WO2006105972A1 - Transgenic organism expressing cd40l and uses thereof - Google Patents

Transgenic organism expressing cd40l and uses thereof Download PDF

Info

Publication number
WO2006105972A1
WO2006105972A1 PCT/EP2006/003159 EP2006003159W WO2006105972A1 WO 2006105972 A1 WO2006105972 A1 WO 2006105972A1 EP 2006003159 W EP2006003159 W EP 2006003159W WO 2006105972 A1 WO2006105972 A1 WO 2006105972A1
Authority
WO
Grant status
Application
Patent type
Prior art keywords
organism
cd40l
trypanosoma
transgenic
nucleic acid
Prior art date
Application number
PCT/EP2006/003159
Other languages
French (fr)
Inventor
Mustapha Chamekh
Abdelmounaïm ALLAOUI
Michel Goldman
Bernard Vray
Original Assignee
Universite Libre De Bruxelles
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70575NGF/TNF-superfamily, e.g. CD70, CD95L, CD153, CD154
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/002Protozoa antigens
    • A61K39/005Trypanosoma antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5156Animal cells expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/523Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55516Proteins; Peptides
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
    • Y02A50/38Medical treatment of vector-borne diseases characterised by the agent
    • Y02A50/398Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a bacteria
    • Y02A50/402Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a bacteria of the genus Rickettsia, Orientia, Ehrlichia, Neorickettsia, Neoehrlichia or Anaplasma, i.e. Rickettsial diseases, e.g. spotted fever
    • Y02A50/403Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a bacteria of the genus Rickettsia, Orientia, Ehrlichia, Neorickettsia, Neoehrlichia or Anaplasma, i.e. Rickettsial diseases, e.g. spotted fever the medicinal preparation containing antigens or antibodies, e.g. vaccines, antisera
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
    • Y02A50/38Medical treatment of vector-borne diseases characterised by the agent
    • Y02A50/408Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa
    • Y02A50/409Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa of the genus Leishmania i.e. Leishmaniasis, Sand-fly fever, phlebotomus fever, kala-azar, black fever or Dumdum fever
    • Y02A50/41Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa of the genus Leishmania i.e. Leishmaniasis, Sand-fly fever, phlebotomus fever, kala-azar, black fever or Dumdum fever the medicinal preparation containing antigens or antibodies, e.g. vaccines, antisera
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
    • Y02A50/38Medical treatment of vector-borne diseases characterised by the agent
    • Y02A50/408Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa
    • Y02A50/411Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa of the genus Plasmodium, i.e. Malaria
    • Y02A50/412Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa of the genus Plasmodium, i.e. Malaria the medicinal preparation containing antigens or antibodies, e.g. vaccines, antisera
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
    • Y02A50/38Medical treatment of vector-borne diseases characterised by the agent
    • Y02A50/408Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa
    • Y02A50/413Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa of the genus Trypanosoma
    • Y02A50/414Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa of the genus Trypanosoma the protozoa being Trypanosoma cruzi i.e. Chagas disease or American trypanosomiasis

Abstract

The present invention relates to a transgenic organism expressing a nucleic acid encoding CD40L and to uses thereof as a medicament or as a vaccine. The present invention also relates to a pharmaceutical or vaccine composition comprising said transgenic organism and to methods for treating a subject infected with said organism and to methods for stimulating an immune response against disease(s) caused by said organism in a subject in need thereof.

Description

Transgenic organism expressing CD40L and uses thereof

Field of the invention

The present invention relates to transgenic organisms, compositions and methods for treating a subject infected with a pathogenic or opportunistic organism and/or for stimulating an immune response in a subject in need thereof. The present invention relates to the use of transgenic organisms expressing CD40L, such as protozoa, bacteria, viruses, and/or fungi, and their use for treating infectious diseases and/or for stimulating immune responses against infectious diseases.

Background

Infectious diseases are human illnesses that may be caused by viruses, bacteria, fungi, protozoan, parasites, and other microbes. They may be spread by direct contact with an infected person or animal, by ingesting contaminated food or water, by insects like mosquito's, bugs or ticks, or by contact with contaminated surroundings like animal droppings or even contaminated air.

One example of an infectious disease is Chagas' disease. Trypanosoma cruzi, the etiological agent of Chagas' disease, is a hemoflagellate parasitic protozoa that infects humans as well as domestic and wild mammals (42). The transmission occurs after the bite of an infected blood-sucking bug (family Reduvidae) which harbours epimastigotes in its gut and which releases metacyclic (infective) trypomastigotes in its feces or urine. Infective trypomastigotes enter mammalian hosts through skin abrasion or locally disrupted mucosal epithelia. In the vertebrate host, trypomastigotes are the circulating blood forms that infect several cells (macrophages, fibroblasts, nerve cells, muscle cells) while amastigotes are intracellular forms of multiplication (46). Experimental infection of BALB/c mice mimics the human disease. It displays an acute phase with parasitemia and mortality followed by a chronic phase during which parasites become undetectable in peripheral blood while persisting in tissues and inducing pathological manifestations (8, 30). Chagas1 disease is especially dangerous because there are no satisfactory prophylactic or curative agents available and because an individual, once he has contracted the disease remains infected for life. This disease is furthermore becoming a worldwide problem because of the contamination through blood transfusion. It has therefore become essential to develop compositions and methods for treating this disease. Because of the present lack of effective chemotherapy, several attempts have been made to develop vaccines for immunisation against Chagas' disease. However, the presently available vaccines for immunisation against Chagas' disease have several disadvantages. The available vaccines generally induce a decrease in parasitaemia but little increase in survival. Also, some vaccines may cause symptoms of the disease which have been associated with auto-immune effects. Another example of an infectious disease is tuberculosis. Tuberculosis is the leading infectious disease cause of death and represents more than a quarter of the world's preventable deaths. Transmission of tuberculosis occurs primarily by the aerosol route but can also occur through the gastrointestinal tract. In many countries, vaccination against tuberculosis is routinely practiced. The Bacillus Calmette-Guehn (BCG) vaccine is a live, attenuated strain of Mycobacterium bovis which was introduced in 1922. However, the true efficacy of BCG is unknown.

There remains a great need in the art for developing improved compositions and methods for treating infectious diseases in general. There also remains a great need in the art for developing improved vaccine compositions and methods for immunization against infectious diseases in general.

One object of the invention is to provide improved compositions and methods for treating infectious diseases.

The present invention also aims to provide improved vaccine compositions and methods for improving and/or stimulating immune responses against infectious diseases in a subject in need thereof.

Summary

The present invention is in general directed to transgenic organisms expressing a nucleic acid encoding CD40L and uses thereof for treatment and/or immunization against infectious diseases.

In a first aspect the invention relates to a transgenic organism expressing a nucleic acid encoding CD40L. Said transgenic organism is preferably able to elicit immune responses when administered to a subject in need thereof. CD40L (or CD154) is a co- stimulatory protein that belongs to the TNF receptor family. It is the ligand of CD40, a cell surface receptor belonging to the TNF receptor family. The CD40/CD40L interaction exerts a potent immunomodulatory capacity and triggers a pleiotropic pathway involved in both humoral and cellular immunity, a pathway which plays a major role in anti-infective host defense. The present invention is at least in part based on the Applicants' finding of the involvement of CD40L produced by a transgenic organism in the modulation of anti- parasite immune response. In another aspect, the invention provides methods for preparing a transgenic organism expressing CD40L.

In yet another aspect, the invention relates to a composition comprising a transgenic organism as defined herein and a pharmaceutically acceptable carrier. Said composition may be suitable for treating a subject infected with said organism. Said composition may also be suitable for stimulating immune responses in a subject, preferably against diseases caused by said organism.

In a further aspect, the invention relates to the use of a transgenic organism or of a composition as defined herein as a medicament for treating a subject infected with said organism; or for the preparation of a medicament for treating a subject infected with said organism.

In yet another aspect, the invention relates to the use of a transgenic organism or of a composition as defined herein as vaccine for stimulating immune responses in a subject; or for the preparation of a vaccine for stimulating immune responses in a subject. The present invention further relates to a method for treating a subject infected with one or more organisms as defined herein comprising administering a transgenic organism or a composition as defined herein to said subject.

In yet another aspect, the invention relates to a method for stimulating immune responses in a subject comprising administering a transgenic organism or a composition as defined herein to said subject.

The present invention thus provides transgenic organisms, pharmaceutical or vaccine compositions and methods for modulating and/or stimulating the immune response of a subject (human/animal) in a beneficial way, and to favor a better defense of the subject against pathogenic or opportunistic organisms. Therefore, the present invention provides attenuated or killed organisms that are capable of strongly stimulating an immune response in a subject in need thereof. In addition, the present transgenic organisms are able to counteract the immune suppression that is induced in the host by antigens produced by the parasitic organisms.

Additional aspects of the present invention will be apparent in view of the detailed description and accompanying drawings, which follow.

Detailed description of the figures

Figure 1 represents RT-PCR and Western blot analyses. RNA and whole cell extracts from wild type (Y), pTEX-transfected (YpTEX) or YpTEX-CD40L-transfected (YpTEX- CD40L) epimastigotes were used for RT-PCR (A) and Western blot analysis (B).

Trypomastigotes derived from these epimastigotes were used for RT-PCR (C) and Western blot analysis (D). Specific primers were used to amplify the indicated cDNA (neo: neomycine phosphotransferase). For protein analysis, CD40L was detected using a specific monoclonal antibody and an anti-TcRGG polyclonal antibody was used as control.

Figure 2 shows parasitemia (Fig. 2A) and cumulative mortality (Fig. 2B) of mice infected with Y, YpTEX or YpTEX-CD40L strains.

A. Three groups (38 mice per group) were infected at day 0 with Y (■), YpTEX (•) or YpTEX-CD40L (A) strain. Parasitemia was recorded every week. Data are mean ± SEM of two independent experiments using 15 and 23 mice per group. Because some mice died in the course of infection or were sacrificed to harvest the spleens, n = 36, 30, 28, 26, 20 and 10 for group Y; n = 36, 30, 28, 26, 18, and 15 for group YpTEX and n = 36, 30, 28, 26, 24 and 22 mice for group YpTEX-CD40L respectively at days 7, 14, 21 , 28, 35 and 42 pi. YpTEX-CD40L vs YpTEX : * : p < 0.05 ; ** : p < 0.01 ; *** : p < 0.001 , (Mann-Whitney C-test). B. Three groups (38 mice per group) were infected at day 0 with Y (■), YpTEX (•) or YpTEX-CD40L (A) strain. Surviving mice were recorded every day. Sacrificed mice were excluded from the survival rate. Data are from two independent experiments. They are presented as the number of died mice (cumulative mortality) in the course of infection. YpTEX-CD40L vs Y : p = 0.0002 ; YpTEX-CD40L vs YpTEX : p = 0.004 ; YpTEX vs Y: p = 0.62 (non significant) (Gehan's Wilcoxon test).

Figure 3 illustrates the proliferation of SCs activated with T. cruzi lysates and production of IFN-K by SCs from mice infected with Y, YpTEX or YpTEX-CD40L strains. Three groups of mice (66 mice per group) were infected at day 0 with Y (black bars), YpTEX (hatched bars) or YpTEX-CD40L (open bars) strain. One group of 5 mice (horizontal bars) was not infected and served as control (day 0 pi). Every week, five mice were sacrificed. A. SCs were harvested and incubated with T. cruzi lysate. B. IFN-j/ was measured by ELISA in the culture supernatants of SCs stimulated with T. cruzi lysates. Data are means ± SEM of three independent experiments. YpTEX-CD40L vs YpTEX : * : p < 0.05 ; ** : p < 0.01. (Mann-Whitney U-test).

Figure 4 shows kinetics of anti-T. cruzi antibody levels. Samples of serum were harvested by cardiac puncture from mice used in 3 independent experiments and infected with Y (■), YpTEX (•) or YpTEX-CD40L (A) strain. Using an ELISA test, the optical densities corresponding to the anti-T. cruzi antibody levels were measured. Seven samples of serum from uninfected mice served as control (DO = 0.107). Data are means ± SEM (n = 5). There was no statiscally significant difference between YpTEX-CD40L and YpTEX (Mann-Whitney U-iest).

Figure 5 illustrates protective capacity of YpTEX-CD40L-transfected trypomastigotes. A group of 6 mice (A) that survived to YpTEX-CD40L infection were challenged at day 55 pi (day 0 of the re-infection) with a different strain of T. cruzi trypomastigotes (Tehuantepec strain, 100 trypomastigotes, ip). Five mice (control group, ■) were infected at the same time with the same inoculum. A. Parasitemia. B. Cumulative mortality. Data are representative of one experiment out of two.

Figure 6 illustrates the nucleic acid sequence of Murine CD40L (of Mus musculus) (SEQ ID NO: 4). Figure 7 illustrates the Murine CD40L protein sequence (of Mus musculus) (SEQ ID NO: 5). Figure 8 illustrates the Human CD40L DNA sequence (SEQ ID NO: 6). Figure 9 illustrates the Human CD40L protein sequence (SEQ ID NO: 7).

Detailed description of the invention

The present invention relates in general to a transgenic organism and its use for treating infectious diseases and/or for immunization against infectious diseases. More in particular, the invention provides a transgenic organism that is able to express a molecule co-stimulating the host immune system. Even more in particular, the invention provides a transgenic organism that is capable of expressing CD40L. The present invention also relates to the construction of such transgenic organism and uses thereof in therapeutic and vaccine applications.

