of the invention

The mammalian SHC locus encodes three isoforms: p52, p46 and p66. These isoforms differ by the presence of N- terminal sequences of variable length and share a C- terminal SH2 domain, a central collagen-homology domain (CHl) , rich in proline/glycine residues, and an N- terminal phosphotyrosine-binding domain (PTB) . The 110 amino acid N-terminal region unique to p66 is also rich in glycine and proline residues (CH2) .

The pββShc isoform is a splice variant of p52Shc/p46Shc (Migliaccio E. et al Embo J. 16, 706-716 (1997), a cytoplasmic signal transducer involved in the transmission of mitogenic signals from tyrosine kinases to Ras (Pelicci G. et al Cell 70, 93-104 (1992)). The p52/46Shc isoforms are involved in the cytoplasmic propagation of mitogenic signals from activated receptors to Ras (Bonfini L. et al Tibs 21, 257-261; 1996) . They are rapidly phosphorylated on tyrosine after ligand stimulation of receptors and, upon phosphorylation, form stable complexes with activated receptors and Grb2 , an adaptor protein for the Ras guanine nucleotide exchange factor SOS (Migliaccio E. et al Embo J. 16, 706-716 (1997); Pelicci G. et al Cell 70, 93-104 (1992); Rozakis- Adcock, M. et al Nature 360, 689-692 (1992)). These complexes induce Ras activation, as measured by increased RasGTP formation, Mitogen Activated Protein Kinase (MAPK) activity and FOS activation in cultured cells overexpressing p52Shc/p46Shc (Migliaccio, E. et al Embo J. 16, 706-716 (1997); Pronk, G. et al MoI. Cell. Biol.

14, 1575-1581 (1994); Lanfrancone, L. et al Oncogene 10, 907-917 (1995)). Likewise, p66Shc becomes tyrosine- phosphorylated upon receptor activation and forms stable complexes with activated receptors and Grb2. However, it inhibits c-fos promoter activation and does not affect MAPK activity, thereby suggesting that p66Shc acts in a distinct intracellular signalling pathway (Migliaccio E. et al Embo J. 16, 706-716 (1997)).

c-fos is transcriptionally activated in response to a large variety of adverse agents (environmental stress) , such as DNA-damaging agents (e.g. ultraviolet radiation, UV) or agents that induce oxidative damage (e.g. hydrogen peroxide, H₂O₂) (Schreiber, M. et al Embo J. 14, 5338-5349 (1995); Sen, C. et al FASEB J. 10, 709-720 (1996)).

The cDNA nucleotide sequence (with the ATG initiation site underlined) of human p66shc is shown in Figure IA (SEQ ID N0:l)and the amino acid sequence of human p66Shc is shown in Figure IB(SEQ ID NO: 2) . It is postulated that the major causal factor of aging is the accumulation of oxidative damage as an organism ages (Martin, G. M. et al Nature Genetics 13, 25-34 (1996); Johnson, F. B. et al Cell 96, 291-302 (1999); Lithgow G. J. et al Science 273, 80 (1996)). Indeed, transgenic flies that overexpress antioxidative enzymes have greater longevity (Orr W. C. et al Science 263, 1128-1130 (1994)); restriction of caloric intake lowers steady state levels of oxidative stress and damage and extends the maximum life span in mammals (Sohal R. S. et al Science 273, 59-63 (1996)). However, the genes that determine lifespan in mammals are not known. Among currently accepted evolutionary theories, it is postulated that aging is a post-reproductive process that has escaped the force of natural selection and that evolved through selection of alleles with early life benefits combined with pleiotropically harmful effects later in life. The postulated genes, since actively selected, are, therefore thought to regulate fundamental cellular processes, common to different species.

The present inventors have previously determined that p66 is a pivotal gene in the regulation of the cellular responses to environmental and oncogenic stresses and that it is involved in the process of aging and in tumour suppression (EP 116335, incorporated herein by reference) . p66 provided the first genetic information on the theory of aging. Mechanistically, p66 exerts its functions downstream to stress-activated serine kinases and upstream to p53-p21. It has previously been shown by the present inventors that targeted mutation of the mouse p66shc gene induces stress resistance and prolongs survival, as described in EP 116335, which is incorporated herein in its entirety. They have demonstrated that i) p66Shc is serine phosphorylated upon UV treatment or oxidative damage; ii) the serine-phosphorylation of pββShc by oxidative signals is mediated by Erkl and p38, as shown both in vivo and in vitro; iii) ablation of pββShc expression by homologous recombination enhances resistance to oxidative damage both in vitro and in vivo; iv) a serine-phosphorylation defective mutant of pββShc is unable to restore a normal stress response in pββShc targeted cells; v) mice carrying the pββShc targeted mutation have prolonged lifespan.

siRNAs that show some down-regulation expression of pββShc are known (Veeramani S. et al Oncogene 24, 7203- 7212 (2005), Wu Z. Journal of Cellular Physiology 209 996-1005 (2006), Tiberi L. et al BBRC 342 503-508 (2006) and Nemoto S. et al Journal of Biological Chemistry 281(15) 10555-10560 (2006)).

Veeramani et al . describe the transient knock-down of pβ6 She expression in rapidly growing prostate cancer cells by transfection with a plasmid encoding p66shc siRNA transcripts, designed to target the sequence 5'-

TGAGTCTCTGTCATCGCTG-3' (SEQ ID NO : 3 ) . This p66shc siRNA resulted in an approximately 40% decrease in the level of p66Shc protein in LNCaP cells and an approximately 45% knock-down of pββShc protein in PC-3 cells. Transient knock-down of pββShc protein levels in this way resulted in a decrease in cell proliferation in both cell types. Wu et al . have shown that incubation of human cells with an siRNA specific for both human and mouse p66shc, and designed to target the same p66shc sequence as the Veeramani siRNA described above, results in a 40% decrease in expression of pββShc protein after 48h and a 60% decrease in pββShc protein expression after 72h. Wu et al . have also shown that human cells incubated with this siRNA are more viable than untreated cells following addition of hydrogen peroxide. Incubation of cells with p66shc siRNA also reduced basal and oxidative stress- induced levels of reactive oxygen species in these cells and resulted in expression of some antioxidant enzymes under basal conditions and others in the presence of oxidative stress.

Tiberi et al . have shown that incubation of human cells with siRNA specific for p66shc (5'-gAA UgA gUC UCU gUC AUC gUC-3 ' (SEQ ID NO: 4) and 5'-CgA UgA CAg AgA CUC AUU CCG-3'(SEQ ID NO : 5 ) ) results in a decrease in the percentage of apoptotic cells following treatment with hydrogen peroxide in HeLa cells, but not in SaOs-2 cells.

Nemoto et al . have shown incubation of rat PC12 cells with an siRNA, which targets the mouse p66shc sequence GTACAACCCACTTCGGAATG(SEQ ID NO: 6), results in reduced oxygen consumption of these cells.

