WO2009059018A1 - Compositions and methods of enhancing immune responses to flagellated bacterium - Google Patents
Compositions and methods of enhancing immune responses to flagellated bacterium Download PDFInfo
- Publication number
- WO2009059018A1 WO2009059018A1 PCT/US2008/081813 US2008081813W WO2009059018A1 WO 2009059018 A1 WO2009059018 A1 WO 2009059018A1 US 2008081813 W US2008081813 W US 2008081813W WO 2009059018 A1 WO2009059018 A1 WO 2009059018A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- vaccine
- polynucleotide sequence
- polypeptide
- subject
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/025—Enterobacteriales, e.g. Enterobacter
- A61K39/0275—Salmonella
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- Salmonella continues to be one of the most commonly reported bacterial causes of human food-borne infections worldwide, and epidemiological evidence indicates that poultry and poultry products are a significant source of human infection. In the United States, an estimated 1.4 million cases of human Salmonellosis are reported annually. Of these cases, S. enterica serovars Enteritidis (SE) and Typhimurium (ST) are the most commonly isolated, although a number of other serovars have also been shown to cause enteritis in humans.
- SE enterica serovars Enteritidis
- ST Typhimurium
- Salmonella infrequently causes apparent clinical disease in poultry flocks. However, infection in young chicks with some Salmonella isolates results in 2% mortality within the first 48 hours post-hatch, and up to 20% morbidity within the first five days. Therefore, increasing the resistance of the poultry population against Salmonella will not only reduce the impact of low level disease on performance, but will also reduce the significant health risk for the human population as well.
- SUMMARY A vaccine comprising afliC polynucleotide sequence encoding a first polypeptide and a second polynucleotide sequence encoding a CD 154 polypeptide is disclosed.
- the CD 154 polypeptide is capable of binding CD40 and has fewer than 50 amino acids, and includes amino acids 140-149 of SEQ ID NO: 8 or a homolog thereof.
- a vaccine comprising a variant of Salmonella enteritidis 13 A is disclosed.
- the Salmonella comprises a first polynucleotide sequence encoding a fliC polypeptide.
- the bacterium includes a first polynucleotide sequence encoding a fliC polypeptide and a second polynucleotide sequence encoding a CD 154 polypeptide.
- the CD 154 polypeptide is capable of binding CD40 and has fewer than 50 amino acids, and includes amino acids 140-149 of
- SEQ ID NO: 8 or a homo log thereof.
- the bacterium is administered in an amount effective to enhance the immune response of the subject to the flagellated bacterium.
- kits for enhancing the immune response against a flagellated bacterium in a subject by administering a variant of Salmonella enteritidis 13A are provided.
- the Salmonella includes a first polynucleotide sequence encoding a fliC polypeptide.
- the Salmonella is administered in an amount effective to enhance the immune response of the subject to the flagellated bacterium.
- the bacterium includes a first polynucleotide sequence encoding afliC polypeptide and a second polynucleotide sequence encoding a CD 154 polypeptide.
- the CD 154 polypeptide is capable of binding CD40, and has fewer than 50 amino acids, and includes amino acids 140-149 of SEQ ID NO: 8 or a homo log thereof.
- the bacterium is administered in an amount effective to reduce the morbidity of the subject after infection with the flagellated bacterium.
- the Salmonella includes a first polynucleotide sequence encoding a fliC polypeptide.
- Salmonella is administered in an amount effective to reduce the morbidity of the subject after infection with the flagellated bacterium.
- Figure 1 depicts the scheme for making site-directed mutations in Salmonella enteritidis.
- Figure 2 depicts the design scheme of the overlapping extension PCR method used to generate the fliC and fliC -CD 154 insertions into loop 9 of the lamB polynucleotide.
- Figure 3 is a bar graph showing the percent Salmonella enteritidis recovery as compared to the initial inoculum in the liver/spleen and cecal tonsils at 3 days post- inoculation with the indicated bacteria.
- Figure 4 is a bar graph showing the percent Salmonella enteritidis recovery as compared to the initial inoculum in the liver/spleen and cecal tonsils at 21 days post- inoculation with the indicated bacteria.
- Vaccination against Salmonella is difficult because over 2,000 serovars have been described and immunity to one serovar generally does not confer immunity to a distinct serovar. Development of a vaccine to protect humans, poultry and other domesticated animals from Salmonellosis is needed. A vaccine capable of protecting against multiple serovars would be optimal. A vaccine comprising a highly conserved region of fliC, a flagellar filament protein found on flagellated Salmonella, is provided.
- Recombinant DNA technologies enable relatively easy manipulation of many bacterial and viral species. Some bacteria and viruses are mildly pathogenic or nonpathogenic, but are capable of generating a robust immune response. These bacteria and viruses make attractive vaccine vectors for eliciting an immune response to antigens. Bacterial or viral vaccine vectors may mimic a natural infection and produce robust and long lasting immunity. Vaccine vectors are often relatively inexpensive to produce and administer. In addition, such vectors can often carry more than one antigen and may provide protection against multiple infectious agents.
- a vaccine comprising a first polynucleotide sequence encoding afliC polypeptide and a second polynucleotide sequence encoding a CD 154 polypeptide which is capable of binding CD40 is provided.
- vaccine vectors such as bacterial vectors
- Salmonella strains make suitable vaccine vectors because bacterial genes may be mutated or attenuated to create bacteria with low to no pathogenesis to the infected or immunized subject, while maintaining immunogenicity.
- the majority of Salmonella isolates contain two genes that encode flagellar (H) antigens, fliC and ⁇ T/B, which are alternately expressed by a phase-variation mechanism.
- the phase 1 antigens are encoded byfli C whereas fljB encodes the phase 2 antigens.
- a conserved region within fliC that has almost 100% homology between multiple Salmonella serovars and - A - between ⁇ ZzC and ⁇ T/B has been identified. This conserved region of fliC is depicted in SEQ ID NO: 1 and was used to generate several vaccine vectors as described in the Examples.
- Other possible polypeptides for use in vaccine vectors are disclosed in SEQ ID NO: 2 (a similar region offliC from E.
- Immunogenic fragments of the ⁇ iC polypeptides may also be used to generate vaccines.
- immunogenic fragments of the ⁇ iC polypeptides may also be used to generate vaccines.
- DCs dendritic cells
- APC antigen presenting cell
- Activated cytotoxic T cells are able to destroy virus- infected cells, tumor cells or even APCs infected with intracellular parasites (e.g., Salmonella) and have been shown to be critical in the protection against viral infection.
- CTLs Activated cytotoxic T cells
- CD40 is a member of the TNF-receptor family of molecules and is expressed on a variety of cell types, including professional antigen-presenting cells (APCs), such as DCs and B cells.
- APCs professional antigen-presenting cells
- CD40 Interaction of CD40 with its ligand CD 154 is extremely important and stimulatory for both humoral and cellular immunity. Stimulation of DCs via CD40, expressed on the surface of DCs, can be simulated by anti-CD40 antibodies. In the body, however, this occurs by interaction with the natural ligand for CD40 (i.e. CD 154) expressed on the surface of activated T-cells.
- CD40-binding regions of CD 154 have been identified.
- the CD40-binding region of CD 154 may be expressed on the surface of a vaccine vector, such as a Salmonella vaccine vector, and may result in an enhanced immune response against a co-presented peptide sequence.
