WO2009058938A2 - Process for the production of ethanol from a medium comprising xylose, employing a recombinant zymomonas strain having a reduced hima expression - Google Patents

Process for the production of ethanol from a medium comprising xylose, employing a recombinant zymomonas strain having a reduced hima expression Download PDF

Info

Publication number
WO2009058938A2
WO2009058938A2 PCT/US2008/081694 US2008081694W WO2009058938A2 WO 2009058938 A2 WO2009058938 A2 WO 2009058938A2 US 2008081694 W US2008081694 W US 2008081694W WO 2009058938 A2 WO2009058938 A2 WO 2009058938A2
Authority
WO
WIPO (PCT)
Prior art keywords
xylose
hima
acetate
gene
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2008/081694
Other languages
English (en)
French (fr)
Other versions
WO2009058938A3 (en
Inventor
Paul V. Viitanen
Luan Tao
Kyle Knoke
Yuying Zhang
Perry G. Caimi
Min Zhang
Yat-Chen Chou
Mary Ann Franden
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
EIDP Inc
Original Assignee
EI Du Pont de Nemours and Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by EI Du Pont de Nemours and Co filed Critical EI Du Pont de Nemours and Co
Priority to EP08843461A priority Critical patent/EP2205753B1/en
Priority to CA2704539A priority patent/CA2704539C/en
Priority to AU2008318720A priority patent/AU2008318720B2/en
Priority to BRPI0817152A priority patent/BRPI0817152A8/pt
Priority to JP2010532229A priority patent/JP2011515067A/ja
Priority to CN2008801137733A priority patent/CN101883861B/zh
Priority to DE602008006446T priority patent/DE602008006446D1/de
Priority to AT08843461T priority patent/ATE506447T1/de
Publication of WO2009058938A2 publication Critical patent/WO2009058938A2/en
Publication of WO2009058938A3 publication Critical patent/WO2009058938A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06Ethanol, i.e. non-beverage
    • C12P7/065Ethanol, i.e. non-beverage with microorganisms other than yeasts
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00Technologies for the production of fuel of non-fossil origin
    • Y02E50/10Biofuels, e.g. bio-diesel