Summary of the Invention

The present inventors have appreciated that there is a need for improved methods of modulating p66 expression. Specifically, the present inventors have designed a novel siRNA, internally named GNX-R8, which targets both human and mouse p66shc mRNA. This siRNA has the nucleotide sequence 5 ' -CUCUGUCAUCGAUGGAGGAtt-3 ' (SEQ ID NO : 7 ) and is a much more potent down-regulator of pββShc protein expression than known siRNAs specific to p66shc, resulting in a >90% reduction in levels of pββShc protein in a range of treated mammalian cells.

Further, the inventors have shown that transfection of cells with GNX-R8 increases cell survival following treatment with hydrogen peroxide (H₂O₂) compared to untreated cells.

The increased efficacy of GNX-R8 compared to known siRNA sequences is believed to be due to: (i) the nucleotide sequence 5'-CUCUGU-3' at its 5' end and (ii) the nucleotide sequence 5'-UGGAGG-3' at its 3' end. Further, it is believed that this improved efficacy of GNX-R8 is caused by the position of certain nucleotides, in particular, a C at position 1, at least 3 A or U between positions 13-19 and an A at position 19. The sequence 5'- UGGAGG-3 ' at the 3 ' end of GNX-R8 corresponds to the seeding region, which is the first 2-7 bases of the antisense strand (corresponding to bases 13-18 of the sense strand) . This sequence is important for the initial complementary binding to the target RNA sequence and is therefore, important for determining specificity of the siRNA molecule. Indeed, GNX-R8 (SEQ ID NO: 7) differs from the human p66shc sequence provided in Fig. 1 (SEQ ID NO:l)at C255. Instead, GNX-R8 (SEQ ID NO : 7 ) contains A at position 12 which corresponds to position C255 of human p66shc as shown in Fig. 1(SEQ ID N0:l) .

Accordingly, at its most general, the present invention provides materials and methods for improved modulation of the expression of pββShc in cells using antisense oligonucleotides .

In a first aspect, the present invention provides an agent for use in reducing expression of pββShc in vitro or in vivo, said agent being selected from the group consisting of:

(a) an oligonucleotide being between 6 and 50 nucleotides in length and comprising the sequence 5'- CCU/TCCA-3' ;

(b) an oligonucleotide being between 6 and 50 nucleotides in length capable of binding to the sequence 5'-U/TGGAGG-3' of p66shc mRNA;

(c) an oligoduplex having a sense and an antisense strand, wherein said sense strand is between 6 and 50 nucleotides in length and comprises the sequence 5'- U/TGGAGG-3' ; and

(d) an oligoduplex having a sense strand and an antisense strand, wherein the sense strand is between 6 and 50 nucleotides in length and starts with the nucleotide sequence 5 ' -C/GU/TCU/TGU/T-3 ' at its 5' end.

Oligonucleotides in accordance with the present invention are preferably at least 14, 15, 16, 17, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.

In a preferred embodiment, the oligonucleotide is between 6 and 50 nucleotides in length, more preferably between 6 nucleotides and 30 nucleotides in length, more preferably between 10 and 30 nucleotides in length and even more preferably between 15 and 30 or even 20 and 30 nucleotides in length. It will be appreciated by those skilled in the art that oligonucleotides have an optimum length. Thus, it is within the capabilities of the skilled person to design an oligonucleotide in accordance with the invention being of optimum size, for example, no greater than 50 nucleotides in length and no shorter than 6 nucleotides.

As a preferred embodiment, the invention provides an agent which is an oligonucleotide of between 6 and 50 nucleotides in length comprising the sequence 5'- CCU/TCCA-3', or more preferably 5 ' -U/TCCU/TCCA-3 ' .

As another preferred embodiment, the invention provides an agent which is an oligonucleotide of between 6 and 50 nucleotides in length capable of binding to one of the following sequences of p66shc nucleic acid:

(a) 5'-17UGGAGG-3'

(b) 5' -T/UGGAGGX-3' , wherein X is A, U or T

(c) 5 ' -YINΠSΠSΠSΠSΠSΠSINNNNU/TGGAGGN(SEQ ID NO: 8), wherein Y is C or G and N is A, U, T, C or G (d) 5'-YNNlrøNNN]SINIrøU/TGGAGGX(SEQ ID NO : 9 ) , wherein Y is C or G, X is A, U or T and N is A, U, T, C or G

(e) CU/TCU/TGU/TCAU/TCGAU/TGGAGGA(SEQ ID NO: 10),

(f) CU/TCU/TGU/TCAU/TCGCU/TGGAGGA(SEQ ID NO: 11).

Oligonucleotide sequences based on the p66shc sequence may be designed to hybridise to the complementary sequence of nucleic acid (which includes DNA and cDNA, pre-mRNA, or mature mRNA) , thereby interfering with the production of polypeptide encoded by a given DNA sequence (e.g. either native p66Shc polypeptide or a mutant form thereof) , so that its expression is reduced or prevented altogether. In addition to the p66shc coding sequence, antisense techniques can be used to target the control sequences of the p66shc gene, e.g. in the 5' flanking sequence of the p66shc coding sequence, whereby the antisense oligonucleotides can interfere with the p66shc control sequences. The construction of antisense sequences and their use is described in Peyman and Ulman, Chemical Reviews, 90:543-584, (1990), Crooke, Ann. Rev. Pharmacol. Toxical., 32:329-376, (1992), and Zamecnik and Stephenson, P.N. A. S., 75:280-284, (1974).

Agents, such as oligonucleotides, provided by the invention may be wholly or partially synthetic and may include genomic DNA, cDNA or RNA. Where nucleic acid includes RNA, reference to the sequence should be construed as reference to the RNA equivalent, with U substituted for T. Accordingly, the agents, such as oligonucleotides, of the invention may be DNA, cDNA or mRNA, but are preferably small interfering RNA (siRNA) molecules .

In a preferred embodiment, the invention provides an agent, which is an oligoduplex having a sense and an anti-sense strand, wherein the sense strand is between 6 and 50 nucleotides in_length and comprises the sequence 5 ' -U/TGGAGG-3 ' or 5 ' -U/TGGAGGX-3 ' , wherein X is A, U or T. Preferably, the sense strand starts with the nucleotide C or G at its 5 ' end and more preferably starts with the sequence 5 ' -CU/TCU/TGU/T-3 ' , 5- CU/TCU/TGU/TC-3 ' or 5 ' -CU/TCU/TGU/TCA-3 ' at its 5' end.

In a second aspect, the present invention provides an siRNA molecule comprising a sense strand and an antisense strand, wherein the sense strand is between 6 and 50 nucleotides in length and comprises the nucleotide sequence 5 ' -UGGAGG-3 ' .