CD40L CD40 is a cell surface receptor belonging to the TNF receptor family. It is expressed by various endothelial and epithelial cells and immunocompetent cells such as B lymphocytes, activated CD4P+P and CD8P+P T lymphocytes, dendritic cells (DCs), follicular DCs, monocytes and macrophages. On the other hand, its ligand, CD40L (or CD154), is a costimulatory protein that belongs to the TNF family. It is expressed, among others, by activated CD4P+P T lymphocytes, B lymphocytes, DCs, NK cells, monocytes and macrophages (3, 21 , 47, 54).

The CD40/CD40L interaction exerts a potent immunomodulatory capacity that has been widely documented (13, 18, 20, 22, 39, 43, 55) and triggers a pleiotropic pathway involved in both humoral and cellular immunity. By exerting potent biological activities on CD4P+P T cells and APC such as DCs and macrophages, this pathway plays a major role in anti-infective host defense. Indeed, CD40 ligation results in the secretion of multiple cytokines such as gamma interferon (IFN-^ by immunocompetent cells. Furthermore, CD40 expression on CD8P+P T cells seem to be involved in the CD8P+P T cell memory generation (6, 10, 11 , 21 , 23).

Transgenic organisms In accordance with the present invention, the CD40L molecule is produced in vivo by a transgenic organism. The CD40L molecule is capable in accordance with the present invention of stimulating immune responses in a subject, which are effective against the establishment of disease infection. The present transgenic organism has very interesting vaccine properties. In a preferred embodiment the invention relates to a transgenic pathogenic and/or an opportunistic organism expressing a nucleic acid encoding CD40L.

The term "organism" as used herein refers to a pathogenic and/or an opportunistic organism. Pathogenic organisms are organisms that are capable of causing disease in a healthy individual. Opportunistic organisms usually do not cause disease in a healthy individual, but may result in disease conditions in immuno-compromised hosts. Both types of organisms include but are not limited to viruses, bacteria, fungi, and protozoa. Additionally, in some diseases, multiple organisms may be present, and may play a causative role in the disease. Preferably, the organism according to the present invention is an "attenuated organism", meaning that the organism is a weakened organism, e.g. being less vigorous and/or having reduced pathogenicity.

The term "transgenic organism" as used herein refers to a genetically modified organism having foreign genetic information.

In an embodiment, the transgenic organisms according to the invention include bacteria. Examples of suitable bacterial organisms used in accordance with the present invention include but are not limited to Mycobacteria, Rickettsia, Salmonella, Shigella, Yersinea, Yersinia, and Streptococcus. Examples of suitable Mycobacteria organisms include but are not limited to Mycobacterium tuberculosis, Mycobacterium leprae, or Mycobacterium bovis. Certain of the Rickettsia, for example R. prowazekii, R. coronii, and R. tsutsugamushi are also included. In addition, examples of suitable Streptococcus organisms include but are not limited to Streptococcus pneumoniae, Streptococcus agalactiae.

In another embodiment, the transgenic organisms according to the invention include fungi. Examples of fungi used in accordance with the present invention include but are not limited to Histoplasma, Candida, Cryptococcus, or Blastomyces. Suitable examples of fungi may include but are not limited to Histoplasma capsulatum, Candida albicans, Candida parapsilosis, Cryptococcus neoformans, or Blastomyces dermatitidis. In still another embodiment, the transgenic organisms according to the invention include viruses. Examples of suitable viruses used in accordance with the present invention include but are not limited to influenza viruses such as Myxovirus influenza, rhinoviruses, rotaviruses, coronaviruses, arboviruses, (RNA) retroviruses such as HIV, or hepatitis viruses such as but not limited to HAV, HBV or HCV.

In yet another embodiment the transgenic organisms according to the invention include protozoa. Examples of protozoan organisms used in accordance with the present invention include but are not limited to Leishmania, Trypanosoma, Plasmodium or Toxoplasma. An exemplary pathogenic protozoan is Leishmania, an obligate intracellular macrophage parasite that causes a variety of diseases characterized by visceral, cutaneous, or mucosal lesions. Different species and isolates of Leishmania vary in their ability to infect and replicate in macrophages both in vivo and in vitro. Another important pathogenic protozoan includes Toxoplasma gondii which causes toxoplasmosis. Yet another important pathogenic hemoflagellate includes the protozoan Trypanosoma cruzi (T. cruzi) which causes Chagas' disease. Infection with this parasite may be acute or chronic, and frequently involves development of progressive pathology in tissues of the heart, esophagus and colon. The parasites infect a variety of nucleated cells, including macrophages. In both human and laboratory animals, T. cruzi infection is accompanied by a non-specific immune suppression mediated by T cells and macrophages. Mechanisms which control parasite replication during the acute and chronic phases and which maintain low but persistent numbers of circulating parasites during the chronic phase are not well understood. Other exemplary pathogenic protozoa include protozoa of the genus Plasmodium, which cause malaria. Examples include Plasmodium vivax, P. malariae, P. ovale and P. falciparum, four species of Plasmodium that infect humans. In addition to infecting humans, many of these organisms infect other mammals, which then can serve as a reservoir of infection for humans. For example, domesticated dogs are believed to serve as a major reservoir of Leishmania, while cats are known to carry Toxoplasma. Transgenic organisms, compositions and methods according to the invention for augmenting a mammals1 immune response against these organisms are also useful in species of mammals other than humans.

In a preferred embodiment the present organism is selected from the group comprising Trypanosoma, Plasmodium, Toxoplasma, Leishmania, Mycobacteria, Rickettsia, Salmonella, Shigella, Yersinia,, Histoplasma, Candida, Cryptococcus, influenza viruses, rhinoviruses, rotaviruses, coronaviruses, arboviruses, retroviruses and hepatitis viruses. In a preferred embodiment, the organism according to the invention comprises a

Trypanosoma organism, and preferably a pathogenic Trypanosoma cruzi strain, such as for instance but not limited to a T. cruzi strain Y or a T. cruzi strain Teuantepec. The term

"strain" as used herein refers to an organism within a particular species that possesses minor differences in its characteristics though still remains distinguishable.

In another preferred embodiment, the organism according to the invention comprises a Mycobacterium organism, and preferably a strain of Mycobacterium bovis or an attenuated Mycobacterium bovis known as BCG strain.

In yet another preferred embodiment, the organism according to the invention comprises a Cryptococcus organism, and preferably a strain of Cryptococcus neoformans.

In still another preferred embodiment, the organism according to the invention comprises a influenza virus, and preferably a strain of Myxovirus influenza.

Method of preparing the organisms according to the invention

The transgenic organisms as defined herein expressing a nucleic acid encoding CD40L can be obtained by means of different techniques.

In one embodiment the transgenic organism as defined herein, and preferably a Trypanosoma organism, a Mycobacterium organism, a Cryptococcus organism, or a Myxovirus organism is obtained by transfection with a vector carrying a nucleic acid encoding CD40L and which is adapted for expressing said nucleic acid in said organism. A suitable transfection vector for use in accordance with the present invention includes a vector which is adapted to express heterologous proteins in said organism.

A preferred example of such vector includes a pTEX, which is for instance adapted to express heterologous proteins in a protozoan organism and preferably in a Trypanosoma organism. Another preferred example of such vector includes a pEN 103 vector, which is for instance adapted to express heterologous proteins in a bacterial organism, and preferably in a Mycobacterium organism. Another preferred example of such vector includes a Bluescript plasmid DNA, which is for instance adapted to transfer heterologous genes and to allow expression of heterologous proteins in a fungal organism, and preferably in a Cryptococcus organism. Another preferred example of a vector includes an eukaryotic vector. A recombinant virus can for instance be obtained according to the present invention by applying a transduction methodology consisting of transfecting cells with an eukaryotic vector containing the CD40L, followed by their infection with targeted viruses.

In another embodiment, the transgenic organism as defined herein, and preferably a Trypanosoma organism, a Mycobacterium organism, a Cryptococcus organism, or a Myxovirus organism, is an organism that has been transformed with a nucleic acid encoding CD40L by means of homologous recombination. This approach involves the targeting of a nucleic acid encoding CD40L in the genome of a -preferably attenuated — organism, and preferably a Trypanosma organism, by homologous recombination. For that, the nucleic acid encoding CD40L is preferably cloned into an expression vector in order to be flanked by intergenic regions (e.g. actin) specific for the organism, and preferably specific for the Trypanosoma parasite. Such construction supports the expression of the nucleic acid encoding CD40L under the control of a suitable promoter introduced in the expression vector and without having deteriorating effects on the survival of the transformed organism.

The nucleic acid encoding CD40L may comprise, or alternatively consist of, a nucleotide sequence as disclosed in US patent N° 6,410,711 (DNA encoding CD40 ligand, a cytokine that binds CD40), which is incorporated herein by reference, or a homologue thereof.

In another embodiment, the nucleic acid encoding CD40L is a nucleic acid having a nucleotide sequence as given in SEQ ID NO: 4, or a homologue thereof. In another embodiment, the nucleic acid encoding CD40L is a nucleic acid having a nucleotide sequence as given in SEQ ID NO: 6, or a homologue thereof. The term "homologue of a nucleic acid" as used herein refers to a nucleic acid having a nucleotide sequence that has at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 97,5%, 98%, 98,5%, 99% or 99,5% identity with the nucleotide sequence corresponding to the CD40L gene, for instance given in SEQ ID NO: 4 or SEQ ID NO: 6. By a nucleic acid with, for example, 95% "identity" with a reference nucleotide sequence, it is intended that the nucleotide sequence of said nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a nucleic acid having a nucleotide sequence of at least 95% identity to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. As a practical matter, whether any particular nucleic acid molecule has at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 97,5%, 98%, 98,5%, 99% or 99,5% identity with a reference nucleotide sequence can be determined using known algorithms. It should also be understood that instead of % "identity", also the corresponding % "similarity" can be used to define homologues according to the invention. In another embodiment, the invention relates to a transgenic organism expressing a nucleic acid encoding CD40L, wherein said CD40L is a polypeptide having an amino acid sequence as given SEQ ID NO: 5, or a homologue thereof. In yet another embodiment, the invention relates to a transgenic organism expressing a nucleic acid encoding CD40L, wherein said CD40L is a polypeptide having an amino acid sequence as given SEQ ID NO: 7, or a homologue thereof.

The term "homologue of a polypeptide" as used herein refers to a polypeptide having an amino acid sequence that has at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 97,5%, 98%, 98,5%, 99% or 99,5% identity with the amino acid sequence corresponding to the CD40L gene, and for instance SEQ ID NO: 5 or SEQ ID NO:7. By a polypeptide with, for example, 95% "identity" to a reference amino acid sequence, it is intended that the amino acid sequence of said polypeptide is identical to the reference sequence except that the amino acid sequence may include up to five amino acid alterations per each 100 amino acids of the reference polypeptide amino acid sequence. In other words, to obtain a polypeptide having an amino acid sequence of at least 95% identity with a reference amino acid sequence, up to 5% of the amino acids in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acids in the reference sequence may be inserted into the reference sequence. As a practical matter, whether any particular polypeptide has at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 97,5%, 98%, 98,5%, 99% or 99,5% identity to an amino acid sequence of the present invention can be determined using known algorithms. It should also be understood that instead of % "identity", also the corresponding % "similarity" can be used to define homologues according to the invention.

In another embodiment, the invention relates to a method for preparing a transgenic organism as defined herein. It shall be understood that the methods for obtaining transgenic organisms as defined herein may comprise any kind of transfection, transformation or transduction methods.

In one embodiment, the invention provides a method for preparing a transgenic organism expressing CD40L comprising the steps of: a) cloning a nucleic acid encoding CD40L in a vector suitable for expressing said nucleic acid in said organism, b) transfecting said organism, said organism being in a suitable life stage, with the vector obtained in step a), and c) optionally maintaining the transfected organism obtained in step b) in vivo or in vitro.

In another embodiment, the invention provides a method for preparing a transgenic organism expressing CD40L comprising the steps of: a) providing a nucleic acid encoding CD40L, b) transforming said organism, said organism being in a suitable life stage, with the nucleic acid according to step a) by means of homologous recombination, and c) optionally maintaining the transformed organism obtained in step b) in vivo or in vitro.

The invention also relates to a method for preparing an organism, preferably a virus organism, expressing CD40L comprising the steps of: a) cloning a nucleic acid encoding CD40L in a vector suitable for expressing said nucleic acid in eukaryotic cells, b) transforming said organism, said organism being in a suitable life stage, with a nucleic acid according to step a) by means of transduction, and a) optionally maintaining the transformed organism obtained in step b) in vivo or in vitro.

In an example, a transgenic virus organism is provided by employing transduction methodology. The invention provides a method for preparing a transgenic viral organism expressing CD40L comprising the steps of: a) cloning a nucleic acid encoding CD40L in a vector suitable for expressing said nucleic acid in an eukaryotic cell, b) transfecting said cell, said cell being in a suitable life stage, with the vector obtained in step a), and c) infecting the cell obtained in step b) with a suitable organism, and d) optionally maintaining the organism obtained in step c) in vivo or in vitro.

In a preferred embodiment, the invention provides a method for preparing a transgenic Trypanosoma organism as defined herein. The method comprises the steps of: a) cloning a nucleic acid encoding CD40L in a vector suitable for expressing said nucleic acid in said Trypanosoma organism, b) transfecting epimastigotes of said Trypanosoma organism with the vector obtained in step a), c) transforming the epimastigotes obtained in step b) into trypomastigotes, and d) optionally maintaining the trypomastigotes obtained in step c) in vivo or in vitro. Preferably said Trypanosoma organism is a pathogenic Trypanosoma cruzi strain, such as for instance but not limited to a T. cruzi strain Y or a T, cruzi strain Teuantepec.