Definitions

  • the invention relates to the fields of microbiology and genetic engineering. More specifically, the himA gene, encoding the alpha subunit of the integration host factor, was found to be involved in acetate tolerance of Zymomonas. A strain of xylose-utilizing Zymomonas with a genetic modification of the himA gene was developed, which exhibits improved ethanol production in the presence of acetate.
  • Zymomonas mobilis is a bacterial ethanologen that grows on glucose, fructose, and sucrose, metabolizing these sugars to CO 2 and ethanol via the Entner-Douderoff pathway. It is desirable to use hydrolyzed lignocellulosic biomass which can provide an abundantly available, low cost carbon substrate for use in fermentation for ethanol production.
  • Xylose is the major pentose in hydrolyzed lignocellulosic materials.
  • strains are modified for expression of four enzymes needed for xylose metabolism: 1 ) xylose isomerase, which catalyses the conversion of xylose to xylulose; 2) xylulokinase, which phosphorylates xylulose to form xylulose 5-phosphate; 3) transketolase; and 4) transaldolase (US 5514583, US 6566107; Zhang et al. (1995) Science 267:240-243).
  • xylose isomerase which catalyses the conversion of xylose to xylulose
  • xylulokinase which phosphorylates xylulose to form xylulose 5-phosphate
  • transketolase transaldolase
  • a particular stress encountered in using hydrolyzed lignocellulosic biomass for fermentation is the presence of acetate (Kim et al. (2000) Applied Biochemistry and Biotechnology 84-86:357-370), which is released from the acetylated xylose residues in hemicellulose during pre-treatment and saccharification processes.
  • NVG nitrosoguanidine
  • the present invention relates to producing ethanol using strains of xylose- utilizing Zymomonas that have improved performance in the presence of acetate.
  • acetate tolerance is affected by the himA gene encoding the alpha subunit of the integration host factor.
  • a xylose-utilizing Zymomonas with agenetic modification of the himA gene has increased acetate tolerance when cultured in concentrated mixtures of glucose and xylose with acetate present.
  • the himA modification provides reduced expression of the endogenous himA gene. Under these conditions, xylose utilization and ethanol production are significanty higher for the modified himA strain than for a comparable strain that has normal himA gene expression.
  • the invention provides a process for producing ethanol from a mixed-sugar medium comprising xylose, comprising:
  • Figure 1 shows a diagram of the four enzymes (boxed) that have been used to engineer Z. mobilis for xylose utilization and biochemical pathways for ethanol production using xylose.
  • Figure 2 shows a plasmid map of pMODgap/aada, the plasmid that was used to generate a transposon insertion library in ZW801 -4.
  • Figure 3 shows a graph of growth of ZW801-4 in a concentrated mixture of glucose and xylose with two different amounts of acetate.
  • Figure 4 shows graphs of glucose utilization, xylose utilization, and ethanol production for the enriched transposon insertion mutant library culture in comparison to the control strain, ZW801 -4, in medium with 100 g/L glucose, 90 g/L xylose and 6 g/L acetate (A) or with 105 g/L glucose, 100 g/L xylose, and 9 g/L acetate (B).
  • Figure 5 shows graphs of growth in glucose-containing media for ZW801 -4 (A) and the transposon insertion mutant, AcR#3 (B) with different amounts of potassium acetate.
  • Figure 6 shows graphs of endpoint values for growth in glucose- containing media at 43 hr for ZW801-4 (A) and the transposon insertion mutant AcR#3 (B) with different acetate salts.
  • Figure 7 shows a graph of glucose utilization, xylose utilization, and ethanol production for AcR#3 and ZW801 -4 in medium with 105 g/L glucose, 100 g/L xylose, and 9 g/L acetate.
  • Figure 8 shows graphs of glucose utilization, xylose utilization, and ethanol production for ZW801 -4 (A) and AcR#3 (B) in 100% Mock Hydrolysate medium, which contains -9.5 g/L of acetate and 190 mM ammonium ions, with 110 g/L glucose and 90 g/L xylose.
  • Figure 9 shows maps of plasmids made during construction of a himA gene knockout vector pLDHTc139#7 (A), pLDHTd 39#7-9WW (B), and pLDHSp-9WW (C).
  • Figure 10A shows the genomic location of primers used to prepare himA flanking DNA for insertion into the himA suicide vector, pHimA, and a circular map of the pHimA plasmid is shown in Figure 10B.
  • Figure 11 shows graphs of glucose utilization, xylose utilization, and ethanol production for ZW801 -4 (A) and ZW801 -4:: ⁇ himA (B) in 100% Mock Hydrolysate media, which contains -9.5 g/L of acetate and 190 mM ammonium ions, with 110 g/L glucose and 90 g/L xylose.
  • Figure 12 shows graphs of growth in glucose-containing media for ZW801 -4 (A), AcR#3 (B), and ZW801 -4:: ⁇ himA (C) with 0 or 8 g/L of acetate added as the potassium salt.
  • SEQ ID NO:1 is the nucleotide sequence of the Zymomonas mobilis him A coding region.
  • SEQ ID NOs:2 and 3 are the nucleotide sequences of primers for sequencing transposon insertion sites.
  • SEQ ID NOs:4 and 5 are the nucleotide sequences of primers for PCR amplification of a DNA fragment containing the ldh gene and some surrounding DNA.
  • SEQ ID NOs:6 and 7 are the nucleotide sequences of primers for PCR amplification of a DNA fragment containing the tetracycline resistance cassette from pACY184.
  • SEQ ID NOs:8 and 9 are the nucleotide sequences of oligos used to prepare a loxP site for insertion into plasmid pLDHTc139#7.
  • SEQ ID NOs:10 and 11 are the nucleotide sequences of oligos used to prepare a loxP site for insertion into plasmid pLDHTc139#7-9W.
  • SEQ ID NOs:12 and 13 are the nucleotide sequences of primers for PCR amplification of a DNA fragment containing the spectinomycin resistance cassette from plasmid pHP15578.
  • SEQ ID NOs:14 and 15 are the nucleotide sequences of primers for PCR amplification of a 3' himA flanking DNA fragment.
  • SEQ ID NOs:16 and 17 are the nucleotide sequences of primers for PCR amplification of a 5' himA flanking DNA fragment.
  • SEQ ID NOs:18 and 19 are the nucleotide sequences of the PCR primers that were used to confirm that a single-crossover event had occurred between the 5' himA flanking DNA in pHimA and its chromosomal counterpart.
  • SEQ ID NOs:20 and 21 are the nucleotide sequences of the PCR primers that were used to confirm that a single-crossover event had occurred between the 3' himA flanking DNA in pHimA and its chromosomal counterpart.
  • SEQ ID NOs:22 and 23 are the nucleotide sequences of the PCR primers that were used to confirm that a double-crossover event had occurred between the 5' and 3' himA flanking DNA sequences in pHimA and the himA gene in the chromosome.
  • SEQ ID NO:24 is the complete nucleotide sequence of the GFOR coding region of Z mobilis.
  • SEQ ID NO:25 is the complete nucleotide sequence of the disrupted GFOR coding region in ZW801 -4 (from the original start codon through the original stop codon).
  • SEQ ID NO:26 is amino acid sequence of the Z. mobilis HimA protein.
  • the present disclosure describes processes for producing ethanol comprising cultuhng xylose-utilizing recombinant Zymomonas strains in medium comprising mixtures of sugars, such as glucose, xylose and acetate; wherein said strains comprise modifications to the endogenous himA gene of said strains.
  • the modification to the himA gene reduces expression of the gene, and results in improved performance of the ft/mA-modified Zymomonas strains when cultured in medium as described herein.
  • Ethanol produced by the ft/mA-modified Zymomonas strains may be used as an alternative energy source to fossil fuels.
  • IHF Integration host factor
  • Gene refers to a nucleic acid fragment that expresses a specific protein, which may include regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence.
  • “Native gene” or “wild type gene” refers to a gene as found in nature with its own regulatory sequences.
  • Chimeric gene refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
  • Endogenous gene refers to a native gene in its natural location in the genome of an organism.
  • a “foreign” gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer.
  • Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes.
  • the term "genetic construct” refers to a nucleic acid fragment that encodes for expression of one or more specific proteins.
  • the gene may be native, chimeric, or foreign in nature.
  • a genetic construct will comprise a "coding sequence”.
  • a "coding sequence” refers to a DNA sequence that codes for a specific amino acid sequence.
  • Promoter or “Initiation control regions” refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
  • a coding sequence is located 3' to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments.
  • promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”.
  • expression refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from a gene. Expression may also refer to translation of mRNA into a polypeptide.
  • Antisense inhibition refers to the production of antisense RNA transcripts capable of suppressing the expression of the target protein.
  • Overexpression refers to the production of a gene product in transgenic organisms that exceeds levels of production in normal or non- transformed organisms.
  • Co-suppression refers to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially similar foreign or endogenous genes (U.S. 5,231 ,020).
  • mRNA messenger RNA
  • non-functional gene refers to a gene that does not express the encoded protein normally as in the wild type strain where the gene is endogenous. Expression of a non-functional gene may be disrupted at any level, such as transcription, RNA processing, or translation. A non-functional gene typically has little or no expression of the encoded protein. However it may also code for a modified protein that has lower enzyme activity than the wild type protein.
  • transformation refers to the transfer of a nucleic acid fragment into a host organism, resulting in genetically stable inheritance. The transferred nucleic acid may be in the form of a plasmid maintained in the host cell, or some transferred nucleic acid may be integrated into the genome of the host cell. Host organisms containing the transformed nucleic acid fragments are referred to as "transgenic” or “recombinant” or “transformed” organisms.
  • Plasmid and "vector” as used herein, refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double- stranded DNA molecules.
  • Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell.
  • operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other.
  • a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter).
  • Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.
  • selectable marker means an identifying factor, usually an antibiotic or chemical resistance gene, that is able to be selected for based upon the marker gene's effect, i.e., resistance to an antibiotic, wherein the effect is used to track the inheritance of a nucleic acid of interest and/or to identify a cell or organism that has inherited the nucleic acid of interest.
  • high concentration of mixed sugars refers to a total sugar concentration in the medium that results in inhibition of growth of xylose-utilizing Zymomonas. This typically occurs when the total sugar concentration exceeds about 100 g/L, and the severity of the effect is greater at higher sugar concentrations. However, the exact sugar concentration where growth inhibition starts to occur is highly dependent on other components in the medium.
  • transferable sugar refers to oligosaccharides and monosaccharides that can be used as a carbon source by a microorganism in a fermentation process.
  • lignocellulosic refers to a composition comprising both lignin and cellulose. Lignocellulosic material may also comprise hemicellulose.
  • cellulosic refers to a composition comprising cellulose and additional components, including hemicellulose.
  • sacharification refers to the production of fermentable sugars from polysaccharides.
  • pretreated biomass means biomass that has been subjected to pretreatment prior to saccharification.
  • Biomass refers to any cellulosic or lignocellulosic material and includes materials comprising cellulose, and optionally further comprising hemicellulose, lignin, starch, polysaccharides, oligosaccharides and/or monosaccharides. Biomass may also comprise additional components, such as protein and/or lipid. Biomass may be derived from a single source, or biomass can comprise a mixture derived from more than one source; for example, biomass could comprise a mixture of corn cobs and corn stover or fiber, or a mixture of grass and leaves.
  • Biomass includes, but is not limited to, bioenergy crops, agricultural residues, municipal solid waste, industrial solid waste, sludge from paper manufacture, yard waste, wood and forestry waste.
  • biomass include, but are not limited to, corn grain, corn cobs, crop residues such as corn husks, corn stover, corn fiber, grasses, wheat, wheat straw, barley, barley straw, hay, rice straw, switchgrass, waste paper, sugar cane bagasse, sorghum, soy, components obtained from milling of grains, trees, branches, roots, leaves, wood chips, sawdust, shrubs and bushes, vegetables, fruits, flowers and animal manure.
  • Biomass hydrolysate refers to the product resulting from sacchahfication of biomass.
  • the biomass may also be pretreated prior to sacchahfication.
  • the present invention relates to engineered strains of xylose-utilizing Zymomonas that have improved performance in the presence of acetate.
  • Acetate is an inhibitor of Zymomonas which when present during fermentation, reduces growth and ethanol production.
  • Acetate is a metabolic by-product in Zymomonas and is also a component of pretreated and saccharified biomass. Therefore a challenge in using sugars derived from biomass for fermentation is to overcome inhibitory effects of acetate on the biocatalyst for improved ethanol production. It is shown herein that engineering a disruption of the endogenous himA gene in xylose-utilizing Z mobilis improves fermentation performance, including xylose utilization and ethanol production, when the fermentation medium comprises acetate. Further, the present invention relates to a process for producing ethanol wherein the present Zymomonas strains are cultured in medium comprising xylose.
  • Any strain of Zymomonas including a Z mobilis strain, that is able to utilize xylose as a carbon source may be used as a host for preparing strains used in the present invention.
  • Strains o1 Zymomonas that have been engineered for xylose fermentation to ethanol are particularly useful.
  • Endogenous genes may provide part of the metabolic pathway, or may be altered by any known genetic manipulation technique to provide a protein with enzyme activity useful for xylose metabolism.
  • the endogenous transketolase may complement other introduced enzyme activities in creating a xylose utilization pathway.
  • Typically four genes have been introduced into Z.
  • transketolase and transaldolase two enzymes of the pentose phosphate pathway, convert xylulose 5-phosphate to intermediates (fructose 6-phosphate and glyceraldehydes 3-phosphate) that couple pentose metabolism to the glycolytic Entner-Douderoff pathway permitting the metabolism of xylose to ethanol.
  • DNA sequences encoding these enzymes may be obtained from any of numerous microorganisms that are able to metabolize xylose, such as enteric bacteria, and some yeasts and fungi.
  • Sources for the coding regions include Xanthomonas, Klebsiella, Escherichia, Rhodobacter, Flavobacterium, Acetobacter, Gluconobacter, Rhizobium, Agrobacterium, Salmonella, Pseudomonads, and Zymomonas. Particularly useful are the coding regions of E. coli.
  • the encoding DNA sequences are operably linked to promoters that are expressed in Zymomonas cells such as the promoter of Zymomonas glyceraldehyde-3-phosphate dehydrogenase (GAP promoter), and Zymomonas enolase (ENO promoter).
  • the coding regions may individually be expressed from promoters, or two or more coding regions may be joined in an operon with expression from the same promoter.
  • the resulting chimeric genes may be introduced into Zymomonas and maintained on a plasmid, or integrated into the genome using, for example, homologous recombination, site-directed integration, or random integration.
  • Xylose-utilizing strains that are of particular use include CP4(pZB5) (US 5514583), ATCC31821/pZB5 (US 6566107), 8b (US 20030162271 ; Mohagheghi et al., (2004) Biotechnol. Lett. 25; 321 -325), and ZW658 (ATTCC #PTA-7858).
  • Zymomonas strains that are additionally engineered to utilize sugars other than xylose, which they do not normally use, may also be used in the present process.
  • An example is a xylose-utilizing strain of Z. mobilis that was further engineered for arabinose utilization is described in US 5843760, which is herein incorporated by reference.
  • Zymomonas strains that are additionally engineered for reduced production of the unwanted by-product xylitol may also be used. These strains are described in commonly owned and co-pending US patent application #11/862566 and pending US patent publication #US20080187973 A1 , which are herein incorporated by reference.