The sense strand and/or the antisense strand of siRNA molecules in accordance with the present invention are preferably at least 14, 15, 16, 17, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In a preferred embodiment, the nucleotide is between 6 and 50 nucleotides in length, more preferably between 6 nucleotides and 30 nucleotides in length, more preferably between 10 and 30 nucleotides in length and even more preferably between 15 and 30 or even 20 and 30 nucleotides in length. It will be appreciated by those skilled in the art that siRNA molecules have an optimum length. Thus, it is within the capabilities of the skilled person to design an siRNA molecule in accordance with the invention being of optimum size, for example, no greater than 50 nucleotides in length and no shorter than 6 nucleotides.

In a preferred embodiment, the sense strand of the siRNA molecule of the invention comprises the nucleotide sequence 5 ' -UGGAGG-3 ' or more preferably, the sequence 5 ' -UGGAGGX-3 ' , wherein X is A or U. In a preferred embodiment, the sense strand of the siRNA molecule of the present invention ends with the nucleotide sequence 5'- UGGAGGX-3' at its 3' end, wherein X is A or U. Preferably, the sense strand of the siRNA molecule starts with the nucleotide C or G at its 5' end and more preferably, starts with the nucleotide sequence 5'- CUCUGU-3', 5'-CUCUGUC-3' or 5 ' -CUCUGUCA-3 ' at its 5' end. Preferably, the sense strand of the siRNA molecule is 19 nucleotides in length and has a C or a G at position 1, at least 3 A or U nucleotides between positions 13-19 and an A or a U at position 19. In a preferred embodiment, the sense strand of the siRNA molecule of the present invention comprises the nucleotide sequence 5'- CUCUGUCAUCGAUGGAGGA-3' (SEQ ID N0:12)or has 50%, 60%, 70%, 80%, 90% or 95% sequence identity with the nucleotide sequence 5'-CUCUGUCAUCGAUGGAGGA-SMSEQ ID NO: 12). In a preferred embodiment, the sense strand of the siRNA molecule comprises the nucleotide sequence 5'- CUCUGUCAUCGAUGGAGGAtt-3 ' (SEQ ID NO : 7 ) . In another embodiment, the sense strand of the siRNA molecule consists of the nucleotide sequence 5'- CUCUGUCAUCGAUGGAGGAtt-3' (SEQ ID NO : 7 ) .

In a further preferred embodiment, the sense strand of the siRNA molecule comprises the nucleotide sequence 5'- CUCUGUCAUCGCUGGAGGAtt-3 ' (SEQ ID NO: 13). In another embodiment, the sense strand of the siRNA molecule consists of the nucleotide sequence 5'- CUCUGUCAUCGCUGGAGGAtt-3 ' (SEQ ID NO: 13). As another preferred embodiment, the antisense strand of the siRNA molecule of the present invention comprises a nucleotide sequence capable of binding to one of the following sequences of p66shc mRNA:

(a) 5 ' -UGGAGG- 3 '

(b) 5 ' -UGGAGGX-3 ' , wherein X is A or U

( c ) 5 ' -YNlSlN]XINNNNNNNTGGAGGN-3 ' ( SEQ ID NO : 14 ) , wherein Y is C or G and N is A, U, C or G

(d) 5 ' -YMSINNNNNNNNNTGGAGGX- 3 ' ( SEQ ID NO : 15 ) , wherein Y is C or G , X is A or U and N is A, U, C or G (e) 5 ' -CUCUGUCAUCGAUGGAGGA-S ' (SEQ ID NO : 12 ) ,

(f) 5' CUCUGUCAUCGCUGGAGGA-S' (SEQ ID NO: 16).

The agents and/or siRNA molecules of the present invention may be present in a vector for delivery to cells. Accordingly, the invention also provides a nucleic acid vector comprising an agent or siRNA molecule as defined above, or comprising a nucleic acid sequence encoding such an agent or siRNA molecule. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. Vectors may be plasmids, viral e.g. 'phage, or phagemid, as appropriate. For further details, see, for example, Molecular Cloning: A Laboratory Manual: 2^nd Edition, Sambrook et al . , 1989, Cold Spring Harbour Laboratory Press. Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in Current Protocols in Molecular Biology, Ausubel et al . eds . , John Wiley & Sons, 1992.

In one embodiment, the vector may comprise an oligonucleotide sequence according to the present invention in both the sense and antisense orientation, such that when expressed as RNA, the sense and antisense sections will associate to form a double stranded RNA.

The vector may also comprise one or more nucleic acid sequences which encode the sense and/or antisense strand of the siRNA molecules of the present invention. Preferably, the vector comprises the nucleic acid sequence 5 ' -CU/TCU/TGU/TCAU/TCGAU/TGGAGGA-3 ' (SEQ ID NO : 10 ) or 5 ' -U/TCCU/TCCAU/TCGAU/TGACAGAG-S ' (SEQ ID NO : 17 ) ; or a variant or fragment thereof. In another embodiment, the sense and antisense sequences are provided on different vectors. Preferably, the vector comprises the nucleic acid sequences 5 ' -CU/TCU/TGU/TCAU/TCGAU/TGGAGGA- 3' (SEQ ID NO: 10) and 5 ' -U/TCCU/TCCAU/TCGAU/TGACAGAG-3 ' SEQ ID NO: 17) or a variant or fragment thereof. In an alternative embodiment the A12 may be substituted for C12 (SEQ ID NO: 11) .

The agents and siRNA molecules of the present invention may be manufactured and/or used in the preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug. Preferably, the composition, pharmaceutical, medicament or drug comprises an agent, including an siRNA molecule, of the present invention in combination with a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. These compositions, pharmaceuticals, medicaments or drugs may be administered to individuals and the precise nature of the carrier or other material may depend on the route of administration, e.g. oral, intravenous, cutaneous or subcutaneous, intranasal, intramuscular, intraperitoneal, intrathecal, intracerebellar, intraocular, intratracheal, intraperitoneal routes, or hypodermic injection or intravascular perfusion. Naked or modified siRNA molecules may also be administered encapsulated in lipid vesicles, attached to polymer-based nanoparticles or a peptide or conjugated to lipids (e.g. cholesterol).

Pharmaceutical compositions for oral administration may be in tablet, capsule, powder or liquid form. A tablet may include a solid carrier, such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally include a liquid carrier, such as water, petroleum animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols, such as ethylene glycol, propylene glycol or polyethylene glycol may be included.

For intravenous, cutaneous or sub-cutaneous injection, or injection at the site of affliction, the active ingredient will be in the form of a parenterally acceptable aqueous solution, which is pyrogen-free and has a suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles, such as sodium chloride injection, Ringer's injection, lactated Ringer's injection. Preservatives, stabilisers, buffers, antioxidants and/or other additives may be included, as required.

