WO2009058440A2 - Lantibiotics from bifidobacterium longum and uses thereof - Google Patents

Lantibiotics from bifidobacterium longum and uses thereof Download PDF

Info

Publication number
WO2009058440A2
WO2009058440A2 PCT/US2008/070511 US2008070511W WO2009058440A2 WO 2009058440 A2 WO2009058440 A2 WO 2009058440A2 US 2008070511 W US2008070511 W US 2008070511W WO 2009058440 A2 WO2009058440 A2 WO 2009058440A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
lantibiotic
amino acid
microbe
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2008/070511
Other languages
English (en)
French (fr)
Other versions
WO2009058440A3 (en
Inventor
Daniel J. O'sullivan
Ju-Hoon Lee
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Minnesota Twin Cities
University of Minnesota System
Original Assignee
University of Minnesota Twin Cities
University of Minnesota System
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Minnesota Twin Cities, University of Minnesota System filed Critical University of Minnesota Twin Cities
Priority to CA2693307A priority Critical patent/CA2693307A1/en
Priority to NZ582529A priority patent/NZ582529A/en
Priority to EP08845118.2A priority patent/EP2176284B1/en
Priority to DK08845118.2T priority patent/DK2176284T3/da
Priority to JP2010517194A priority patent/JP2010534063A/ja
Priority to AU2008319177A priority patent/AU2008319177B2/en
Publication of WO2009058440A2 publication Critical patent/WO2009058440A2/en
Publication of WO2009058440A3 publication Critical patent/WO2009058440A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/50Isolated enzymes; Isolated proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • Bacteriocins are peptide based antimicrobial compounds produced by many types of bacteria and are inhibitory to closely related bacteria. Frequently, the inhibitory spectrum is within the genus of the producing bacterium.
  • a lantibiotic is a type of bacteriocin that has a wide inhibitory spectrum and is also post-translationly modified. Specifically, modification enzymes modify some amino acids into lantionine residues.
  • Nisin which is produced by certain strains of the lactic acid bacterium Lactococcus lactis, is a lantibiotic with the widest inhibitory spectrum of any lantibiotic described todate that extends to most gram positive bacteria. Given its broad spectrum it is widely used as a preservative and a shelf life extender. Unfortunately, spoilage and pathogenic bacteria are not just gram positive. Many pathogens, such as E. coli and Salmonella are gram negative and many spoilage bacteria are also gram negative, such as Pseudomonas and Klebsiella.
  • the present invention provides a lantibiotic, entitled bisin, from a probiotic culture of Bifidobacterium longum that inhibits both gram positive and gram negative bacteria.
  • This is the first bacteriocin described to date to have natural inhibitory action against both gram positive and gram negative bacteria. It therefore has potential to be an effective shelf life extender in dairy products, given that the enzymatic activities of gram negative bacteria, particularly Pseudomonas, are responsible for a lot of defects.
  • the present invention provides an isolated biologically active compound that includes an amino acid sequence, wherein the amino acid sequence of the compound and the amino acid sequence of SEQ ID NO:21 or SEQ ID NO:22 have at least 80% identity.
  • the polypeptide sequence may include at least one conservative substitution of the amino acid sequence of SEQ ID NO:21 or SEQ ID NO:22.
  • the compound has the characteristic of inhibiting growth of a Gram negative microbe in conditions that do not damage the outer membrane of the Gram negative microbe.
  • the Gram negative may be an E. coli, a Serr ⁇ ti ⁇ proteus, or a Salmonella spp. In some aspects it is preferably not a P. aeruginaosa.
  • the compound inhibits growth of a Gram positive microbe, such as a Lactobacillus spp., Lactococcus spp., a Streptococcus spp., a Staphylococcus spp., or a Bacillus spp.
  • the compound may be produced by a Bifidobacterium.
  • the present invention also includes a composition having the isolated biologically active compound and a food product, and a composition having the isolated biologically active compound and a pharmaceutically acceptable carrier.
  • the present invention also provides an isolated polynucleotide including: (a) a nucleotide sequence encoding a polypeptide, wherein the amino acid sequence of the polypeptide and the amino acid sequence of SEQ ID NO:21 or SEQ ID NO:22 have at least 80% identity, or (b) the full complement of the nucleotide sequence of (a).
  • the isolated polynucleotide may be operably linked to a heterologous regulatory sequence.
  • the present invention also provides a vector containing the isolated polynucleotide, and a cell containing the isolated polynucleotide.
  • the present invention further provides isolated lantibiotic, wherein the lantibiotic inhibits growth of a Gram negative microbe in conditions that do not damage the outer membrane of the Gram negative microbe.
  • the lantibiotic may include an amino acid sequence, wherein the amino acid sequence of the compound and the amino acid sequence of SEQ ID NO:21 or SEQ ID NO:22 have at least 80% identity.
  • the Gram negative may be an E. coli, a Serratia proteus, or a Salmonella spp. In some aspects it is preferably not a P. aeruginaosa.
  • the present invention provides a composition with a lantibiotic and a food product, wherein the lantibiotic has the characteristic of inhibiting growth of a Gram negative microbe in conditions that do not damage the outer membrane of the Gram negative microbe.
  • the lantibiotic may be present on the surface of the food product, in the food product, or the combination.
  • the lantibiotic may include an amino acid sequence, wherein the amino acid sequence of the lantibiotic and the amino acid sequence of SEQ ID NO:21 or SEQ ID NO:22 have at least 80% identity.
  • the Gram negative may be an E. coli, a Serratia protens, or a Salmonella spp.
  • the present invention provides a composition with a lantibiotic and a pharmaceutically acceptable carrier, wherein the lantibiotic includes the characteristic of inhibiting growth of a Gram negative microbe in conditions that do not damage the outer membrane of the Gram negative microbe.
  • the lantibiotic may include an amino acid sequence, wherein the amino acid sequence of the lantibiotic and the amino acid sequence of SEQ ID NO:21 or SEQ ID NO:22 have at least 80% identity.
  • the Gram negative may be an E. coli, a Serratia proteus, or a Salmonella spp.
  • the present invention also provides methods for producing the compounds described herein.
  • the methods may include growing an isolated Bifidobacterium under conditions suitable for producing a lantibiotic, wherein the Bifidobacterium produces a lantibiotic.
  • the method may further include isolating the lantibiotic.
  • the growing may include growing the Bifidobacterium, preferably B. longum, on a surface.
  • the present invention also includes a lantibiotic produced by the method.
  • Method for producing a lantibiotic may include growing a microbe that includes a polynucleotide encoding a polypeptide, wherein the amino acid sequence of the polypeptide and the amino acid sequence of SEQ ID NO:21 or SEQ ID NO:22 have at least 80% identity, wherein the microbe is grown under conditions suitable for producing the polypeptide, and wherein the microbe produces the polypeptide.
  • the microbe may further include a polynucleotide encoding a polypeptide selected from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, or a combination thereof.
  • the growing may include growing the Bifidobacterium, preferably B. longum, on a surface.
  • the present invention also includes a polypeptide produced by the method.
  • the method may further include isolating the polypeptide, for instance by extraction with a composition that includes an alcohol, such as methanol.
  • a method may include adding the lantibiotic to a food product, wherein the lantibiotic includes the characteristic of inhibiting growth of a Gram negative microbe in conditions that do not damage the outer membrane of the Gram negative microbe.
  • the method may include applying the lantibiotic to the surface of the food product, for instance, by bringing a surface of a casing, film, or packaging material comprising the lantibiotic into contact with the food product.
  • the adding may include adding the lantibiotic to the food product.
  • the lantibiotic may act as a food preservative.
  • the present invention provides a dentifrice, such as a mouthwash or a toothpaste, that includes a biologically active compound with an amino acid sequence, wherein the amino acid sequence of the compound and the amino acid sequence of SEQ ID NO:21 or SEQ ID NO:22 have at least 80% identity, wherein the compound has the characteristic of inhibiting growth of a Gram negative microbe in conditions that do not damage the outer membrane of the Gram negative microbe.
  • Also provided by the present invention is a method for using a lantibiotic that includes administering a composition with the lantibiotic to an animal, such as a human, wherein the subject has or is at risk of an infection by a microbe that is inhibited by the lantibiotic, and wherein the lantibiotic has the characteristic of inhibiting growth of a Gram negative microbe in conditions that do not damage the outer membrane of the Gram negative microbe.
  • the composition may include a pharmaceutically acceptable carrier, and the composition may be administered topically.
  • the present invention also provides isolated biologically active polypeptides, wherein the amino acid sequence of the polypeptide and the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, or SEQ ID NO: 16, have at least 80% identity. Also included in the invention are isolated polynucleotides encoding the polypeptides.
  • the present invention further provides a Bifibobacterium that produces a lantibiotic.
  • the lantibiotic has the characteristic of inhibiting growth of a Gram negative microbe in conditions that do not damage the outer membrane of the Gram negative microbe.