  • the described strains ZW800, ZW801 -4, and ZW801 -6 have a disrupted gene encoding glucose-fructose oxidoreductase (GFOR). Disruption of expression of the GFOR gene may be accomplished using the same methods described below for disrupting the himA gene, using the known sequence of the GFOR coding region (SEQ ID NO:24).
  • DNA sequences surrounding the GFOR coding sequence are also useful in some modification procedures and are available for Zymomonas in the complete genome sequence (GenBank Accession #AE008692). Reduced expression of GFOR was found to reduce xylitol production and enhance ethanol production.
  • HimA The protein encoded by the himA gene, referred to herein as "HimA” protein, is the alpha subunit (SEQ ID NO:26) of the integration host factor (IHF), a protein which also includes a beta subunit encoded by the himD gene.
  • IHF integration host factor
  • IHF is a heterodimehc protein that is comprised of two closely related subunits. IHF has been studied in E.
  • E. coli and shown to be a DNA binding and DNA bending protein that is involved in DNA recombination, DNA replication, and regulation of gene expression (Friedman (1988) Cell 55:545-554; Arfin et al. (2000) J. Biol. Chem. 275: 29672-29684).
  • Gene expression profiling experiments in E. coli have shown that himA gene inactivation significantly alters the expression level of at least 120 genes, and that this manipulation activates more genes than it represses (Arfin et al. (2000) J. Biol. Chem. 275: 29672-29684). It is also known that the E.
  • coli himA gene is most actively transcribed when cells transition from exponential phase to the stationary phase, and the himA gene product is thought to play a role in this process.
  • himA affects a broad range of DNA processes and is a regulator of gene expression in E. coli, but none of the many genes that it is thought to regulate are clearly related to acetate tolerance.
  • global analysis of gene expression in E. coli after exposure to an inhibitory concentration of acetate has been examined using microarrays, and of the 86 genes that were effected by this treatment the himA gene was not among them (Arnold et al. (2001 ) J. Bacterid. 183: 2178-2186).
  • nothing is known about the role of the himA gene in Zymomonas.
  • the ZymomonasH imA protein is 46% identical to the E. coli homolog (GenBank accession number NP_416227).
  • the most closely related known protein is the HimA homolog of Sphingomonas wittichii (GenBank accession number YP_001264041 ) which is 67% identical, as determined by a tBLASTx search against the NCBI database using the Z. mobilis himA coding region (SEQ ID NO:1 ) as the query sequence.
  • a xylose-utilizing Z. mobilis strain of the present invention is genetically modified such that there is reduced or no expression of integration host factor alpha subunit protein (HimA).
  • HimA integration host factor alpha subunit protein
  • reduction in HimA protein expression is accomplished through a modification that reduces expression of the himA gene.
  • Reducing HimA protein expression may include modifications that for example reduce translation of the encoding mRNA, or reduce stability of the HimA protein. Reduced expression of the HimA protein results in improved performance in the presence of acetate. Any genetic modification method known by one skilled in the art for reducing the expression of a protein may be used to alter HimA expression.
  • Methods include, but are not limited to, deletion of the entire or a portion of the himA gene, inserting a DNA fragment into the himA gene (in either the promoter or coding region) so that the encoded protein cannot be expressed, introducing a mutation into the himA coding region which adds a stop codon or frame shift such that a functional protein is not expressed, and introducing one or more mutations into the himA coding region to alter amino acids so that a non-functional or a less functionally active protein is expressed.
  • himA expression may be blocked by expression of an antisense RNA or an interfering RNA, and constructs may be introduced that result in cosuppression.
  • a particularly suitable method for creating a genetically modified himA strain is using homologous recombination mediated by himA flanking DNA sequences bounding a spectinomycin resistance or other marker gene, leading to insertion of the marker gene in the himA coding region such that a functional protein is not expressed.
  • the marker gene may be bounded by site-specific recombination sites, so that following expression of the corresponding site-specific recombinase, the resistance gene is excised from the himA gene.
  • the site-specific recombination leaves behind a recombination site which disrupts expression of the himA gene.
  • the homologous recombination vector may be constructed to also leave a deletion in the himA gene following excision of the marker, as is well known to one skilled in the art.
  • a non-functional himA gene refers to not functioning in the normal manner such that lower than normal levels of encoded protein are present. Some methods of gene inactivation may result in some remaining low-level expression, such as co-suppression.
  • a modified himA strain refers to a genetically modified strain with reduced or no HimA enzyme activity.
  • a himA modified xylose-utilizing Z. mobilis strain of the present invention has improved performance when cultured in a mixed-sugars medium comprising an amount of xylose.
  • the medium may also contain an amount of acetate. It is desirable to use sugars that are produced from biomass saccharification in culture medium for xylose-utilizing Z. mobilis.
  • biomass is pretreated, for example as described in Patent Publication WO2004/081185 and in commonly owned and co-pending US publication US20070031918A1 , and then treated with saccharification enzymes as reviewed in Lynd, L. R., et al. (Microbiol. MoI. Biol. Rev. (2002) 66:506-577).
  • the hydrolysate product of biomass pretreatment and saccharification which contains xylose and other sugars also typically contains acetate.
  • Hemicellulose in biomass contains acetylated xylose residues and the acetate is released under very mild conditions.
  • the improved performance in the presence of acetate as assayed herein includes growth, utilization of xylose, and production of ethanol. Improved performance of a himA modified xylose-utilizing Z. mobilis strain is relative to a strain with the same genetic features (an isogenic strain), but lacking a modification of the himA gene. The parental strain used for genetic modification of the himA gene is typically used in this comparison. Improvement may be seen at any level of acetate in which an unmodified himA strain does not reach its full potential for growth and ethanol production. Depending on the composition of the medium and pH control, improvement typically occurs when the concentration of acetate is about 5 g/L or higher.
  • acetate inhibition also depends on the pH since the inhibitory species is actually acetic acid, and the equilibrium of acetic acid and acetate is dependent upon pH. Without control of pH, Z. mobilis rapidly acidifies the culture medium, like other gram-negative bacteria. With a drop in pH from 5.8 to 4.8, the concentration of acetic acid increases by 5- fold due to the -4.8 pK A of acetic acid. Thus the actual concentration of acetic acid (the inhibitor) depends on the pH of the culture medium as well as the total amount of the protonated and unprotonated species that is present in the culture medium.
  • the unmodified and modified himA strains utilize glucose similarly under pH controlled conditions, with the glucose largely being consumed prior to xylose consumption.
  • the himA modified strain is able to convert more xylose to ethanol than the isogenic parent strain that has normal himA gene expression.
  • the level of increased ethanol production conferred by the himA gene modification is dependent upon the components of the culture medium in pH controlled conditions, including the levels and ratios of types of sugars and presence of other inhibitors. For example, in the presence of 126 g/L glucose, 107 g/L xylose and 10% acetate there was a 4% increase in the ethanol titer for the himA modified strain as compared to the isogenic strain with no himA modification. When the culture medium also contains other inhibitors, the increased ethanol production can be even greater.
  • a mock hydrolysate medium that includes 110 g/L glucose, 90 g/L xylose, -9.5 g/L acetate and 190 mM ammonium ions (another inhibitor of Z mobilis growth (Agrawal (1989) Biotechnology and Bioengineering 34: 278-281 ) that may be present in biomass hydrolysate at this concentration)
  • ammonium ions another inhibitor of Z mobilis growth (Agrawal (1989) Biotechnology and Bioengineering 34: 278-281 ) that may be present in biomass hydrolysate at this concentration
  • the differential in ethanol production between a modified himA strain and an isogenic unmodified himA strain might even be greater than the examples cited.
  • the improvement in ethanol production may be at least about 4% or higher.
  • the present himA modified, xylose- utilizing strain is cultured in medium that contains any mixture of sugars that also includes xylose.
  • the present strain may be cultured in biomass hydrolysate, or a dilution of biomass hydrolysate.
  • Biomass sacchahfication produces sugars in a biomass hydrolysate that may typically include a mixture of xylose with glucose, fructose, sucrose, galactose, mannose, and/or arabinose.
  • a mixed sugars composition that includes xylose and glucose, where additional sugars may be present. The ratio of different sugars may vary in the mixture, with xylose typically at least about 10% of the total amount of sugars.
  • xylose is between about 40% and about 60%.
  • Fructose is present in sugars produced by saccharification of some biomass such as sugar cane bagasse, and may replace a portion of xylose or glucose, such that xylose remains at least about 10% of the sugar mixture.
  • arabinose is derived from hemicellulose and thus is a typical component of mixed sugars derived from saccharified biomass containing hemicellulose.
  • xylose is one of the sugars that is used as a carbon source for production of ethanol. For maximal ethanol production and efficiency of fermentation it is desirable to culture the present himA modified, xylose-utilizing strain in medium containing a concentrated mixture of sugars, including xylose.
  • the mixed sugars concentration in the fermentation medium is typically at least about 120 g/L and up to about 300 g/L. Particularly useful is a high concentration of mixed sugars that is between about 150 g/L and about 235 g/L.
  • sorbitol may be included in the fermentation medium used to culture the himA modified, xylose-utilizing Z. mobilis as described in commonly owned and co-pending US publication #US20080081358 A1 , which is herein incorporated by reference.
  • Sorbitol D-Sorbitol and/or L-Sorbitol
  • Sorbitol may be present in the medium at concentrations that are between about 2 mM and 200 mM. More suitable final concentrations in the medium are concentrations between about 2 mM and 100 mM, with concentrations between 5 mM and 20 mM preferred.
  • Mannitol may be used in the medium instead of sorbitol, or in combination with sorbitol.
  • galactitol and/or ribitol may be used in place of or in combination with sorbitol or mannitol. Sorbitol, mannitol, galactitol, ribitol or combinations thereof are all used in the same concentrations as described for sorbitol.
  • Z. mobilis is cultured in the medium where fermentation occurs and ethanol is produced.
  • the fermentation is run without supplemented air, oxygen, or other gases (which may include conditions such as anaerobic, microaerobic, or microaerophilic fermentation), for at least about 24 hours, and may be run for 48 hours or more.
  • the timing to reach maximal ethanol production is variable, depending on the fermentation conditions. Typically, if inhibitors are present in the medium, a longer fermentation period is required.
  • the fermentations may be run at temperatures that are in a range between about 25 ° C and about 40 ° C, and at a pH of about 4.5 to about 7.5. Particularly suitable are temperatures between about 3O 0 C and about 37 ° C. It is also particularly suitable to maintain the pH at least about 1 pH unit above the pK A of acetic acid, bringing the pH to between about 5.8 and 7.5, to decrease the ratio of acetic acid to acetate.
  • the himA modified xylose-utilizing Z. mobilis may be cultured in medium containing mixed sugars including xylose in laboratory scale fermenters, and in scaled up fermentation where commercial quantities of ethanol are produced.
  • the medium may contain acetate as described above.
  • culture methodologies may be applied.
  • large-scale production from himA modified xylose- utilizing Z. mobilis may be produced by both batch and continuous culture methodologies.
  • a classical batch culturing method is a closed system where the composition of the medium is set at the beginning of the culture and not subjected to artificial alterations during the culturing process.
  • the medium is inoculated with the desired organism and growth or metabolic activity is permitted to occur adding nothing to the system.
  • a "batch" culture is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration.
  • the metabolite and biomass compositions of the system change constantly up to the time the culture is terminated.
  • cells typically moderate through a static lag phase to a growth phase and finally to a stationary phase where growth rate is diminished or halted. If untreated, cells in the stationary phase will eventually die.
  • Cells in log phase are often responsible for the bulk of production of end product or intermediate in some systems. Stationary or post-exponential phase production can be obtained in other systems.
  • Fed-Batch culture processes are also suitable for culture of himA modified xylose-utilizing Z. mobilis and comprise a typical batch system with the exception that the substrate is added in increments as the culture progresses.
  • Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the medium.
  • Continuous cultures are open systems where a defined culture medium is added continuously to a bioreactor and an equal amount of conditioned medium is removed simultaneously for processing. Continuous cultures generally maintain the cells at a constant high liquid phase density where cells are primarily in log phase growth.
  • continuous culture may be practiced with immobilized cells where carbon and nutrients are continuously added, and valuable products, by-products or waste products are continuously removed from the cell mass.
  • Cell immobilization may be performed using a wide range of solid supports composed of natural and/or synthetic materials as is known to one skilled in the art.
  • Continuous or semi-continuous culture allows for the modulation of one factor or any number of factors that affect cell growth, metabolism, or end product concentration.
  • one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate.
  • a number of factors affecting growth or metabolism can be altered continuously while the cell concentration, measured by medium turbidity, is kept constant.
  • Continuous systems strive to maintain steady state growth conditions and thus the cell loss due to medium being drawn off must be balanced against the cell growth rate in the culture.
  • Particularly suitable for ethanol production is a fermentation regime as follows.
  • a modified xylose-utilizing Z. mobilis strain is grown in shake flasks in semi-complex medium at about 3O 0 C to about 37 0 C with shaking at about 150 rpm in orbital shakers and then transferred to a 10 L seed fermentor containing similar medium.
  • the seed culture is grown in the seed fermentor anaerobically until OD 6 oo is between 3 and 6, when it is transferred to the production fermentor where the fermentation parameters are optimized for ethanol production.
  • Typical inoculum volumes transferred from the seed tank to the production tank range from about 2% to about 20% v/v.
  • Typical fermentation medium contains minimal medium components such as potassium phosphate (1.0 - 10.0 g/l), ammonium sulfate (0- 2.0 g/l), magnesium sulfate (0 - 5.0 g/l), a complex nitrogen source such as yeast extract or soy based products (0 - 10 g/l). A final concentration of about 5 mM sorbitol or mannitol is present in the medium.
  • Mixed sugars including xylose and at least one additional sugar such as glucose (or sucrose), providing a carbon source are continually added to the fermentation vessel on depletion of the initial batched carbon source (50-200 g/l) to maximize ethanol rate and titer.
  • Carbon source feed rates are adjusted dynamically to ensure that the culture is not accumulating glucose in excess, which could lead to build up of toxic byproducts such as acetic acid.
  • biomass growth is restricted by the amount of phosphate that is either batched initially or that is fed during the course of the fermentation.
  • the pH of the fermentation broth is controlled/maintain by automated base addition using ammonium hydroxide, potassium hydroxide, sodium hydroxide, or other strong bases.
  • the temperature of the fermentor is controlled in the desired range.