Accordingly, in a third aspect of the invention, there is provided a composition comprising an agent, including an siRNA molecule, of the present invention in combination with a pharmaceutically acceptable carrier. Such a composition of the present invention may be used to reduce the expression of pββShc in vitro, ex vivo or in vivo, to disrupt the pββShc signal transduction pathway in a cell and to increase resistance in cells to oxidative stress. Oxidative stress has been implicated in the generation of many human diseases. Accordingly, the compositions of the present invention may be used to treat a disease selected from the group consisting of arteriosclerosis, ischemic heart disease, Parkinson's disease, Alzheimer's disease, complications of diabetes, emphysema, lung disease, myocardial infarction, stroke, premature aging, cell senescence, skin disease and cancer .

The composition of the invention may further comprise a second agent, e.g. an siRNA molecule, said second agent being capable of targeting different or overlapping sequences of the p66Shc gene. For example, the second agent may be specific for the 5 ' flanking sequence of the p66Shc coding sequence and be capable of disrupting p66Shc control sequences .

Agents, including siRNA molecules, in accordance with the present invention may be employed to modulate/regulate gene expression. In particular, in a fourth aspect of the invention there is provided a method for modulating the expression of pββShc in a cell comprising the step of contacting said cell with an agent, siRNA molecule or composition as defined above. In a preferred embodiment, said method results in the down-regulation of p66shc expression. Said method may be performed in vivo, ex vivo or in vitro. In a fifth aspect, the invention provides a method of disrupting the p66Shc signal transduction pathway in a cell, said method comprising the step of contacting said cell with an agent, an siKNA molecule or a composition as defined above. This method may be performed in vivo, ex vivo or in vitro.

In a sixth aspect, the invention provides a method of increasing resistance in cells to oxidative stress, said method comprising the step of disrupting the pββShc signal transduction pathway in said cell by contacting said cell with an agent, siRNA molecule or composition of the present invention. This method may be performed in vivo, ex vivo or in vitro.

Oxidative stress may be as a result of external (e.g. environmental) factors, such as UV, X-rays, heat shock, osmotic shock, oxidative stress caused by singlet oxygen, H2O2, hydroxyradicals or inflammatory cytokines or it may be as a result of internal factors resulting in necrosis of cells as occurs in some disease states.

In a seventh aspect, the invention provides a method of decreasing apoptosis in cells in response to oxidative stress, said method comprising the step of disrupting the pββShc signal transduction pathway by contacting the cell with an agent, an siRNA molecule or a composition of the present invention. This method may be performed in vivo, ex vivo or in vitro.

In an eighth aspect , the invention provides a method of increasing cell survival in response to oxidative stress , said method comprising the step of disrupting the pββShc signal transduction pathway by contacting the cell with an agent, siKNA molecule or composition of the present invention. This method may be performed in vivo, ex vivo or in vitro.

In a ninth aspect, the invention provides a method of treating an individual suffering from a disease associated with cellular oxidative stress, said method comprising administering a composition as defined above to said individual .

Oxidative stress has been implicated in the generation of many human diseases, such as arteriosclerosis, ischemic heart disease, Parkinson's disease, Alzheimer's disease, complications of diabetes, emphysema and other lung diseases, myocardial infarction, stroke, premature aging, cell senescence, skin diseases and cancers. Accordingly, in a preferred embodiment, the invention provides a method of treating an individual suffering from a disease selected from the group consisting of treatment of a disease from the group consisting of: arteriosclerosis, ischemic heart disease, Parkinson's disease, Alzheimer's disease, complications of diabetes, emphysema, lung disease, myocardial infarction, stroke, premature aging, cell senescence, skin disease and cancer.

It will be appreciated that the present invention covers the agents, siKMA molecules and/or compositions as defined above for use in the methods described above.

Similarly, the present invention covers the use of the agents and/or siRNA molecules as defined above in the preparation of a medicament for carrying out the methods described above.

Aspects and embodiments of the invention will now be illustrated, by way of example, with reference to the accompanying figures . Further aspects of the invention will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference.

Brief description of the drawings In the figures:

Figure IA shows the cDNA nucleotide sequence (with the ATG initiation site underlined) of human p66shc ( SEQ ID NO : 1 ) .

Figure IB shows the amino acid sequence of human pββShc (SEQ ID N0:2) .

Figure 2A shows the nucleotide sequence of the first 69 base pairs of a human cDNA sequence of p66shc (SEQ ID NO: 18). This sequence differs from the pββshc sequence shown in Fig. IA (SEQ ID N0:l)in that position 61 is A, whereas the corresponding position in Fig.l (255) is C.

The corresponding mouse sequence (SEQ ID NO: 19) is aligned below with vertical lines denoting sequence identity. Black lines above or below the DNA sequence denote the region covered by the various published siRNA sequences and GNX-R8. GNX-R8 covers p66shc nucleotides 50 to 68, the siRNA sequence described by Wu et al . 2006 (SEQ ID N0:21)and Veeramani et al . 2005 (SEQ ID NO : 3 ) covers nucleotides 45 to 63, the sequence described by Tiberi et a.1., 2006 (SEQ ID NO: 4) covers nucleotides 42 to 60 and the sequence described by Nemoto et a.1., 2006 (SEQ ID NO : 6) sequence covers nucleotides 27 to 45 corresponding to the human cDNA (but are identical to the mouse sequence in that region) .

Figure 2B shows the nucleotide sequence of an oligoduplex corresponding to GNX-R8. The figure shows both strands of the RNA sequence of the siRNA oligoduplex GNX-R8(SEQ ID NOs: 7 & 20) .

Figure 3 shows a comparison of the efficacy of depletion of p66Shc by GNX-R8 siRNA versus the siRNA oligoduplex described by Wu et al . , 2006 (5'-UGAGUCUCUGUCAUCGCUGdTdT- 3 ' ; (SEQ ID NO: 21)) in several cell lines: human hepatocellular carcinoma (Hep3B) , human glioblastoma (U87MG) , human microvascular endothelial cells (HMEC) , human retinal pigment epithelia (RPE) and a murine fibroblast cell line (NIH 3T3).. Cell lines were transfected with 20 nM GNX-R8 siRNA duplex or with 20 nM Wu siRNA using 3 μl of Oligofectamine (OF) or 4 μl Dharmafect (DH) transfection reagent, or were untransfected as a control (C) . Cells were harvested after 48 hrs (Hep3B and U87MG) or 72 hrs (RPE, HMEC and NIH 3T3) and lysed in standard buffer. Total lysed protein (20 μg) was separated by SDS-PAGE, transferred to PDF membrane and subjected to western blot analysis using anti-She antibodies to determine p66Shc protein levels. In addition, a western blot analysis was performed using anti-vinculin antibodies to verify equal protein loading per lane. The anti-She antibody recognises all three splice variants of the shc-A gene (pββ,p52, p46) and these are evident as three distinct bands on the western blot. In both human tumoural (U87MG and Hep3B) , human normal (RPE and HMEC) and mouse (NIH 3T3) cell lines GNX- R8 was more efficacious at ablating the p66Shc protein than a corresponding amount of the Wu siRNA indicating a significant increase in potency. In addition, no reduction in protein levels of the other two She splice variants was observed.