- Salmonella can survive the gastrointestinal tract of the host and give rise to a mucosal immune response.
- Oral vaccines using a Salmonella vector produce a robust mucosal immune response and are relatively easy to administer to both animals and humans.
- many of the current attenuated Salmonella vaccine strains are not as effective in generating a strong protective immune response as compared to their more virulent counterparts.
- Virulent strains provide a robust immune response but may also cause significant morbidity to the vaccinated subject.
- a Salmonella strain that could be used for effective mucosal, e.g., oral, vaccination would provide a vector that could be used to readily vaccinate a subject against one or more pathogenic agents, such as flagellated bacteria.
- a method of limiting an infection caused by a Salmonella vaccine vector would also be useful.
- Administration of the second vaccine vector enhances the immune response to Salmonella and limits the infection caused by the Salmonella vaccine vector.
- the second vaccine vector may be administered before, at the same time as or after the Salmonella vaccine vector.
- a Salmonella enteritidis strain useful as a vaccine vector, and various recombinant vaccine vectors made using this strain, are described.
- a Salmonella enteritidis 13A capable of expressing an exogenous fliC polypeptide
- SE 13A Salmonella enteritidis 13A
- a vaccine vector and methods of enhancing an immune response in a subject by administering the vaccine vector comprising a first polynucleotide sequence encoding a fliC polypeptide and a second polynucleotide sequence encoding a polypeptide of CD 154 or a homo log thereof that is capable of binding to CD40 are disclosed.
- the vaccine vectors may be used to enhance an immune response against Salmonella or another flagellated bacterium, such as Escherichia coli or Shigella, or may be used to reduce the morbidity associated with a flagellated bacterial infection.
- a wild-type isolate of Salmonella, Salmonella enteritidis 13A (SE 13A) (deposited with the American Type Culture Collection (ATCC) on September 13, 2006, deposit number PTA-7871), was selected based upon its unusual ability to cause mucosal colonization and submucosal translocation in chickens, permitting robust presentation of associated antigens or epitopes in commercial chickens. Importantly, this wild-type Salmonella isolate causes no clinically detectable disease or loss of performance in commercial chickens, indicating little disease-causing potential of the wild-type Salmonella in vertebrate animals.
- the SEl 3 A isolate may be further attenuated by inactivating at least one gene necessary for sustained replication of the bacteria outside of laboratory or manufacturing conditions. Attenuated or variant Salmonella strains that can be used as vaccine vectors are described below. SEl 3 A was used to generate attenuated Salmonella strains to develop vaccines and generate enhanced immune responses. SE13A is invasive, non-pathogenic for poultry and causes no measurable morbidity. These features result in an enhanced immune response as compared to non-invasive bacterial vectors. Attenuation of SEl 3 A by mutation of genes that limit the ability of the bacterium to spread may increase the safety of the vaccine.
- SE13A strains with mutations in aroA and/or htrA retain the ability to generate an immune response, but have limited replication in the host.
- the attenuation increases the safety of the vaccine vector without compromising the immunogenicity.
- Mutations may be made in a variety of other Salmonella genes including, but not limited to, cya, crp, asd, cdt, phoP, phoQ, ompR, outer membrane proteins, dam, htrA or other stress related genes, aro, pur and gua. As shown in the Examples, mutations in aroA and htrA were found to attenuate SE 13 A.
- the aro genes are enzymes involved in the shikimate biosynthesis pathway or the aromatase pathway and aro mutants are auxotrophic for the aromatic amino acids tryptophan, tyrosine and phenylalanine.
- htrA is a stress response gene that encodes a periplasmic protease that degrades aberrant proteins. Mutants in htrA are also attenuated and display increased sensitivity to hydrogen peroxide.
- the mutations in aroA and htrA described in the Examples are deletion mutations, but the mutations can be made in a variety of ways. Suitably, the mutations are non-reverting mutations that cannot be repaired in a single step. Suitable mutations include deletions, inversions, insertions and substitutions.
- a vaccine vector may include more than one mutation, for example a vaccine vector may contain mutations in both aro A and htrA. Methods of making such mutations are well known in the art.
- SEl 3 A or the attenuated SE13A variants may be used as vaccine vectors.
- Polynucleotides encoding fliC polypeptide antigens and other antigens from any number of pathogenic organisms may be inserted into the bacteria and expressed by the bacteria to generate antigenic polypeptides.
- the polynucleotides may be inserted into the chromosome of the bacteria or encoded on plasmids or other extrachromosomal DNA.
- polynucleotides encoding fliC antigens are inserted into a bacterial polynucleotide that is expressed.
- the bacterial polynucleotide encodes a transmembrane protein
- the polynucleotide encoding the fliC antigen is inserted into the bacterial polynucleotide sequence to allow expression of the fliC antigen on the surface of the bacteria.
- the polynucleotide encoding ⁇ /zC may be inserted in frame into the bacterial polynucleotide in a region encoding an external loop region of a transmembrane protein such that the bacterial polynucleotide sequence remains in frame. See Example 1.
- the first polynucleotide encoding fliC antigen may be inserted into a polynucleotide encoding a secreted polypeptide.
- a polynucleotide encoding the fliC antigen could be inserted in a wide variety of bacterial polynucleotides to provide expression and presentation of the fliC antigen to the immune cells of a subject treated with the bacterial vaccine vector.
- a polynucleotide encoding a fliC antigen was inserted into loop 9 of the lamB gene of SE 13 A.
- the polynucleotide encoding the fliC antigen may be included in a single copy or more than one copy.
- a bacterial vaccine vector containing a single copy of the ⁇ iC antigen inserted into loop 9 of lamB is described.
- copies of an epitope may be inserted into the bacterial vaccine vector at more than one location.
- the copies of the polynucleotide may be linked together or separated by a linker. Suitable linkers are known to those of skill in the art and include, but are not limited to a repeated amino acid, such as 1-10 serine residues.
- a vaccine vector may include a CD 154 polypeptide that is capable of binding CD40 in the subject and stimulating the subject to respond to the vaccine vector and its associated antigen.
- these polynucleotides may be inserted into the chromosome of the vaccine vector or maintained extrachromosomally.
- One of skill in the art will appreciate that these polynucleotides can be inserted in a variety of endogenous polynucleotides and expressed in different parts of the vaccine vector such as the cell wall or may be secreted.
- the polynucleotide encoding a CD 154 polypeptide capable of enhancing the immune response to a foreign antigen may also encode the foreign antigen.
- the polynucleotide encoding a CD 154 polypeptide may be linked to the polynucleotide encoding the fliC antigen, such that in the vaccine vector the CD 154 polypeptide and the fliC antigen are present on the same polynucleotide.
- a polynucleotide encoding a polypeptide of CD 154 that is capable of binding to CD40 also encodes the fliC antigen. See SEQ ID NOS: 1, 2, 9, 10 and 11 in the attached sequence listing.
- the polynucleotide encoding the fliC antigen and the polynucleotide encoding the CD154 polypeptide are both inserted in loop 9 of the lamB gene.
- bacterial polynucleotides encoding other transmembrane proteins and other loops of the lamB gene may also be used.
- the SE13A bacteria include an exogenous polynucleotide encoding afliC polypeptide that is a portion of the full-length fliC polypeptide natively associated with Salmonella.
- a polynucleotide encoding a portion of the fliC polypeptide or the entire fliC polypeptide may be inserted into the vaccine vector.