  • antifoam agents any class- silicone based, organic based etc
  • An antibiotic for which there is an antibiotic resistant marker in the strain, such as kanamycin, may be used optionally to minimize contamination.
  • a transposon-based genomic knockout/overexpression library was constructed in a xylose-utilizing recombinant strain of Z mobilis to screen for acetate-resistant mutants. There were two principle reasons for using a transposon to generate the library. First, it is a completely unbiased approach that does not require any previous knowledge about the genes that play a role in acetate tolerance. Second, it is easy to identify the disrupted gene that is responsible for the desired phenotype since it is "tagged" with a selectable marker. The strain that was used to generate the library was ZW801 -4.
  • ZW801 -4 was derived from ZW658 (ATCC # PTA- 7858) through an intermediate strain, ZW800.
  • the latter strain was constructed by double-crossover insertion from a suicide plasmid of a spectinomycin resistance cassette (Spec r -cassette), flanked by wild type loxP sites, into the gene encoding glucose-fructose oxidoreductase (GFOR).
  • GFOR glucose-fructose oxidoreductase
  • the resulting GFOR knockout mutant was shown to have reduced production of xylitol, a detrimental by-product of xylose metabolism, and better production of ethanol during mixed sugar fermentation with glucose and xylose.
  • ZW800 was then converted to ZW801 -4 through Cre-mediated excision of the Spec r -cassette. Elimination of the selectable marker left a single wild type loxP site in the middle of the GFOR open reading frame, which resulted in an in-frame stop codon that prematurely truncates translation of the protein.
  • the GFOR coding sequence in ZW801 -4 is missing -72 bp of the original wildtype GFOR nucleotide sequence in the region surrounding the loxP site as a result of the design of the suicide construct.
  • the sequence of the mutant GFOR coding region in ZW801 -4 is given as SEQ ID NO:25. Like its immediate predecessor (ZW800), ZW801 -4 does not generate any detectable xylitol since it does not produce a functional GFOR enzyme.
  • the methodology that was used to generate the ZW801 -4 genomic knockout/overexpression library was based on the Epicentre (Madison, Wl) transposome technology using the pMODTM-2 ⁇ MCS> Transposon Construction Vector (Cat. No. MOD0602).
  • This plasmid includes an ampicillin resistance gene (ampR), an E. coli origin of replication (ori), and a multi-cloning site that is situated between the two mosaic ends (ME) that Tn5 transposase interacts with.
  • ampR ampicillin resistance gene
  • ori E. coli origin of replication
  • ME mosaic ends
  • pMODTM-2 ⁇ MCS> was converted to pMODgap/aadA, shown in Figure 2, by inserting a Spec r -cassette (that has its own promoter) and the strong constitutive promoter for the Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene (Pgap) into the multi-cloning site that is situated between the two MEs; the Pgap promoter and Spec r -cassette are oriented in opposite directions.
  • the DNA fragment that was randomly inserted into the Z. mobilis chromosome during transposition using this construct contained both the Spec r -cassette and Pgap promoter.
  • the Pgap promoter was added to the transposon to increase the genetic diversity of the library, since it can potentially alter the expression of Z mobilis chromosomal genes that are adjacent to the transposon insertion site.
  • the ZW801 -4 genomic knockout/overexpression library consisted of -17, 500 independent mutants and the titer of the glycerol stock was -7.1 x 10 8 Spec r colony forming units (cfu) per milliliter. This translates to -1 transposon insertion event/115 nucleotides, which is about 8x coverage of the entire genome, based on random insertion of the transposon and -2000 genes with an average size of -1 kb. Because of the low transformation frequency of Z. mobilis, it was expected that none or very few of the mutants would have more than one transposon insert.
  • the ZW801 -4 genomic knockout/overexpression library was screened for acetate-resistant mutants as described below. Before doing this, however, it was important to set up the proper selection conditions for the mutant enrichment process. The goal was to find a concentration of acetate that slowed the growth rate by at least a factor of two, but still allowed the cells to divide for several generations so that faster growing mutants could accumulate. It was also important to do this under process-relevant conditions in a concentrated mixture of glucose and xylose, since previous experiments have shown that osmotic stress and acetate both inhibit growth in a synergistic manner.
  • controlling the pH was also critical since the real inhibitory compound is acetic acid, and the ratio of the protonated species to the non-protonated species would increase dramatically without pH control as the bacterial cells acidified the growth media. For example, if the pH were to drop from 5.8 to 4.8, the concentration of acetic acid would increase about 5-fold, since the pK A of this weak organic acid is -4.8.
  • Figure 3 shows the inhibitory effects of two different concentrations of acetate on the growth rate and final biomass yield of ZW801 -4, the strain that was used to generate the library. Potassium acetate was used for these experiments and the final concentrations that are given below are based on the acetate component of the added salt in grams per liter.
  • the pH-controlled bioreactors contained mRM3S media (10 g/L yeast extract, 2 g/L KH 2 PO 4 , 1 g/L MgSO 4 , 5 mM sorbitol) plus 100 g/L glucose, 90 g/L xylose and 5 g/L or 6 g/L of acetate; pH and temperature were 5.8 and 30 0 C, and stirring was at 150 rpm. Based on the results shown in Figure 3 and other experiments, 5 g/L of acetate was chosen for library screening, since this concentration of the inhibitor satisfied both criteria for growth as stated above.
  • the 150-ml final culture contained mRM3S media plus 100 g/L glucose, 90 g/L xylose, 5 g/L of acetate, and the pH was maintained at 5.8 by automated KOH addition.
  • an aliquot of the culture (OD 6 oo ⁇ 0.5) was transferred to a new bioreactor that contained fresh growth media with the same composition to an initial OD 6 oo of -0.02.
  • This step was repeated six more times essentially as described above.
  • the cells were transferred every 24- 36 hrs and the initial OD in the bioreactor was -0.02 to -0.03. Thus, there were at least five generations between transfers.
  • a glycerol stock of the culture was prepared for further characterization.
  • Figure 4A shows the results of a pH-controlled bioreactor experiment with high sugar and acetate that was performed with the enriched mutant culture after the seventh transfer.
  • the control for this experiment was the parent strain, ZW801 -4.
  • Seed cultures were grown at 3O 0 C in SM media to an OD 6 oo of -4.5 and the bioreactors were started with a 10% inoculum.
  • the final 150-ml cultures contained mRM3S media plus 100 g/L glucose, 90 g/L xylose and 6 g/L acetate. Stirring was at 150 rpm, and pH and temperature were maintained at 5.8 and 3O 0 C, respectively.
  • the following procedure was used for this analysis.
  • the colonies were diluted in 50 ⁇ l of water and genomic DNA was amplified using the GenomiPHI Amplification Kit (GE Healthcare Life Sciences Cat. No. 25-6600-1 ). Briefly, 1 ⁇ l of the cell suspension was added to 9 ⁇ l of the Lysis Reagent and the mixture was heated to 95 0 C for 3 min and immediately cooled to 4 0 C. Next, 9 ⁇ l of Enzyme Buffer and 1 ⁇ l of Phi 29 DNA polymerase were added to the lysed samples. After 18 hours of amplification at 30 0 C, the polymerase was heat-inactivated for 10 min at 65 0 C and the sample was then immediately cooled to 4 0 C.
  • the entire 40- ⁇ l sequencing reaction mixture was pipetted into one well of a pre-spun 96-well clean up plate, and the plate was spun for 5 min at 5000 x gravity in a Sorvall RT-7 refrigerated centrifuge. The cleaned up reactions were then placed directly onto an Applied Biosystems 3730 DNA sequencer and sequenced with automatic base-calling.
  • the growth media that was used for the mutant selection process contained high concentrations of glucose and xylose, in addition to an inhibitory level of acetate. It was therefore possible that the improved fermentation performance that was observed after the seventh round of enrichment (Figure 4) was related to osmotic stress or better growth on xylose, since this sugar is not utilized as well as glucose. It was also possible that ethanol resistant mutants had been enriched for since they too would presumably grow faster or survive longer under the experimental conditions employed. To rule out these other possibilities and see if himA gene inactivation really does confer higher tolerance to acetate, strain AcR#3 was compared to the parent strain, ZW801 -4 under the following conditions.
  • the experiment was performed at 33 0 C in shake flasks (20 ml cultures in 50 ml tubes), and the growth media contained 10 g/L yeast extract, 2 g/L KH2PO 4 , 1 g/L MgSO 4 , 10 mM KHCO 3 (to help maintain pH), 50 g/L glucose and 0, 8, or 12 g/L acetate, which was added as the potassium salt; the concentrations of acetate that are given are based on the acetate component of the potassium salt.
  • the initial pH was adjusted to 5.8 with phosphoric acid before the cells were added and the cultures were gently agitated on a reciphcol shaker (150 rpm).
  • the seed cultures were grown to late exponential phase (OD 6 Oo ⁇ 1 -4) in the same media without acetate and the initial OD 6 oo for the experimental cultures was 0.03. It is important to note that these are ideal conditions for growth of Z. mobilis in the absence of acetate, since there is no osmotic stress and the preferred substrate glucose is the carbon source. Furthermore, the highest concentration of ethanol that could be generated in this experiment is ⁇ 25 g/L which has little or no effect on growth of Z. mobilis.
  • Performances of AcR#3 and ZW801 -4 were evaluated in the presence of concentrations of ammonium and acetate ions that are expected to be present in biomass hydrolysate produced using an ammonium hydroxide pretreatment process. This was a critical experiment since it has been estimated that the concentration of ammonium ions during fermentation of ammonium hydroxide pretreated corn stover hydrolysate may exceed 180 mM, and high concentrations of ammonium ions inhibit growth of Z. mobilis (Agrawal (1989) Biotechnology and Bioengineering 34: 278-281 ).
  • the synthetic 100% Mock Hydrolysate (100% MH) medium that was used for these experiments contains 5 g/L yeast extract, 15 mM (NH 4 ) 2 HPO 4 ,160 mM ammonium acetate, 1 g/L MgSO 4 and 10 mM sorbitol (pH 5.8).
  • the final concentrations of acetate and ammonium ions in 100% MH after addition of the seed cultures were -9.5 g/L and 190 mM, respectively.
  • the experiments were conducted in pH-controlled bioreactors. The seed cultures were grown at 3O 0 C in SM media to an OD 6 oo of -4.4 and a 10% inoculum was used to start the bioreactors.
  • the final 150-ml cultures contained 100% MH plus 110 g/L glucose and 90 g/L xylose.
  • the stirrer was set at 150 rpm, and pH and temperature were maintained at 5.8 and 33 0 C, respectively.
  • aliquots were removed for HPLC analysis of the fermentation broth using the same procedure that is described in Example 2.
  • the results from a representative pair of experiments that were conducted at the same time are shown in Figure 8: ZW801 -4 in 8A, and AcR#3 in 8B.
  • the transposon that was used to generate the ZW801 -4 genomic knockout/overexpression library contained a Spec r -cassette and the Z. mobilis Pgap promoter. These elements are oriented in opposite directions, and both of them were inserted into the himA open reading frame during transposition. Since the Z. mobilis Pgap promoter is a strong, constitutive promoter it could have altered the expression level of genes that are in close proximity to the himA transposon insertion site.
  • the suicide construct that was used in the present invention to knockout the himA gene in ZW801 -4 (“pHimA”) was ultimately derived from another suicide construct (“pLDHSp-9WW”) that was previously used to insertionally-inactivate the D-lactate dehydrogenase gene in Z mobilis using host-mediated, double- crossover, homologous recombination and spectinomycin resistance as a selectable marker.
  • pLDHSp-9WW was also derived from a number of other constructs that were previously generated. The initial precursor for all of these constructs was the plasmid vector pNEB193 (New England Biolabs #N3051 S) that is commercially available. This plasmid was chosen because it can replicate in E.
  • pLDH193 pNEB193 was double-digested with Sbfl and Ascl for insertion of the DNA fragment that is described below. Both restriction sites are unique and are located in the multi-cloning region of the plasmid.
  • Sbfl/Ascl-lineahzed pNEB193 plasmid DNA fragment was purified using Qiagen's QIAQuick Purification Kit (catalog #28104) according to the manufacturer's protocol.
  • the DNA insert that was cloned into pNEB193 was a 2268 bp fragment that was PCR-amplified from Z. mobilis genomic DNA that was isolated from strain ZW1 (ATCC #31821 ) using Qiagen's Blood & Cell Culture Maxi Kit (catalog #13362).
  • the synthetic oligonucleotides that were used for PCR-amplification of this fragment were Primers 1 and 2.
  • Primer 1 SEQ ID NO:4
  • the underlined bases of Primer 1 hybridize to nucleotides 1262739-1262720 of the Z. mobilis genome (GenBank accession number AE008692) at the 3'end of the open reading frame that codes for phosphoglyceromutase (pgm), while the lower case letters correspond to an Sbfl site that was added to the 5' end of the primer.
  • the underlined bases of Primer 2 (reverse primer) hybridize to nucleotides 1260490-1260472 of the Z. mobilis genome, which is just upstream from the open reading frame that codes for alcohol dehydrogenase I (adhl), while the lower case letters correspond to an Ascl site that was added to the 5' end of the primer.
  • the 2268 bp DNA fragment that was the target for PCR-amplification therefore consists of the following elements starting from the Sbfl site and ending at the Ascl site: (a) the 3' end of the pgm gene, (b) the entire ldh gene that codes for D-lactate dehydrogenase, and (c) a 5' non-translated region of the adhl gene.
  • the PCR product was cut with Sbfl and Ascl, and the resulting DNA fragment was ligated into the Sbfl/Ascl-linearized pNEB193 vector that was described above. The ligation reaction mixture was used to transform E.
  • coli JM110 and the transformed cells were plated on LB media that contained ampicillin (100 ⁇ g/ml).
  • Ampicillin- resistant tranformants that contained plasmids with the correct size insert were initially identified by PCR using resuspended colonies ("colony PCR") and Primers 1 and 2. Subsequent confirmation of positive clones came from restriction digestion analysis of plasmid DNA with Sbfl and Ascl, and DNA sequence analysis of the 2268 bp fragment that was generated by colony PCR with the ampicillin-resistant transformants.
  • the plasmid that was selected for further manipulation was named pLDH193.
  • Plasmid pLDH193 has a unique Ncol site that is located in about the middle of the ldh open reading frame. This site was used to insert a DNA fragment that confers resistance to tetracycline.
  • the tetracycline resistance cassette (Tc r -cassette) that was used for this manipulation was generated by PCR using plasmid pACYC184 (GenBank accession number X06403) as a DNA template and Primers 3 and 4 as PCR primers.
  • Primer 3 SEQ ID NO:6
  • Primer 4 (SEQ ID NO:7): ATCTCACTccatqqCCGGCCAACTAffaaftaaGAATTGATTGGCTCCAATTCTTG
  • the bold underlined bases of Primer 3 hybridize just upstream from the promoter for the tetracycline resistance gene.
  • Primer 3 also has three restriction sites (Ncol, AsiSI, and Notl) that were added to its 5' end.
  • the Ncol site is in normal lower case letters.
  • the AsiSI site is underlined with a thin line.
  • the Not I site is in italicized lower case letters.
  • the bold underlined bases of Primer 4 (reverse primer) hybridize just downstream from the stop codon for the tetracycline resistance gene, and this primer also has three restriction sites (Ncol, Fsel, and Pad) that were added to its 5' end.
  • the Ncol site is in normal lower case letters, the Fsel site is underlined with a thin line, and the Pad site is in italicized lower case letters.
  • the 1448 bp Tc r -cassette that was generated with Primers 3 and 4 was cut with Ncol and purified by preparative agarose gel electrophoresis. The resulting DNA fragment was then ligated into the unique Ncol site that is present in the ldh open reading frame of plasmid, pLDH193. To minimize the possibility of re- circularization of the vector without an insert, the Ncol-digested pNEB193 was dephosphorylated with calf intestinal alkaline phosphatase prior to ligation.
  • the ligation reaction mixture was introduced into Escherichia coli JM110 and the transformed cells were plated on LB media that contained 20 ⁇ g/ml of tetracycline. Tetracycline-resistant tranformants that contained plasmids with the correct insert were identified by restriction digest analysis with Ncol, AsiSI, Notl, Fsel, and Pad, and the orientation of the Tc r cassette was confirmed by PCR analysis using appropriate primers.