Figure 4 shows that siRNA interference with GNX-R8 can almost completely ablate pββShc from several cell lines. Five cell lines (Hep3B, U87MG, HMEC, RPE and NIH 3T3) were transfected with 20 nM of GNX-R8 siRNA duplex using 3 μl of oligofectamine (OF) or 4 μl of Dharmafect (DH) , as indicated. After 72 h or 96 h, total cell lysates were harvested and 20 μg of total cell extract was loaded per lane, separated by SDS-PAGE and subjected to western blot analysis. The resulting figure shows western blot analysis of pββshc protein levels in the five cell lines after treatment with GNX-R8 siRNA. The pββShc protein was depleted by >90% in all cell lines within the time course of the experiments demonstrating a significant ablation efficacy for GNX-R8.

Figure 5 shows IC₅₀ determination of GNX-R8 for the ablation of pββShc in U87MG cell line. The top panel shows western blot analysis for pββShc protein levels in U87MG cells after transfection with various concentrations of GNX-R8 (top panel) . A fixed number (5 X 10⁶) of U87MG cells were transfected with various concentrations of GNX-R8 in a dose escalation series ranging from 0.05 to 100 nM and harvested after 72 hrs . After cell lysis, SDS-PAGE separation (20 μg total cell extract per lane) , and western blot analysis using anti- p66Shc and anti-vinculin antibodies, the amount of pββShc protein remaining per treatment was determined by densitometry of the photographic film after ECL exposure. By this procedure, the concentration of GNX-R8 required to deplete 50% of the pββShc protein under these experimental conditions was 0.1 nM (IC50 = 0.1 nM) .

In addition, a similar experiment using a scrambled version of GNX-R8 , where the middle three base pairs in the siRNA sequence were inverted, had no effect on pββShc protein levels (middle panel). OF: oligofectamine; C: untransfected control.

The titration experiment described above was also performed using Wu siRNA, instead of GNX-R8 (bottom panel) . Comparison of the western blots shown in the top and bottom panels indicates that a higher concentration of the Wu oligoduplex (Wu et al . , 2006) is required compared to GNX-R8 to deplete 50% of the pββShc protein under the same experimental conditions. The IC50 of the Wu oligoduplex is > 1OnM. In comparison, the IC50 of GNX-R8 is 0.1 nM.

Figure 6 shows the effect of GNX-R8 on percentage cell survival after treatment with H₂O₂- NIH 3T3 cells were transfected with 20 nM GNX-R8, the scrambled version of GNX-R8 or the Dharmafect transfection buffer alone for 72 hrs. Cells were then treated with 0.8 πi H₂O₂ for a further 24 hrs and then harvested for cell viability and pββShc expression analysis. Figure 6A shows that GNX-R8 affords increased cell survival in NIH 3T3 cells after treatment with 0.8 mM H₂O₂ as < 50% of untransfected cells survived H2O2 treatment after 24 hrs whilst > 80% of the cells survive after treatment with GNX-R8. These data show that siRNA mediated ablation of pββShc by GNX-R8 is able to increase cell survival in response to oxidative stress in mouse fibroblasts. Figure 6B shows western blot analysis of the level of pββShc in NIH 3T3 cells after transfection with GNX-R8 siRNA and treatment with H₂O₂. 20 μg of total cell extract was loaded per lane and anti-pββShc and anti-vinculin antibodies were used for the western blot. A reduction in pββShc levels was observed in the GNX-R8-treated sample that showed resistance to H₂O₂-induced cell death. DH: Dharmafect ; Scr-R8: Scrambled siRNA of GNX-R8 ; Cntrl : Control untransfected cells.

Detailed Description The role of RNAi machinery and small RNAs in targeting heterochromatin complexes and the epigenetic gene silencing at specific chromosomal loci has previously been demonstrated in the art.

By way of background, double-stranded RNA (dsRNA)- dependent post transcriptional silencing, also known as RNA interference (RNAi) , is a phenomenon in which dsRNA complexes can target specific genes of homology for silencing in a short period of time. It acts as a signal to promote degradation of mRNA with sequence identity. A

20-nt siRNA is generally long enough to induce gene- specific silencing, but short enough to evade host response. The decrease in expression of targeted gene products can be extensive with 90% silencing induced by a few molecules of siKNA.

In the art, these KNA sequences are termed "short or small interfering KNAs" (siRNAs) or "microKNAs" (miRNAs) depending in their origin. Both types of sequence may be used to down-regulate gene expression by binding to complementary KNAs and either triggering mKNA elimination (KNAi) or arresting mKNA translation into protein. siRNAs are derived by the processing of long double stranded KNAs and when found in nature are typically of exogenous origin. Micro-interfering KNAs (miRNA) are endogenously encoded small non-coding KNAs, derived by processing of short hairpins. Both siRNA and miRNA can inhibit the translation of mRNAs bearing partially complementary target sequences without KNA cleavage and degrade mRNAs bearing fully complementary sequences .

Accordingly, the present invention provides the use of these siRNA sequences for downregulating the expression of pββShc.

The siRNA molecules are typically double stranded and, in order to optimise the effectiveness of RNA mediated down- regulation of the function of a target gene, it is preferred that the length of the siKNA molecule is chosen to ensure correct recognition of the siKNA by the RISC complex that mediates the recognition by the siRNA of the mKNA target and so that the siKNA is short enough to reduce a host response. miRNA ligands are typically single stranded and have regions that are partially complementary enabling the ligands to form a hairpin. miRNAs are RWA genes which are transcribed from DNA, but are not translated into protein. A DNA sequence that codes for a miRNA gene is longer than the miRNA. This DNA sequence includes the miRNA sequence and an approximate reverse complement . When this DNA sequence is transcribed into a single- stranded RNA molecule, the miRNA sequence and its reverse-complement base pair to form a partially double stranded RNA segment. The design of miRNA sequences is discussed in John et al, PLoS Biology, 11(2), 1862-1879, 2004.

Typically, the RNA ligands intended to mimic the effects of siRNA or miRNA have between 10 and 40 ribonucleotides (or synthetic analogues thereof) , more preferably between 17 and 30 ribonucleotides, more preferably between 19 and 25 ribonucleotides and most preferably between 21 and 23 ribonucleotides. In some embodiments of the invention employing double-stranded siRNA, the molecule may have symmetric 3' overhangs, e.g. of one or two (ribo) nucleotides, typically a UU of dTdT 3' overhang. Based on the disclosure provided herein, the skilled person can readily design of suitable siRNA and miRNA sequences, for example using resources such as Ambion ' s siRNA finder, see http : //www. ambion. com/techlib/misc/siRNA_finder.html . siRNA and miRNA sequences can be synthetically produced and added exogenously to cause gene downregulation or produced using expression systems (e.g. vectors) . In a preferred embodiment, the siRNA is synthesized synthetically.