- a seven amino acid polypeptide (SEQ ID NO:1) was incorporated into SE 13 A.
- the portion of the fliC polypeptide inserted into the vaccine vector is an immunogenic fragment.
- An immunogenic fragment is a peptide or polypeptide capable of eliciting a cellular or humoral immune response.
- an immunogenic fragment offliC may be 6 or more amino acids, 10 or more amino acids, 15 or more amino acids or 20 or more amino acids of the full-length protein sequence .
- Suitable epitopes for inclusion in a fliC vaccine vector include, but are not limited to, polynucleotides encoding other bacterial polypeptides.
- polynucleotides encoding other bacterial polypeptides include, but are not limited to, polynucleotides encoding other bacterial polypeptides.
- One of skill in the art will appreciate that a variety of sequences may be used in combination with any other antigen and may also be used in conjunction with polypeptides encoding immune stimulatory peptides such as a polypeptide of CD 154.
- a polynucleotide encoding a CD 154 polypeptide that is capable of enhancing the immune response to the antigen may be included in the vaccine vector.
- the CD 154 polypeptide is fewer than 50 amino acids long, more suitably fewer than 40, fewer than 30 or fewer than 20 amino acids in length.
- the polypeptide may be between 10 and 15 amino acids, between 10 and 20 amino acids or between 10 and 25 amino acids in length.
- the CD 154 sequence and CD40 binding region are not highly conserved among the various species.
- the CD 154 amino acid sequences of chicken and human are provided in SEQ ID NO: 9 and SEQ ID NO: 8, respectively.
- CD40 binding regions of CD 154 have been determined for a number of species, including human, chicken, duck, mouse and cattle and are shown in SEQ ID NO: 3, SEQ ID NO:
- SEl 3 A recombinant bacteria were generated.
- the fliC polypepetide and the CD 154 polypeptide were encoded on the same polynucleotide and were in frame with each other and with the Salmonella lamB polynucleotide in which they were inserted.
- the CD 154 polypeptide and the fliC polypeptide may be encoded by distinct polynucleotides.
- aroA htrA fliC contains a deletion in aroA and htrA and encodes both the fliC epitope (SEQ ID NO:1) and optionally the CD 154 polypeptide (SEQ ID NO: 3) inserted into loop 9 of lamB.
- compositions comprising an attenuated Salmonella strain and a pharmaceutically acceptable carrier are also provided.
- a pharmaceutically acceptable carrier is any carrier suitable for in vivo administration.
- pharmaceutically acceptable carriers suitable for use in the composition include, but are not limited to, water, buffered solutions, glucose solutions or bacterial culture fluids. Additional components of the compositions may suitably include, for example, excipients such as stabilizers, preservatives, diluents, emulsif ⁇ ers and lubricants.
- Examples of pharmaceutically acceptable carriers or diluents include stabilizers such as carbohydrates (e.g., sorbitol, mannitol, starch, sucrose, glucose, dextran), proteins such as albumin or casein, protein-containing agents such as bovine serum or skimmed milk and buffers (e.g., phosphate buffer). Especially when such stabilizers are added to the compositions, the composition is suitable for freeze-drying or spray-drying.
- carbohydrates e.g., sorbitol, mannitol, starch, sucrose, glucose, dextran
- proteins such as albumin or casein
- protein-containing agents such as bovine serum or skimmed milk
- buffers e.g., phosphate buffer
- the vaccine vector comprising the polynucleotide encoding a CD 154 polypeptide capable of binding to CD40 is administered to a subject in an amount effective to enhance the immune response of the subject to the vaccine.
- the vaccine vector contains a polynucleotide encoding a polypeptide including amino acids 140- 149 of the human CD 154 polypeptide (SEQ ID NO: 8) or a homo log thereof.
- CD40 binding region of CD 154 is not conserved among species, yet heterologous CD 154 was capable of enhancing the immune response (i.e. human sequence used in a chicken). Therefore, a homologue of amino acid 140-149 derived from one species may be used to stimulate an immune response in a distinct species.
- the polynucleotide encodes a CD 154 polypeptide from the same species as the subject.
- a polynucleotide encoding the polypeptide of SEQ ID NO: 3 is used in human subjects
- a polynucleotide encoding the polypeptide of SEQ ID NO: 4 is used in chickens
- a polynucleotide encoding the polypeptide of SEQ ID NO: 5 is used in ducks
- a polynucleotide encoding the polypeptide of SEQ ID NO: 6 is used in mice
- a polynucleotide encoding the polypeptide of SEQ ID NO: 7 is used in cows.
- the human CD 154 polypeptide (SEQ ID NO: 3) was used in a chicken vaccine vector and was demonstrated to enhance the immune response to a foreign antigen.
- the CD 154 polypeptide may be used to enhance the immune response in the subject to any foreign antigen or antigenic polypeptide present in the vaccine vector in addition to the fliC polypeptide.
- the CD 154 polypeptide could be used to enhance the immune response to more than one antigenic polypeptide present in a vaccine vector.
- the polypeptide from CD 154 stimulates an immune response at least in part by binding to its receptor, CD40.
- the Examples used a polypeptide homologous to the CD 154 polypeptide which is expressed on immune cells of the subject and which is capable of binding to the CD40 receptor on macrophages and other antigen presenting cells. Binding of this ligand-receptor complex stimulates macrophage (and macrophage lineage cells such as dendritic cells) to enhance phagocytosis and antigen presentation while increasing cytokine secretions known to activate other local immune cells (such as B-lymphocytes). As such, molecules associated with the CD 154 peptide are preferentially targeted for immune response and expanded antibody production.
- Potential vaccine vectors for use in the methods include, but are not limited to, Salmonella (Salmonella enteritidis), Shigella, Escherichia (E. coli), Yersinia, Bordetella, Lactococcus, Lactobacillus, Bacillus, Streptococcus, Vibrio (Vibrio cholerae), Listeria, adenovirus, poxvirus, herpesvirus, alphavirus, and adeno-associated virus.
- the methods comprise administering to a subject a vaccine vector comprising a polynucleotide sequence encoding a fliC polypeptide in an effective amount.
- the fliC polypeptides include SEQ ID NO: 1-2 and 10-12.
- the insertion of the fliC polypeptides into the vaccine vector may be accomplished in a variety of ways known to those of skill in the art, including but not limited to, the scarless site-directed mutation system described in BMC Biotechnol.
- the vaccine vector may also be engineered to express the fliC polypeptides in conjunction with polynucleotides capable of enhancing the immune response as discussed above, such as in SEQ ID NO:8 and SEQ ID NO:9.
- a polypeptide of CD 154 capable of binding CD40 may be expressed by the vaccine vector to enhance the immune response of the subject to the fliC polypeptide.
- the vaccine vector is a bacterium, such as Salmonella enteritidis .
- the useful dosage of the vaccine vector to be administered will vary depending on the age, weight and species of the subject, the mode and route of administration and the type of pathogen against which an immune response is sought.
- the composition may be administered in any dose sufficient to evoke an immune response.
- doses ranging from 10 3 to 10 10 bacteria, from 10 4 to 10 9 bacteria, or from 10 5 to 10 7 bacteria are suitable.
- the composition may be administered only once or may be administered two or more times to increase the immune response. For example, the composition may be administered two or more times separated by one week, two weeks, or by three or more weeks.