  • a circle diagram of the plasmid that was selected for further manipulation (named pLDHTc139#7) is shown in Figure 9A.
  • this suicide construct was successfully used for insertional- inactivation (to "disrupt” or “knockout") of the D-lactate dehydrogenase gene in ZW1 using host-mediated, double-crossover, homologous recombination and growth on tetracycline as the selectable marker. Construction of pLDHTd 39#7-9WW
  • pLDHTc139#7 could be used to "knockout” the D-lactate dehydrogenase gene in ZW1 , the construct was then modified so that it would be possible to remove the selectable marker from the chromosome after gene disruption, using Cre recombinase.
  • two wild type loxP sites (Lee and Saito, 1998) were added to pLDHTc139#7 taking advantage of the four unique restriction sites that flank the Tc r -cassette, namely, AsiSI and Notl at the 5' end and Pad and Fsel at the 3' end.
  • the first loxP site was inserted between the AsiSI and Notl sites of plasmid pLDHTc139#7 after cutting the construct with both enzymes and purifying the resulting large DNA fragment.
  • the loxP site that was inserted into this location was generated from two synthetic oligonucleotides (Oligos 5 and 6) that were both phosphorylated at their 5' end.
  • Oligo 5 SEQ ID NO:8: cgcATAACTTCGTATAATGTATGCTATACGAAGTTATgc
  • Oligo 6 (SEQ ID NO:9): ggccgcATAACTTCGTATAGCATACATTATACGAAGTTATgcgat
  • Oligos 5 and 6 are complimentary to each other, and when annealed together form a full-length double-stranded wild type loxP site that has single- stranded overhangs at both ends, which allow the DNA fragment to be ligated between the AsiSI and Notl sites of pLDHTc139#7.
  • the upper case letters in Oligos 5 and 6 correspond to the full-length wild type loxP site, while the lower case letters indicate the nucleotides that were used to ligate the double-stranded DNA fragment into the AsiSI and Notl sites of pLDHTc139#7.
  • the ligation reaction mixture was used to transform Escherichia coli DH10B and the transformed cells were plated on LB media that contained 20 ⁇ g/ml of tetracycline. Tetracycline-resistant tranformants that contained plasmids with the loxP site correctly inserted into the AsiSi and Notl sites of pLDHTc139#7 were identified by restriction digest analysis, colony PCR using appropriate primers, and DNA sequence analysis of the relevant regions. The plasmid that was selected for further manipulation was named pLDHTc139#7-9W.
  • loxP site was inserted between the Pad and Fsel sites at the other end of the Tc r -cassette in pLDHTd 39#7-9W, after cutting the plasmid with both enzymes and purifying the resulting large vector fragment.
  • the loxP site that was inserted into this location was also generated with two synthetic oligonucleotides (Oligos 7 and 8) that were both phosphorylated at their 5' end.
  • Oligo 7 (SEQ ID NO:10): taaATAACTTCGTATAATGTATGCTATACGAAGTTATggccgg Oligo 8 (SEQ ID NO:11 ): ccATAACTTCGTATAGCATACATTATACGAAGTTATttaat
  • Oligos 7 and 8 are complimentary to each other, and when hybridized form a full-length, double-stranded wild type loxP site that has single-stranded overhangs at both ends that allow the DNA fragment to be ligated between the Pad and Fsel sites of pLDHTc139#7-9W.
  • the upper case letters in Oligos 7 and 8 correspond to the full-length loxP site, and the lower case letters indicate the nucleotides that were used to ligate the double-stranded DNA fragment into the Pad and Fsel sites of pLDHTc139#7-9W.
  • the ligation reaction mixture was used to transform Escherichia coli DH10B and the transformed cells were plated on LB media that contained 20 ⁇ g/ml of tetracycline.
  • Tetracycline-resistant tranformants that contained plasmids with the wild type loxP site correctly inserted into the Pad and Fsel sites of pLDHTc139#7-9W were identified by restriction digest analysis, colony PCR using appropriate primers, and DNA sequence analysis of the relevant regions.
  • the plasmid that was selected for further manipulation was named pLDHTd 39#7-9WW, and a circle diagram of this construct is shown in Figure 9B.
  • pLDHSp-9WW is identical to pLDHTd 39#7-9WW, except that the tetracycline-resistance cassette in the latter construct was replaced with a DNA fragment that confers resistance to spectinomycin (i.e. a Spec r -cassette).
  • the latter was generated by PCR using plasmid pHP15578 (described in Cahoon et al, 2003) as a template and Primers 9 and 10 for PCR-amplification.
  • pHP15578 contains the complete nucleotide sequence for the Spec r cassette, including its promoter, which is based on the published sequence of the Tranposon Tn7 aadA gene (GenBank accession number X03403) that codes for 3' (9)-O- nucleotidyltransferase.
  • Primer 9 (SEQ ID NO:12): ATAAAAqc ⁇ ccqcAGCACAGGATGA
  • Primer 10 (SEQ ID NO:13): GGCGttaattaaGGCAGGTCAGCAAG
  • the underlined bases of Primer 9 hybridize just upstream from the promotor for the Spec r cassette (to nts 6-17 of GenBank accession number X03043), while the lower case letters correspond to a Notl site that was added to the 5' end of the primer.
  • the underlined bases of Primer 10 reverse primer hybridize about 130 bases downstream from the stop codon for the Spec r cassette (to nts 1006-1019 of GenBank accession number X03043), while the lower case letters correspond to a Pad site that was added to the 5' end of the primer.
  • the 1040 bp PCR-generated Spec r cassette was double-digested with Notl and Pad, and the resulting DNA fragment was purified by agarose gel electrophoresis. Plasmid pLDHTc139#7-9WW was also cut with the same two restriction enzymes to remove the Tc r -cassette, and the resulting large vector fragment was purified by agarose gel electrophoresis. The PCR and vector fragments were then ligated together, and the transformation reaction mixture was introduced into E. coli DH10B using electroporation. Transformants were plated on LB media that contained spectinomycin (200 ⁇ g/ml) and grown at 37 0 C.
  • plasmids with the correct size insert were identified by restriction digest analysis with Notl and Pad, and the plasmid that was selected for further manipulation was named pLDHSp- 9WW; a circle diagram of this construct is shown in Figure 9C.
  • pLDHSp-9WW was used to knockout the gene for D- lactate dehydrogenase in ZW1 using host-mediated, double-crossover, homologous recombination and growth on spectinomycin as the selection.
  • the double-crossover event was targeted to the ldh gene by two DNA fragments that flank the Spec r -cassette in the suicide construct.
  • One of these fragments (referred to below as 5' ldh flanking DNA) is just upstream from the Spec r - cassette and is located between the Sbfl and AsiSI sites.
  • the nucleotide sequence of this ⁇ 1100 bp DNA fragment is identical to the ZW1 chromosomal DNA that codes for the 3' end of the pgm gene and about the first half of the ldh open reading frame.
  • the other DNA fragment (referred to below as the 3' ldh flanking DNA) is located at the opposite end the Spec r -cassette between the Fsel and Ascl sites.
  • the nucleotide sequence of the 3' ldh flanking DNA (which is also ⁇ 1100 bp) is identical to the chromosomal DNA that codes for the other half of the ldh gene and part of the 5' non-translated region of the adhl gene.
  • a double-crossover event occurs when the 5' and 3' ldh flanking DNA fragments both interact with their chromosomal counterparts and undergo homologous recombination.
  • This phenomenon which is essentially irreversible and entirely mediated by the host's enzymatic machinery, inactivates the chromosomal ldh gene by inserting the Spec r -cassette that is flanked by two wild type loxP sites in the middle of the open reading frame. Since the suicide construct cannot replicate in Z mobilis, the only way to generate stable spectinomycin-resistant colonies with pLDHSp-9WW (apart from spontaneous drug resistant mutants that occur at a very low frequency) is a double-crossover event through homologous recombination.
  • the ldh flanking DNA in pLDHSp-9WW was replaced with himA flanking DNA to target the selectable marker and double-crossover event to the chromosomal himA gene.
  • Four DNA fragments were required for this manipulation as described below.
  • Fragment 1 was derived from pLDHSp-9WW (Fig. 9C) by cutting the plasmid with four different restriction enzymes: Notl, Bsal, Sbfl and Ascl. Notl cuts pLDHSp-9WW at nt 2647 and Bsal cuts the plasmid at nt 1816. After the plasmid DNA was completely digested with the four restriction enzymes, the 2666 bp Sbfl-Ascl DNA fragment was purified by electrophoresis using a 1 % agarose gel and the Zymoclean Gel DNA Recovery Kit (catalog #D4001 , Zymo Research). This fragment, named Fragment 1 , contains an E. coli origin of replication that is not functional in Z. mobilis and a gene that confers ampicillin- resistance in E. coli.
  • Fragment 2 was also derived from pLDHSp-9WW.
  • the plasmid was double-digested with Fsel and AsiSI, and the resulting 1105 bp Fsel-AsiSI DNA fragment was purified by electrophoresis using a 1 % agarose gel and the Zymoclean Gel DNA Recovery Kit (catalog #D4001 , Zymo Research) to clean up the fragment.
  • This fragment, named Fragment 2 contains the Spec r -cassette which is flanked by two wild type loxP sites, one at each end.
  • Fragment 3 contains 3' himA flanking DNA.
  • the ⁇ 1.12 Kbp Fragment 3 was generated by PCR using Primers A and B.
  • the template for PCR- amplification was genomic DNA that was isolated from ZW658 (ATCC #PTA- 7858) using the Wizard Genomic DNA Purification Kit (catalog #A1125, Promega).
  • CTACTCATcct ⁇ ca ⁇ TTTAATGAATGAGCGGATGCTG Primer B (SEQ ID NO:15): CATCTTACT ⁇ c ⁇ atc ⁇ cTGACTTTCCGTGCCAGCCAG
  • the underlined bases of Primer A hybridize to nucleotides 1137154 -1137175 of the Z. mobilis genome (GenBank accession number AE008692) that are located in the middle of a coding region for a putative member of the glutathione S-transferase family of proteins (Seo et al., Nat. Biotechnol. 23 (1 ), 63-68 (2005)) that is downstream from the himA gene, while the lower case letters correspond to an Sbfl site that was added to the 5' end of the primer.
  • the underlined bases of Primer B (reverse primer) hybridize to nucleotides 1138276 -1138257 of the Z.
  • Fragment 4 contains 5' himA flanking DNA.
  • the ⁇ 1.16 kb Fragment 4 was generated by PCR using Primers C and D.
  • the template for PCR-amplification was genomic DNA that was isolated from ZW658 (ATCC #PTA-7858) using the Wizard Genomic DNA Purification Kit (catalog #A1125, Promega).
  • Primer C SEQ ID NO:16:
  • Primer D (SEQ ID NO:17): CATCTTACT ⁇ c ⁇ c ⁇ ccGATATGCTGCCTTCCGAAGTG
  • the underlined bases of Primer C (forward primer) hybridize to nucleotides 1138510 -1138530 of the Z mobilis genome at the 5' end the of himA open reading frame, while the lower case letters correspond to an Fsel site that was added to the 5' end of the primer.
  • the underlined bases of Primer D (reverse primer) hybridize to nucleotides 1139668-1139648 of the Z.
  • the four DNA fragments described above were then subjected to a 4-way ligation reaction to assemble the himA knockout construct, pHimA shown in Figure 10B.
  • the molar ratio of Fragments 1 -4 that was used for this reaction was approximately 1 :1 :1 :1.
  • An aliquot of the ligation reaction mixture was electroporated into E. coli DH10B and the transformed cells were plated on LB media that that contained ampicillin (100 ⁇ g/ml) and spectinomycin (100 ⁇ g/ml); the plates were incubated at 37 0 C.
  • Ampicillin and spectinomycin double resistant tranformants that contained plasmids with the correct size inserts were initially identified by colony PCR using two different pairs of primers: Primer A/Primer B, and Primer C/Phmer D. Subsequent confirmation of positive clones came from restriction digestion analysis of plasmid DNA with Sbfl and Ascl, and DNA sequence analysis of the pHimA plasmid DNA from the PCR positive clones.
  • non-methylated plasmid DNA needed for transformation of Z. mobilis pHimA was introduced into E. coli SCS110 (dcnrT, dam " ), and the transformed cells were plated on LB media that contained ampicillin (100 ⁇ g/ml) and spectinomycin (100 ⁇ g/ml); growth was at 37 0 C.
  • the chemically competent cells that were used for this manipulation were obtained from Stratagene (Cat. No. 200247) and the vendor's protocol was followed. It is important to note that the use of non-methylated plasmid DNA for transformation of Z. mobilis stains that are derived from ZM4 is critical for success, since methylated plasmid DNA that is isolated from wild type strains of E.
  • coli like DH10B, is readily destroyed by the host's restriction/modification system.
  • plasmid DNA was isolated from one of the SCS110 transformants using the QIAGEN Plasmid Maxi Kit (Cat. No. 12162), and the final concentration of DNA was ⁇ 2 ⁇ g/ ⁇ l.
  • the non-methylated pHimA plasmid DNA (which does not replicate in Z. mobilis) was introduced into ZW801 - 4 using electroporation, essentially as described in US 5,514,583. Briefly, the 50 ⁇ l transformation reactions contained ⁇ 10 10 cells/ml in 10% (v/v) glycerol and -0.5 ⁇ g of non-methylated plasmid DNA that was isolated from E. coli SSC110 as described in Example 5. The control reaction was treated identically, but did not receive any plasmid DNA.
  • the settings for the electroporator were 1.6 kv/cm, 200 ⁇ , and 25 ⁇ F, and the gap width of the cuvette was 0.1 cm.
  • the transformation reactions were diluted with 1.0 ml of MMG media (50 g/L glucose, 10 g/L yeast extract, 5 g/L of tryptone, 2.5 g/L of (NH 4 ) 2 SO 4 , 0.2 g/L K 2 HPO 4 , and 1 mM MgSO 4 ) and the cells were allowed to recover for ⁇ 3 hours at 3O 0 C.
  • MMG media 50 g/L glucose, 10 g/L yeast extract, 5 g/L of tryptone, 2.5 g/L of (NH 4 ) 2 SO 4 , 0.2 g/L K 2 HPO 4 , and 1 mM MgSO 4
  • the cells were then harvested by centhfugation at room temperature (13, 000 X g, 5 min) in sterile 1.5 ml microfuge tubes and the supernatant was carefully removed.
  • Cell pellets were resupended in 200 Dl of liquid MMG media, and 25-, 50- and 100 ⁇ l aliquots of the cell suspension were plated on MMG media that contained 1.5% agar and 200 ⁇ g/ml of spectinomycin.
  • the plates were incubated in an anaerobic chamber at 3O 0 C, and after 48-72 hrs there were at least 100 colonies on all of the experimental plates. In contrast, the control reaction only yielded one colony which was on the plate that received 100 ⁇ l of the cell suspension.
  • the two primary transformants that were described above were patched onto an MMG plate that contained 200 ⁇ g/ml of spectinomycin. After a 30-hr incubation period at 33 0 C under anaerobic conditions, single colonies were isolated from both patches by streaking the cells onto fresh agar plates that contained the same growth media.
  • the second pair of primers GATATTCCAGTGCTGATCGAC (SEQ ID NO: 20) and CTACGTGAAAGGCGAGATCAC (SEQ ID NO: 21 ), could only generate a PCR product of the correct size if the 3' himA flanking DNA in the suicide construct had undergone a single-crossover event with its chromosomal counterpart.
  • the third pair of primers GATCAGGTAGGTGTGCTCTA (SEQ ID NO: 22) and GCATCAGAGAGCATACTGCT (SEQ ID NO: 23), could only generate a PCR product of the correct size if a double-crossover event had occurred at the correct locus.
  • This pair of primers was also able to detect trace amounts of non-disrupted copies of the himA gene and/or single-crossover events if they were also present as contaminants. Since both of the himA knockout mutants that were examined yielded the expected results with three different sets of primers and appeared to be indistinguishable, only one of them was selected for further characterization. This strain is referred to below as "Z801 -4:: ⁇ himA”.
  • Example 7 Inactivation of the himA gene is solely responsible for the AcR#3 phenotype
  • FIG. 11 A side-by-side comparison of ZW801 -4 and ZW801-4:: ⁇ himA in 100% MH using pH-controlled bioreactors is shown in Fig. 11.
  • the seed cultures were grown at 3O 0 C in SM media to an OD 6 oo of -4.4 and the bioreactors were started with a 10% inoculum.
  • the final 150 ml cultures contained 100% MH plus 110 g/L glucose and 90 g/L xylose.
  • the stirrer was set at 150 rpm, and pH and temperature were maintained at 5.8 and 33 0 C, respectively.
  • aliquots were removed from the bioreactors for HPLC analysis of the fermentation broth using the procedure that is described in Example 2. Note that these are the exact same experimental conditions that were used for the experiments with AcR#3 and ZW801 -4 that are shown in Figure 8 and Table 2 (Example 4).
  • Seed cultures were grown at 3O 0 C in SM media to an OD 6 oo of 4.5 and the bioreactors were started with a 10% inoculum.
  • the final 150-ml cultures contained 100% MH plus 118 g/L glucose and 98 g/L xylose.
  • the stirrer was set at 150 rpm, and pH and temperature were maintained at 5.8 and 33 0 C, respectively.
  • aliquots were removed from the bioreactors for HPLC analysis of the fermentation broth using the procedure that is described in Example 2.
  • the final values for glucose, xylose, acetate, ethanol and biomass production (OD 6 oo) for both strains are shown in Table 3.