As mentioned above, any vector which is suitable for and capable of expressing said nucleic acid encoding CD40L in a Trypanosoma organism may be used in accordance with the present invention. A preferred example is a pTEX vector. The nucleic acid encoding CD40L may be cloned in such vector according to cloning techniques which are well known in the art.

In a next step, the obtained vector is transfected to epimastigotes of a Trypanosoma organism. The term "epimastigote" is well known in the art and refers to a non-infectious stage in the life cycle of a (Trypanosoma) parasite. The term "transfection" refers to the introduction of DNA into cells. Transfection typically involves opening transient "holes" or gates in cells to allow the entry of extracellular molecules. Introduction of a vector expressing a nucleic acid encoding CD40L in epimastigotes in accordance with the present method may be done by any suitable transfection method known in the art, including, but not limited to calcium phosphate transfection, liposome transfection, electroporation, heat shock, or by means of proprietary transfection reagents such as Fugene. In a preferred embodiment epimastigotes of a Trypanosoma organism are transfected with a vector carrying a nucleic acid encoding CD40L by means of electroporation.

In a next step, the obtained epimastigotes are transformed into trypomastigotes. The term "trypomastigote" is well known in the art and refers to an infectious stage in the life cycle of a (Trypanosoma) parasite. The epimastigotes may be transformed into trypomastigotes in vitro by means of a metacyclogenesis process. The term "metacyclogenesis" involves the transformation of non-infective epimastigotes into metacyclic trypomastigotes, which are the pathogenic form. In accordance with the invention, the metacyclogenesis process may be done by any suitable method known in the art.

In a further step, the obtained trypomastigotes may be maintained in vivo, for instance by infecting animals (e.g. mice, rats and the like). The applicant has shown that inoculation of mice with the obtained trypomastigotes generates a weak parasitemic reaction without causing animal death. Moreover, it was shown that the obtained trypomastigotes induce an immune response capable of fully protecting surviving mice against a test inoculation with a strain different from a T. cruzi strain (see examples).

The obtained trypomastigotes may also be maintained in vitro, e.g. in the presence of suitable cells such as macrophages, VERO cells, etc... which are preferably kept in culture in order to permit the parasites to multiply.

In another embodiment, the present method for preparing a transgenic organism as defined herein, and preferably for preparing a transgenic Trypanosoma organism as defined herein, comprises the step of directly transfecting the trypomastigotes of said Trypanosoma organism with the vector obtained in step a) as defined above, by any possible transfection technique. Preferably said Trypanosoma organism is a pathogenic Trypanosoma cruzi strain, such as for instance but not limited to a T. cruzi strain Y or a T. cruzi strain Teuantepec.

Compositions

In one embodiment, the present invention thus relates to a composition comprising a transgenic organism as defined herein, and a pharmaceutically acceptable carrier for treating a subject against diseases caused by said transgenic organism.

In another embodiment, the present invention relates to a vaccine composition comprising a transgenic organism as defined herein and a pharmaceutically acceptable carrier for inducing immunity and/or for stimulating immune responses to a disease caused by said organism.

In a particularly preferred embodiment, said transgenic organism is a Trypanosoma organism, and preferably a pathogenic Trypanosoma cruzi strain, such as for instance but not limited to a T. cruzi strain Y or a T. cruzi strain Teuantepec.

It shall be clear that in accordance to the present invention the term "compositions" as used herein may in certain embodiments be considered to refer to pharmaceutical compositions and/or to therapeutic or prophylactic vaccine compositions.

The term "prophylactic vaccine compositions" as used herein refers to vaccine compositions that are prophylactic and that are used before illness develops, either being administered to large numbers of people in order to prevent infection, or in some cases to people who have been exposed to a disease but have not yet become ill.

The term "therapeutic (treatment) vaccine compositions" as used herein refers to vaccine compositions that are curative and that are used after illness has developed.

Therapeutic vaccines may be administered to people who already have the disease in order to heighten and broaden the immune response to the disease and helping to halt disease progression. In a further preferred embodiment, the invention relates to a (vaccine) composition comprising a transgenic organism, and preferably a Trypanosoma organism, a pharmaceutically acceptable carrier, and optionally one or more additional compounds, preferably co-stimulatory molecules. The term "co-stimulatory molecules" as used herein refers to molecules which modulate and/or stimulate immune or inflammatory responses in a subject. These molecules may include but are not limited to soluble cytokine receptors or cytokines such as for instance interleukin-1 α & β (IL-1α, IL-Ij.?), interleukin-2 (IL-2), interleukin-6 (IL-6), interleukin-8 (IL-8), interleukin-12 (IL-12), interleukin-18 (IL-18) and Tumor necrosis factor α (TNF-σ), Macrophage Inhibitory Peptide-1 α (MIP-1σ), Macrophage Inhibitory Peptide-1/?, (MIP-1/?), or growth regulatory protein (GRO). These co-stimulatory molecules may also include factors that are known to activate monocytes/macrophages such as but not limited to granulocyte-macrophage colony stimulating factor (GM-CSF, or sargramostim), or fusion proteins comprising GM-CSF, or interferons (INFs) such as interferon-gamma (IFN-y). In an example the invention relates to a pharmaceutical (vaccine) composition comprising A) a transgenic organism, and preferably a Trypanosoma organism, as defined herein, B) a pharmaceutically acceptable carrier, and C) interleukin-1 α & /? (IL-1α, \L-Λβ), interleukin-2 (IL-2), interleukin-6 (IL-6), interleukin-8 (IL-8), interleukin-12 (IL-12) and/or interleukin-18 (IL-18). In another example the invention relates to a pharmaceutical (vaccine) composition comprising A) a transgenic organism, and preferably a Trypanosoma organism, as defined herein, B) a pharmaceutically acceptable carrier, and C) interleukin 12 (IL-12) and/or interleukin-18 (IL-18).

In yet another example, the invention relates to a pharmaceutical (vaccine) composition comprising A) a transgenic organism, and preferably a Trypanosoma organism, as defined herein, B) a pharmaceutically acceptable carrier, and C) Macrophage Inhibitory Peptide-1σ (MIP-1 α) and/or Macrophage Inhibitory Peptide-1^, (MIP-1/?).

In yet another example, the invention relates to a pharmaceutical (vaccine) composition comprising A) a transgenic organism, and preferably a Trypanosoma organism, as defined herein, B) a pharmaceutically acceptable carrier, and C) Tumor necrosis factor α (TNF-σ).

In still another example, the invention relates to a pharmaceutical (vaccine) composition comprising A) a transgenic organism, and preferably a Trypanosoma organism, as defined herein, B) a pharmaceutically acceptable carrier, and C) growth regulatory protein (GRO). In another example, the invention relates to a pharmaceutical (vaccine) composition comprising A) a transgenic organism, and preferably a Trypanosoma organism, as defined herein, B) a pharmaceutically acceptable carrier, and C) granulocyte-macrophage colony stimulating factor (GM-CSF) and/ or fusion proteins comprising GM-CSF.

In still another example, the invention relates to a pharmaceutical (vaccine) composition comprising A) a transgenic organism, and preferably a Trypanosoma organism, as defined herein, B) a pharmaceutically acceptable carrier, and C) an interferon such as interferon-gamma (IFN-y). It will be clear that the appropriate doses of said one or more of said co-stimulatory molecules in said compositions may be easily established by a skilled person using generally known techniques.

Pharmaceutically acceptable carriers for use in (vaccine) composition according to the invention may include sterile aqueous or non-aqueous solutions, suspensions, and emulsions preferably suitable for injection or inhalation. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and certain organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Other examples of carries include but are not limited to slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, etc.. Such carriers are well known to those of ordinary skill in the art.

The (vaccine) composition according to the invention may also contain one or more adjuvants, as long as these are compatible with the transgenic organism and do not interfere with its desired immunogenic properties. Adjuvants are chemical additions to (vaccine) compositions that help boost and enhance the effectiveness of the composition. Adjuvants may be derived from a variety of sources and can be isolated from animals, plants, or are synthetic chemical compounds. Examples of suitable adjuvants may include but are not limited Freud's adjuvant (IFA, mineral oil and an emulsifying agent), paraffin oils to produce a water-oil emulsion, and insoluble metallic salts, e.g. aluminium salts. Such adjuvants are well known to those of ordinary skill in the art.

Preservatives and other additives may also be present such as, for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like. One skilled in the art will select among these available compounds depending upon the administration route. Further, said pharmaceutical (vaccine) composition comprising a transgenic organism as defined herein may be lyophilized, freeze dried, or dry sprayed, according to the route of administration, for example inhalation, injection, etc....

The transgenic organism and the other molecule(s), e.g. co-stimulatory molecules as defined herein, can be administered simultaneously, sequentially or separately.

Therefore, in another embodiment, the invention may further relate to a kit comprising a composition as defined herein and one or more co-stimulatory molecules, as defined above, for simultaneous, sequential or separate use.

The invention further also relates to a method for the preparation of a pharmaceutical (vaccine) composition comprising admixing a transgenic organism, and preferably a Trypanosoma organism, as defined herein with a pharmaceutically acceptable carrier, and optionally with one or more co-stimulatory molecules as defined herein.

First and second medical uses In another embodiment, the invention relates to the use of a transgenic organism or of a composition comprising said organism as defined herein as a medicament, or for the preparation of a medicament for treating a subject infected with said organism.

In another embodiment, the invention relates to the use of a transgenic organism or of a composition comprising said organism as defined herein as a vaccine or for the preparation of a vaccine for stimulating immune responses in a subject, preferably against a disease caused by said organism. The vaccine may be a therapeutic or prophylactic vaccine. Said transgenic organism is expressing a nucleic acid encoding CD40L which is able to elicit an immune response when administered to a subject in need thereof.

Preferably said transgenic organism is a pathogenic Trypanosoma cruzi strain, such as for instance but not limited to a T. cruzi strain Y or a T. cruzi strain Teuantepec. In a preferred embodiment, the invention relates to the use of a transgenic Trypanosoma organism or of a composition comprising said organism as defined herein as a medicament, or for the preparation of a medicament for treating Chagas' disease. In another embodiment; the invention relates to the use of a transgenic Trypanosoma organism or of a composition comprising said organism as defined herein as a vaccine or for the preparation of a vaccine for stimulating immune responses in a subject against Chagas' disease.

In yet another embodiment, the use of a transgenic organism, and preferably a transgenic Trypanosoma organism as defined herein, in conjunction with additional compounds including but not limited to other co-stimulatory molecules, as defined above, is also contemplated, as long as these molecules are compatible with the transgenic organism and do not interfere with its desired immunogenic properties. The transgenic organism and the other molecule(s) can either be combined in a suitable solution, or can be administered simultaneously, sequentially or separately. In an alternative embodiment, a gene encoding CD40L and one or more genes encoding one or more of the above defined co-stimulatory molecules can be co-transfected or co-transformed to a desired organism, and preferably to a Trypanosoma organism.

Therapeutic applications

The present transgenic organisms and/or the (vaccine) compositions as defined herein may be used for therapeutic applications. The use of a transgenic organism or a composition as defined herein may result in the reduction or curing of a disease. The use of a transgenic organism or composition as defined herein may also result in the stimulation of immune responses in a subject against one or more diseases.

The present transgenic organisms and/or (vaccine) compositions may therefore be used for treating diseases caused by, and/or for stimulating immune responses against pathogenic and/or opportunistic organisms as defined herein, and preferably selected from the group comprising Trypanosoma, Plasmodium, Toxoplasma, Leishmania, Mycobacteria, Rickettsia, Salmonella, Shigella, Yersinia, Histoplasma, Candida, Cryptococcus, influenza viruses, rhinoviruses, rotaviruses, coronaviruses, arboviruses, retroviruses or hepatitis viruses. In fact, the present transgenic organisms and/or (vaccine) compositions as defined herein may be used for any kind of therapeutic application which involves the curing of a disease and/or the modulation and/or stimulation of -i.e. to elicit, produce, and/or enhance- an immune response.

The term "subject" as used herein refers to a human or an animal host. The subject will preferably be a human, but veterinary applications are also in the scope of the present invention targeting for example domestic livestock, laboratory or pet animals.

In one embodiment, the present invention relates to a method for treating a subject infected with one or more pathogenic and/or opportunistic organisms as defined herein, and preferably selected from the group comprising Trypanosoma, Plasmodium, Toxoplasma, Leishmania, Mycobacteria, Rickettsia, Salmonella, Shigella, Yersinia, Histoplasma, Candida, Cryptococcus, influenza viruses, rhinoviruses, rotaviruses, coronaviruses, arboviruses, retroviruses or hepatitis viruses, comprising administering a transgenic organism or a composition comprising such transgenic organism as defined herein to said subject. In a preferred embodiment, the invention relates to a method for treating Chagas' disease in a subject infected with a Trypanosma organism, preferably a T. cruzi strain, comprising administering a transgenic Trypanosoma organism or a composition comprising such transgenic organism as defined herein to said subject. The present invention also relates to a method for modulating and/or stimulating immune responses in a subject against one or more pathogenic and/or opportunistic organisms as defined herein, and preferably selected from the group comprising Trypanosoma, Plasmodium, Toxoplasma, Leishmania, Mycobacteria, Rickettsia, Salmonella, Shigella, Yersinia, Histoplasma, Candida, Cryptococcus, influenza viruses, rhinoviruses, rotaviruses, coronaviruses, arboviruses, retroviruses or hepatitis viruses comprising administering a transgenic organism or composition as defined herein to said subject. The present invention thus provides for a method for modulating and/or stimulating immune responses of a subject in a beneficial way, and to favor a better defense of the subject against pathogenic and/or opportunistic organisms causing diseases. In a preferred embodiment, the invention relates to a method for stimulating immune responses in a subject against Chagas' disease, comprising administering a transgenic Trypanosoma organism, preferably a T. cruzi strain, or a composition comprising such organism as defined herein to said subject. In another embodiment, the present invention also relates to a method for counteracting the immunodeficiency induced by one or more pathogenic and/or opportunistic organisms, and preferably selected from the group comprising Trypanosoma, Plasmodium, Toxoplasma, Leishmania, Mycobacteria, Rickettsia, Salmonella, Shigella, Yersinia, Histoplasma, Candida, Cryptococcus, influenza viruses, rhinoviruses, rotaviruses, coronaviruses, arboviruses, retroviruses or hepatitis viruses, during infection in a subject, comprising administering a transgenic organism or a composition as defined herein to said subject. In a preferred embodiment, the invention relates to a method for counteracting the immunodeficiency induced by a Trypanosoma organism during infection in a subject, comprising administering a transgenic Trypanosoma organism, preferably a T. cruzi strain, or a composition comprising such orgnaism as defined herein to said subject.