- the bacteria are suitably viable prior to administration, but in some embodiments the bacteria may be killed prior to administration. In some embodiments, the bacteria may be able to replicate in the subject, while in other embodiments the bacteria may not be capable of replicating in the subject.
- compositions may be administered by a variety of means including, but not limited to, intranasally, mucosally, by spraying, intradermally, parenterally, subcutaneously, orally, by aerosol, or intramuscularly. Eye-drop administration or addition to drinking water or food are additionally suitable.
- the compositions may be administered in ovo.
- Some embodiments of the invention provide methods of enhancing immune responses in a subject.
- Suitable subjects may include, but are not limited to, vertebrates, suitably mammals, suitably a human, and birds, suitably poultry such as chickens. Other animal models of infection may also be used.
- Enhancing an immune response includes, but is not limited to, inducing a therapeutic or prophylactic effect that is mediated by the immune system of the subject.
- enhancing an immune response may include enhanced production of antibodies, enhanced class switching of antibody heavy chains, maturation of antigen presenting cells, stimulation of helper T cells, stimulation of cytolytic T cells or induction of T and B cell memory.
- vaccine vectors may encode antigens from multiple pathogenic microorganisms, viruses or tumor associated antigens.
- Administration of vaccine vectors capable of expressing multiple antigens has the advantage of inducing immunity against two or more diseases at the same time.
- live attenuated bacteria such as Salmonella enteritidis 13 A, provide a suitable vaccine vector for eliciting an immune response against multiple antigens.
- Bacterial vaccines may be constructed using exogenous polynucleotides encoding antigens which may be inserted into the bacterial genome at any non-essential site or alternatively may be carried on a plasmid using methods well known in the art.
- One suitable site for insertion of polynucleotides is within external portions of transmembrane proteins or coupled to sequences that target the exogenous polynucleotide for secretory pathways.
- One example of a suitable transmembrane protein for insertion of polynucleotides is the lamB gene. In the Examples, fliC and CD 154 polynucleotides were inserted into loop 9 of the lamB sequence.
- Exogenous polynucleotides include, but are not limited to, polynucleotides encoding antigens selected from pathogenic microorganisms or viruses and include polynucleotides of the vaccine vector which are expressed in such a way that an effective immune response is generated.
- Such polynucleotides may be derived from pathogenic viruses such as influenza (e.g., M2e, hemagglutinin, or neuraminidase), herpesviruses (e.g., the genes encoding the structural proteins of herpesviruses), retroviruses (e.g., the gpl60 envelope protein), adenoviruses, paramyxoviruses, coronaviruses and the like.
- influenza e.g., M2e, hemagglutinin, or neuraminidase
- herpesviruses e.g., the genes encoding the structural proteins of herpesviruses
- Exogenous polynucleotides can also be obtained from pathogenic bacteria, e.g., genes encoding bacterial proteins such as toxins, and outer membrane proteins. Further, exogenous polynucleotides from parasites are attractive candidates for use of a vector vaccine.
- Polynucleotides encoding polypeptides involved in triggering the immune system may also be included in a vaccine vector, such as a live attenuated Salmonella vaccine.
- the polynucleotides may encode immune system molecules known for their stimulatory effects, such as an interleukin, Tumor Necrosis Factor, or an interferon, or another polynucleotide involved in immune-regulation.
- the vaccine vector may also include polynucleotides encoding peptides known to stimulate an immune response, such as the CD 154 polypeptide described herein.
- Example 1 Construction of fliC and fliC/CD154 inserts. Strains and Culture Conditions
- Salmonella enteritidis 13A was used for introduction of mutations.
- Salmonella enteritidis strain 13 A was a field isolate available from USDA/APHIS/NVSL and deposited with the ATCC as deposit number PTA-7871.
- Bacteria carrying plasmid pKD46 were grown at 30 0 C. Other bacteria were grown at 37°C. Plasmid curing was conducted at 37°C. Luria-Bertani (LB) media was used for routine growth of cells, and SOC media
- antibiotics were added to the media: ampicillin (Amp) at lOO ⁇ g/ml, kanamycin (Km) at 50 ⁇ g/ml, and chloramphenicol (Cm) at 25 ⁇ g/ml.
- Plasmid pKD46 encodes Red recombinase enzymes which mediate homologous recombination of incoming linear DNA with chromosomal DNA. This plasmid also contains the Ampicillin resistance gene and is temperature-sensitive so that it requires 30 0 C for maintenance in the cell. Plasmid pKD13 served as a template for amplification of the Km resistance (Km 1 ) gene used in overlapping PCR.
- Plasmid pBC-I-Scel which is maintained in the cell at 37°C, produces the I-Scel enzyme, which cleaves the following 18 base pair, rare recognition sequence: 5'- TAGGGATAACAGGGT AAT-3' (SEQ ID NO: 13). Plasmid pBC-I-Scel also contains the chloramphenicol resistance (Cm 1 ) gene.
- PCR was performed using approximately 0.1 ⁇ g of purified genomic, plasmid or PCR-generated DNA (Qiagen,
- each primer in a total volume of 50 ⁇ L.
- the DNA engine thermal cycler (Bio-Rad, Hercules, CA, USA) was used with the following amplification conditions: 94°C for 2 minutes; 30 cycles of 94°C sec for 30 sec, 58°C for 60 sec, 72°C for 90 sec per 1 kb; and 72°C for 10 minutes for final extension.
- Each PCR product was gel purified (Qiagen, Valencia, CA, USA) and either eluted in 25 ⁇ L EB buffer for preparation of templates used in overlapping extension PCR or in 50 ⁇ L EB buffer, ethanol precipitated and suspended in 5 ⁇ L of ddH 2 O for electroporation into S. enteritidis.
- Primer Amplified region Primer sequence lam-up-f loop 9 up 5'TGTACAAGTGGACGCCAATC 3' (SEQ ID NO: 14) lam-up-f S 'GTTATCGCCGTCTTTGATATAGCC 3' (SEQ ID NO: 15) lam-dn-f looop 9 dn 5'ATTTCCCGTTATGCCGCAGC 3' (SEQ ID NO: 16) lam-dn-f 5'GTTAAACAGAGGGCGACGAG 3 T (SEQ ID NO: 17)
- Kan4f inside Km 1 gene sequencing 5'CAAAAGCGCTCTGAAGTTCC 3' (SEQ ID NO: 20) Kan4r 5'GCGTGAGGGGATCTTGAAGT 3 T (SEQ ID NO: 21) fliC up reverse Q iC/ loop 9 up 5'CGGT ⁇ CTGTACGGAGGAGGAGTTATCGCCGTCT
- Transformation of pKD46 into S. enteritidis was the first step carried out so that Red recombinase enzymes could be used for mediating recombination of subsequent mutations.
- Plasmid pKD46 was harvested from E. coli BW25113 (Datsenko and Wanner, PNAS 2000, 97:6640-6645) using a plasmid preparation kit (Qiagen Valencia, CA, USA). Then 0.5 ⁇ L of pKD46 DNA was used for transformation into S. enteritidis 13A which had been prepared for electroporation. (Datsenko and Wanner, PNAS 2000, 97:6640-6645).
- cells were inoculated into 10-15mL of 2X YT broth and grown at 37°C overnight. Then lOO ⁇ L of overnight culture was re-inoculated into 1OmL fresh 2X YT broth at 37°C for 3-4 hours.