  • the Gram negative may be an E. coli, a Serratia proteus, or a Salmonella spp.
  • the Bifidobacterium may be encapsulated or in tablet form, for instance, and may be present in a food product.
  • the present invention also provides method that includes administering a Bifidobacterium to an animal in need thereof, wherein the Bifidobacterium will produce a lantibiotic that has the characteristic of inhibiting growth of a Gram negative microbe in conditions that do not damage the outer membrane of the Gram negative microbe.
  • the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
  • FIGURES Figure 1 Organization of mobile integrase cassettes (MIC) in B. longum
  • DJOlOA (A) and NCC2705, (B). Orfs 1, 2 and 3 refer to three contiguous, but different xerC integrase genes.
  • P a conserved 20 bp palindrome (TTAAACCGACATCGGTTTAA (SEQ ID NO:24), which has an 11 bp extension in MIC III.
  • IR 96 bp inverted repeat
  • IR 96 bp inverted repeat
  • A Base deviation index (BDI) analysis of the B. longum DJOlOA and NCC2705 genomes. Unique regions of each genome as defined in the text are numbered. The locations of oriC and terC are indicated by green arrows.
  • Letters refer to predicted gene phenotypes from regions with definitive BDI peaks that are present in both genomes, a, GTPase, b, cation transport ATPase, c, DNA partitioning protein, d, choloylglycine hydrolase, e, glutamine synthase beta chain, f, alanyl-tRNA synthetase, g, pyruvate kinase, h, cation transport ATPase, I, fibronectin type III, j, aminopeptidase C, k, subtilisin- like serine protease, 1, sortase, m, fatty acid synthase.
  • B Organization of the unique region 1 showing the location of a 361 bp DNA remnant, indicated by the green bar, from the ushA gene remaining at the predicted deletion location in
  • FIG. 3 Comparsion of oligosaccharide utilization gene cluster 7 between two B. longum genomes.
  • DJOlOA-unique genes in unique region 10 are colored dark grey, ISL3-type IS element is colored black and other matched genes are colored white.
  • galA ⁇ -galactosidase
  • lad Lacl-type repressor
  • malEFG ABC-type transport system;
  • ISL3, ISL3-type IS element agll, glycosidase; UvA, threonine dehydratase; SIR2, NAD-dependent protein deacetylase; glyH, glycosyl hydrolase; hyp, hypothetical protein.
  • B Comparison of arsenic resistance activity in B. longum DJOlOA with fermentation adapted B. animalis subsp. lactis strains, E. coli and Lactobacillus plantarum. c, calculated from data presented in van Kranenburg et al., (van Kranenburg et al,. 2005, Appl Environ Microbiol 2005, 71 :1223-1230).
  • FIG. 6 Lantibiotic prodiction by B. longum DJOlOA.
  • A Organization of the lantibiotic encoding unique region 12 of B. longum DJOlOA and the corresponding genome locations in strains NCC2705 and DJOlOA-JHl .
  • the A or B designator following IS30 refer to unique classes of IS30 elements that are only found at this location in the genome. The ' designator indicates a fragmented IS30 element.
  • B Pulsed Field Gel Electrophoresis (PFGE) analysis of Xbal-digested total DNA from B. longum DJOlOA and its fermentation adapted isolate, DJOlOA- JHl. White arrows indicate bands missing from strain DJOlOA-JHl.
  • C Bioassay for lantibiotic production by B. longum DJOlOA with strains DJOlOA and DJOlOA- JHl as indicator bacteria.
  • FIG. 7 IS30 'jumping' in the genome of B. longum DJOlOA.
  • A Genome positioning of the IS30 elements in the genome of B. longum DJOlOA and the laboratory adapted strain DJOlOA-JHl .
  • the gray arrows indicate the five elements identified by direct sequencing of DJOlOA genomic DNA.
  • the white arrows indicate the location of elements that were detected in some sequencing clones prepared from DJOlOA genomic DNA.
  • the asterisk under A6 indicates this element was missing from some sequencing clones of DJOlOA DNA.
  • B Nrul digested genomic DNA from DJOlOA shown in the left gel and its Southern hybridization (right gel) using probes specific for four different IS element families. (1) refers to DJOlOA and (2) refers to DJOlOA-JHl . Arrows indicate bands in DJOlOA corresponding to specific IS30 elements as illustrated in (A).
  • Figure 8 Simulated fecal competitive analysis of B. longum DJOlOA and its in vitro adapted derivative, strain DJOlOA-JHl, against Clostridium difficile and E. coli.
  • A Viable cell counts of E. coli DJOecl at the beginning of the competitive study (black), following competition with B. longum DJOlOA-JHl (horizontal lines) and B. longum DJOlOA (hatched).
  • B Viable cell counts of C. difficile DJOcdl at the beginning of the competitive study (black), following competition with B. longum DJOl OA-JHl (horizontal lines) and B. longum DJOlOA (hatched).
  • N 3.
  • Figure 9 conserved structure of the oriC region. This consists of three clusters, in the two B. longum genomes.
  • the DnaA boxes consist of 7 types, designated A to G as follows: Type A (TTATCCACA), Type B (TTGTCCACA), Type C (TTTTCCACA), Type D (TTACCCACA), Type E (TTATCCACC), Type F (TTATTCACA), Type G (TTATGCACA).
  • FIG. 1 Type I and II restriction modification (R-M) systems encoded by the B. longum genomes.
  • A Alignment of the genomic locations encoding a type I R-M system between B. longum DJOlO and NCC2705.
  • B Comparison of a Sau3AI-type II R-M system (recognition site, 5'-GATC-3') with analogous R-M systems in other bacteria and
  • C Comparison of a EcoRII-type II R-M system (recognition site, 5'-CCWGG-3') with analogous R-M systems in other bacteria. Percentage protein sequence identities compared to B. longum DJOlOA are indicated.
  • Figure 11 Organization of the 11 different types of oligosaccharide utilization gene clusters (11 in DJOlOA and 7 in NCC2705). Unique genes of strain DJOlOA are indicated. IS, insertion sequence; Hyp, hypothetical protein; Arab, arabinosidase; E, malE; F, malF; G,malG; R, lacl-type repressor; K, ATPase of ABC transporter; ⁇ Gal, ⁇ -galactosidase; ⁇ Xyl, ⁇ -xylosidase; Est, esterase; LCFACS, long-chain fatty acid acetyl CoA synthetase; f, fragmented gene; XyIT, D-xylose proton symporter; ⁇ Gal, ⁇ -galactosidase; Arab- ⁇ Gal, arabinogalactan endo-l,4- ⁇ - galactosidase; 0157, ORF with homolog only in E.
  • IS
  • glycosyl hydrolase gene in cluster 7 is a group consisting of: ⁇ Man, ⁇ - mannosidase; GlycH, glycosyl hydrolase; NAc-GIc, N-acetyl glucosaminidase; UhpB, histidine kinase; RfbA, dTDP-glucose pyrophosphorylase; RfbB, dTDP-D- glucose 4,6-dehydratase; RfbC, dTDP-4-dehydrorhamnose 3,5-epimerase; RgpF, lipopolysaccharide biosynthesis protein; TagG, ABC-type polysaccharide/polyol phosphate export systems, permease component; TagH, ABC-type polysaccharide/polyol phosphate transport system, ATPase component; MdoB, phosphoglycerol transferase; ProP, permease; Acyl-Est, acyl esterase. It should
  • Figure 12 Nucleotide substitution analysis of all gene homologs between B. longum DJOlOA and NCC2705, according to the dN:dS ratio.
  • Figure 13 Organization of four predicted LPXTG-type, cell surface anchor proteins in B. longum DJOlOA. The numbers below the signal peptide boxes indicate the location of signal peptides. The size of the respective proteins is indicated in amino acids.
  • Figure 14 Loss of the lantibiotic gene cluster from B. longum DJOlOA-JHl .
  • A Detection of DJOlOA specific gene clusters in B. longum DJOlOA and its fermentation adapted isolate DJOlOA-JHl by PCR.
  • M 1 kb DNA ladder (Invitrogen); lane 1, unique region 15; lane 2, unique region 6; lane 3, unique region 9; lane 4, unique region 1 1 ; lane 5, unique region 5; lane 6, unique region 7; lane 7, unique region 12; lane 8, 16S rRNA partial gene.
  • the arrow indicates the lantibiotic encoded unique region 12 that is missing from strain DJOlOA-JHl .
  • Figure 15 Growth curves in RCM medium of the four bacteria used in the fecal competitive growth experiments. All bacteria were inoculated at 1 % from freshly grown cultures. Squares, E. coli DJOecl ; triangles, Clostridium difficile DJOcdl ; circles, B. longum DJOlOA-JHl ; and diamonds, B. longum DJOlOA.
  • FIG. 16 Portion of genomic sequence of B. longum DJOlOA (Genbank Accession No. CP000605) including the lantibiotic-encoding gene cluster (SEQ ID NO:23).