In another preferred embodiment, the invention relates to methods as disclosed herein comprising administering a transgenic organism or a composition as defined herein to a subject in need thereof and further comprising simultaneously, separately or sequentially administering one or more co-stimulatory molecules, as defined above to said subject.

For therapeutic use, the herein described transgenic organisms and/or compositions may be administered to a subject, preferably a human, for treatment in a manner appropriate to the indication. Thus, for example, transgenic organisms and/or compositions administered to augment immune responses can be given by bolus injection, continuous infusion, sustained release from implants, or other suitable technique. Typically, a therapeutic agent will be administered in the form of a composition comprising a transgenic organism in conjunction with physiologically acceptable carriers, excipients or diluents. Such carriers will be nontoxic to recipients at the dosages and concentrations employed. The herein described transgenic organisms and/or compositions can be formulated such that a single dose is sufficient. However embodiments where multiple applications over a period of time, e.g. with a view to the persistence of the infecting organisms, are also envisaged as falling within the scope of the invention. The provision of booster vaccinations is also envisaged as a potential embodiment with the vaccine formulations according to the invention.

Appropriate dosages can be determined in trials, first in an appropriate animal model, and subsequently in the species to be treated. The amount and frequency of administration will depend, of course, on such factors as the nature and severity of the indication being treated, the desired response, the condition of the individual being treated, and so forth.

Appropriate dosages may be comprised within the range of about 10 ng/kg/day to about 100μg/kg/day, alone or in combination with other co-stimulatory molecules. Preferably a dose of 100 ng/kg/day to about 1000 ng/kg/day for about 1-20 days can be expected to induce an appropriate biological effect. Alternatively, bolus injections of from about 1μg/kg/day to about 100μg/kg/day can be given at approximately 4-day intervals to exert effects via stimulation of immune responses.

In an alternative embodiment, appropriate dosages may be expressed by means of the number of transgenic organisms (e.g. number of trypomastigotes in the case of transgenic Trypanosoma) to be administered. Such dosages may be comprised within the range of about 1 X 102 to 1 X 108 transgenic organisms per subject, alone or in combination with other co-stimulatory molecules.

The following examples are intended to illustrate particular embodiments of the invention, and do not limit the scope of the invention.

Examples

Example 1 Transfection of Trypanosoma cruzi with host CD40L results in improved control of parasite infection

The following example illustrates several aspects of the invention, and in particular the construction of a transgenic Trypanosoma cruzi strain by transfection with a vector carrying a nucleic acid encoding CD40L. The example further illustrates the effects of administering such transgenic organism to mice. This example demonstrates the feasibility to generate transgenic Trypanosoma strains expressing a bioactive host co- stimulatory molecule (CD40L) that counteracts the immunodeficiency induced by the Trypanosoma parasite during the infections and enhances protective immunity against a challenge infection.

Material and methods

Epimastigote and trypomastigote forms of T. cruzi

T. cruzi epimastigotes (Y strain), the vector form, was a kind gift of Dr. D. Le Ray, Tropical Medicine Institute, Antwerpen, Belgium. They were grown in liver infusion- tryptose (LIT) medium at 28°C (9). T. cruzi trypomastigotes (Y strain) were maintained by weekly intraperitoneal inoculations into male BALB/c mice (6-8 weeks old) (Bantin & Kingman Universal, Hull, Humberside, United Kingdom) with 100 blood-form trypomastigotes in 0.2 mL of phosphate-buffered saline (PBS) on day 0. To perform challenge infection, the Tehuantepec strain of T. cruzi was maintained in mice as the Y strain and used as previously described (13, 33, 48, 49, 52).

Parasitemia of infected mice was monitored by counting the trypomastigotes in blood samples collected by tail incision every week. Survival rates were determined daily. To follow splenomegaly, a major feature of acute infection, spleens were harvested from mice (two or three mice per group and per week) and weighed (14). To obtain large quantities of parasites, trypomastigotes (2.5 x 105 parasites/rat) were inoculated to 7 Gy irradiated F344 Fischer rats (IfTa Credo, Brussels, Belgium). Trypomastigotes were obtained from the blood (containing 10 U heparin/mL) of infected rats by ion exchange chromatography on diethylaminoethyl cellulose (Whatman DE 52) equilibrated with PBS glucose at pH 7.4 (33). Trypomastigotes were centrifuged (15 min, 1800 g, 4° C) and resuspended in endotoxin-free PBS glucose. Then they were lysed by six thawed/frozen cycles to obtain T. cruzi lysate that served as antigen. Protein concentration of the lysate was adjusted to 20 μg/ mL.

The maintenance and care of mice and rats complied with the guidelines of the Free University of Brussels Ethic Committee for the human use of laboratory animals.

Construction of pTEX-CD40L vector and transfection of T. cruzi epimastigotes

The murine CD40L cDNA (3) was amplified by RT-PCR using mRNA derived from activated EL4 cells as previously described (13, 28). For cloning in pTEX vector (3), the mCD40L insert was purified as a Xbal-Sall fragment from pBluescript-CD40L (a kind gift from Dr. K. Thielemans, Laboratorium Fysiologie, Faculteit Geneeskunde, Vrije Universiteit Brussel, Brussels, Belgium) and ligated in Spel-Sall digested vector. The resulting pTEX- CD40L was used as shuttle vector for transfection of CD40L in T. cruzi. Transfection experiments were realized as follows: epimastigotes were grown to log phase in LIT medium and washed once in LIT medium, resuspended at a density of 108 cells/mL and incubated on ice for 10 min. Cell suspension (350 μL) was mixed with 50 μl (1 mg/mL) of plasmid DNA and electroporation was performed at 350 V and 1500 μF with two successive pulses. Samples were then cooled on ice for 5 min, transferred to a flask containing 5 mL of LIT medium containing 10% fetal bovine serum and incubated at 28°C for 24 h and geneticin (G418 sulfate, Alexis Corporation, San Diego, Ca.) was added to a final concentration of 50 μg/mL. The concentration of G418 was increased gradually up to 200 μg/mL during 3-4 weeks to allow identification of resistant epimastigotes.

Metacyclogenesis

The differentiation of epimastigotes to mammalian infective metacyclic trypomastigotes was carried out in vitro by using a chemically defined medium as previously described (5, 15). During the first step of the differentiation process, the epimastigotes adhered to the culture flask and one to four days later, metacyclic trypomastigotes were observed in the culture medium. The transfected trypomastigotes were recovered from the supernatant and maintained in culture using VN5 cells (VERO cells transfected with the Neo gene encoding for neomycine phosphotransferase that inhibits geneticin).

Detection of CD40L gene and CD40L protein in transfected T. cruzi

Total RNA was extracted from T. cruzi by using Rneasy kit (Qiagen Benelux, Venlo,

The Netherlands) following manufacturer's instructions. For cDNA synthesis, 5 μg of RNA was reverse transcribed using oligo dT primer. Amplification of CD40LcDNA was performed with the following primers: 5'ATAGAAACATACAGCCAACCTTC 3' (reverse)

(SEQ ID NO:1) and 5' AGTTTGAGTAAGCCAAAAGATGAG 3' (forward) (SEQ ID NO:2). For Western blot analysis, total parasite extracts were solubilized in Laemmeli buffer and 10 μL (corresponding to 2 x 106 parasites) were separated on SDS-PAGE and then transferred to nitrocellulose. Specific anti-mCD40L goat polyclonal antibody (Santa Cruz

Biotechnology, Inc., Heidelberg, Germany) was used at a final concentration of 1 μg/mL.

Horseradish peroxydase-labelled rabbit anti-goat antibody (Sigma Chemical & Co, St.

Louis, Mo) was used as secondary antibody and proteins were visualised by enhanced chemiluminescence (Pierce, Rockford, IL1USAU)U.

Intracellular multiplication of CD40L-transfected trypomastigotes of T. cruzi. The capacity of intracellular multiplication of CD40L-transfected trypomastigotes was evaluated by using mouse peritoneal macrophages (MPM). BALB/c mice were killed by cervical dislocation and MPM were harvested by washing the peritoneal cavities twice with ice-cold Hank's balanced salt solution without CaP2+p and MgP2+p. MPM were collected by centrifugation at 400 g for 10 min at 40C. Distilled sterile water (1 ml_) was added to the pellet for 30 s to lyse red cells. MPM were immediately suspended in Hank's balanced salt solution without CaP2+p and MgP2+p and centrifuged as above. The resulting pellet was suspended in culture medium (RPMI 1640 medium) supplemented with 25 mM HEPES, 2 mM glutamine, 10% fetal calf serum, penicillin (100 IU/ml) and streptomycin (100 μg/mL). All these reagents were from GIBCO, Grand Island, N. Y. MPM were then allowed to adhere (2 x 10 MPM/well) in 96-well microplates (Nunc, Roskilde, Denmark) for 2 h at 37°C in a 5% COB26 water-saturated atmosphere in culture medium. Non-adherent cells were removed by washing with culture medium at 370C before adding appropriate solutions diluted in culture medium. Trypomastigotes (Y, pTEX- or pTEX-CD40L-transfected trypomastigotes) were added to MPM in a 10-to-1 parasite-to-cell ratio. After 16 h, the cultures were washed to remove all free parasites. After 48 h, the cells were fixed with methanol and stained with Giemsa stain. At least 200 MPM were microscopically counted to determine the percentage of infected cells and the mean number of amastigotes per infected MPM (53).

Measurement of cell proliferation by HP3P-thymidine incorporation.

Mice were killed by cervical dislocation. Spleens were harvested and wheighed. Suspensions of SCs were obtained by spleen dilaceration. After centrifugation on Ficoll gradient (Lymphoprep Axis-Shield), SCs were resuspended in RPMI 1640 medium (GIBCO) and counted. A part of these SCs were cultured in microplates (2.5 x 105 SCs/well) and supernatants were harvested to measure IFN-κ production (see below). Proliferation of SCs from non-infected or infected mice was measured using the second part of SCs. They were cultured in 96-well plates (Nunc) at a final concentration of 2.5 x 105 SCs in 100 μl_ per well. Stimulation was performed by adding 100 μL of T. cruzi lysate (20 μg/mL) to SCs and microplates were incubated at 370C in an humidified atmosphere at 5% COB26 for 72 h. Then, cells were pulsed with 1 μL of a (methyl-P3PH)thymidine (1 mCi/mL; MP Biomedicals Irvine, Ca, USA). After 16 h, SCs were harvested with a cell harvester on nitrocellulose filters (Packard Instrument Company Inc. Warrenville, Downers Grove, Illinois, USA) and radioactivity was measured in an automated scintillation counter (Packard Microplate scintillation counter). Determination of IFN-K by ELISA

IFN-K measurement was performed in SC culture supematants (100 μL) by ELISA performed according to the manufacturer's instructions (CytoSetsP™P-Biosource International, Camarillo, Ca, USA). Experiments were repeated three times and performed in triplicates. Optical densities were measured at 450 nm by a microplate reader (Packard Spectra Count). Cytokine levels were calculated by reference to standard curves made in culture medium.

Levels of anti-T. cruzi antibodies Blood samples from non-infected and infected mice were harvested by cardiac puncture and, after clotting at room temperature and centrifugation, serum was frozen at - 2O0C until use. Levels of anti-7". cruzi antibodies were measured with an ELISA test using 96-well microplates (Maxisorp, Nunc) pre-coated overnight at 4°C with T. cruzi lysate (50 μg/mL). After washing, serum samples (dilution 1/1000) were added and microplates were incubated for 2 h at room temperature. After washing, biotin-conjugated anti-mouse immunoglobulin antibody (dilution 1/1000, Dako A/S, Glostrup, Denmark) was added and microplates were incubated at 37°C for 1 h followed by addition of streptavidin/horse radish peroxydase (dilution 1/1000; Dako) for an additional incubation at 37°C for 1 h. After addition of hydrogen peroxyde (10 μl, 30%, Merck) and 2,2-azino-bis(3-ethylbenz- thiazoline-6-sulfonic acid) (ABTS, 100 mg/mL, Sigma), optical density was measured at 405 nm with an ELISA reader (Packard Spectra Count).

Statistical analysis

The statistical comparisons of the data were carried out by the Mann-Whitney U- test. The survival analyses were carried out by means of Kaplan-Meier curves and Gehan's generalized Wilcoxon test. The statistical analyses were carried out using Statistica (Statsoft, Tulsa, OK).