- Cells to be transformed with pKD46 plasmid were heated at 50 0 C for 25 minutes to help inactivate host restriction. Cells were washed five times in ddH 2 O water and resuspended in 60 ⁇ L of 10% glycerol. Cells were then pulsed at 2400-245OkV for l-6ms, incubated in SOC for 2-3 hours at 30 0 C and plated on LB media with appropriate antibiotics. S.
- enteritidis transformants with pKD46 were maintained at 30 0 C. When these transformants were prepared for additional electroporation reactions, all steps were the same except that 15% arabinose was added to induce Red recombinase enzymes one hour prior to washing, and cells did not undergo the 50 0 C heat step.
- I-Scel enzyme recognition site along with the Km 1 gene into loop 9 of the lamB gene was done by combining the Red recombinase system (Datsenko and Wanner, PNAS 2000, 97:6640-6645, which is incorporated herein by reference in its entirety) and overlapping PCR (Horton et al., BioTechniques 1990, 8:528-535, which is incorporated herein by reference in its entirety).
- the insertion site corresponds to nucleotide 1257 of the lamB gene using Salmonella typhimurium LT2 (S. typhimurium) as an annotated reference genome.
- the upstream and downstream regions immediately flanking the loop 9 insertion site were amplified separately.
- Primers used were lam-up-f and lam-up-r for loop 9 up and lam-dn-f and lam-dn-r for loop 9 down.
- the Km 1 gene from pKD13 plasmid was amplified using primers Km-f and Km-r.
- the I-Scel enzyme site was synthetically added to the 5' end of Km-f primer then preceded by a region complimentary to the loop-up-r primer.
- a region complimentary to the loop-dn-f primer was added to the 5 ' end of Km-r primer.
- PCR fragments consisting of loop 9 up- I-Scel/ Km 1 - loop 9 down sequence (PCR-A) were electroporated into S. enteritidis cells, which harbored pKD46 and were induced by arabinose, and then plated on LB with Km plates.
- PCR-A PCR fragments consisting of loop 9 up- I-Scel/ Km 1 - loop 9 down sequence
- PCR-A PCR fragments consisting of loop 9 up- I-Scel/ Km 1 - loop 9 down sequence (PCR-A) were electroporated into S. enteritidis cells, which harbored pKD46 and were induced by arabinose, and then plated on LB with Km plates.
- Kan4F and Kan4R are Km 1 gene-specific primers
- Iam3f and Iam3r are primers located outside the lamB loop 9 region.
- the final overlapping PCR fragment, PCR-B contained the added fliC antigen (or combination with CD 154 sequences flanked by loop 9 up and down regions ( Figure 2b).
- Combination sequences consisted of fliC polynucleotide comprising SEQ ID NO:1 and a CD 154 polynucleotide sequence along with spacers such as Glycine (GIy) or Serine (Ser) residues.
- the fliC oxfliC- CD 154 sequence was synthetically added to the 5' end of the lam-dn-f primer and preceded by the complimentary region to the loop-up-r primer.
- the previously used PCR product for loop 9 up could be used together with the newly constructed PCR product in which fliC or fliC-CDl54 were incorporated at the 5' end of loop 9 down to perform the final PCR reaction.
- combination sequences an extra PCR step was needed, due to the longer lengths of insert sequences, to amplify loop 9 up with added nucleotides specific to insertion sequences connected to loop-up-r primer.
- Clones for each PCR-B recombination mutation were chosen according to the ability to grow on Cm plates but not on Km plates, due to the replacement of PCR-B for the Km 1 encoding PCR-A sequence. Modified regions in the selected clones were PCR-amplified, and DNA sequences were determined using primers Iam3f and Iam3r located outside the loop 9 down and up amplified regions.
- the first mutation step involved designing a PCR fragment, PCR-A, which would serve as the carrier of the I-Scel site/ Km 1 cassette to be inserted into the lamB site.
- PCR-A consisted of the I-Scel enzyme recognition site adjacent to the Km 1 gene with approximately 200- 300bp of flanking DNA on each end homologous to the upstream and downstream regions of lamB loop 9 insertion site (loop 9 up and loop 9 down, respectively).
- the fragment was introduced into S. enteritidis cells expressing Red recombinase enzymes and Km 1 colonies were selected. After screening a few colonies by colony PCR, positive clones were sequenced for the desired inserted I-Scel site/ Km 1 sequence, and the identified mutant was selected and designated as SE 164.
- PCR- B The second mutation step required constructing a PCR fragment, referred to as PCR- B and shown in Figure 2B, consisting of the final insertion sequence, fliC or fliC-CD 154, flanked by lamB homologous fragments.
- PCR-B amplicons have no selection marker and must be counter-selected after replacement for the previous I-Scel site/ Km 1 mutation in SE164.
- Plasmid pBC-I-Scel encodes the Cm 1 gene and the I-Scel enzyme, which will cut the genome at the I-Scel site of SE164. Therefore, pBC-I-Scel was electroporated into SE164 along with PCR-B.
- Attenuation of SE13A was achieved by deletion mutation of the aroA gene and/or the htrA gene. Mutation of the aroA gene, a key gene in the chorismic acid pathway of bacteria, results in a severe metabolic deficiency which affects seven separate biochemical pathways. Mutation of the htrA gene reduces the cell's ability to withstand exposure to low and high temperatures, low pH, and oxidative and DNA damaging agents and reduces the bacteria's virulence.
- the target gene sequence in the bacterial genome of S. enteritidis was replaced with the Km resistant gene sequence. This was completed using overlapping extension PCR and electroporation of the PCR products as described above.
- the Km resistance gene was targeted into the genomic region containing the genes of interest (aroA or htrA) by flanking the Km resistance gene with 200-300 base pairs of sequences homologous to the genes of interest. Once Km resistant mutants were obtained, the aroA or htrA deletion mutations were confirmed by DNA sequencing. The attenuated strains were also tested in vivo with regards to clearance time.
- Salmonella isolates or saline control The Salmonella isolates included the following: wtSE represents the original field isolate of Salmonella enteritidis 13 A (SE 13A); fliC represents the double attenuated (i.e., aroA and htrA) wild type SE13A expressing fliC in the lamB loop (cell surface); fliC-CD154C represents the double attenuated wild type SEl 3 A similarly expressing fliC and a chicken CD 154 oligopeptide.
- SE 13A the original field isolate of Salmonella enteritidis 13 A
- fliC represents the double attenuated (i.e., aroA and htrA) wild type SE13A expressing fliC in the lamB loop (cell surface)
- fliC-CD154C represents the double attenuated wild type SEl 3 A similarly expressing fliC and a chicken CD 154 oligopeptide.