Longer double stranded RNAs may be processed in the cell to produce siRNAs (see for example Myers (2003) Nature

Biotechnology 21:324-328) . The longer dsRNA molecule may have symmetric 3' or 5' overhangs, e.g. of one or two (ribo) nucleotides , or may have blunt ends. The longer dsKNA molecules may be 25 nucleotides or longer. Preferably, the longer dsRNA molecules are between 25 and 30 nucleotides long. More preferably, the longer dsRNA molecules are between 25 and 27 nucleotides long. Most preferably, the longer dsRNA molecules are 27 nucleotides in length. dsKNAs 30 nucleotides or more in length may be expressed using the vector pDECAP (Shinagawa et al . , Genes and Dev. , 17, 1340-5, 2003).

Another alternative is the expression of a short hairpin RNA molecule (shRNA) in the cell. shRNAs are more stable than synthetic siKNAs . A shRNA consists of short inverted repeats separated by a small loop sequence. One inverted repeat is complementary to the gene target. In the cell the shRNA is processed by DICER into a siRNA which degrades the target gene mRNA and suppresses expression. The shRNA may be produced endogenously

(within a cell) by transcription from a vector. shRNAs may be produced within a cell by transfecting the cell with a vector encoding the shRNA sequence under control of a RNA polymerase III promoter such as the human Hl or 7SK promoter or a RNA polymerase II promoter.

Alternatively, the shRNA may be synthesised exogenously (in vitro) by transcription from a vector. The shRNA may then be introduced directly into the cell. Preferably, ■ the shRNA molecule comprises a partial sequence of p66shc. Preferably, the shRNA sequence is between 40 and 100 bases in length, more preferably between 40 and 70 bases in length. The stem of the hairpin is preferably between 19 and 30 base pairs in length. The stem may contain G-U pairings to stabilise the hairpin structure.

siKNA molecules, longer dsRNA molecules or miRNA molecules may be made recombinantly by transcription of a nucleic acid sequence, preferably contained within a vector. Preferably, the antisense strand of the siKNA molecule, longer dsRNA molecule or miRNA molecule comprises a partial sequence of p66shc starting with the nucleotide sequence 5'-CUCUGU-S', 5'-CUCUGUC-S' or 5- CUCUGUCA-3' at its 5' end. The siKNA, longer dsRNA molecule or miRNA molecule may also comprise the nucleotide sequence 5'-CUCUGUCAUCGAUGGAGGA-SMSEQ ID NO: 12) .

In one embodiment, the siRNA, longer dsRNA or miRNA is produced endogenously (within a cell) by transcription from a vector. The vector may be introduced into the cell in any of the ways known in the art. Optionally, expression of the RNA sequence can be regulated using a tissue specific promoter. In a further embodiment, the siRNA, longer dsRNA or miRNA is produced exogenously (i.e. in vitro) by transcription from a vector.

In one embodiment, the vector may comprise an oligonucleotide sequence according to the invention in both the sense and antisense orientation, such that when expressed as RNA the sense and antisense sections will associate to form a double stranded RNA. The vector may also contain a nucleic acid sequence which encodes the siRNA sequences. Preferably, the vector comprises the nucleic acid sequence 5 ' -CU/TCU/TGU/TCAU/TCGAU/TGGAGGA- 3'(SEQ ID NO: 10); or a variant or fragment thereof. In another embodiment, the sense and antisense sequences are provided on different vectors. Preferably, the vector comprises the nucleic acid sequences 5'- CU/TCU/TGU/TCAU/TCGAU/TGGAGGA-S' (SEQ ID NO: 10) and 5'-

U/TCCU/TCCAU/TCGAU/TGACAGAG-3 ' (SEQ ID NO: 17) or a variant or fragment thereof .

Alternatively, siRNA molecules may be synthesized using standard solid or solution phase synthesis techniques which are known in the art. Linkages between nucleotides may be phosphodiester bonds or alternatives, for example, linking groups of the formula P(O)S, (thioate) ; P(S)S, (dithioate) ; P(O)NR"2; P(O)R¹; P(O)OR6; CO; or CONR'2 wherein R is H (or a salt) or alkyl (1-12C) and R6 is alkyl (1-9C) is joined to adjacent nucleotides through-O- or-S-.

Modified nucleotide bases can be used in addition to the naturally occurring bases and may confer advantageous properties on siRNA molecules containing them.

For example, modified bases may increase the stability of the siRNA molecule, thereby reducing the amount required for silencing. The provision of modified bases may also provide siRNA molecules which are more, or less, stable than unmodified siRNA. The term "modified nucleotide base' encompasses nucleotides with a covalently modified base and/or sugar. For example, modified nucleotides include nucleotides having sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3 'position and other than a phosphate group at the 5 'position. Thus modified nucleotides may also include 2 ' substituted sugars such as 2 ' -0-methyl- ; 2-0- alkyl ; 2-0-allyl ; 2'-S-alkyl; 2'-S-allyl; 2 ' -fluoro- ; 2 ' -halo or 2; azido-ribose, carbocyclic sugar analogues a-anomeric sugars; epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, and sedoheptulose .

Modified nucleotides are known in the art and include alkylated purines and pyrimidines, acylated purines and pyrimidines, and other heterocycles . These classes of pyrimidines and purines are known in the art and include pseudoisocytosine, N4,N4-ethanocytosine, 8-hydroxy-N6- methy1adenine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5 fluorouracil, 5-bromouracil, 5- carboxymethylaminomethyl-2-thiouracil, 5- carboxymethylaminomethyl uracil, dihydrouracil, inosine, N6-isopentyl-adenine, 1- methyladenine, 1- methylpseudouracil, 1-methylguanine, 2 , 2-dimethylguanine, 2methyladenine, 2-methylguanine, 3-methylcytosine, 5- methylcytosine, N6-methyladenine, 7-methylguanine, 5- methylaminomethyl uracil, 5-methoxy amino methyl~2- thiouracil, -D-mannosylqueosine, 5- methoxycarbonylmethyluracil, 5methoxyuracil, 2 methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methyl ester, psueouracil, 2-thiocytosine, 5-methyl-2 thiouracil, 2-thiouracil, 4-thiouracil, 5methyluracil, N- uracil-5-oxyacetic acid methylester, uracil 5-oxyacetic acid, queosine, 2-thiocytosine, 5-propyluracil, 5- propylcytosine, 5-ethyluracil, 5ethylcytosine, 5- butyluracil, 5-pentyluracil, 5-pentylcytosine, and 2 , 6, diaminopurine, methylpsuedouracil, 1-methylguanine, 1-methylcytosine .