  • SEQ ID NO:23 nucleotides 1979049 - 1979753 (SEQ ID NO:1) and the polypeptide encoded thereby (SEQ ID NO:2); nucleotides 1979747 - 1980907 (SEQ ID NO:3) and the polypeptide encoded thereby (SEQ ID NO:4); nucleotides 1981217 - 1981417 (SEQ ID NO:5) and the polypeptide encoded thereby (SEQ ID NO:6); nucleotides 1981501 - 1982160 (SEQ ID NO:7) and the polypeptide encoded thereby (SEQ ID NO:8); nucleotides 1982200 - 1982937 (SEQ ID NO:9) and the polypeptide encoded thereby (SEQ ID NO: 10); nucleotides 1983009 - 1986110 (SEQ ID
  • a compound of the present invention includes a polypeptide.
  • polypeptide refers broadly to a polymer of two or more amino acids joined together by peptide bonds.
  • polypeptide also includes molecules which contain more than one polypeptide joined by a disulfide bond, or complexes of polypeptides that are joined together, covalently or noncovalently, as mul timers (e.g., dimers, tetramers).
  • mul timers e.g., dimers, tetramers.
  • a compound of the present invention can be referred to herein as a lantibiotic.
  • a compound of the present invention is isolated.
  • an "isolated" polypeptide, such as a lantibiotic, or polynucleotide refers to a polypeptide or polynucleotide that has been either removed from its natural environment, produced using recombinant techniques, or chemically or enzymatically synthesized.
  • a polypeptide or polynucleotide of this invention is purified, i.e., essentially free from any other polypeptide or polynucleotide and associated cellular products or other impurities.
  • a prepeptide is produced and subsequently processed in three steps; dehydration of certain amino acids, formation of thioether linkages between certain amino acids, and cleavage by a signal peptidase.
  • the initial prepeptide may have the amino acid sequence SEQ ID NO:6.
  • the prepeptide is processed by dehydration to result in an intermediate.
  • Serine residues may be dehydrated to form didehydroalanine.
  • the serine amino acids at position 36, 38, 42, 45, 47, 49, 52, 61 or a combination thereof may be dehydrated to form didehydroalanine.
  • the serine amino acids at positions 47, 49, and 61 are dehydrated to form didehydroalanine.
  • Threonine amino acids may be dehydrated to form didehydrobutyrine.
  • the threonine amino acids at positions 54, 57 or a combination thereof may be dehydrated to form didehydrobutyrine.
  • the threonines at both positions 54 and 57 are dehydrated to form didehydrobutyrine.
  • an intermediate polypeptide resulting from the dehydration amino acids may have the following structure:
  • Xaal, 2, 3, 4, 5, 6, 7, and 10 are each independently serine or didehydroalanine; and Xaa8 and 9 are each independently threonine or didehydrobutyrine.
  • a preferred example of an intermediate polypeptide resulting from the dehydration of certain amino acids is
  • the polypeptide resulting from the dehydration of certain amino acids is further processed to form thioether linkages between certain amino acids.
  • Didehydrobutyrine residues may be processed to form 2-aminobutyric acid (Abu) when used to form a thioether linkage with another amino acid
  • didehydroalanine residues may be processed to form alanine when used to form a thioether linkage with another amino acid
  • cysteine residues may be processed to form alanine when used to form a thioether linkage with another amino acid.
  • lanthionine and 3-methyllanthionine residues result from the formation of thioether linkages between different amino acids.
  • the processed polypeptide is further processed by cleavage between two amino acids.
  • the expected cleavage site is between amino acids 33 and 34.
  • Other cleavage sites in SEQ ID NO:6 may be used to result in a processed peptide.
  • a compound of the present invention may have the following sequence:
  • Xaal, 2, 3, 4, 5, 6, 8, and 11 are each independently serine, didehydroalanine, or alanine;
  • Xaa7, 12, and 13 are each independently cysteine or alanine, and
  • Xaa9 and 10 are each independently threonine, didehydrobutyrine, or 2-aminobutyric acid.
  • a preferred example of a compound of the present invention is
  • a compound may have at least 1, at least 2, at least 3, at least 4, at least 5, at least 6 thioether cross links.
  • a compound of the present invention has at least 1 , more preferably at least 2, most preferably 3 cross links.
  • the cross links can be between any two residues at positions Xaa 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, and 13 of SEQ ID NO:21, in any combination.
  • each cross link includes one cysteine residue, i.e., Xaa 7, 12, or 13 of SEQ ID NO:21.
  • a preferred example of a compound of the present invention is SEQ ID NO:22 with thioether cross links between the amino acids at positions 14 (Xaa 5) and 18 (Xaa 7), positions 24 (Xaa 10) and 29 (Xaa 12), and positions 28 (Xaa 1 1) and 32 (Xaa 13).
  • a compound of the present invention may include polypeptides other than those depicted at SEQ ID NOs: 19, 20, 21 , or 22, preferably, SEQ ID NO:21.
  • a compound of the present invention may include those having structural similarity with another amino acid sequence.
  • the similarity is referred to as structural similarity and is generally determined by aligning the residues of the two amino acid sequences (i.e., a candidate amino acid sequence and the amino acid sequence of SEQ ID NOs: 19, 20, 21, or 22) to optimize the number of identical amino acids along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of identical amino acids, although the amino acids in each sequence must nonetheless remain in their proper order.
  • a candidate amino acid sequence is the amino acid sequence being compared to an amino acid sequence present in an amino acid sequence, such as SEQ ID NO:21.
  • a candidate amino acid sequence may be isolated from a Bifidobacterium, or may be produced using recombinant techniques, or chemically or enzymatically synthesized.
  • two amino acid sequences are compared using the BESTFIT algorithm in the GCG package (version 10.2, Madison WI), or the Blastp program of the BLAST 2 search algorithm, as described by Tatusova, et al. (FEMS Microbiol Lett 1999, 174:247-250), and available through the World Wide Web, for instance at the internet site maintained by the National Center for Biotechnology Information, National Institutes of Health.
  • a compound of the present invention also includes polypeptides with an amino acid sequence having at least 80% amino acid identity, at least 81% amino acid identity, at least 82% amino acid identity, at least 83% amino acid identity, at least 84% amino acid identity, at least 85% amino acid identity, at least 86% amino acid identity, at least 87% amino acid identity, at least 88% amino acid identity, at least 89% amino acid identity, at least 90% amino acid identity, at least 91% amino acid identity, at least 92% amino acid identity, at least 93% amino acid identity, at least 94% amino acid identity, at least 95% amino acid identity, at least 96% amino acid identity, at least 97% amino acid identity, at
  • a compound of the present invention having structural similarity to SEQ ID NOs: 19, 20, 21 , or 22, preferably SEQ ID N0:21, may include one or more conservative substitutions of the sequence disclosed at SEQ ID NOs: 19, 20, 21, or 22.
  • a conservative substitution is typically the substitution of one amino acid for another that is a member of the same class.
  • an amino acid belonging to a grouping of amino acids having a particular size or characteristic can generally be substituted for another amino acid without substantially altering the secondary and/or tertiary structure of a polypeptide.
  • conservative amino acid substitutions are defined to result from exchange of amino acids residues from within one of the following classes of residues: Class I: GIy, Ala, VaI, Leu, and He (representing aliphatic side chains); Class II: GIy, Ala, VaI, Leu, He, Ser, and Thr (representing aliphatic and aliphatic hydroxyl side chains); Class III: Tyr, Ser, and Thr (representing hydroxyl side chains); Class IV: Cys and Met (representing sulfur-containing side chains); Class V: GIu, Asp, Asn and GIn (carboxyl or amide group containing side chains); Class VI: His, Arg and Lys (representing basic side chains); Class VII: GIy, Ala, Pro, Tip, Tyr, He, VaI, Leu, Phe and Met (representing hydrophobic side chains); Class VIII: Phe, Tip, and Tyr (representing aromatic side chains); and Class IX: Asn and GIn (representing amide
  • the classes are not limited to naturally occurring amino acids, including amino acids not coded for in the standard genetic code and resulting from, for instance, post-translational modification of an amino acid, but also include artificial amino acids.
  • a conservative substitution may be present at any location, preferably, at position 1, 2, 4, 6, 7, 8, 10, 11, 13, 15, 17, 20, 22, 23, 25, 26, 27, 30, 31, 33, or a combination thereof of SEQ ID NO:21.
  • Bowie et al. discloses that there are two main approaches for studying the tolerance of a polypeptide sequence to change. The first method relies on the process of evolution, in which mutations are either accepted or rejected by natural selection. The second approach uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene and selects or screens to identify sequences that maintain functionality. As stated by the authors, these studies have revealed that proteins are surprisingly tolerant of amino acid substitutions.
  • a compound of the present invention is biologically active.