Results Construction of pTEX-CD40L expression vector and generation of CD40L- transfected epimastigotes

The murine CD40L cDNA was amplified by RT-PCR from mRNA derived from the murine thymoma line EL4 (3, 28). The full length CD40L was then cloned as a Xbal-Sall fragment in Spel-Sall sites contained within the multiple cloning site of pTEX vector that was flanked by the untranslated 5' and 3' regions of the T. cruzi glyceraldehydeS-S3- phosphate dehydrogenase gene and the neomycin phosphotransferase gene (neo) as a selectable marker (24). This shuttle vector, which replicates in E. coli and T. cruzi, was used as a vehicle for expression of CD40L in T. cruzi.

Epimastigotes were electroporated with the pTEX-CD40L construct or the pTEX vector alone and transfected cells were selected for their resistance to geneticin G418. Wild-type parasites cultured in the presence of G418 drug (50 μg/mL) died 10 to 15 days later, whereas parasites transfected with either pTEX or pTEX-CD40L survived indicating that their resistance to G418 drug was conferred by the neo gene product. To generate stable transfectants, parasites were grown in the presence of gradually increased concentrations of G418 ranging from 0.1 to 1 mg/mL. Under this antibiotic pressure, no detectable differences in the growth rates of parasites were observed between epimastigotes transfected with pTEX alone or with pTEX-CD40L construct (data not shown).

CD40L transcript and protein were then analysed in stable transfected epimastigotes using RT-PCR and Western blotting. Total RNA was extracted from wild type epimastigotes (Y) or epimastigotes transfected with pTEX or with pTEX-CD40L, and reverse transcription was performed using oligo(dT) primer. The cDNA obtained was used as template for PCR amplification with different set of specific primers. As shown in Fig.

1 A, a specific fragment of the expected size (780 bp) corresponding to CD40L cDNA was detected only in CD40L-transfected epimastigotes. As a control, the neo cDNA (820 bp) was detected in epimastigotes transfected either with pTEX or pTEX-CD40L, whereas cDNA corresponding to chromosome encoded TcRGG gene (1030 bp) was detected in all tested epimastigotes (38).

For CD40L protein analysis, whole cell extract from epimastigotes grown to log phase was analysed by Western blotting using specific anti-CD40L antibodies (Fig. 1 B). Two bands of approximately 30 kDa and 14 kDa corresponding to the CD40L were detected in the protein extracts from pTEX-CD40L transfected cell line but not in those from wild type or pTEX-transfected cell lines. As a control, anti-TcRGG antibody revealed specific band in all tested protein extracts.

Metacyclogenesis and characterization of CD40L-transfected trypomastigotes

The transformation by metacyclogenesis of wild-type, pTEX- and pTEX-CD40L- transfected epimastigotes to mammalian infective metacyclic trypomastigotes was carried out in vitro using a defined medium (5, 15). Transfected metacyclic forms were maintained in culture using VN5 cells expressing neomycine phosphotransferase. This process allowed us to achieve intracellular multiplication of amastigotes under selective drug pressure and consequently to ensure the expression of CD40L in the derived trypomastigotes. To verify this feature, transfected trypomastigotes were analysed by RT- PCR and Western blotting using different probes (Figure 1 C and D). CD40L cDNA was specifically amplified by RT-PCR from pTEX-CD40L-transfected trypomastigotes (called YpTEX-CD40L) but not from wild type (called Y) or pTEX-transfected trypomastigotes (called YpTEX), whereas neo cDNA was detected in both transfected parasites (Fig 1 C). Western blot analysis performed on whole cell lysate revealed two specific bands corresponding to 30 kDa and 14 kDa in pTEX-CD40L transfected trypomastigotes only (Fig 1 D). Anti-TcRGG antibody used as a control revealed specific band in all tested protein extracts. To answer that CD40L is expressed even in the absence of drug selection, first, CD40L-transfected trypomastigotes were cultured with MPM without adding G418 drug. One week later, trypomastigotes were harvested in the culture supernatant and then tested by Western blotting. Data confirmed the expression of CD40L expression compared to YpTEX-transfected trypomastigotes maintained under the same conditions. Second, similar results were obtained in YpTEX-CD40L-transfected trypomastigotes harvested after 3 to 4 successive passages in mice.

CD40L-transfected T. cruzi trypomastigotes: infectious capacity in vitro, kinetics of parasitemia and cumulative mortality in vivo

First the infectious capacity of transfected parasites was tested in vitro using MPM. The three strains of trypomastigotes (Y, YpTEX, and YpTEX-CD40L) were added to MPM in a 10-to-1 parasite-to-cell ratio and incubated for 48 h at 37°C. The percentages of infected MPM were 87.0 ± 2.1 , 75.5 ± 3.8 and 78.3 ± 2.1 respectively for Y, YpTEX, and YpTEX-CD40L strains. When compared to Y strain, no significant difference was seen with YpTEX (p>0.05) or with YpTEX-CD40L (p>0.05). However, the mean number of amastigotes per infected MPM was significantly higher for Y (6.9 ± 0.4) compared to YpTEX (3.8 ± 0.1) and YpTEX-CD40L (3.2 ± 0.1) (p=0.0001). These data are means ± SEM of two independent experiments (n = 11). It is important to note that no significant difference was observed with parasites transfected either with pTEX or pTEX-CD40L vectors (p>0.05). Such data confirmed the infectious capacity of transfected parasites previously shown with VN5 cells.

Then parasitic parameters of the three strains were investigated in the course of experimental infection in mice. Three groups of 38 mice were inoculated respectively with Y, YpTEX or YpTEX-CD40L (1 x 103 trypomastigotes per mouse). Parasitemia was monitored every week. Mice that were infected with YpTEX-CD40L strain presented a very low parasitemia while those infected with the Y strain had the usual pattern of parasitemia. Interestingly, an intermediate level of parasitemia was observed in the group of YpTEX- infected mice (Fig. 2A). Surviving mice were counted every day. In each group of infected mice, 18 of them were sacrificed to harvest the spleens. The sacrificed mice were excluded from the survival rate. These experiments showed that all the 20 mice infected with YpTEX- CD40L strain survived. In contrast 11 and 7 mice died in the groups infected with the Y or the YpTEX strains, respectively (Fig. 2 B). The multiple-group analysis of the survival curves confirmed a significant difference across them with YpTEX-CD40L vs Y : p = 0.0002; YpTEX-CD40L vs YpTEX : p = 0.004, and YpTEX vs Y: p = 0.62 (non significant).

Kinetics of mouse weight may be considered as representative of healthy state. In two independent experiments, mice (15 mice per group) were infected with Y, or YpTEX or YpTEX-CD40L strains. Parasitemia and mortality were similar to that obtained in previous experiments (data not shown). In addition, mice were weighed every week. As expected, a sharp decrease of weight was observed in Y-infected mice. A slower decrease of weight was observed inT TYpTEX-infected mice. In the group of YpTEX-CD40L-infected mice, the weight increased until day 21 pi as in the control group of non-infected mice in which the weight increased regularly. Then, it decreased slightly to reach 26,0 ± 0.7 g while it was 19,9 ± 1 ,2 g and 31 ,2 ± 0,3 g respectively for YpTEX-infected mice and non-infected mice at day 35 pi. In summary, the weight kinetics of the infected mice corroborated the infection pattern.

Taken together, these data indicate that mice infected with YpTEX-CD40L strain were able to control the parasitemia and to survive the acute phase of the T. cruzi infection with a minimal lost of weight.

The spleens harvested from the sacrificed mice were weighed and a peak of weight was reached at day 21 pi with no statistically significant difference between the three groups of mice : 654,8 ± 102,8 mg, 680,4 ± 106,4 mg, and 627,4 ± 101 ,7 mg for spleens from mice infected respectively with Y, YpTEX or YpTEX-CD40L. These data are mean ± SD from two independent experiments (n = 5). They corresponded to the usual splenomegaly observed in the course of infection (14).

Proliferation of SCs activated with T. cruzi lysate. To further investigate the immunological parameters, spleens were harvested and

SCs were isolated and incubated with T. cruzi lysates (Fig. 3 A). At day 14 pi, a high proliferation was observed with SCs from mice infected with the three strains. Then, the indexes decreased sharply at day 21 pi. These data reflect the well-known immunosuppressive effect of the infection upon SC proliferation (50). The proliferation was close to that of the control (day 0) for SCs from Y-infected mice at days 28 and 35 pi. For YpTEX-infected mice, the SC proliferation was stable at days 21 , 28, 35 and 49 pi and remained as low as at day 7 pi. In contrast, this proliferation was partially inhibited in the case of the YpTEX-CD40L-infected mice, particularly at day 28, 35 and 49 pi. Taken together, these data demonstreate that SC proliferation, that is a marker of immunosuppression usually observed during the acute phase of the infection, was less inhibited in the course of the YpTEX-CD40L infection.

IFN-K production by SCs

IFN-K was measured in the supernatant of SCs stimulated with T. cruzi lysate. As shown in Fig. 3 B, the production of IFN-K increased first at day 14 pi for SCs from mice infected with the three strains. Then it decreased at day 21 pi for SCs from Y and YpTEX- infected mice and it remained at a very low level until day 49 pi. In contrast, for SCs from YpTEX-CD40L-infected mice, the production of IFN-κ was enhanced particularly at days 28, 35 and 49 pi. This significant IFN-K production fits well with the elevated cell proliferation observed at the same time with the YpTEX-CD40L strain (Fig. 3 A).

Kinetics of anti-T. cruzi antibody levels

Samples of serum were harvested by cardiac puncture from Y, YpTEX or YpTEX- CD40L infected mice and tested at 1/1000 dilution in ELISA against T. cruzi antigen extract. The optical densities corresponding to the specific anti-T. cruzi antibody levels were reported in Fig. 4. The anti-T. cruzi antibody levels increased progressively in the course of infection. However, despite the very low parasitemia previously observed (Fig. 2 A), the level of anti-T. cruzi antibodies was similar in the serum of YpTEX- and YpTEX- CD40L-infected mice.

Protective capacity of YpTEX-CD40L-transfected trypomastigotes

In support of a vaccine approach based on YpTEX-CD40L-transfected parasites, mice were first infected with YpTEX-CD40L-transfected T. cruzi (day 0). When parasitemia was undetectable in circulating blood (starting on day 39 pi), they were challenged at day 55 pi (day 0 of the challenge infection) with a different strain of T. cruzi trypomastigotes (Tehuantepec strain, 100 trypomastigotes, ip). As shown in Fig. 5 A, no significant parasitemia was seen in the four weeks following the challenge infection (no parasites were detected in three mice and a very low and transient parasitemia, not exceeding 0,051 x 106 trypomastigotes/mL, was seen in three other mice). This indicates that mice were effectively immunized. Control mice infected at the same time with the same inoculum presented the usual high level of parasitemia, confirming that this inoculum was effectively infectious. Only one mouse died in the group of YpTEX-CD40L-infected mice while all the control mice died before day 26 pi (Fig. 5 B).

Discussion In the present example a clone of T. cruzi (YpTEX-CD40L) was generated that synthesizes the murine CD40L molecules by using the pTEX shuttle vector that is widely used to express heterologous DNA sequences in trypanosome genetic environment (24). Because CD40L participates in the triggering of the immune response via its interaction with its cognate CD40 receptor expressed on various immunocompetent cells, the immunomodulation induced by this CD40L-transfected parasite in the course of infection in mice was also investigated.

To the applicants' knowledge, this is the first report about a transfected protozoan parasite producing biologically active host-costimulatory molecule (CD40L). The production of CD40L by transfected parasites was assessed by RT-PCR and Western blotting both in epimastigotes and in the derived trypomastigotes obtained by in vitro metacyclogenesis. Moreover, the stability of CD40L production in transfected parasites was confirmed after several passages in mice indicating that plasmid DNA was stably established even in the absence of drug selection. The stability of such a transfection is in line with other reports using this shuttle vector pTEX to transfect different molecules in T. cruzi (8, 35, 37). Western blotting analysis showed that, beside the 30 kDa fragment corresponding to the expected molecular size of CD40L, the lower band of 14 kDa was also present in both epimastigotes and trypomastigotes. This could be due to a degradation product or to an internal ATG start (Met 147) resulting in carboxy terminal part of CD40L. This is suggested by the presence of a Shine-Dalgarno-like sequence close to Met-147, 5'-AAA GGA TAT TAT ACC ATG- 3' (SEQ ID NO: 3). A fragment of a similar molecular size was reported in another study concerning recombinant soluble CD40L produced in E. coii (32). This soluble extracellular carboxy-terminal region of CD40L encompassing TNF homology sequences and containing receptor-binding domains can be expressed as a soluble molecule with biological activity (17, 36). The present data showed that mice inoculated with YpTEX-CD40L strain of T. cruzi exhibited a reduced parasitemia and no mortality, hence reflecting the biological activity of CD40L produced by transfected parasites. Such a feature indicates that the molecule was properly processed and presented to trigger immunocompetent cells. Attempts have been made to localize the CD40L molecule in different parasite extracts by Western blotting and the molecule was effectively detected as membrane-bound form (data not shown). This indicates that the parasite can effectively recognize higher eukaryotic peptide signal that allow export of host molecule to the membrane. However, no significant signal has been observed at the surface of the transfected parasites using the same anti-CD40L antibodies in immunofluorescence and flow cytometry analysis (data not shown). It is possible that the transfected CD40L molecule undergoes rapid turnover at the cell surface that leads to the release of the molecule. Other studies have shown that host cytokines such as IFN-K can be properly processed and secreted into media across the parasite membrane in Leishmania major (45) and in Plasmodium knowlesi (40).