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
PCT/US2008/081694 2007-10-30 2008-10-30 Process for the production of ethanol from a medium comprising xylose, employing a recombinant zymomonas strain having a reduced hima expression Ceased WO2009058938A2 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP08843461A EP2205753B1 (en) 2007-10-30 2008-10-30 Process for the production of ethanol in a medium comprising xylose employing a recombinant zymomonas strain with reduced hima expression
CA2704539A CA2704539C (en) 2007-10-30 2008-10-30 Zymomonas with improved ethanol production in medium containing concentrated sugars and acetate
AU2008318720A AU2008318720B2 (en) 2007-10-30 2008-10-30 Process for the production of ethanol from a medium comprising xylose, employing a recombinant zymomonas strain having a reduced himA expression
BRPI0817152A BRPI0817152A8 (pt) 2007-10-30 2008-10-30 processo para a produção de etanol
JP2010532229A JP2011515067A (ja) 2007-10-30 2008-10-30 himA発現の減少した組み換えザイモモナス株を使用する、キシロースを含む培地からエタノールを産生する方法
CN2008801137733A CN101883861B (zh) 2007-10-30 2008-10-30 利用hima表达减少的重组发酵单胞菌属菌株从包含木糖的培养基生产乙醇的方法
DE602008006446T DE602008006446D1 (de) 2007-10-30 2008-10-30 Verfahren zur herstellung von etahnol in einem xylose enthaltenden medium unter verwendung eines rekombinanten zymomonas stammes mit reduzierter hima expression
AT08843461T ATE506447T1 (de) 2007-10-30 2008-10-30 Verfahren zur herstellung von etahnol in einem xylose enthaltenden medium unter verwendung eines rekombinanten zymomonas stammes mit reduzierter hima expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US98376107P 2007-10-30 2007-10-30
US60/983,761 2007-10-30