Antisense molecules with modified nucleotides can also be obtained by Locked Nucleic Acid (LNA) derivatisation (Santaris Pharma A/S and Mook et al . , 2007, MoI. Cancer Ther . 6(3): 833-843. Such oligonucleotides may include DNA and/or RJNA nucleotides and are composed of at least one LNA selected from beta-D-thio/amino-LNA or alpha-L- oxy/thio/amino-LNA.

Methods relating to the use of RNAi to silence genes in C. elegans, Drosophila, plants, and mammals are known in the art (Fire A, et al . , 1998 Nature 391:806-811; Fire, A. Trends Genet. 15, 358-363 (1999); Sharp, P. A. RNA interference 2001. Genes Dev. 15, 485-490 (2001); Hammond, S. M., et al . , Nature Rev. Genet. 2, 110-1119 (2001); Tuschl, T. Chem. Biochem. 2, 239-245 (2001); Hamilton, A. et al . , Science 286, 950-952 (1999);

Hammond, S. M., et al . , Nature 404, 293-296 (2000); Zamore, P. D., et al . , Cell 101, 25-33 (2000); Bernstein, E., et al., Nature 409, 363-366 (2001); Elbashir, S. M., et al., Genes Dev. 15, 188-200 (2001); WO0129058; WO9932619, and Elbashir S M, et al . , 2001 Nature 411:494- 498) . Examples

Materials and Methods

1) Cell lines and antibodies Human RPE (retinal pigmented epithelial) cells were grown in a 1:1 mixture of Dulbecco ' s Modified Eagle's Medium and Ham's F12 medium with 2.5mM L-glutamine adjusted to contain 15mM Hepes, 1.2g/l sodium bicarbonate and supplemented with 0.01mg/ml hygromycin B and 10% fetal bovine serum.

HMEC (human microvascular endothelial cells) were grown in MCDB-131 with 2.5mM L-glutamine supplemented with IDg/ml Hydrocortisone, 10ng/ml EGF and 10% fetal bovine serum. U87MG (Human glioblastoma) .

Hep3B (human hepatocellular carcinoma) were grown in MEM with 2.5mM L-glutamine supplemented with 0. ImM NEAA₇ ImM Na Pyr and 10% fetal bovine serum.

NIH 3T3 cells (murine embryo fibroblast cells) were grown in Dulbecco' s Modified Eagle's Medium with 2.5mM L- glutamine supplemented with 10% Colorado calf serum.

Human glioblastoma (U87MG) were grown in MEM with 2.5mM L-glutamine supplemented with 0. ImM NEAA, ImM Na Pyr and 10% fetal bovine serum.

The antibodies used were: the anti-She polyclonal antibody which recognises the SH2 domain of all three She isoforms, p66, p52 and p46 (Pelicci G. et al . Cell 70, 93-104 (1992)); the anti-p66 polyclonal antibody which specifically recognises the pββShc isoform (Migliaccio E. et al. EMBO J. 16, 706-716 (1997)); the anti-vinculin antibody (Sigma; cat. no. V9131) .

2) Western blotting

Cells were lysed in JS buffer (5OmM Hepes, 15OmM NaCl,1.5mM MgCl, 1% glycerol, 1% triton, 5mM EGTA) plus protease inhibitors and then boiled in SDS gel loading buffer for 5 min. 20μg of total protein was loaded onto a 12% acrylamide gel and resolved by SDS-PAGE. The separated proteins were transferred to a nitrocellulose membrane (Protran, Schleicher and Schuell, Whatman). Non specific binding was blocked by incubation with 5% nonfat milk at room temperature for 30 min and then the membrane was incubated with primary antibody O/N at 4⁰C. The primary antibodies used were rabbit polyclonal anti human SHC (1:1000, Transduction Laboratories) and mouse monoclonal anti vinculin ' (1 : 10000 , Sigma). Membranes were washed in phosphate buffered saline (PBS) and then incubated at room temperature for Ih with HRP-linked anti mouse or anti rabbit antibodies. The proteins were detected by ECL solution (Amersham) .

3) Transfections Hep3B, U87MG were transfected with oligofectamine (OF)

Reagent (Invitrogen) and HMEC cells were transfected with Dharmafect (DH) . Cells were grown in a 6 well plate overnight in antibiotic free medium to reach 30-50% confluence. Oligoduplexes were diluted in serum free media to the desired concentration (0.05 to 100 nM) .

Oligofectamine reagent (3 μl) was diluted in serum free medium (12 μl) and incubated at RT for 10 mins . Oligoduplexes (diluted in 185 μl of media) were then mixed with the diluted oligofectamine reagent and incubated for a further 20 mins at RT. After washing with PBS, 800 μl of serum free media was added to the cells and the appropriate oligofectamine/oligoduplex mixture (200μl) was added and incubated in a tissue culture incubator for 4 hrs . A further 500 ml of media containing 30% FBS was added to the cells and they grown for up to 96 hrs. RPE, HMEC and NIH 3T3 cells were transfected using a similar protocol to that described above with the exceptions that 4 μl of Dharmafect 1 buffer was used as transfection reagent and the cells were incubated with media and oligoduplex-Dharmafect 1 complexes for 4 hrs in medium containing serum.

4) Construction of siRNA oligoduplex

Oligoduplexes were synthesised and prepared by Ambion.

5) Apoptosis assays/cellular viability test

NIH 3T3 were plated in 6 well tissue culture plates, transfected with oligoduplexes (oligofectamine alone, GNX-R8 or a scrambled oligoduplex containing an inversion of the 4 middle base pairs) as described above and grown for 72 hrs. Cells were then either treated with 0.8 mM H₂O₂ or irradiated with 50 mJ/cm² of UV light. Cell viability was determined 24 hrs post treatment by the Trypan Blue (Sigma) exclusion method.

Results

1) Comparison of the efficacy of GNX-R8 versus the sequence described by Wu efc al., 2006 Western blot analysis of five different cell lines (Hep3B, U87MG, RPE, HMEC and NIH 3T3) showed that GNX-R8 was a much more potent down-regulator of pββShc expression than the siRNA described by Wu efc al . in each of the cell lines used.

The increased efficacy of GNX-R8 compared to known siRNA sequences is believed to be due to: (i) the nucleotide sequence 5'-CUCUGU-3' at its 5' end and (ii) the nucleotide sequence 5'-UGGAGG~3' at its 3' end.