- Serum was collected from the inoculated chicks and fliC specific antibody was measured by ELISA using standard procedures. FHC antibody production was not significantly increased in the animals vaccinated with fliC ory7zC-CD154 containing SE.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| HK11100779.4A HK1146644B (en) | 2007-10-30 | 2008-10-30 | Compositions and methods of enhancing immune responses to flagellated bacterium |
| CA 2704457 CA2704457A1 (en) | 2007-10-30 | 2008-10-30 | Compositions and methods of enhancing immune responses to flagellated bacterium |
| CN2008801169113A CN102037135A (zh) | 2007-10-30 | 2008-10-30 | 增强对有鞭毛的细菌的免疫反应的组合物和方法 |
| JP2010532246A JP2011502165A (ja) | 2007-10-30 | 2008-10-30 | 鞭毛細菌に対する免疫応答を強化する組成物および方法 |
| US12/740,631 US9125854B2 (en) | 2007-10-30 | 2008-10-30 | Compositions and methods of enhancing immune responses to flagellated bacterium |
| BRPI0818736A BRPI0818736A2 (pt) | 2007-10-30 | 2008-10-30 | composições e métodos para intensificar imunorrepostas à bactéria flagelada |
| EP20080832781 EP2214840B1 (en) | 2007-10-30 | 2008-10-30 | Compositions and methods of enhancing immune responses to flagellated bacterium |
| NZ585776A NZ585776A (en) | 2007-10-30 | 2008-10-30 | Compositions and methods of enhancing immune responses to flagellated bacterium |
| AU2008318615A AU2008318615A1 (en) | 2007-10-30 | 2008-10-30 | Compositions and methods of enhancing immune responses to flagellated bacterium |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US98380307P | 2007-10-30 | 2007-10-30 | |
| US60/983,803 | 2007-10-30 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2009059018A1 true WO2009059018A1 (en) | 2009-05-07 |
| WO2009059018A9 WO2009059018A9 (en) | 2009-12-30 |
Family
ID=40591464
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2008/081813 Ceased WO2009059018A1 (en) | 2007-10-30 | 2008-10-30 | Compositions and methods of enhancing immune responses to flagellated bacterium |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US9125854B2 (enExample) |
| EP (1) | EP2214840B1 (enExample) |
| JP (1) | JP2011502165A (enExample) |
| CN (1) | CN102037135A (enExample) |
| AU (1) | AU2008318615A1 (enExample) |
| BR (1) | BRPI0818736A2 (enExample) |
| CA (1) | CA2704457A1 (enExample) |
| NZ (1) | NZ585776A (enExample) |
| WO (1) | WO2009059018A1 (enExample) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8956849B2 (en) | 2007-11-01 | 2015-02-17 | The Board Of Trustees Of The University Of Arkansas | Compositions and methods of enhancing immune responses to Eimeria |
| US8956618B2 (en) | 2010-01-21 | 2015-02-17 | The Texas A&M University System | Vaccine vectors and methods of enhancing immune responses |
| US8961990B2 (en) | 2010-06-09 | 2015-02-24 | The Board Of Trustees Of The University Of Arkansas | Vaccine and methods to reduce campylobacter infection |
| CN104789583A (zh) * | 2014-01-20 | 2015-07-22 | 华中农业大学 | 一种人源产肠毒素大肠杆菌鞭毛蛋白2FliC融合蛋白及其应用 |
| US9603915B2 (en) | 2013-02-14 | 2017-03-28 | The Board of Trustees of the University of Akansas | Compositions and methods of enhancing immune responses to Eimeria or limiting Eimeria infection |
| US10376571B2 (en) | 2013-03-15 | 2019-08-13 | The Board Of Trustees Of The University Of Arkansas | Compositions and methods of enhancing immune responses to enteric pathogens |
| US10682398B2 (en) | 2016-05-03 | 2020-06-16 | The Texas A&M University System | Yeast vaccine vector including immunostimulatory and antigenic polypeptides and methods of using the same |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2520026T3 (es) * | 2006-09-18 | 2014-11-11 | The Board Of Trustees Of The University Of Arkansas | Composiciones y métodos para potenciar respuestas inmunitarias |
| US20080124355A1 (en) | 2006-09-22 | 2008-05-29 | David Gordon Bermudes | Live bacterial vaccines for viral infection prophylaxis or treatment |
| US8647642B2 (en) | 2008-09-18 | 2014-02-11 | Aviex Technologies, Llc | Live bacterial vaccines resistant to carbon dioxide (CO2), acidic PH and/or osmolarity for viral infection prophylaxis or treatment |
| CA2895805A1 (en) | 2012-12-18 | 2014-06-26 | Kotzker Consulting Llc | Use of cannabinoids and terpenes for treatment of organophosphate and carbamate toxicity |
| CN104328136B (zh) * | 2014-10-03 | 2018-04-17 | 哈尔滨博翱生物医药技术开发有限公司 | 鸡新城疫病毒毒株rClone30‑fliC的制备及其在鸡新城疫病防治中的应用 |
| US10676723B2 (en) | 2015-05-11 | 2020-06-09 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| US11129906B1 (en) | 2016-12-07 | 2021-09-28 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| US11180535B1 (en) | 2016-12-07 | 2021-11-23 | David Gordon Bermudes | Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria |
| WO2019040135A1 (en) * | 2017-05-12 | 2019-02-28 | Children's Medical Center Corporation | NUCLEIC ACIDS HANDLING IMMUNEWAYS |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4420497A (en) * | 1981-08-24 | 1983-12-13 | Fairchild Camera And Instrument Corporation | Method of detecting and repairing latent defects in a semiconductor dielectric layer |
| US4510674A (en) * | 1982-10-21 | 1985-04-16 | Sovonics Solar Systems | System for eliminating short circuit current paths in photovoltaic devices |
| US5800632A (en) * | 1995-09-28 | 1998-09-01 | Canon Kabushiki Kaisha | Photovoltaic device and method for manufacturing it |
| US7098058B1 (en) * | 2004-01-15 | 2006-08-29 | University Of Toledo | Photovoltaic healing of non-uniformities in semiconductor devices |
| US20060249202A1 (en) * | 2004-09-20 | 2006-11-09 | Seunghyup Yoo | Photovoltaic cell |
| WO2007103048A2 (en) | 2006-03-01 | 2007-09-13 | Regents Of The University Of Colorado | Tlr agonist (flagellin)/cd40 agonist/antigen protein and dna conjugates and use thereof for inducing synergistic enhancement in immunity |
| US20070227586A1 (en) * | 2006-03-31 | 2007-10-04 | Kla-Tencor Technologies Corporation | Detection and ablation of localized shunting defects in photovoltaics |
Family Cites Families (52)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2099841C (en) | 1991-03-05 | 2003-02-25 | Ian G. Charles | Expression of recombinant proteins in attenuated bacteria |
| WO1993008207A1 (en) | 1991-10-25 | 1993-04-29 | Immunex Corporation | Novel cytokine |
| US7405270B2 (en) | 1991-10-25 | 2008-07-29 | Immunex Corporation | CD40-Ligand lacking native-pattern glycosylation |
| US5981724A (en) | 1991-10-25 | 1999-11-09 | Immunex Corporation | DNA encoding CD40 ligand, a cytokine that binds CD40 |
| US5962406A (en) | 1991-10-25 | 1999-10-05 | Immunex Corporation | Recombinant soluble CD40 ligand polypeptide and pharmaceutical composition containing the same |
| DE69322092T2 (de) | 1992-09-04 | 1999-07-15 | University Of Saskatchewan, Saskatoon | Neue bakterielle impfstoffe unter verwendung von impfstämmen von pathogenen bakterien |