  • a "biologically active" compound or a compound having "biological activity” is one that inhibits growth of an indicator microbe.
  • the microbe may be used to inoculate the center of an agar plate and incubated for a period of time, for instance, 2 days, to allow for replication of the microbe and production of the lantibiotic.
  • the agar plate is MRS or BLIM.
  • an indicator strain previously grown on a different plate or in broth, is suspended in a molten top agar, for instance, 0.5% agar, and poured over the plate that contains the microbe producing the lantibiotic to be tested.
  • the amount of indicator strain used can vary, but is typically added at a concentration that will yield visible growth in 1 to 2 days in the absence of a lantibiotic-producing microbe.
  • the top agar is allowed to cool and harden, and the plate is incubated under conditions to allow growth of the indicator strain.
  • the absence of the indicator strain around the microbe inoculated in the middle of the plate indicates the microbe is producing a lantibiotic with biological activity.
  • the plate may be completely devoid of growth of the indicator strain, or there may be a halo of no indicator strain in the center of the plate.
  • a hole may be cut in the center of an agar plate, and a solution containing an isolated or purified lantibiotic may be added to the hole and allowed to diffuse into the agar.
  • an indicator strain previously grown on a different plate or in broth, is suspended in a molten top agar, for instance, 0.5% agar, and poured over the plate that contains the isolated or purified lantibiotic.
  • the top agar is allowed to cool and harden, and the plate is incubated under conditions to allow growth of the indicator strain.
  • the absence of the indicator strain around the microbe inoculated in the middle of the plate indicates the microbe is producing a lantibiotic with biological activity.
  • the plate may be completely devoid of growth of the indicator strain, or there may be a halo of no indicator strain in the center of the plate.
  • Some lantibiotics are known to have some biological activity against gram negative microbes, but typically the biological activity exists only if the outer membrane of the gram negative microbe is damaged before exposure to the lantibiotic.
  • the lantibiotic of the present invention has biological activity against gram negative microbes in the absence of damage to the outer membrane. Accordingly, testing whether a lantibiotic has biological activity is preferably done under conditions that do not damage the outer membrane of a gram negative microbe.
  • Such conditions include, for instance, inclusion of a chelator in the medium, subjecting the indicator microbe to conditions of osmotic shock, heat, hydrostatic pressure, exposure to sub-lethal antimicrobials that effect the lipopolysaccarhide of the outer membrane, sub-lethal microwave exposure, and sublethal sonication.
  • some lantibiotics are known to have some biological activity against gram negative microbes, but typically the biological activity exists only if the gram negative microbe is exposed to higher concentrations of the lantibiotic than are used to inhibit a gram positive microbe (Hillman, U.S. Patent Application 20020128186.
  • the lantibiotic of the present invention has biological activity against gram negative microbes and gram positive microbes when used at the same concentration.
  • Preferred indicator strains include, for instance, Micrococcus leuteus, Lactococcus lactis, Staphylococcus, aureus, Staphylococcus epidermdis, E. coli, Serratia marcescens, and Proteus vulgaris.
  • a compound of the present invention also has the characteristics of being resistant to heating to 100 0 C for 10 minutes, inactivated by proteolytic digestion with pepsin at pH 2 and pronase E at pH7.5, and not inactivated by proteolytic digestion with ⁇ -Chymotrypsin, proteinase K, trypsin, and thermolysin.
  • the compound is predicted to have an isoelectric point of 9.5, and a molecular weight of 3291.8 Daltons.
  • the present invention also provides other isolated polypeptides. Without intending to be limiting, production of a compound of the present invention, for instance, SEQ ID NO:22, by a microbe such as a Bifidobacterium, is facilitated by 7 other polypeptides.
  • the naturally occurring versions of these 7 polypeptides are encoded by a set of coding regions including the coding region encoding the naturally occurring preprotein SEQ ID NO:6, and the expression of each of these 7 polypeptide results in the production of a compound, for instance, SEQ ID NO:22.
  • polypeptides are a response regulator of two component system (SEQ ID NO:2), a signal transduction histidine kinase (SEQ ID NO:4), a response regulator (SEQ ID NO:8), a prepeptide modification polypeptide (SEQ ID NO: 10), a modifying enzyme (SEQ ID NO: 12), an immunity polypeptide (SEQ ID NO: 14), and a transporter polypeptide (SEQ ID NO: 16).
  • the transporter polypeptide is predicted to include protease capability to cleave the prepeptide.
  • the similarity is referred to as structural similarity and is generally determined by aligning the residues of the two amino acid sequences (i.e., a candidate amino acid sequence and the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, or SEQ ID NO:16) as described above.
  • a polypeptide of this aspect of the invention also includes polypeptides with an amino acid sequence having at least 80% amino acid identity, at least 81% amino acid identity, at least 82% amino acid identity, at least 83% amino acid identity, at least 84% amino acid identity, at least 85% amino acid identity, at least 86% amino acid identity, at least 87% amino acid identity, at least 88% amino acid identity, at least 89% amino acid identity, at least 90% amino acid identity, at least 91% amino acid identity, at least 92% amino acid identity, at least 93% amino acid identity, at least 94% amino acid identity, at least 95% amino acid identity, at least 96% amino acid identity, at least 97% amino acid identity, at least 98% amino acid identity, or at least 99% amino acid identity to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, or SEQ ID NO: 16.
  • a polypeptide the present invention having structural similarity to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, or SEQ ID NO: 16 may include one or more conservative substitutions of the sequence disclosed at SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, or SEQ ID NO:
  • a polypeptide having structural similarity to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, or SEQ ID NO:16 preferably has activity of producing a biologically active compound of SEQ ID NO:22.
  • Whether a polypeptide having structural similarity to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO: 14, or SEQ ID NO: 16 has activity can be determined by expressing one of the polypeptides with an altered amino acid sequence in a microbe, preferably a Bifidobacterium, with the other naturally occurring polypeptides, and determining whether a biologically active compound of the present invention is produced.
  • a polypeptide having structural similarity to SEQ ID NO:2 may be expressed in a cell with SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, and SEQ ID NO: 16, and the cell grown under conditions suitable for the production of a compound of the present invention. If the cell produces a compound having biological activity, then the tested polypeptide, i.e., the polypeptide having structural similarity to SEQ ID NO:2, is active.
  • polynucleotide refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxynucleotides, and includes both double- and single-stranded DNA and RNA.
  • a polynucleotide may include nucleotide sequences having different functions, including for instance coding sequences, and non-coding sequences such as regulatory sequences. Coding sequence, non-coding sequence, and regulatory sequence are defined below.
  • a polynucleotide can be obtained directly from a natural source, or can be prepared with the aid of recombinant, enzymatic, or chemical techniques.
  • a polynucleotide can be linear or circular in topology.
  • a polynucleotide can be, for example, a portion of a vector, such as an expression or cloning vector, or a fragment.
  • One polynucleotide of the present invention includes SEQ ID NO: 17 (nucleotides 1981316 - 1981417 of SEQ ID NO:23), which encodes the polypeptide depicted at amino acids 34-66 of SEQ ID NO:6. It should be understood that a polynucleotide encoding a polypeptide represented by amino acids 34-66 of SEQ ID NO:6.
  • nucleotide sequence disclosed at SEQ ID NO: 17 is not limited to the nucleotide sequence disclosed at SEQ ID NO: 17, but also includes the class of polynucleotides encoding such a polypeptide as a result of the degeneracy of the genetic code.
  • the naturally occurring nucleotide sequence SEQ ID NO: 17 is but one member of the class of nucleotide sequences encoding a polypeptide having the amino acid sequence depicted at amino acids 34- 66 of SEQ ID NO:6.
  • polynucleotides encoding a biologically active polypeptide of the present invention include those having structural similarity with the nucleotide sequence of SEQ ID NO: 17.
  • the similarity is referred to as structural similarity and is determined by aligning the residues of the two polynucleotides (i.e., the nucleotide sequence of the candidate sequence and the nucleotide sequence of SEQ ID NO: 17) to optimize the number of identical nucleotides along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of shared nucleotides, although the nucleotides in each sequence must nonetheless remain in their proper order.
  • a candidate sequence is the sequence being compared to SEQ ID NO: 17.
  • a candidate nucleotide sequence may be isolated from a Bifidobacterium, or may be produced using recombinant techniques, or chemically or enzymatically synthesized.
  • two nucleotide sequences are compared using the BESTFIT algorithm in the GCG package (version 10.2, Madison WI), or the Blastn program of the BLAST 2 search algorithm, as described by Tatusova, et al. (FEMS Microbiol Lett 1999, 174:247-250), and available through the World Wide Web, for instance at the internet site maintained by the National Center for Biotechnology Information, National Institutes of Health.