Although CD40L exits in nature predominantly as a membrane-anchored molecule, the soluble form of CD40L may be biologically active (3, 17, 32, 36). Therefore, the possible release of the CD40L molecules from the parasites in the course of infection cannot be ruled out. Alternatively, the possible lysis of a part of the parasite population could release CD40L molecules. In these two cases, parasite-derived CD40L can activate immunocompetent cells and promote an effective and protective immune response against T. cruzi infection. The infective capacity of the YpTEX and YpTEX-CD40L trypomastigotes was tested by incubating them with MPM that are usual host cells for T. cruzi (51 ). Like the Y strain, these two strains were able to infect more than 70% of MPM. The mean number of YpTEX amastigotes per infected cells was similar to that obtained with YpTEX-CD40L parasites showing that CD40L do not interfere with the multiplication rate of the transfected parasite. However, the mean numbers of amastigotes of the transfected parasites remained lower when compared to the wild type Y. This indicates that the presence of the plasmid DNA in the parasite might slow down the multiplication of the amastigotes.

Despite the similar size of the inoculum (1 x 103 trypomastigotes), reduced parasitemia and no mortality were observed in YpTEX-CD40L-infected mice. This is in line with previous results showing that CD40L-transfected fibroblasts have a protective effect when injected together with T. cruzi trypomastigotes (13). These results show that the synthesis of CD40L molecules effectively occurred in the transfected YpTEX-CD40L strain in vivo. Immunocompetent cells were over-stimulated by the parasite itself expressing CD40L as early as the inoculation has occurred and then by its tremendous expansion in blood and various organs and tissues (8, 56) so that many of the escape mechanisms induced by the parasites were by-passed.

The YpTEX strain induced a parasitemia lower than that of the Y strain. This was essentially due to the genetic transfection that attenuated its virulence as it was already observed for the in vitro infection of MPM. This indicates that the presence of foreign plasmid DNA in the parasite can interfere with the multiplication of the amastigotes also in vivo. Because the YpTEX-CD40L strain induced a parasitemia lower than that of the YpTEX strain, the expression of CD40L is involved in the reduction of the infectivity of the YpTEX-CD40L strain.

As it is the case for many other pathogens, the evolutionary adaptation of T. cruzi allows the parasite to evade the immune system and to induce dramatic immunodeficiency by using various molecular strategies (1 , 12, 29, 44, 48, 49, 52). CD40L-transfected parasites exhibited less pronounced suppression of SCs proliferation when compared to the wild type Y and YpTEX strains. Indeed the sharply reduced SC proliferation observed with Y, YpTEX and YpTEX-CD40L strains at day 21 pi was very similar to the one described in a previous work (50). However, the proliferation of SCs from YpTEX-CD40L- infected mice was higher than that observed with Y and YpTEX strains at days 28, 35 and 49 pi. The expression of CD40L molecules by the parasite itself accounts for sustained T cell activation and therefore counteracts the immunodeficiency induced by parasite-derived molecules such as glycoinositolphospholipids (7, 19, 25, 34, 48, 49). In relation with the higher SC proliferation, the production of IFN-)/ a cardinal cytokine in anti-infective immune response, was clearly enhanced in supernatants of SCs from YpTEX-CD40L-infected mice from day 21 to day 49 pi. IFN-K production was shown to be related to CD40/CD40L ligation (11). Prasites expressing CD40L are able to stimulate a more efficient type 1 immune response.

Various immunocompetent cells expressing CD40 are probably activated by the YpTEX-CD40L trypomastigotes. Although the expression of CD40 molecules seems to be reduced in infected DCs and macrophages (7, 41 , 48), their activation could be over- stimulated by YpTEX-CD40L-transfected parasites and therefore their immunological function can be partially restaured.

CD8P+P lymphocytes seems to be of prime importance in the control of infection by destroying MHC class I positive infected cells (16, 35) and by producing a large amount of IFN-K (31). In addition, CD8P+P T cell memory can be generated with the "help" of CD4 via CD40 molecule (6). Therefore, the CD40/CD40L pathway plays a central role in immune response mediated by both CD4P+P and CD8P+P T cells. Further investigations will unravel immunocompetent cells involved in the reduced infection induced by YpTEX-CD40L strain. Preliminary experiments indicated that the percentage of CD8P+P SCs increased in the course of infection particularly in mice inoculated with YpTEX-CD40L strain. Moreover, the flow cytometry analysis showed that the high production of IFN-^ was mainly due to CD8P+P cells (data not shown). Ongoing investigations will clarify the role of these cells in the control of CD40L-transfected parasite infection. In the course of T. cruzi murine infection, protective antibodies specific for T cruzi are produced (26, 27). This production is correlated to the level of parasitemia reached during the acute phase of infection (30). These results show that, despite a very low parasitemia, a significative level of T. cruz/'-specific antibodies was induced by the YpTEX-CD40L strain. CD40L is indeed involved in the stimulation of the humoral response through T-cell dependent B-cell activation, cytokine-mediated B-cell activation and immunoglobulin isotype switching (2, 4). Future investigations will concern the analysis of such humoral response generated against YpTEX-CD40L-transfected parasites and the potential involvement of these antibodies in the protective immunity.

Further investigations related to functional activities of the delivered host co- stimulatory CD40L have shown that surviving mice infected with Yptex-CD40L-transfected parasites resist to a new challenge infection. This indicates that the YpTEX-CD40L- transfected parasites strongly stimulate a protective immune response. Such data open new perspectives for a novel vaccine approach based on CD40L-transfected pathogen. Future works will focus on the characterization of the immunological mechanisms involved in such protection.

Conclusion

The CD40/CD40L pathway plays a critical role of in the induction and effector phases of immune responses. The Applicant has shown previously that the injection of CD40L- transfected 3T3 fibroblasts at the time of T. cruzi inoculation dramatically reduced both parasitemia and mortality rate of T. cruzi-infected mice (13). Now the Applicant demonstrates the feasability to transfect T. cruzi with the gene encoding CD40L and analysed the consequences on the infection in mice inoculated with the transfected parasite by monitoring parasitic and immunologic parameters.

More in particular, The applicant has generated T. cruzi expressing host co- stimulatory molecule and demonstrated that CD40L-transfected parasite can counteract the immunodeficiency induced by the parasite itself. The Applicant has transfected T. cruzi with the murine CD40L gene and studied the consequences of such a transfection on the course of infection. For this, epimastigotes (Y strain) were electroporated with the pTEX vector alone or the pTEX-CD40L construct and transfected cells were selected for their resistance to geneticin G418. Then, Y, pTEX- and pTEX-CD40L-transfected epimastigotes were transformed by metacyclogenesis into mammalian infective forms called Y, YpTEX and YpTEX-CD40L trypomastigotes. The transfection of the CD40L gene and the expression of the CD40L protein were assessed by RT-PCR and Western blot analysis. The three strains of parasites were infective in vitro for mouse peritoneal macrophages. When inoculated to mice, a very low parasitemia and no mortality were seen with the YpTEX-CD40L strain compared to Y and YpTEX strains. Furthermore, the proliferative capacity and the secretion of IFN-K were both preserved in spleen cells (SCs) from YpTEX- CD40L-infected mice but not with SCs from Y- and YpTEX-infected mice. These results indicated the involvement of CD40L produced by transfected T. cruzi in the modulation of anti-parasite immune response. Moreover, mice surviving to YpTEX-CD40L infection resisted to a challenge infection with wild type strain. Taken together, these data demonstrate the feasibility to generate a T. cruzi strain expressing a bioactive host costimulatory molecule that counteracts the immunodeficiency induced by the parasite during the infection and enhances protective immunity against a challenge infection.

These data will lead to greater insight into the immunomodulation regarding the control of parasite infection.

Example 2 Role of CD40L expressed by recombinant Mycobacterium tuberculosis BCG in enhancing the response of CD8+ T cells producing IFN-γ

Mycobacterium tuberculosis is characterized by its ability to induce a Th1- mediated immune response (57). Effective immunity against tuberculosis is likely to depend on priming and maintenance of antigen specific CD8+ T cells producing IFN-K (58-60). Of interest, CD4+ T cells contribute to such sustained T cell immunity through binding of the CD40L present on their surface to the CD40 on antigen presenting cells (61 ). The importance of the CD40-CD40L-triggered signalling is supported by the fact that recombinant CD40L protein can enhance T cell effector function in response to M. tuberculosis (62).

The present example aims to confirm the original finding that CD40L produced by recombinant micro-organisms (protozoan parasite model) during experimental infection is functionally active (63). In this example a bacterial model, Mycobacterium tuberculosis infection in mice is used to study whether in vivo recombinant CD40L produced during infection enhances effective immune response against M. tuberculosis.

Construction of recombinant Mycobacterium tuberculosis expressing the CD40L

It has been reported that the extracellular carboxy-terminal region of CD40L containing TNF homology sequences and receptor-binding domains can be expressed as a soluble molecule with biological activity (17). With the aim to design a CD40L shuttle vector that is suitable to transform a BCG strain, we adopted a strategy consisting on substitution of the 44 amino terminal of the CD40L encompassing the intracellular and the trans-membrane domains with the 42 residues corresponding to mycobacterial secretion signal sequence from the BCG alpha-antigen. The modified CD40L cDNA was inserted in the expression vector pEN 103 under the control of the BCG hsp60 promotor (64), This construction allows the expression of the biologically active soluble form of CD40L.

A second construction based on the cloning of the full CD40L cDNA under the control of the hspδO promotor of the pEN 103 vector is investigated as well. This permits to unsure whether CD40L can be expressed at the surface of transformed M. tuberculosis.

The resulting shuttle vectors are used to transform BCG, and the transformants are selected by their resistance to HgCI2 (65). Resistant BCG colonies are analysed for their plasmid content by using electroduction (66).

Production and secretion of CD40L by recombinant BCG

The recombinant BCG (rBCG) is analysed by immunoblotting with an anti-CD40L specific antibody (63). Immunoreactive protein with expected size is detected in the lysate of rBCG and not in untransformed BCG. Immunofluorescence and FACS assay are carried out to localize the CD40L expressed by the rBCG (63).

Functional analysis of the recombinant CD40L produced by BCG during experimental infection

This experiment is realised in mice (BALB/c and/or C3H/HeJ) inoculated intraperitoneally with rBCG or BCG (5x106/mouse). First the kinetics of bacterial growth are compared by counting viable bacteria in organ homogenates (ex, spleen). This indicates whether rBCG and BCG display similar persistence within mouse organs (67).

The next step is focused on the analysis of cellular immune response. It is known that mice infected with BCG develop a strong cell-mediated response several months after immunisation. The present investigation is therefore extended up to 120 days post- infection (pi) to see whether rBCG producing CD40L enhances an antigen-specific Th1- type immune response. Splenocytes and lymph node cells are isolated from infected mice at 20, 50, 80 and 120 days pi, stimulated with purified protein derivative (PPD) and tested for their in vitro proliferation and IFN-K production.

Because CD8+ T cells are thought to contribute to the clearance of M. tuberculosis through production of IFN-κ (62), the number of CD8+ T cells producing this cytokine is evaluated during rBCG versus BCG infection after their stimulation with M. tuberculosis derivative antigens. The lysis of infected cells is mainly attributed to CD8+ T cells. To test whether CD40L increases the cytotoxicity of these cells, specific CD8+ T cells are purified from rBCG and BCG infected mice and their capacity to lyse M. tuberculosis-infected monocytes is compared (62). Furthermore, RT-PCR experiments on RNA isolated from spleen cells are performed at different days pi to quantify the major cytokine transcripts: IL-4, IL-5, IL-6, IL- 10, IL-12, IL-18 and TNF-σ. This study allows to evaluate the potential role of rBCG producing CD40L in promoting Th1-type cytokines.

References

1. Abrahamsohn, I. A., and R. L. Coffman. 1995. Cytokine and nitric oxide regulation of the immunosuppression in Trypanosoma cruzi infection. J. Immunol. 155:3955-3963.

2. Armitage, R. J., and M. R. Alderson. 1995. B-cell stimulation. Curr. Opin. Immunol. 7:243-247.

3. Armitage, R. J., W. C. Fanslow, L. Strockbine, T. A. Sato, K. N. Clifford, B. M. Macduff, D. M. Anderson, S. D. Gimpel, T. Davis-Smith, and C. R. Maliszewski. 1992. Molecular and biological characterization of a murine ligand for CD40. Nature 357:80- 82. 4. Bishop, G. A., and B. S. Hostager. 2001. Signaling by CD40 and its mimics in B cell activation. Immunol. Res. 24:97-109.

5. Bonaldo, M. C, T. Souto-Padron, W. de Souza, and S. Goldenberg. 1988. Cell- substrate adhesion during Trypanosoma cruzi differentiation. J. Cell Biol. 106:1349- 1358. 6. Bourgeois, C, B. Rocha, and C. Tanchot. 2002. A role for CD40 expression on CD8+ T cells in the generation of CD8+ T cell memory. Science 297:2060-2063.

7. Brodskyn, C, J. Patricio, R. Oliveira, L. Lobo, A. Arnholdt, L. Mendonca-Previato, A. Barral, and M. Barral-Netto. 2002. Glycoinositolphospholipids from Trypanosoma cruzi interfere with macrophages and dendritic cell responses. Infect. Immun. 70:3736- 3743.

8. Buckner, F. S., A. J. Wilson, and W. C. Van Voorhis. 1999. Detection of live Trypanosoma cruzi in tissues of infected mice by using histochemical stain for beta- galactosidase. Infect. Immun. 67:403-409.