Publications (2)

Publication Number Publication Date
WO2009058938A2 true WO2009058938A2 (en) 2009-05-07
WO2009058938A3 WO2009058938A3 (en) 2009-06-18

Family

ID=40551263

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/081694 Ceased WO2009058938A2 (en) 2007-10-30 2008-10-30 Process for the production of ethanol from a medium comprising xylose, employing a recombinant zymomonas strain having a reduced hima expression

Country Status (11)

Country Link
US (1) US7897396B2 (cg-RX-API-DMAC7.html)
EP (1) EP2205753B1 (cg-RX-API-DMAC7.html)
JP (1) JP2011515067A (cg-RX-API-DMAC7.html)
CN (1) CN101883861B (cg-RX-API-DMAC7.html)
AT (1) ATE506447T1 (cg-RX-API-DMAC7.html)
AU (1) AU2008318720B2 (cg-RX-API-DMAC7.html)
BR (1) BRPI0817152A8 (cg-RX-API-DMAC7.html)
CA (1) CA2704539C (cg-RX-API-DMAC7.html)
DE (1) DE602008006446D1 (cg-RX-API-DMAC7.html)
ES (1) ES2361385T3 (cg-RX-API-DMAC7.html)
WO (1) WO2009058938A2 (cg-RX-API-DMAC7.html)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013096366A1 (en) * 2011-12-20 2013-06-27 E. I. Du Pont De Nemours And Company Gene inactivation allowing immediate growth on xylose medium by engineered zymomonas