  • a polynucleotide includes a nucleotide sequence having at least 80% nucleotide identity, at least 81 % nucleotide identity, at least 82% nucleotide identity, at least 83% nucleotide identity, at least 84% nucleotide identity, at least 85% nucleotide identity, at least 86% nucleotide identity, at least 87% nucleotide identity, at least 88% nucleotide identity, at least 89% nucleotide identity, at least 90% nucleotide identity, at least 91% nucleotide identity, at least 92% nucleotide identity, at least 93% nucleotide identity, at least 94% nucleotide identity, at least 95% nucleotide identity, at least 96% nucleotide identity, at least 97% nucleotide identity, at
  • a polynucleotide identical to, or having structural similarity with SEQ ID NO: 17 includes an additional nucleotide sequence located immediately 5' or upstream of SEQ ID NO: 17.
  • This optional sequence encodes a polypeptide corresponding to the amino terminal region of the prepeptide that is removed during processing, i.e., amino acids 1-33 of SEQ ID NO:6.
  • These nucleotides are disclosed at nucleotides 1 - 99 of SEQ ID NO:5.
  • a polynucleotide encoding a polypeptide represented by amino acids 1-33 of SEQ ID NO:6 is not limited to the nucleotide sequence disclosed at nucleotides 1 - 99 of SEQ ID NO:5, but also includes the class of polynucleotides encoding such a polypeptide as a result of the degeneracy of the genetic code.
  • isolated polynucleotides encoding the amino terminal region of the prepeptide include those having structural similarity with the nucleotide sequence of nucleotides 1 - 99 of SEQ ID NO:5.
  • the similarity is referred to as structural similarity and is determined by aligning the residues of the two polynucleotides (i.e., the nucleotide sequence of the candidate sequence and nucleotides 1 - 99 of SEQ ID NO:5) as described above.
  • such a polynucleotide includes a nucleotide sequence having at least 80% nucleotide identity, at least 81% nucleotide identity, at least 82% nucleotide identity, at least 83% nucleotide identity, at least 84% nucleotide identity, at least 85% nucleotide identity, at least 86% nucleotide identity, at least 87% nucleotide identity, at least 88% nucleotide identity, at least 89% nucleotide identity, at least 90% nucleotide identity, at least 91% nucleotide identity, at least 92% nucleotide identity, at least 93% nucleotide identity, at least 94% nucleotide identity, at least 95% nucleotide identity, at least 96% nucleotide identity, at least 97% nucleotide identity, at least 98% nucleotide identity, or at least 99% nucleotide identity to nucleotides 1 - 99 of S
  • the present invention also includes isolated polynucleotides encoding the 7 polypeptides that facilitate production of a compound of the present invention.
  • These polynucleotides include SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:1 1, SEQ ID NO: 13, and SEQ ID NO: 15.
  • These polynucleotides encode SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:16, respectively.
  • SEQ ID NO:2 SEQ ID NO:4, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:16, respectively.
  • SEQ ID NO: 14 is not limited to the nucleotide sequence disclosed at SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 11 , SEQ ID NO: 13, or SEQ ID NO: 15, but also includes the class of polynucleotides encoding such a polypeptide as a result of the degeneracy of the genetic code.
  • polynucleotides encoding on of the 7 polypeptides that facilitate expression of a compound of the present invention include those having structural similarity with the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:1 1, SEQ ID NO:13, or SEQ ID NO:15.
  • the similarity is referred to as structural similarity and is determined by aligning the residues of the two polynucleotides (e.g., the nucleotide sequence of the candidate sequence and the nucleotide sequence of SEQ ID NO:1) as described above.
  • a polynucleotide includes a nucleotide sequence having at least 80% nucleotide identity, at least 81% nucleotide identity, at least 82% nucleotide identity, at least 83% nucleotide identity, at least 84% nucleotide identity, at least 85% nucleotide identity, at least 86% nucleotide identity, at least 87% nucleotide identity, at least 88% nucleotide identity, at least 89% nucleotide identity, at least 90% nucleotide identity, at least 91% nucleotide identity, at least 92% nucleotide identity, at least 93% nucleotide identity, at least 94% nucleotide identity, at least 95% nucleotide identity, at least 96% nucleotide identity, at least 97% nucleotide identity, at least 98% nucleotide identity, or at least 99% nucleotide identity to SEQ ID NO: 1 , SEQ ID NO: 1
  • nucleotide sequence having structural similarity to SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO: 13, or SEQ ID NO: 15 having the activity of producing a compound of SEQ ID NO:22. Testing for such activity is described above.
  • a polynucleotide of the present invention may be present in a vector.
  • a vector is a replicating polynucleotide, such as a plasmid, phage, cosmid, or artificial chromosome, to which another polynucleotide may be attached so as to bring about the replication of the attached polynucleotide.
  • a polynucleotide of the invention may be referred to as a recombinant polynucleotide.
  • a "recombinant polynucleotide” refers to a polynucleotide having sequences that are not naturally joined together. The sequences may be joined by the artificial manipulation of different polynucleotide sequences using recombinant techniques, or may be chemically or enzymatically synthesized. A recombinant polynucleotide may be included in a suitable vector. Construction of vectors containing a polynucleotide of the invention employs standard ligation techniques known in the art. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual., Cold Spring Harbor Laboratory Press (1989).
  • a vector can provide for further cloning (amplification of the polynucleotide), i.e., a cloning vector, or for expression of the polypeptide encoded by the coding region, i.e., an expression vector.
  • Suitable expression vectors include those that can be used to produce amounts of polypeptide, preferably a compound of the present invention that can be used in a composition of the present invention and, for instance, administered to a subject.
  • Vectors may include a coding region encoding a polypeptide of the present invention or a fragment thereof.
  • a "coding region” refers to a nucleotide sequence that encodes a polypeptide and, when placed under the control of appropriate regulatory sequences expresses the encoded polypeptide.
  • the boundaries of a coding region are generally determined by a translation start codon at its 5' end and a translation stop codon at its 3' end
  • Selection of a vector depends upon a variety of desired characteristics in the resulting construct, such as a selection marker, vector replication rate, and the like.
  • Suitable host cells for cloning or expressing the vectors herein are prokaryote or eukaryotic cells.
  • An expression vector optionally includes regulatory sequences operably linked to the coding region.
  • a regulatory sequence is a nucleotide sequence that regulates expression of a coding region to which it is operably linked.
  • Nonlimiting examples of regulatory sequences include promoters, transcription initiation sites, translation start sites, translation stop sites, and terminators.
  • "Operably linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner.
  • a regulatory sequence is "operably linked" to a coding region when it is joined in such a way that expression of the coding region is achieved under conditions compatible with the regulatory sequence. The invention is not limited by the use of any particular promoter, and a wide variety of promoters are known.
  • Promoters act as regulatory signals that bind RNA polymerase in a cell to initiate transcription of a downstream (3 1 direction) coding region.
  • the promoter used may be a constitutive or an inducible promoter. It may be, but need not be, heterologous with respect to the host cell.
  • a heterologous regulatory sequence is a regulatory sequence operably linked to a coding region to which it is not normally operably linked.
  • An expression vector may optionally include a ribosome binding site and a start site (e.g., the codon ATG) to initiate translation of the transcribed message to produce the polypeptide. It may also include a termination sequence to end translation. A termination sequence is typically a codon for which there exists no corresponding aminoacetyl-tRNA, thus ending polypeptide synthesis.
  • the polynucleotide used to transform the host cell may optionally further include a transcription termination sequence.
  • a vector may include more than one polynucleotide of the present invention.
  • the polynucleotides may be organized in an operon, and operably linked to the same promoter located upstream of the first coding region in the operon.
  • more than one promoter may drive expression of the polynucleotides.
  • the vector introduced into a host cell optionally includes one or more marker sequences, which typically encode a molecule that inactivates or otherwise detects or is detected by a compound in the growth medium.
  • a marker sequence may render the transformed cell resistant to an antibiotic, or it may confer compound-specific metabolism on the transformed cell.
  • Examples of a marker sequence are sequences that confer resistance to kanamycin, ampicillin, chloramphenicol, tetracycline, neomycin, and eruthromycin.
  • a method for producing a compound of the present invention may include growing a Bifidobacterium under conditions suitable for producing the compound. Typically, such conditions may include growing the Bifidobacterium on a surface.
  • Suitable components that cam be used to for a solid medium include, but are not limited to, agar, gelatin, and gums such as alginate, xantham, and the like.
  • the medium may be complete or minimal, preferably complete.
  • suitable media include, but are not limited to, complex media that include a fermentable sugar, such as MRS, BLIM, and Brain Heart Infusion.
  • Bifidobacteria that may produce a compound of the present invention can be obtained from an individual, or laboratory strains can be used.
  • Examples of bifidobacteria that may be used as a source of a compound of the present invention include B. adolescentis, B. aerophihim, B. angulation, B. animalis, B. asteroides, B. bifidum, B. bourn, B. breve, B. catenulatum, B. choerinum, B. coryneforme , B. cuniculi, B. denticolens, B. dentium, B. gallicum, B. gallinarum, B indicum, B. infantis, B.