| AU1059095A (en) | 1993-11-24 | 1995-06-13 | Australian National University, The | Treatment of viral disease with cd40l peptide |
| JP3657271B2 (ja) | 1995-03-01 | 2005-06-08 | イミュネックス・コーポレーション | 病原性または日和見感染性生物に感染した哺乳動物の治療のための組成物 |
| IL122174A (en) | 1995-06-07 | 2004-07-25 | Immunex Corp | Dna encoding a cd40l mutein and a cd40l polypeptide encoded by said dna |
| US6479258B1 (en) | 1995-12-07 | 2002-11-12 | Diversa Corporation | Non-stochastic generation of genetic vaccines |
| US6713279B1 (en) | 1995-12-07 | 2004-03-30 | Diversa Corporation | Non-stochastic generation of genetic vaccines and enzymes |
| US6306387B1 (en) | 1997-05-29 | 2001-10-23 | The Research Foundation Of State University Of New York | Antigen delivery system |
| US6969609B1 (en) | 1998-12-09 | 2005-11-29 | The United States Of America As Represented By The Department Of Health And Human Serivces | Recombinant vector expressing multiple costimulatory molecules and uses thereof |
| CA2223225A1 (en) | 1997-11-28 | 1999-05-28 | Canadian Red Cross Society | Method for inhibiting in vivo immune response |
| IL136731A0 (en) | 1997-12-19 | 2001-06-14 | Immunex Corp | Method for reducing susceptibility to hiv infection |
| GB9806449D0 (en) | 1998-03-25 | 1998-05-27 | Peptide Therapeutics Ltd | Attenuated bacteria useful in vaccines |
| US6190669B1 (en) | 1998-05-13 | 2001-02-20 | University Of Maryland, Baltimore | Attenuated mutants of salmonella which constitutively express the Vi antigen |
| US6248329B1 (en) * | 1998-06-01 | 2001-06-19 | Ramaswamy Chandrashekar | Parasitic helminth cuticlin nucleic acid molecules and uses thereof |
| ATE486940T1 (de) | 1998-09-04 | 2010-11-15 | Emergent Product Dev Uk Ltd | Abgeschwächte salmonella sp12 mutante als antigen-träger. |
| US7300774B1 (en) | 1999-12-09 | 2007-11-27 | The Regents Of The University Of California | Multimeric fusion proteins of the TNF superfamily ligands |
| EP1067194A1 (en) | 1999-04-16 | 2001-01-10 | F. Hoffmann-La Roche Ag | Vectors containing a gene coding for CD40 and/or CD40L under the control of a cytokine-inducible promoter which is a human acute phase amyloid A gene promoter. Methods for their production and uses thereof |
| WO2000063395A1 (en) | 1999-04-16 | 2000-10-26 | F. Hoffmann-La Roche Ag | Nucleic acids encoding cd40/cd40l chimeric polypeptides, methods for their production and uses thereof |
| WO2001026608A2 (en) * | 1999-10-14 | 2001-04-19 | Ledbetter Jeffrey A | Dna vaccines encoding antigen linked to a domain that binds cd40 |
| DK1112747T3 (da) | 1999-12-28 | 2004-10-25 | Akzo Nobel Nv | Salmonellavaccine, som ikke inducerer antistoffer mod flagellin eller flageller |
| WO2001056602A2 (en) | 2000-02-02 | 2001-08-09 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Cd40 ligand adjuvant for respiratory syncytial virus |
| ES2244617T3 (es) | 2000-03-17 | 2005-12-16 | Pharmacia & Upjohn Co Llc | Vacunas a base de salmonelas en las cuales los genes ssa han sido inactivados. |
| GB0015426D0 (en) | 2000-06-24 | 2000-08-16 | Univ Southampton | Method for generating soluble highly multimeric proteins |
| AU2002221780A1 (en) | 2000-10-31 | 2002-05-15 | F.Hoffmann-La Roche Ag | Nucleic acids encoding cd40/cd40l chimeric polypeptides, methods for their production and uses thereof |
| US8703146B2 (en) | 2001-04-20 | 2014-04-22 | Institute For Systems Biology | Toll-like receptor 5 ligands and methods of use |
| EP2107110A3 (en) | 2001-05-15 | 2011-10-26 | Ortho-McNeil Pharmaceutical, Inc. | Ex-vivo priming for generating cytotoxic T lymphocytes specific for non-tumor antigens to treat autoimmune and allergic disease |
| US6923958B2 (en) | 2002-03-02 | 2005-08-02 | The Scripps Research Institute | DNA vaccines encoding CEA and a CD40 ligand and methods of use thereof |
| WO2003096812A1 (en) * | 2002-04-15 | 2003-11-27 | Washington University | Regulated attenuation of live vaccines to enhance cross protective immunogenicity |
| US7495090B2 (en) | 2002-05-23 | 2009-02-24 | The Regents Of The University Of California | Nucleic acids encoding chimeric CD154 polypeptides |
| US20050181994A1 (en) | 2003-01-06 | 2005-08-18 | Xencor, Inc. | Novel variants of CD40L protein |
| US20060014248A1 (en) | 2003-01-06 | 2006-01-19 | Xencor, Inc. | TNF super family members with altered immunogenicity |
| US7754209B2 (en) * | 2003-07-26 | 2010-07-13 | Trubion Pharmaceuticals | Binding constructs and methods for use thereof |
| WO2005035570A2 (en) | 2003-10-10 | 2005-04-21 | Xencor, Inc. | Variants of cd40l protein |
| EP1720905A2 (en) | 2003-12-11 | 2006-11-15 | Sidney Kimmel Cancer Center | Methods for generating immunity to antigen |
| US8828957B2 (en) | 2003-12-11 | 2014-09-09 | Microvax, Llc | Methods for generating immunity to antigen |
| EP1740604A2 (en) | 2004-04-27 | 2007-01-10 | Intercell AG | Td antigens |
| WO2005113598A2 (en) | 2004-05-21 | 2005-12-01 | Xencor, Inc. | Tnf super family members with altered immunogenicity |
| US8513008B2 (en) | 2004-10-07 | 2013-08-20 | Argos Therapeutics, Inc. | Mature dendritic cell compositions and methods for culturing same |
| WO2006042177A2 (en) | 2004-10-07 | 2006-04-20 | Argos Therapeutics, Inc. | Mature dendritic cell compositions and methods for culturing same |
| WO2006105972A1 (en) | 2005-04-07 | 2006-10-12 | Universite Libre De Bruxelles | Transgenic organism expressing cd40l and uses thereof |
| US20060286074A1 (en) | 2005-05-31 | 2006-12-21 | Yucheng Tang | Methods for immunotherapy of cancer |
| RU2431499C2 (ru) | 2005-10-07 | 2011-10-20 | Пройекто Де Биомедисина Сима, С.Л. | Иммуностимулирующая комбинация для профилактики и лечения гепатита с |
| WO2007056266A2 (en) | 2005-11-07 | 2007-05-18 | Sidney Kimmel Cancer Center | Cd40 ligand fusion protein vaccine |
| WO2007054658A1 (en) | 2005-11-14 | 2007-05-18 | King's College London | Control of immune responses |
| US8802419B2 (en) | 2006-03-02 | 2014-08-12 | University Of Massachusetts | Modified pathogens for use as vaccines |
| ES2520026T3 (es) | 2006-09-18 | 2014-11-11 | The Board Of Trustees Of The University Of Arkansas | Composiciones y métodos para potenciar respuestas inmunitarias |
| WO2008109825A2 (en) | 2007-03-08 | 2008-09-12 | Mayo Foundation For Medical Education And Research | Inducing immune-mediated tumor cell death |
| CA3051748C (en) | 2007-11-01 | 2022-07-12 | The Board Of Trustees Of The University Of Arkansas | Compositions and methods of enhancing immune responses to eimeria |
-
2008
- 2008-10-30 NZ NZ585776A patent/NZ585776A/en not_active IP Right Cessation
- 2008-10-30 US US12/740,631 patent/US9125854B2/en active Active
- 2008-10-30 AU AU2008318615A patent/AU2008318615A1/en not_active Abandoned