Families Citing this family (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8247208B2 (en) * 2008-12-22 2012-08-21 Alliance For Sustainable Energy Llc Zymomonas with improved xylose utilization in stress conditions
US20110143408A1 (en) * 2009-06-18 2011-06-16 E. I. Du Pont De Nemours And Company Zymomonas with improved arabinose utilization
US8647850B2 (en) 2009-12-23 2014-02-11 E I Du Pont De Nemours And Company Process for simultaneous saccharification and fermentation for production of ethanol
CN102947457B (zh) 2010-06-18 2016-12-21 布特马斯先进生物燃料有限责任公司 用于在丁醇生产中的提取发酵之前移除不溶解固体的方法和体系
BR112012032172A2 (pt) 2010-06-18 2015-11-24 Butamax Tm Advanced Biofuels método para produzir um álcool e composição
US9040263B2 (en) 2010-07-28 2015-05-26 Butamax Advanced Biofuels Llc Production of alcohol esters and in situ product removal during alcohol fermentation
US8679822B2 (en) 2010-06-29 2014-03-25 E I Du Pont De Nemours And Company Xylose utilization in recombinant zymomonas
IL207945A0 (en) 2010-09-02 2010-12-30 Robert Jansen Method for the production of carbohydrates
US8476048B2 (en) 2010-12-17 2013-07-02 E I Du Pont De Nemours And Company Xylose utilizing zymomonas mobilis with improved ethanol production in biomass hydrolysate medium
US20130040340A1 (en) 2011-02-07 2013-02-14 E. I. Du Pont De Nemours And Company Production of alcohol esters in situ using alcohols and fatty acids produced by microorganisms
US8765425B2 (en) 2011-03-23 2014-07-01 Butamax Advanced Biofuels Llc In situ expression of lipase for enzymatic production of alcohol esters during fermentation
US8759044B2 (en) 2011-03-23 2014-06-24 Butamax Advanced Biofuels Llc In situ expression of lipase for enzymatic production of alcohol esters during fermentation
US8765426B2 (en) 2011-04-07 2014-07-01 E I Du Pont De Nemours And Company Pantothenic acid biosynthesis in zymomonas
CA2837722A1 (en) 2011-06-17 2012-12-20 Butamax Advanced Biofuels Llc Co-products from biofuel production processes and methods of making
JP2015501643A (ja) 2011-12-09 2015-01-19 ビュータマックス・アドバンスド・バイオフューエルズ・エルエルシー 発酵ブロスから生成物アルコールを取り出す方法
EP2844730A1 (en) 2012-05-04 2015-03-11 Butamax Advanced Biofuels LLC Processes and systems for alcohol production and recovery
US8759069B2 (en) 2012-06-15 2014-06-24 E I Du Pont De Nemours And Company Contaminant control in Zymomonas fermentation using hop acids
US8697426B2 (en) 2012-06-15 2014-04-15 E I Du Pont De Nemours And Company Contaminant control in Zymomonas fermentation using virginiamycin
US20140024064A1 (en) 2012-07-23 2014-01-23 Butamax(Tm) Advanced Biofuels Llc Processes and systems for the production of fermentative alcohols
BR112015005439A8 (pt) 2012-09-12 2022-01-11 Butamax Advanced Biofuels Llc Método para recuperar um produto alcoólico de um caldo de fermentação e sistema
BR112015006296A2 (pt) 2012-09-21 2017-07-04 Butamax Advanced Biofuels Llc ''processo, composição bifásica, métodos para a manutenção do estado oxidativo de uma composição, para otimizar a extração do butanol, para aprimorar o rendimento de uma fermetanção de isobutanol, para aprimorar o título de isobutanol produzido durante a fermentação e para aprimorar a taxa de produção de isobutanol durante uma fermentação''
BR112015008077A2 (pt) 2012-10-11 2017-12-05 Butamax Advanced Biofuels Llc métodos para a produção de um produto de fermentação
WO2014081848A1 (en) 2012-11-20 2014-05-30 Butamax Advanced Biofuels Llc Butanol purification
US8846357B2 (en) 2012-12-20 2014-09-30 E I Du Pont De Nemours And Company Stabilized chlorine dioxide for contamination control in Zymomonas fermentation
US20160002131A1 (en) 2013-02-21 2016-01-07 Butamax Advanced Biofuels Llc Vapor recompression
US20140273105A1 (en) 2013-03-12 2014-09-18 E I Du Pont De Nemours And Company Gradient pretreatment of lignocellulosic biomass
US9523104B2 (en) 2013-03-12 2016-12-20 Butamax Advanced Biofuels Llc Processes and systems for the production of alcohols
US9441250B2 (en) 2013-03-14 2016-09-13 Butamax Advanced Biofuels Llc Glycerol 3- phosphate dehydrogenase for butanol production
US9156760B2 (en) 2013-03-15 2015-10-13 Butamax Advanced Biofuels Llc Method for production of butanol using extractive fermentation
WO2014151645A1 (en) 2013-03-15 2014-09-25 Butamax Advanced Biofuels Llc Process for maximizing biomass growth and butanol yield by feedback control
WO2014144643A1 (en) 2013-03-15 2014-09-18 Butamax Advanced Biofuels Llc Method for producing butanol using extractive fermentation
US9206445B2 (en) 2013-04-29 2015-12-08 Alliance For Sustainable Energy, Llc Biocatalysts with enhanced inhibitor tolerance
WO2015002913A1 (en) 2013-07-03 2015-01-08 Butamax Advanced Biofuels Llc Partial adaptation for butanol production
US20150087040A1 (en) 2013-09-26 2015-03-26 E I Du Pont De Nemours And Company Production of ethanol and recycle water in a cellulosic fermentation process
US20150087041A1 (en) 2013-09-26 2015-03-26 E I Du Pont De Nemours And Company Production of ethanol with reduced contaminants in a cellulosic biomass based process
US10227623B2 (en) 2013-11-24 2019-03-12 E I Du Pont De Nemours And Company High force and high stress destructuring of cellulosic biomass
EP3397772A1 (en) 2015-12-28 2018-11-07 Danisco US Inc. Methods for the production of fermentation products from feedstock

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5514583A (en) 1994-04-15 1996-05-07 Midwest Research Institute Recombinant zymomonas for pentose fermentation
US6566107B1 (en) 2000-11-01 2003-05-20 Midwest Research Institute Recombinant Zymomonas mobilis with improved xylose utilization
US20030162271A1 (en) 2000-05-01 2003-08-28 Min Zhang Zymomonas pentose-sugar fermenting strains and uses thereof
US20080081358A1 (en) 2006-09-28 2008-04-03 Viitanen Paul V Ethanol production in fermentation of mixed sugars containing xylose
US20080187973A1 (en) 2006-09-28 2008-08-07 Viitanen Paul V Ethanol production using xylitol synthesis mutant of xylose-utilizing zymomonas

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5231020A (en) 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
US5789210A (en) * 1993-11-08 1998-08-04 Purdue Research Foundation Recombinant yeasts for effective fermentation of glucose and xylose
AU2388295A (en) 1994-04-15 1995-11-10 Midwest Research Institute Recombinant zymomonas for pentose fermentation
US5712133A (en) 1994-04-15 1998-01-27 Midwest Research Institute Pentose fermentation by recombinant zymomonas
US5843760A (en) 1994-04-15 1998-12-01 Midwest Research Institute Single zymomonas mobilis strain for xylose and arabinose fermentation
IN191596B (cg-RX-API-DMAC7.html) * 1996-05-06 2003-12-06 Purdue Research Foundation
WO2001083786A2 (en) * 2000-05-01 2001-11-08 Midwest Research Institute Stable zymomonas mobilis xylose and arabinose fermenting strains
US20040231060A1 (en) 2003-03-07 2004-11-25 Athenix Corporation Methods to enhance the activity of lignocellulose-degrading enzymes
CA2603774C (en) * 2005-04-12 2015-11-17 E.I. Du Pont De Nemours And Company System and process for biomass treatment

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5514583A (en) 1994-04-15 1996-05-07 Midwest Research Institute Recombinant zymomonas for pentose fermentation
US20030162271A1 (en) 2000-05-01 2003-08-28 Min Zhang Zymomonas pentose-sugar fermenting strains and uses thereof
US6566107B1 (en) 2000-11-01 2003-05-20 Midwest Research Institute Recombinant Zymomonas mobilis with improved xylose utilization
US20080081358A1 (en) 2006-09-28 2008-04-03 Viitanen Paul V Ethanol production in fermentation of mixed sugars containing xylose
US20080187973A1 (en) 2006-09-28 2008-08-07 Viitanen Paul V Ethanol production using xylitol synthesis mutant of xylose-utilizing zymomonas

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013096366A1 (en) * 2011-12-20 2013-06-27 E. I. Du Pont De Nemours And Company Gene inactivation allowing immediate growth on xylose medium by engineered zymomonas
CN104220590A (zh) * 2011-12-20 2014-12-17 纳幕尔杜邦公司 使得工程化的发酵单胞菌在木糖培养基上立即生长的基因失活

Also Published As

Publication number Publication date
CN101883861B (zh) 2013-12-11
WO2009058938A3 (en) 2009-06-18
ATE506447T1 (de) 2011-05-15
CA2704539C (en) 2014-12-23
CA2704539A1 (en) 2009-05-07
ES2361385T3 (es) 2011-06-16
JP2011515067A (ja) 2011-05-19
AU2008318720B2 (en) 2013-09-26
EP2205753B1 (en) 2011-04-20
EP2205753A2 (en) 2010-07-14
DE602008006446D1 (de) 2011-06-01
US20090203099A1 (en) 2009-08-13
BRPI0817152A8 (pt) 2018-12-11
US7897396B2 (en) 2011-03-01
AU2008318720A1 (en) 2009-05-07
CN101883861A (zh) 2010-11-10
BRPI0817152A2 (pt) 2015-11-24

Similar Documents

Publication Publication Date Title
US7897396B2 (en) Zymomonas with improved ethanol production in medium containing concentrated sugars and acetate
CA2704532C (en) Zymomonas with improved ethanol production in medium containing concentrated sugars and acetate
CA2661512C (en) Xylitol synthesis mutant of xylose-utilizing zymomonas for ethanol production
EP2066797B1 (en) Ethanol production using xylitol synthesis mutant of xylose-utilizing zymomonas
AU2012364733B2 (en) Pnp gene modification for improved xylose utilization in Zymomonas
EP2794862B1 (en) Gene inactivation allowing immediate growth on xylose medium by engineered zymomonas

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200880113773.3

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08843461

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2008318720

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2547/DELNP/2010

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2008318720

Country of ref document: AU

Date of ref document: 20081030

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2010532229

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2704539

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2008843461

Country of ref document: EP

ENP Entry into the national phase

Ref document number: PI0817152

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20100430