  • the Bifidobacerium is B. breve, B. infantis, or B. longum, more preferably, B. longum.
  • a Bifidobacterium is preferably obtained from an individual.
  • Methods for obtaining a Bifidobacterium from an individual are routine and known in the art (see, for instance, Kullen et al., 1997, FEMS Microbiol. Lett, 154:377-383; O'Suillivan, U.S. Patent 6,746,672).
  • fresh fecal samples may be collected from an individual and immediately homogenized in an appropriate amount of a sterile solution such as sterile peptone water (0.1%).
  • an individual has no history of gastrointestinal disorders and has not used antibiotics in the previous year.
  • the homogenate may be transferred to an anaerobic chamber, where it may be serially diluted and plated on, for instance, BIM-25 (Munoa et al., 1988, Appl. Environ. Microbiol, 54:1715- 1718). After anaerobic incubation at 37°C, red colonies can be randomly selected.
  • the authenticity of the colonies appearing on the BIM-25 plates can be verified by routine methods, such as assessing the activity of fructose-6-phosphate phosphoketolase, a diagnostic enzyme for bifidobacteria, or by molecular analysis of the 16s rRNA gene or the recA gene as described by Kullen et al. (1997, FEMS Microbiol Lett., 154:377-383).
  • a Bifidobacterium that produces a compound of the present invention should not be grown for extended periods under conditions that do not favor lantibiotic production, such as in broth, as they can loose the gene cluster encoding the compund. As the gene cluster also encodes the immunity genes, it cannot be lost if the lantibiotic is in the environment.
  • a Bifidobacterium can be screened to determine if it produces a compound of the present invention. Screening methods include culturing a Bifidobacterium under conditions suitable for expression of a lantibiotic and testing for the presence of a lantibiotic. Conditions that are "suitable” for an event to occur, or conditions that "allow” an event to occur, such as production of a lantibiotic by a
  • Bifidobacterium or "suitable” conditions are conditions that do not prevent such events from occurring. Thus, these conditions permit, enhance, facilitate, and/or are conducive to the event.
  • Screening methods may include determining if a Bifidobacterium has one or more of the polynucleotides involved in the synthesis of a compound of the present invetion. For instance, the presence of a polynucleotide of the present invention can be determined by amplification. Preferably, a polynucleotide is amplified by the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • a molar excess of a primer pair is added to a sample that includes polynucleotides from the test Bifidobacterium, preferably the chromosomal DNA.
  • the primers are extended to form complementary primer extension products which act as templates for synthesizing the desired amplified polynucleotides.
  • the presence of an amplified polynucleotide of the expected size indicates the test Bifidobacterium may produce a compound of the present invention.
  • Suitable polynucleotides that can be amplified include coding regions present in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, and 15.
  • the polynucleotide amplified is a portion of the nucleotide sequence (SEQ ID NO:5) encoding the polypeptide SEQ ID NO:6.
  • Primers that amplify a portion of a polynucleotide of the present invention can be designed using readily available computer programs, such as OMIGA program, (Oxford Molecular, Ltd., Oxford, UK). Factors that can be considered in designing primers include, but are not limited to, melting temperatures, primer length, size of the amplification product, and specificity. Primer length is generally between 15 and 30 nucleotides, but can be shorter or longer if desired.
  • primer pairs include, for instance, LANRl-F (ATGAAGGCGATTCTGTTTC, SEQ ID NO:38) and LANRl-R (TCACAGCTCGATATTGGTG, SEQ ID NO:39), which result in an amplified product of 676 bp, and LANTl-F (GAGC ATC AATGAGAAGTCC, SEQ ID NO:56) and LANTl-R (GCAATCAACACCAAAACC, SEQ ID NO:57), which result in an amplified product of 788 bp.
  • LANRl-F ATGAAGGCGATTCTGTTTC, SEQ ID NO:38
  • LANRl-R TCACAGCTCGATATTGGTG, SEQ ID NO:39
  • LANTl-F GAGC ATC AATGAGAAGTCC, SEQ ID NO:56
  • LANTl-R GCAATCAACACCAAAACC, SEQ ID NO:57
  • polynucleotide of the present invention can be determined with polynucleotide probes designed to hybridize to a polynucleotide present in the test Bifidobacterium.
  • hybridizes As used herein, “hybridizes,”
  • hybridizing refers to noncovalent interaction forms between a probe and a target polynucleotide under standard conditions.
  • Standard hybridizing conditions are those conditions that allow a probe to hybridize to a target polynucleotide. Such conditions are readily determined for a probe and the target polynucleotide using techniques well known to the art, for example see Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory: New York (1989).
  • Suitable polynucleotides that can be identified by hybridization include coding regions present in SEQ ID NOs: 1 , 3, 5, 7, 9, 11, 13, and 15.
  • the polynucleotide identified by hybridization is the nucleotide sequence encoding the polypeptide SEQ ID NO:6.
  • a probe may be less than 20 nucleotides, at least 20 nucleotides, at least 50 nucleotides, or at least 100 nucleotides in length.
  • a method for producing a compound of the present invention may include growing a microbe that includes a recombinant polynucleotide encoding a polypeptide that includes an amino acid sequence having structural similarity to SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, or SEQ ID NO:22, preferably SEQ ID NO:22.
  • a microbe may include a coding region encoding a lanA of the present invention, and optionally may include a coding region encoding a lanRl of the present invention, a lanK of the present invention, a lanRl of the present invention, a lanD of the present invention, a lanM of the present invention, a lanl of the present invention, a Ian T of the present invention, or a combination thereof.
  • microbe may include a coding region encoding SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, or a combination thereof.
  • a compound of the present invention may also be produced in vivo (Xie et al., 2004, Science,
  • a microbe that includes a recombinant polynucleotide encoding a compound of the present invention may be an Archae, Eukarya or a Eubacteria, preferably a Eubacteria, such as a gram negative or a gram positive microbe.
  • gram negative microbes include, but are not limited to, E. coli and Salmonella spp.
  • gram poositive microbes include, but are not limited to, Bacillus spp. such as B. subtilis, Enterococcus spp. such as E.faecium, E.faecalis, lactic acid bacteria such as Lactococcus lactis, L. sakei, and Streptomyces .
  • Other microbes include yeast such as, but not limited to, Saccharomyces cerevisiae and Pichia pastoris.
  • a compound of the present invention may be isolated.
  • a microbe producing a compound of the present invention preferably a Bifidobacterium
  • the culture including the medium, exposed to conditions suitable for isolating the compound.
  • a compound of the present invention may be isolated by drying the cells and, optionally, the solid medium on which the cells are grown.
  • the culture may be further treated to sterilize it.
  • the culture can be treated by exposure to conditions to kill the bifidobacteria present in the culture. Examples of conditions useful for sterilization include heat or ultraviolet radiation.
  • the culture may be dried until essentially all moisture is removed and a powder containing the compound remains.
  • Methods for drying cultures include, for instance, spray drying, freeze drying, tunnel drying, vacuum drying, and air drying.
  • the result of such methods is a mixture that includes a large number of components, including the compound of the present invention.
  • Such a mixture may be added to food products.
  • the mixture added to food products may be sterile.
  • a lantibiotic of the present invention may be isolated by methanol extraction. Additional methods may be used for further isolation and/or purification using methods known in the art for isolating and/or purifying lantibiotics. Such methods typically include, but are not limited to, column chromatography, including hydrophobic interaction chromatography, and high perfo ⁇ nance liquid chromatography (HPLC), such as reverse phase HPLC using, for instance, a Cl 8 column. The optimum conditions to be used can be determined by routine experimentation. A purified compound of the present invention may be made using known synthetic chemistry techniques.
  • compositions may include a compound of the present invention.
  • Such compositions may optionally include a pharmaceutically acceptable earner.
  • pharmaceutically acceptable earner includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration and not deleterious to a recipient thereof.
  • the compound present in the composition may be isolated or purified. An isolated compound may be one that is isolated by drying the cells. Additional active compounds can also be incorporated into the compositions.
  • compositions of the present invention may further include at least one component that damages the outer membrane of a gram negative microbe.
  • a composition may include at least one chelator, preferably a metal chelator.
  • chelators such as ethylenediaminetetraacetic acid (EDTA) with lantibiotics is known to result in expanding the activity of some lantibiotics, such as nisin, from just gram positive microbes to include gram negative microbes (Blackburn et al., U.S. Patent 5,691,301).
  • EDTA ethylenediaminetetraacetic acid
  • the use of a chelator with a compound of the present invention is not required for the compound to be active against gram negative microbes.
  • metal chelators include natural and synthetic compounds.
  • Examples of natural compounds include plant phenolic compounds, such as flavonoids.
  • flavinoids include the copper chelators catechin and naringenin, and the iron chelators myricetin and quercetin.