- 2008-10-30 JP JP2010532246A patent/JP2011502165A/ja active Pending
- 2008-10-30 EP EP20080832781 patent/EP2214840B1/en active Active
- 2008-10-30 CN CN2008801169113A patent/CN102037135A/zh active Pending
- 2008-10-30 CA CA 2704457 patent/CA2704457A1/en not_active Abandoned
- 2008-10-30 WO PCT/US2008/081813 patent/WO2009059018A1/en not_active Ceased
- 2008-10-30 BR BRPI0818736A patent/BRPI0818736A2/pt not_active IP Right Cessation
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4420497A (en) * | 1981-08-24 | 1983-12-13 | Fairchild Camera And Instrument Corporation | Method of detecting and repairing latent defects in a semiconductor dielectric layer |
| US4510674A (en) * | 1982-10-21 | 1985-04-16 | Sovonics Solar Systems | System for eliminating short circuit current paths in photovoltaic devices |
| US5800632A (en) * | 1995-09-28 | 1998-09-01 | Canon Kabushiki Kaisha | Photovoltaic device and method for manufacturing it |
| US7098058B1 (en) * | 2004-01-15 | 2006-08-29 | University Of Toledo | Photovoltaic healing of non-uniformities in semiconductor devices |
| US20060249202A1 (en) * | 2004-09-20 | 2006-11-09 | Seunghyup Yoo | Photovoltaic cell |
| WO2007103048A2 (en) | 2006-03-01 | 2007-09-13 | Regents Of The University Of Colorado | Tlr agonist (flagellin)/cd40 agonist/antigen protein and dna conjugates and use thereof for inducing synergistic enhancement in immunity |
| US20070227586A1 (en) * | 2006-03-31 | 2007-10-04 | Kla-Tencor Technologies Corporation | Detection and ablation of localized shunting defects in photovoltaics |
Non-Patent Citations (3)
| Title |
|---|
| COX MANDY M ET AL., BMC BIOTECHNOLOGY, vol. 7, no. 59, 17 September 2007 (2007-09-17), pages 1 - 10 |
| KAJIKAWA ET AL., VACCINE, vol. 25, no. 18, 17 April 2007 (2007-04-17), pages 3599 - 3605 |
| See also references of EP2214840A4 |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8956849B2 (en) | 2007-11-01 | 2015-02-17 | The Board Of Trustees Of The University Of Arkansas | Compositions and methods of enhancing immune responses to Eimeria |
| US10016493B2 (en) | 2007-11-01 | 2018-07-10 | The Board Of Trustees Of The University Of Arkansas | Compositions and methods of enhancing immune responses to Eimeria |
| US10842858B2 (en) | 2007-11-01 | 2020-11-24 | The Board Of Trustees Of The University Of Arkansas | Compositions and methods of enhancing immune responses to Eimeria |
| US8956618B2 (en) | 2010-01-21 | 2015-02-17 | The Texas A&M University System | Vaccine vectors and methods of enhancing immune responses |
| US9913893B2 (en) | 2010-01-21 | 2018-03-13 | The Board Of Trustees Of The University Of Arkansas | Vaccine vectors and methods of enhancing immune responses |
| US10960068B2 (en) | 2010-06-09 | 2021-03-30 | The Board Of Trustees Of The University Of Arkansas | Vaccine and methods to reduce campylobacter infection |
| US8961990B2 (en) | 2010-06-09 | 2015-02-24 | The Board Of Trustees Of The University Of Arkansas | Vaccine and methods to reduce campylobacter infection |
| US9603915B2 (en) | 2013-02-14 | 2017-03-28 | The Board of Trustees of the University of Akansas | Compositions and methods of enhancing immune responses to Eimeria or limiting Eimeria infection |
| US9884099B2 (en) | 2013-02-14 | 2018-02-06 | The Board Of Trustees Of The University Of Arkansas | Compositions and methods of enhancing immune responses to Eimeria or limiting Eimeria infection |
| US10376571B2 (en) | 2013-03-15 | 2019-08-13 | The Board Of Trustees Of The University Of Arkansas | Compositions and methods of enhancing immune responses to enteric pathogens |
| US11013792B2 (en) | 2013-03-15 | 2021-05-25 | The Board Of Trustees Of The University Of Arkansas | Compositions and methods of enhancing immune responses to enteric pathogens |
| US10716840B2 (en) | 2013-03-15 | 2020-07-21 | The Board Of Trustees Of The University Of Arkansas | Compositions and methods of enhancing immune responses to enteric pathogens |
| CN104789583A (zh) * | 2014-01-20 | 2015-07-22 | 华中农业大学 | 一种人源产肠毒素大肠杆菌鞭毛蛋白2FliC融合蛋白及其应用 |
| US10682398B2 (en) | 2016-05-03 | 2020-06-16 | The Texas A&M University System | Yeast vaccine vector including immunostimulatory and antigenic polypeptides and methods of using the same |
| US11382962B2 (en) | 2016-05-03 | 2022-07-12 | The Board Of Trustees Of The University Of Arkansas | Yeast vaccine vector including immunostimulatory and antigenic polypeptides and methods of using the same |
Also Published As
| Publication number | Publication date |
|---|---|
| HK1146644A1 (en) | 2011-06-24 |
| AU2008318615A1 (en) | 2009-05-07 |
| AU2008318615A2 (en) | 2010-06-24 |
| WO2009059018A9 (en) | 2009-12-30 |
| US9125854B2 (en) | 2015-09-08 |
| JP2011502165A (ja) | 2011-01-20 |
| US20110159026A1 (en) | 2011-06-30 |
| EP2214840A4 (en) | 2012-03-07 |
| EP2214840A1 (en) | 2010-08-11 |
| BRPI0818736A2 (pt) | 2017-06-13 |
| CN102037135A (zh) | 2011-04-27 |
| CA2704457A1 (en) | 2009-05-07 |
| NZ585776A (en) | 2012-07-27 |
| EP2214840B1 (en) | 2015-05-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9125854B2 (en) | Compositions and methods of enhancing immune responses to flagellated bacterium | |
| US10842858B2 (en) | Compositions and methods of enhancing immune responses to Eimeria | |
| HK1146644B (en) | Compositions and methods of enhancing immune responses to flagellated bacterium | |
| AU2015202009B2 (en) | Compositions and methods of enhancing immune responses to eimeria | |
| HK1231742B (en) | Compositions and methods of enhancing immune responses to eimeria | |
| HK1231742A (en) | Compositions and methods of enhancing immune responses to eimeria | |
| HK1231742A1 (en) | Compositions and methods of enhancing immune responses to eimeria | |
| HK1146575B (en) | Compositions and methods of enhancing immune responses to eimeria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200880116911.3 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08832781 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2704457 Country of ref document: CA Ref document number: 2010532246 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1904/KOLNP/2010 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008832781 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 585776 Country of ref document: NZ |
|
| ENP | Entry into the national phase |
Ref document number: 2008318615 Country of ref document: AU Date of ref document: 20081030 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12740631 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: PI0818736 Country of ref document: BR Kind code of ref document: A2 Effective date: 20100430 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 585776 Country of ref document: NZ |