9. Camargo, E. P. 1964. Growth and differentiation in Trypanosoma cruzi . I. Origin of metacyclic trypanosomes in liquid media. Rev. Inst. Med. Trap. Sao Paulo 12:93-100.

10. CeIIa, M., F. Facchetti, A. Lanzavecchia, and M. Colonna. 2000. Plasmacytoid dendritic cells activated by influenza virus and CD40L drive a potent TH1 polarization. Nat. Immunol. 1 :305-310.

11. CeIIa, M., D. Scheidegger, K. Palmer-Lehmann, P. Lane, A. Lanzavecchia, and G. Alber. 1996. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J. Exp. Med. 184:747-752.

12. Cerrone, M. C, D. M. Ritter, and R. E. Kuhn. 1992. Effect of antigen-specific T helper cells or interleukin-2 on suppressive ability of macrophage subsets detected in spleens of Trypanosoma craz/'-infected mice as determined by limiting dilution-partition analysis. Infect. Immun. 60:1489-1498.

13. Chaussabel, D., F. Jacobs, J. de Jonge, M. de Veerman, Y. Carlier, K. Thielemans, M. Goldman, and B. Vray. 1999. CD40 ligation prevents Trypanosoma cruzi infection through interleukin-12 upregulation. Infect. Immun. 67:1929-1934. 14. Chaussabel, D., B. Pajak, V. Vercruysse, C. Bisseye, V. Garze, M. Habib, M.

Goldman, M. Moser, and B. Vray. 2003. Alteration of migration and maturation of dendritic cells and T-cell depletion in the course of experimental Trypanosoma cruzi infection. Lab. Invest. 83:1373-1382.

15. Contreras, V. T., J. M. Salles, N. Thomas, C. M. Morel, and S. Goldenberg. 1985. In vitro differentiation of Trypanosoma cruzi under chemically defined conditions. MoI.

Biochem. Parasitol. 16:315-327. 16. DosReis G.A. Cell-mediated immunity in experimental Trypanosoma cruzi infection. Parasitol. Today 13, 335-342. 1997.

17. Fanslow, W. C1 S. Srinivasan, R. Paxton, M. G. Gibson, M. K. Spriggs, and R. J. Armitage. 1994. Structural characteristics of CD40 ligand that determine biological function. Semin. Immunol. 6:267-278.

18. Ferlin, W. G., W. T. von der, F. Cottrez, D. A. Ferrick, R. L. Coffman, and M. C. Howard. 1998. The induction of a protective response in Leishmania mayor-infected BALB/c mice with anti-CD40 mAb. Eur. J. Immunol. 28:525-531.

19. Gomes, N. A., J. O. Previato, B. Zingales, L. Mendonca-Previato, and G. A. DosReis. 1996. Down-regulation of T lymphocyte activation in vitro and in vivo induced by glycoinositolphospholipids from Trypanosoma cruzi. Assignment of the T cell- suppressive determinant to the ceramide domain. J. Immunol. 156:628-635.

20. Grewal, I. S., P. Borrow, E. G. Pamer, M. B. Oldstone, and R. A. Flavell. 1997. The CD40-CD154 system in anti-infective host defense. Curr. Opin. Immunol. 9:491-497. 21. Grewal, I. S., and R. A. Flavell. 1998. CD40 and CD154 in cell-mediated immunity. Annu. Rev. Immunol. 16:111-135.

22. Gurunathan, S., K. R. Irvine, C. Y. Wu, J. I. Cohen, E. Thomas, C. Prussin, N. P. Restifo, and R. A. Seder. 1998. CD40 ligand/trimer DNA enhances both humoral and cellular immune responses and induces protective immunity to infectious and tumor challenge. J. Immunol. 161:4563-4571.

23. Heinzel, F. P., R. M. Rerko, and A. M. Hujer. 1998. Underproduction of interleukin-12 in susceptible mice during progressive leishmaniasis is due to decreased CD40 activity. Cell Immunol. 184:129-142.

24. Kelly, J. M., H. M. Ward, M. A. Miles, and G. Kendall. 1992. A shuttle vector which facilitates the expression of transfected genes in Trypanosoma cruzi and Leishmania.

Nucleic Acids Res. 20:3963-3969.

25. Kierszenbaum, F., and M. B. Sztein. 2001. Down-regulation of human B lymphocyte activities by a Trypanosoma cruzi membrane glycoprotein. Int. J. Parasitol. 2001. 31 :265-271. 26. Krautz, G. M., J. C. Kissinger, and A. U. Krettli. 2000. The targets of the lytic antibody response against Trypanosoma cruzi . Parasitol. Today 16:31-34.

27. Kumar, S. and R. L. Tarleton. 1998. The relative contribution of antibody production and CD8+ T cell function to immune control of Trypanosoma cruzi. Parasite Immunol. 20:207-216. 28. Lane, P., T. Brocker, S. Hubele, E. Padovan, A. Lanzavecchia, and F. McConnell. 1993. Soluble CD40 ligand can replace the normal T cell-derived CD40 ligand signal to B cells in T cell-dependent activation. J. Exp. Med. 177:1209-1213.

29. Lopes, M. F., and G. A. DosReis. 1996. Trypanosoma cmz/'-induced immunosuppression: selective triggering of CD4+ T-cell death by the T-cell receptor- CD3 pathway and not by the CD69 or Ly-6 activation pathway. Infect. Immun.

64:1559-1564.

30. Marinho, C. R., M. R. D'lmperio Lima, M. G. Grisotto, and J. M. Alvarez. 1999. Influence of acute-phase parasite load on pathology, parasitism, and activation of the immune system at the late chronic phase of Chagas1 disease. Infect. Immun. 67: 308- 318.

31. Martin, D. and R. Tarleton. 2004. Generation, specificity, and function of CD8 T cells in Trypanosoma cruzi infection. Immunol. Rev. 201:304-317.

32. Mazzei, G. J., M. D. Edgerton, C. Losberger, S. Lecoanet-Henchoz, P. Graber, A. Durandy, J. F. Gauchat, A. Bernard, B. Allet, and J. Y. Bonnefoy. 1995. Recombinant soluble trimeric CD40 ligand is biologically active. J. Biol. Chem. 270:7025-7028.

33. Metz, G., Y. Carlier, and B. Vray. 1993. Trypanosoma cruzi upregulates nitric oxide release by lFN-gamma-preactivated macrophages, limiting cell infection independently of the respiratory burst. Parasite Immunol. 15:693-699. 34. Millar, A. E., M. Wleklinski-Lee, and S. J. Kahn. 1999. The surface protein superfamily of Trypanosoma cruzi stimulates a polarized Th1 response that becomes anergic. J. Immunol. 162:6092-6099.

35. Miyahira, Y., S. Kobayashi, T. Takeuchi, T. Kamiyama, T. Nara, J. Nakajima-Shimada, and T. Aoki. 1999. Induction of CD8+ T cell-mediated protective immunity against

Trypanosoma cruzi. Int. Immunol. 11 :133-141.

36. Morris, A. E., R. L. Remmele, Jr., R. Klinke, B. M. Macduff, W. C. Fanslow, and R. J. Armitage. 1999. Incorporation of an isoleucine zipper motif enhances the biological activity of soluble CD40L (CD154). J. Biol. Chem. 274:418-423. 37. Norris, K. A. 1998. Stable transfection of Trypanosoma cruzi epimastigotes with the trypomastigote-specific complement regulatory protein cDNA confers complement resistance. Infect. Immun. 66:2460-2465.

38. Ouaissi, A., B. Vergnes, M. Borges, and E. Guilvard. 2000. Identification and molecular characterization of two novel Trypanosoma cruzi genes encoding polypeptides sharing sequence motifs found in proteins involved in RNA editing reactions. Gene 253:271-280.

39. Oz, H. S., W. T. Hughes, E. K. Thomas, and C. J. McClain. 2002. Effects of immunomodulators on acute Trypanosoma cruzi infection in mice. Med. Sci. Monit. 8:BR208-BR211. 40. Ozwara, H., A. van der WeI C. H. Kocken, and A. W. Thomas. 2003. Heterologous promoter activity in stable and transient Plasmodium knowlesi transgenes. MoI. Biochem. Parasitol. 2003. 130:61-64.

41. Planelles, L, M. C. Thomas, C. Maranon, M. Morell, and M. C. Lopez. 2003. Differential CD86 and CD40 co-stimulatory molecules and cytokine expression pattern induced by Trypanosoma cruzi in APCs from resistant or susceptible mice. Clin. Exp.

Immunol. 131:41-47.

42. Prata, A. 2001. Clinical and epidemiological aspects of Chagas disease. Lancet Infect. Dis. 1 :92-100.

43. Soong, L, J. C. Xu, I. S. Grewal, P. Kima, J. Sun, B. J. Longley, N. H. Ruddle, D. McMahon-Pratt, and R. A. Flavell. 1996. Disruption of CD40-CD40 ligand interactions results in an enhanced susceptibility to Leishmania amazonensis infection. Immunity. 4:263-273.

44. Tarleton, R. L. 1988. Trypanosoma craz/-induced suppression of IL-2 production. II. Evidence for a role for suppressor cells. J. Immunol. 140:2769-2773. 45. Tobin, J. F., S. L Reiner, F. Hatam, S. Zheng, C. L. Leptak, D. F. Wirth, and R. M. Locksley. 1993. Transfected Leishmania expressing biologically active IFN-gamma. J. Immunol. 150:5059-5069.

46. Tyler, K. M. and D. M. Engman. 2001. The life cycle of Trypanosoma cruzi revisited. Int. J. Parasitol. 31 :472-480. 47. van Kooten, C. and J. Banchereau. 2000. CD40-CD40 ligand. J. Leukoc. Biol. 67:2-17.

48. Van Overtvelt, L., N. Vanderheyde, V. Verhasselt, J. Ismaili, L. De Vos, M. Goldman,

F. Willems, and B. Vray. 1999. Trypanosoma cruzi infects human dendritic cells and prevents their maturation: inhibition of cytokines, HLA-DR, and costimulatory molecules. Infect. Immun. 67:4033-4040. 49. Van Overtvelt, L., M. Andrieu, V. Verhasselt, F. Connan, J. Choppin, V. Vercruysse, M. Goldman, A. Hosmalin, and B. Vray. 2002. Trypanosoma cruzi down-regulates lipopolysaccharide-induced MHC class I on human dendritic cells and impairs antigen presentation to specific CD8(+) T lymphocytes. Int. Immunol. 14:1135-1144.

50. Vandekerckhove, F., A. Darji, M. T. Rivera, Y. Carlier, B. Vray, A. Billiau, and P. De Baetselier. 1994. Modulation of T-cell responsiveness during Trypanosoma cruzi infection: analysis in different lymphoid compartments. Parasite Immunol. 16:77-85.

51. Vray B. 2002. Macrophages in parasitic infection, p. 253-304. In B. Burke and C. E. Lewis (ed.), The Macrophage. Oxford University Press. 52. Vray, B., I. Camby, V. Vercruysse, T. Mijatovic, N. V. Bovin, P. Ricciardi-Castagnoli, H.

Kaltner, I. Salmon, H. J. Gabius, and R. Kiss. 2004. Upregulation of galectin-3 and its ligands by Trypanosoma cruzi infection with modulation of adhesion and migration of murine dendritic cells. Glycobiology 14:647-657. 53. Vray, B., P. De Baetselier, A. Ouaissi, and Y. Carlier. 1991. Trypanosoma cruzi but not

Trypanosoma brucei fails to induce a chemiluminescent signal in a macrophage hybridoma cell line. Infect. Immun. 59:3303-3308. 54. Wykes, M. 2003. Why do B cells produce CD40 ligand? Immunol. Cell Biol. 81 :328-

331. 55. Xiang, R., F. J. Primus, J. M. Ruehlmann, A. G. Niethammer, S. Silletti, H. N. Lode, C.

S. Dolman, S. D. Gillies, and R. A. Reisfeld. 2001. A dual-function DNA vaccine encoding carcinoembryonic antigen and CD40 ligand trimer induces T cell-mediated protective immunity against colon cancer in carcinoembryonic antigen-transgenic mice. J. Immunol. 167:4560-4565. 56. Younes-Chennoufi, A., M. Hontebeyrie-Joskowicz, V. Tricottet, H. Eisen, M. Reynes, and G. Said. 1988. Persistence of Trypanosoma cruzi antigens in the inflammatory lesions of chronically infected mice. Trans. R. Soc. Trap. Med. Hyg. 82:77-83. 57. Fine PE 1989. The BCG story: lessons from the past and implications fror the future.