  • Examples of synthetic copper chelators include, for instance, tetrathiomolybdate, and examples of synthetic zinc chelators include, for instance, N,N,N',N' -Tetrakis (2-pyridylmethyl)-ethylene diamine.
  • Examples of synthetic iron chelators include 2,2'-dipyridyl, 8- hydroxyquinoline, EDTA, ethylenediamine-di-O-hydroxyphenylacetic acid (EDDHA), desferoxamine methanesulphonate (desferol), transferrin, lactoferrin, ovotransferrin, biological siderophores, such as xcatecholates and hydroxamates, and citric acid.
  • the chelator is EDTA.
  • compositions of the present invention may further include at least one surfactant, preferably a non-ionic surfactant.
  • non-ionic surfactants include glycerol monolaurate, sucrose esters such as sucrose palmitate, polysorbate 20, TRITON X-IOO, Isoceteth-20, ARLASOLVE 200L, Lauramine oxide, Decylpolyglucose, Phospholipid PTC, MEROXAPOL 105, and the like.
  • Compositions of the present invention may include other agents having bacteriostatic and/or bacteriocidal activity.
  • agents include, but are not limited to, lysostaphin, bacitracin, neomycin, polymixin, beta-lactams, including penicillin, methicillin, moxalactam and cephalosporins, such as cefaclor, cefadroxil, cefamandole nafate, cefazolin, cefixime, cef ⁇ netazole, cefonioid, cefoperazone, ceforanide, cefotanme, cefotaxime, cefotetan, cefoxitin, cefpodoxime proxetil, ceftazidime, ceftizoxime, ceftriaxone, cefriaxone, cefuroxime, cephalexin, cephalosporin C, cepahlosporin C sodium salt, cephalothin, cephalot
  • a composition may contain organic acids acceptable for use in food products or salts of these acids.
  • a composition may contain individual acids or salts, or mixtures thereof.
  • Preferred organic acids or salts for use in compositions include acetic acid, sodium acetate, sodium diacetate, potassium acetate, lactic acid, sodium lactate, potassium lactate, propionic acid, propionates, including, but not limited to, sodium propionate and potassium propionate, citric acid or its salts such as sodium citrate or potassium citrate, or combinations thereof.
  • a composition for administration to a subject may be prepared by methods known in the art of pharmacy.
  • a composition can be formulated in a dosage form to be compatible with its intended route of administration.
  • routes of administration include, but are not limited to, perfusion; parenteral, e.g., intravenous, intradermal, intramuscular, subcutaneous; topical, e.g., mucosal (such as nasal, sublingual, vaginal, buccal, or rectal) and transdermal; otic; and oral.
  • Solutions or suspensions can include the following components: a sterile diluent such as water for administration, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; buffers such as acetates, citrates or phosphates; electrolytes, such as sodium ion, chloride ion, potassium ion, calcium ion, and magnesium ion, and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • a composition can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • compositions can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile solutions or dispersions.
  • suitable carriers include physiological saline, bacteriostatic water, or phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • a composition is typically sterile and, when suitable for injectable use, should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and optionally preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
  • polyol for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like
  • Prevention of the action of microorganisms can be achieved by various optional antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile solutions can be prepared by incorporating the active compound (i.e., a compound of the present invention) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier.
  • the active compound can be incorporated with excipients and used in the form of tablets or capsules, e.g., gelatin capsules.
  • Oral compositions can also be prepared using a fluid carrier for use as a dentifrice.
  • a dentifrice may be a liquid, paste, or powder, such as a mouthwash or a toothpaste.
  • Pharmaceutically compatible binding agents may be included as part of the composition.
  • the tablets, pills, capsules, and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or com starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a composition may be a transgenic plant expressing a compound of the present invention.
  • the active compounds may be delivered in the form of an aerosol spray from a pressured container or dispenser which contains a suitable propellant, e.g., a gas such as a hydrofluoroalkane, or a nebulizer.
  • a suitable propellant e.g., a gas such as a hydrofluoroalkane, or a nebulizer.
  • compositions of the invention may include various mixtures and combinations that can be applied topically and to permit even spreading and absorption into cutaneous and mucosal surfaces. Examples include sprays, mists, aerosols, lotions, creams, aqueous and non-aqueous solutions or liquids, oils, gels, powders, ointments, pastes, unguents, emulsions and suspensions.
  • Topical formulations may be prepared by combining a compound of the present invention with conventional pharmaceutical or cosmeceutical diluents or carriers commonly used in topical dry, liquid, cream and aerosol formulations. Both liquids and powders can be delivered as sprays, mists or aerosols.
  • Powders may be formed with the aid of any suitable powder base, e.g., talc, lactose, starch, and the like.
  • Solutions can be formulated with an aqueous or nonaqueous base, and can also include one or more dispersing agents, suspending agents, solubilizing agents, and the like.
  • Topical gels may be prepared using polymers having a molecular weight and level of concentration effective to form a viscous solution or colloidal gel of an aqueous or non-aqueous solution or suspension of the active compound.
  • Polymers from which topical gels may be prepared include polyphosphoesters, polyethylene glycols, high molecular weight poly(lactic) acids, hydroxypropyl celluloses, chitosan, polystyrene sulfonates, and the like.
  • Ointments, creams and lotions may be formulated, for example, with an aqueous or oily base and addition of a suitable thickening agent, gelling agent, stabilizing agent, emulsifying agent, dispersing agent, suspending agent, or consistency regulating agent, and the like.
  • Bases include water, an alcohol or an oil, such as liquid paraffin, mineral oil, or a vegetable oil, such as peanut or castor oil.
  • Thickening agents that can be used according to the nature of the base include soft paraffin, aluminum stearate, cetostearyl alcohol, propylene glycol, polyethylene glycols, polyphosphoesters, poly(lactic acids), hydroxyethyl celluloses, hydroxypropyl celluloses, cellulose gums, acrylate polymers, hydrophilic gelling agents, chitosan, polystyrene sulfonate, petrolatum, woolfat, hydrogenated lanolin, beeswax, and the like.
  • the ointments, pastes, creams, gels, and lotions can also contain excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc, zinc oxide, and mixtures thereof.
  • Powders and sprays can also contain excipients such as silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Solutions, suspensions or dispersions can be converted into aerosols or sprays by any of the known means routinely used for making aerosols for topical application.
  • such methods include pressurizing or providing a means of pressurizing a container of a solution, suspension or dispersion, usually with an inert carrier gas, and passing the pressured gas through a small orifice.
  • Sprays and aerosols can also contain customary propellants, e.g., chlorofluorohydrocarbons or volatile unsubstituted hydrocarbons, such as butane and propane.
  • Excipients may include compounds that promote skin absorption, such as dimethyl sulfoxide (DMSO), partial glycerides of fatty acids, and the like. Examples of partial fatty acid glycerides include, but are not limited to IMWITOR 742 and IMWITOR 308.
  • the topical formulations may also optionally include inactive ingredients to improve cosmetic acceptability, including but not limited to, humectants, surfactants, fragrances, coloring agents, emollients, fillers, and the like.
  • a composition may be administered directly by the dusting of a powder, spraying of an aerosol or by spreading a film of an ointment, cream, lotion, solution or gel to the desired area of the skin using the fingertips of the patient or a healthcare provider or other conventional application such as a swab or wipe.
  • the product may be first applied to the skin and spread with the fingertips or an applicator or applied to the fingertips and spread over the skin.
  • the compositions may also optionally first be coated on the surface of a topical applicator, such as a bandage, swab, moist woven or non-woven wipe and the like, which is then applied to the portion of the skin to receive the composition.
  • the active compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
  • the active compounds may be prepared with carriers that will protect the active compound against rapid elimination from the body, such as a controlled release formulation, including implants.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. The materials can also be obtained commercially.
  • Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art.
  • the compounds of the present invention are safe and suitable for use in animals, including use in foods eaten by an animal.
  • toxicity and therapeutic efficacy of such active compounds may be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 50 /ED 50 .
  • Compounds which exhibit high therapeutic indices are preferred. Methods for evaluating the toxicity of lantibiotics are known in the art and are routine.
  • the data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in animals, including humans.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose may be formulated in animal models to achieve a concentration range that includes the IC 50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of signs) as determined in cell culture. Such information can be used to more accurately determine useful doses.
  • composition in those aspects where a composition is being administered to an animal for a pharmaceutical application or a personal care application, the composition can be administered one or more times per day to one or more times per week, including once every other day.
  • the dosage and timing required to effectively treat a subject including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present.
  • treatment of a subject with an effective amount of a compound of the present invention can include a single treatment or, preferably, can include a series of treatments.
  • the present invention includes both patient-specific dosages forms, as well as non-patient-specific multi-dosage forms that can be used to decontaminate populations exposed to pathogens as a consequence of a bioterrorism attack.
  • a composition of the present invention may include a microbe, such as a Bifidobacterium, that expresses a compound of the present invention.