Specifically, this improved efficacy of GNX-R8 is may be caused by the position of certain nucleotides, in particular, a C at position 1, at least 3 A or U between positions 13-19 and an A at position 19. The sequence 5'- UGGAGG-3' at the 3' end of GNX-R8 corresponds to the seeding region, which is the first 2-7 bases of the antisense strand (corresponding to bases 13-18 of the sense strand) . This sequence is important for the initial complementary binding to the target RNA sequence and is therefore, important for determining specificity of the siRNA molecule.

2) siRNA interference with GNX-R8 can almost completely ablate p66Shσ from several cell lines Quantitative analysis of these western blots demonstrated that treatment with GNX-R8 resulted in a >90% depletion of p66Shc protein in all five cell lines tested (Hep3B, U87MG, RPE, HMEC and NIH 3T3 ) .

3) IC₅₀ determination of GNX-R8 for the ablation of p66Shc in U87MG cell line The concentration of GNX-R8 required to deplete 50% of the pββShc protein in U87MG cells following transfection of these cells with GNX-R8 siRNA was 0.1 nM (i.e. IC₅₀ = 0.1 nM) . The same transfection was performed using the oligoduplex described in Wu efc a.1. However, a much higher concentration of this siRNA was required to deplete 50% of the pββShc protein compared to GNX-R8 , demonstrating that GNX-R8 is much more efficient at depleting pββShc than the Wu oligoduplex.

Transfecting U87MG cells with a scrambled version of GNX- R8 , in which the middle three base pairs in the siRNA sequence were inverted, had no effect on pββShc protein levels .

4) GNX-R8 results in increased survival of NIH 3T3 cells following treatment with H₂O₂

Following treatment with 0.8 iαM H₂O₂, <50% of untransfected cells survive after 24h. However, >80% of cells which have been transfected with GNX-R8 siRNA survive for 24h after treatment with 0.8 mM H₂O₂ - Therefore, transfection of cells with GNX-R8 results in increased cell survival following treatment with H₂O2 i.e. in response to oxidative stress .

Western blot analysis confirmed that the transfection with GNX-R8 siRNA resulted in almost complete ablation of pββShc protein and that cell survival correlated with the level of pββShc expression (see Figure 6) .

Claims

1. An agent for use in reducing expression of pββShc, said agent being _. selected from the group consisting of a) an oligonucleotide being between 6 and 50 nucleotides in length and comprising the sequence 5'- CCU/TCCA-3' ; b) an oligonucleotide being between 6 and 50 nucleotides in length capable of binding to the sequence 5'- U/TGGAGG-3' of p66shc mRNA; c) an oligoduplex having a sense and an antisense strand, wherein said sense strand is between 6 and 50 nucleotides in length and comprises the sequence 5'-

U/TGGAGG- 3 ' ; and d) an oligoduplex having a sense and an antisense strand wherein the sense strand is between 6 and 50 nucleotides in length and starts with the nucleotide sequence 5 ' -C/GU/TCU/TGU/T-3 ' at its 5' end.

2. An siRNA molecule comprising a sense strand and an antisense strand wherein said sense strand is between 6 and 50 nucleotides in length and comprises the nucleotide sequence 5' -UGGAGG-3'.

3. An siKNA molecule comprising a sense strand and an antisense strand wherein said antisense strand is between 6 and 50 nucleotide in length and comprises a nucleotide sequence capable of binding to the sequence 5' -UGGAGG-3' of p66shc mRNA.

4. An siKNA molecule according to claim 2 wherein the sense strand ends with the nucleotide sequence 5 ' - UGGAGGX-3' at its 3' end, wherein X is A or U.

5. An siKNA molecule according to any one of claims 2 to 4, wherein the sense strand comprises the nucleotide sequence 5'-CUCUGU-3' at its 5' end.

6. An siRNA molecule according to claim 5, wherein the sense strand starts with the nucleotide sequence 5'-

CUCUGU-3 ' at its 5' end.

7. An siRNA molecule according to any one of claims 2 to 6 wherein the sense strand comprises the nucleotide sequence 5'-CUCUGUCAUCGAUGGAGGA-SMSEQ ID NO: 12), or 5 ' - CUCUGUCAUCGCUGGAGGA-S' (SEQ ID NO: 16).

8. An siRNA molecule according to any one of claims 2 to 7 wherein the sense strand comprises the nucleotide sequence 5 ' -CUCUGUCAUCGAUGGAGGAtt-3 ' (SEQ ID NO: 7), or 5 ' -CUCUGUCAUCGCUGGAGGAtt-3 ' (SEQ ID NO : 13) .

9. An siRNA molecule according to claim 8 wherein the sense strand consists of the nucleotide sequence 5'- CUCUGUCAUCGAUGGAGGAtt-3' (SEQ ID NO: 7), or 5 ' - CUCUGUCAUCGCUGGAGGAtt-3 ' (SEQ ID NO: 13).

10. A vector comprising the agent of claim 1 or the siRNA molecule of claims 2 to 9.

11. A composition comprising an agent according to claim 1 or an siRNA molecule according to any one of claims 2 to 9 in combination with a pharmaceutically acceptable carrier.

12. A composition according to claim 11 for use in reducing expression of pβδShc in vitro, ex vivo or in vivo.

13. A composition according to claim 11 for use in disrupting the pβδShc signal transduction pathway in a cell.

14. A composition according to claim 11 for use in increasing resistance in cells to oxidative stress.

15. A composition according to claim 11 for treating a disease selected from the group consisting of arteriosclerosis, ischemic heart disease, Parkinson's disease, Alzheimer's disease, complications of diabetes, emphysema, lung disease, myocardial infarction, stroke, premature aging, cell senescence, skin disease and cancer .

16. A method of disrupting the pββShc signal transduction pathway in a cell comprising the step of contacting said cell with an agent according to claim 1 or an siRNA molecule according to any one of claims 2 to 9.

17. A method of increasing resistance in cells to oxidative stress, said method comprising disrupting the pββShc signal transduction pathway in said cell by contacting said cell with an agent according to claim 1 or an siRNA molecule according to any one of claims 2 to 9.

18. A method of decreasing apoptosis in cells, said method comprising the step of disrupting the pββShc signal transduction pathway by contacting the cell with an agent according to claim 1, an siRNA molecule of any one of claims 2 to 9 , or a composition according to claim 11.

19. A method of increasing cell survival in response to oxidative stress, said method comprising the step of disrupting the pββShc signal transduction pathway by contacting the cell with the oligonucleotide according to claim 1, an siRNA molecule of any one of claims 2 to 9 , or a composition according to claim 11.

20. A method of treating an individual suffering from a disease associated with cellular oxidative stress, said method comprising administering a composition according to claim 11 to said individual.

21. A method according to claim 20 wherein the disease is selected from the group consisting of arteriosclerosis, ischemic heart disease, Parkinson's disease, Alzheimer's disease, complications of diabetes, emphysema, lung disease, myocardial infarction, stroke, premature aging, cell senescence, skin disease and cancer.