Rev; Infect. Dis. 11 (Suppl. 2): 5353 58. Sousa et al. 2000. Relative contributions of distinct MHC class l-dependant cell populations in protection to tuberculosis infection in mice. Proc. Natl. acad. ScL USA

07:4204 59. Lavlani et al. 1998. Human cytolytic and IFN-κ-secreting CD8+ T lymphocytes specific to Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 95:250 60. Leewinsohn DM et al. 1998. Characterization of human CD8+ T cells reactive with

Mycobacterium tuherculosis-'miected antigen-presenting cells. J. Exp. Med. 187:1633

61. Keene JA and J Forman 1982. Helper activity is required for the in vivo generation of cytotoxic T lymphocytes. J. Exp. Med. 155:768

62. Samten B et al. 2003. CD40 Ligand trimer enhances the response of CD8+ T cells to Mycobacterium tubersulosis. J. Immunol. 170:3180

63. Chamekh et al. 2005. Transfection of Trypanosome cruzi with host CD40 Ligand results in improved control of parasite infection. Infect. Immun. 73.10:6552

64. Kremer et al. 1995. Analysis of Mycobacterium tuberculosis 85A antigen promoter region. J. bacterial. 177:642 65. Boulard et al. 1995. Mercury resistance as a selective marker for recombinant mycobacteria. Microbiology 141 :1045

66. Boulard et al. 1992. Rapid mycobacterial plasmid analysis bu electroduction between Mycobacterium spp. and E. coli. Nucleic Acids Res. 20:4105

67. Biet F e al. 2002. Mycobacterium tuberculosis BCG producing IL-18 increases antigen-specific gamma interferon production in mice. Infect. Immun. 70.12:6549

Claims

1. Transgenic organism expressing a nucleic acid encoding CD40L.
2. Transgenic organism according to claim 1 , wherein said organism is selected from the group comprising Trypanosoma, Plasmodium, Toxoplasma, Leishmania, Mycobacteria, Rickettsia, Salmonella, Shigella, Yersinia, Histoplasma, Candida, Cryptococcus, influenza viruses, rhinoviruses, rotaviruses, coronaviruses, arboviruses, retroviruses or hepatitis viruses.
3. Transgenic organism according to claims 1 or 2, wherein said organism is a Trypanosoma organism, and preferably a Trypanosoma cruzi strain.
4. Transgenic organism according to any of claims 1 to 3, wherein said organism has been transfected with a vector carrying a nucleic acid encoding CD40L and which is adapted to express said nucleic acid in said organism.
5. Transgenic organism according to claim 3 or 4, wherein said vector is a pTEX vector.
6. Transgenic organism according to any of claims 1 to 3, wherein said organism has been transformed with a nucleic acid encoding CD40L by means of homologous recombination.
7. Transgenic organism according to any of claims 1 to 6, wherein said nucleic acid is a nucleic acid having a nucleotide sequence as given in SEQ ID NO:4 or SEQ ID NO:6, or a homologue thereof.
8. Transgenic organism according to any of claims 1 to 6, wherein said CD40L is a polypeptide having an amino acid sequence as given in SEQ ID NO:5 or SEQ ID NO:7, or a homologue thereof.
9. Composition comprising a transgenic organism as claimed in any of claims 1 to 8, and a pharmaceutically acceptable carrier for treating a subject infected with said organism.
10. Composition comprising a transgenic organism as claimed in any of claims 1 to 8, and a pharmaceutically acceptable carrier for stimulating immune responses in a subject.
11. Composition according to claim 9 or 10, further comprising one or more co-stimulatory molecules.
12. Composition according to claim 11 , wherein said co-stimulatory molecules are selected from the group comprising cytokine receptors or cytokines such as interleukin-1 a & β (IL-1σ, IL-1/?), interleukin-2 (IL-2), interIeukin-6 (IL-6), interleukin-8 (IL-8), interleukin-12 (IL-12), interleukin-18 (IL-18), and Tumor necrosis factor a (TNF- α), Macrophage Inhibitory Peptide-1σ (MIP-1σ), Macrophage Inhibitory Peptide-1/?, (MIP-1/?), growth regulatory protein (GRO), granulocyte-macrophage colony stimulating factor (GM-CSF, or sargramostim), fusion proteins comprising GM-CSF, and interferons (INFs) such as interferon-gamma (IFN-y).
13. Kit comprising a composition as claimed in any of claims 9-10 and one or more co- stimulatory molecules as claimed in claim 12 for simultaneous, sequential or separate use.
14. Use of a transgenic organism according to any of claims 1 to 8, or of a composition according to any of claims 9 to 12 as a medicament.
15. Use of a transgenic organism according to any of claims 1 to 8, or of a composition according to any of claims 9 to 12 as a vaccine.
16. Use of a transgenic organism according to any of claims 1 to 8, or of a composition according to any of claims 9 to 12 for the preparation of a medicament for treating a subject infected with said organism.
17. Use of a transgenic organism according to any of claims 1 to 8, or of a composition according to any of claims 9 to 12 for the preparation of a vaccine for stimulating immune responses in a subject.
18. Use according to any of claims 14-17, wherein said organism is a Trypanosoma organism, and preferably a Trypanosoma cruzi strain.
19. Method for preparing a transgenic Trypanosoma organism expressing a nucleic acid encoding CD40L, comprising the steps of: a) cloning a nucleic acid encoding CD40L in a vector suitable for expressing said nucleic acid in said Trypanosoma organism, b) transfecting epimastigotes of said Trypanosoma organism with the vector obtained in step a), c) transforming the epimastigotes obtained in step b) into trypomastigotes, and d) optionally maintaining the trypomastigotes obtained in step c) in vivo or in vitro.
20. Method according to claim 19, comprising the step of directly transfecting the trypomastigotes of said Trypanosoma organism with the vector obtained in step a).
PCT/EP2006/003159 2005-04-07 2006-04-07 Transgenic organism expressing cd40l and uses thereof WO2006105972A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US66918005 true 2005-04-07 2005-04-07
US60/669,180 2005-04-07

Publications (1)

Publication Number Publication Date
WO2006105972A1 true true WO2006105972A1 (en) 2006-10-12

Family

ID=36613491

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/003159 WO2006105972A1 (en) 2005-04-07 2006-04-07 Transgenic organism expressing cd40l and uses thereof

Country Status (1)

Country Link
WO (1) WO2006105972A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2066339A2 (en) * 2006-09-18 2009-06-10 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses
US8956618B2 (en) 2010-01-21 2015-02-17 The Texas A&M University System Vaccine vectors and methods of enhancing immune responses
US8956849B2 (en) 2007-11-01 2015-02-17 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to Eimeria
US8961990B2 (en) 2010-06-09 2015-02-24 The Board Of Trustees Of The University Of Arkansas Vaccine and methods to reduce campylobacter infection
US9125854B2 (en) 2007-10-30 2015-09-08 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to flagellated bacterium
US9603915B2 (en) 2013-02-14 2017-03-28 The Board of Trustees of the University of Akansas Compositions and methods of enhancing immune responses to Eimeria or limiting Eimeria infection

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004035794A1 (en) * 2002-10-14 2004-04-29 Klaus Pfizenmaier Selective, local activation of members of the tnf ligand family of systemically inactive non-antibody tnf ligand fusion proteins

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004035794A1 (en) * 2002-10-14 2004-04-29 Klaus Pfizenmaier Selective, local activation of members of the tnf ligand family of systemically inactive non-antibody tnf ligand fusion proteins

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CHAMEKH MUSTAPHA ET AL: "Transfection of Trypanosoma cruzi with host CD40 ligand results in improved control of parasite infection", INFECTION AND IMMUNITY, vol. 73, no. 10, October 2005 (2005-10-01), pages 6552 - 6561, XP002389267, ISSN: 0019-9567 *
CHAUSSABEL DAMIEN ET AL: "CD40 ligation prevents Trypanosoma cruzi infection through interleukin-12 upregulation", INFECTION AND IMMUNITY, vol. 67, no. 4, April 1999 (1999-04-01), pages 1929 - 1934, XP002389264, ISSN: 0019-9567 *
CHEN GANG ET AL: "Vaccination against the intracellular pathogens Leishmania major and L. amazonensis by directing CD40 ligand to macrophages", INFECTION AND IMMUNITY, vol. 69, no. 5, May 2001 (2001-05-01), pages 3255 - 3263, XP002389265, ISSN: 0019-9567 *
MAZZEI G J ET AL: "Recombinant soluble trimeric CD40 ligand is biologically active", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOCHEMICAL BIOLOGISTS, BIRMINGHAM,, US, vol. 270, no. 13, 31 March 1995 (1995-03-31), pages 7025 - 7028, XP002247873, ISSN: 0021-9258 *
OZWARA HASTINGS ET AL: "Heterologous promoter activity in stable and transient Plasmodium knowlesi transgenes.", MOLECULAR AND BIOCHEMICAL PARASITOLOGY, vol. 130, no. 1, 11 August 2003 (2003-08-11), pages 61 - 64, XP002389266, ISSN: 0166-6851 *
TOBIN J F ET AL: "Transfected Leishmania expressing biologically active INF-gamma", JOURNAL OF IMMUNOLOGY, THE WILLIAMS AND WILKINS CO. BALTIMORE, US, vol. 11, no. 150, 1 June 1993 (1993-06-01), pages 5059 - 5069, XP002075808, ISSN: 0022-1767 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2857038A3 (en) * 2006-09-18 2015-07-08 The Board of Trustees of the University of Arkansas Compositions and methods of enhancing immune responses
EP2066339A4 (en) * 2006-09-18 2010-02-03 Univ Arkansas Compositions and methods of enhancing immune responses
EP2517723A1 (en) * 2006-09-18 2012-10-31 The Board of Trustees of The University of Arkansas Compositions and methods of enhancing immune responses
US8604178B2 (en) 2006-09-18 2013-12-10 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses
US10004798B2 (en) 2006-09-18 2018-06-26 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses
US9226957B2 (en) 2006-09-18 2016-01-05 The Texas A&M University System Compositions and methods of enhancing immune responses
EP2066339A2 (en) * 2006-09-18 2009-06-10 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses
US9125854B2 (en) 2007-10-30 2015-09-08 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to flagellated bacterium
US8956849B2 (en) 2007-11-01 2015-02-17 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to Eimeria
US10016493B2 (en) 2007-11-01 2018-07-10 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to Eimeria
US8956618B2 (en) 2010-01-21 2015-02-17 The Texas A&M University System Vaccine vectors and methods of enhancing immune responses
US9913893B2 (en) 2010-01-21 2018-03-13 The Board Of Trustees Of The University Of Arkansas Vaccine vectors and methods of enhancing immune responses
US8961990B2 (en) 2010-06-09 2015-02-24 The Board Of Trustees Of The University Of Arkansas Vaccine and methods to reduce campylobacter infection
US9603915B2 (en) 2013-02-14 2017-03-28 The Board of Trustees of the University of Akansas Compositions and methods of enhancing immune responses to Eimeria or limiting Eimeria infection
US9884099B2 (en) 2013-02-14 2018-02-06 The Board Of Trustees Of The University Of Arkansas Compositions and methods of enhancing immune responses to Eimeria or limiting Eimeria infection

Similar Documents

Publication Publication Date Title
Park et al. IL-12 is required to maintain a Th1 response during Leishmania major infection
Gazzinelli et al. Interleukin 12 is required for the T-lymphocyte-independent induction of interferon gamma by an intracellular parasite and induces resistance in T-cell-deficient hosts
Stäger et al. Immunization with a recombinant stage-regulated surface protein from Leishmania donovani induces protection against visceral leishmaniasis
Tascon et al. Vaccination against tuberculosis by DNA injection
Tarleton Depletion of CD8+ T cells increases susceptibility and reverses vaccine-induced immunity in mice infected with Trypanosoma cruzi.
Khan et al. A purified parasite antigen (p30) mediates CD8+ T cell immunity against fatal Toxoplasma gondii infection in mice.
Hunter et al. Production of gamma interferon by natural killer cells from Toxoplasma gondii-infected SCID mice: regulation by interleukin-10, interleukin-12, and tumor necrosis factor alpha.
Kusakabe et al. The timing of GM-CSF expression plasmid administration influences the Th1/Th2 response induced by an HIV-1-specific DNA vaccine
Gurunathan et al. Vaccination with DNA encoding the immunodominant LACK parasite antigen confers protective immunity to mice infected with Leishmania major
Coler et al. Second-generation vaccines against leishmaniasis
Groux et al. A transgenic model to analyze the immunoregulatory role of IL-10 secreted by antigen-presenting cells
Shirley et al. The biology of avian Eimeria with an emphasis on their control by vaccination
Trinchieri Cytokines acting on or secreted by macrophages during intracellular infection (IL-10, IL-12, IFN-γ)
Cuadros et al. Flagellin fusion proteins as adjuvants or vaccines induce specific immune responses
Yun et al. Intestinal immune responses to coccidiosis
Struik et al. Does malaria suffer from lack of memory?
Demangel et al. Protection against aerosol Mycobacterium tuberculosis infection using Mycobacterium bovis Bacillus Calmette Guérin‐infected dendritic cells
Jabbari et al. Secondary memory CD8+ T cells are more protective but slower to acquire a central–memory phenotype
Belkaid et al. CD8+ T cells are required for primary immunity in C57BL/6 mice following low-dose, intradermal challenge with Leishmania major
Romani et al. Interleukin-12 in infectious diseases.
Boyle et al. DNA immunization: induction of higher avidity antibody and effect of route on T cell cytotoxicity
Handman Leishmaniasis: current status of vaccine development
Gonzalez et al. Salmonella typhi vaccine strain CVD 908 expressing the circumsporozoite protein of Plasmodium falciparum: strain construction and safety and immunogenicity in humans
Porgador et al. Bone marrow-generated dendritic cells pulsed with a class I-restricted peptide are potent inducers of cytotoxic T lymphocytes.
Stober et al. NKT cells provide help for dendritic cell-dependent priming of MHC class I-restricted CD8+ T cells in vivo

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWW Wipo information: withdrawn in national office

Country of ref document: DE

NENP Non-entry into the national phase in:

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: RU

NENP Non-entry into the national phase in:

Ref country code: RU

122 Ep: pct application non-entry in european phase

Ref document number: 06724103

Country of ref document: EP

Kind code of ref document: A1

WWW Wipo information: withdrawn in national office

Ref document number: 6724103

Country of ref document: EP