  • a composition including a microbe that expresses a compound of the present invention may be encapsulated in, for example, a sugar matrix, a fat matrix, a polysaccharide matrix, or a protein matrix. It may also be coated and/or incorporated into tablet form. For instance, encapsulation, coating, and incorporation into tablet form may allow better survival of the microbe in the composition, or may allow better delivery of the microbe to the large intestine.
  • compositions that include a microbe that expresses a compound of the present invention are often orally administered to an animal.
  • bifidobacteria can be incorporated into different types of food products.
  • the bifidobacteria of the present invention can be incoporporated into solid and semi-solid dairy products, including fermented dairy products, for instance yogurt.
  • Other examples of dairy products include cottage cheese, cheese, and powdered milk.
  • Bifidobacteria can also be incorporated mto baby foods. Beverages to which bifidobacteria can be added include milk, vegetable juice, fruit juice, soy milk, soybean milk, fermented soybean milk, and fruit flavored dairy beverages.
  • the present invention is also directed to methods of using the compositions described herein.
  • the methods include, for instance, pharmaceutical applications, food applications, personal care applications, and probiotic applications.
  • the methods may include preventing microbial growth.
  • the prevention of growth may be due to a bacteriostatic activity or a bacte ⁇ ocidal activity of a compound of the present invention.
  • the microbe may be gram positive or gram negative.
  • Examples of gram positive microbes that may be sensitive to a lantibiotic of the present invention and inhibited include, but are not limited to, Streptococcus spp., such as S agalactiae; Enterococcus spp., such as E faecalis and E faecium; Bacillus spp., such as B anthracis, B cereus, B coagulans, and B hcheniformis; Listeria spp., such as L monocytogenes; Staphylococcus spp., such as S aureus; Streptococcus spp., such as S agalactiae, S mutans, S vindans, S thermophilus, S constellatus, and S zooepidemicus; Clostridium spp , such as C botuhnum, C difficile, C perfringens, C sordellii, C tetani, C sordell
  • Peptostreptococcus spp. Sporolactobacillus spp., Brevibacterium spp., and Sporolactobacillus spp.
  • Examples of gram negative microbes that may be sensitive to a lantibiotic of the present invention and inhibited include, but are not limited to, members of the family Enterobacte ⁇ aceae, such as Citrobacter spp., Edwardsiella spp.,
  • Enterobacter spp. Erwima spp., Escherichia, such as E coli (e.g., H7:O157), Ewingella spp., Klebsiella, such as K pneumoniae spp., Pleswmonas, such as P shigelloses spp., Proteus, such as P vulgaris spp., Providencia spp., Salmonella spp., Serratia, such as S marcescens spp., Shigella spp., and Yersinia, such as Y enterocolitica and Y. pestis; members of the family Vibrionaceae, such as Vibrio alginolyticus, V.
  • cholerae V. parahaemolyticus, and V. vulnificus
  • members of the family Pseudomonadaceae such as Pseudomonas aeruginosa, P. anguilliseptica, P. oryzihabitans , P. plecoglossicida, P. fluorescens and P. syringae.
  • Other examples of gram negative microbes that may be inhibited include, but are not limited to, Helicobacter pylori; Camplyobacter spp., such as C. jejuni, C. coli, and C. upsaliensis; Bacteroides spp., such as B.
  • frgilis frgilis
  • Fusobacaterium spp. such as F. necrophorum, F. ulcercans, F. russi, and F. varium
  • Leptospira spp. Pectobacterium spp., such as P. carotovorum
  • Pasteurella spp. such as P. multocida, Borrelia spp., Legionella spp., Neissaria spp., Fusobacterium spp., and Agrobacterium spp.
  • Treatment and “treating” refer to the use of a composition of the present invention to prevent, cure, retard, or reduce the severity of signs in a subject resulting from the presence of a microbe, and/or result in no worsening of signs over a specified period of time in an subject which has already been exposed to a microbe that can cause the signs.
  • Treatment may be prophylactic or, alternatively, may be initiated after the exposure of an animal to a microbe.
  • Prophylactic treatment refers to the use of a composition of the present invention to inhibit, preferably prevent microbial growth, thereby preventing or reducing signs of a condition if the subject is later exposed to a microbe.
  • Treatment that is prophylactic, for instance, initiated before a subject manifests signs of a condition is referred to herein as treatment of a subject that is "at risk" of developing a condition.
  • Treatment initiated after the exposure of a subject to a microbe causing a condition may result in decreasing the severity of the signs, or completely removing the signs.
  • the term "signs" refers to objective evidence in a subject of a condition caused by the presence of a microbe. Signs can vary depending upon the microbe. Signs of conditions caused by the presence of a microbe and the evaluation of such signs are routine and known in the art. Accordingly, the present invention is also directed to methods for treating a microbial infection in an animal, and methods for treating a condition caused by a microbe.
  • a "microbial infection” refers to a detrimental colonization of an animal by a microbe. The methods include administering an effective amount of the composition of the present invention to an animal having an infection and/or signs of a condition caused by a microbe, and determining whether the infection and/or signs of the condition have decreased. Conditions include, but are not limited to, wound infections, halitosis, caries, systemic infections, and skin infections.
  • the methods may include administering a composition of the present invention to an animal.
  • the animal may be any animal susceptible to a condition caused by a microbe including, but not limited to, a vertebrate, more preferably a mammal, or an avian.
  • mammals include, but are not limited to, a human; a member of the subfamily Bovinae, such as cattle and bison; a member of the subfamily Caprinae, such as sheep and goats; a member of the genus Sus, such as pigs and hogs; companion animals, such as cats and dogs; and a member of the genus Equus, such as horses and donkeys.
  • a composition of the present invention may be delivered to an animal by methods described herein and known in the art, thereby providing an effective amount to the animal.
  • an "effective amount" is an amount effective to inhibit growth of a microbe, prevent the manifestation of signs of the condition, decrease the severity of the signs of the condition, and/or complete remove the signs. It is not required that any composition of the present invention completely inhibit growth of all microbes, or completely cure or eliminate all signs of a condition being treated.
  • Food applications include, for instance, food preservation by inhibiting microbes that spoil food.
  • the term “food” or “food product” encompasses all edible nutritive substances and compositions, including those intended for human consumption as well as consumption by, for instance, livestock.
  • Food and “food product” includes unprocessed, as well as processed, e.g., cooked, nutritive substances and compositions, such as beverages.
  • the expression “present in food” refers to portions of a food that may be resident to harmful bacteria, such as external surfaces, interior surfaces, or the combination thereof.
  • a composition of the present invention may be used in connection with a food product that is susceptible to bacterial growth or degradation.
  • dairy foods include, but are not limited to, cheese, milk, cream, and fermented dairy foods such as yogurt.
  • meats include, for instance, ham, beef, salami, chicken, and turkey, including whole parts or processed meat products made therefrom.
  • Other food products include processed food products including ready to eat meals, entrees, and meats, deli salads, mayonnaise, dressings (including salad dressings), sauces and condiments, pastas, soups, edible oils, fish and fish products, egg products, beverages, aseptically packaged foods, as well as mixtures of the foregoing.
  • a composition of the present invention may be used by mixing with and/or applying on a blendable food product, but may be applied to a surface of solid food products by a dip, rinse, or spray, or by application to the interior of such products, e.g. by injection.
  • the composition may be applied as a marinade, breading, seasoning rub, glaze, colorant mixture, and the like, or as an ingredient to be mixed with and incorporated into the food product,
  • the composition may be indirectly placed into contact with the food surface by applying the composition to food packaging materials, such as a casing or a film, and thereafter applying the packaging to the food surface such that the composition comes into contact with the external food surface.
  • the optimum amount to be used will depend upon the particular food product to be treated and the method used to apply the composition to the food and/or the food surface, but can be determined by routine experimentation.
  • compositions of the present invention include, for instance, use of a microbe, preferably a Bifidobacterium, expressing a compound of the present invention, as a dietary supplement or as a food ingredient.
  • a Bifidobacterium expressing a compound of the present invention is administered to an animal in need thereof.
  • the Bifidobacterium can be administered as a biologically pure culture, or as a mixed culture.
  • a "mixed" culture is one containing a Bifidobacterium and at least one other microbe, preferably a prokaryotic microbe, more preferably a second Bifidobacterium.
  • One method of the present invention provides inhibiting the replication of microbes in the gastrointestinal tract, preferably the large intestine, of an animal by administering to an animal a Bifidobacterium that expresses a compound of the present invention.
  • the method may include measuring the presence in the gastrointestinal tract of the microbe to be inhibited, where a decrease in the presence of the microbe in the animal after administration of the Bifidobacterium indicates inhibition of the replication of the microbe in the gastrointestinal tract of the animal.
  • the types of microbes whose replication can be inhibited include those present in the gastrointestinal tract of an animal when the Bifidobacterium is administered, and microbes that are introduced to the gastrointestinal tract after the Bifidobacterium is administered.
  • a Bifidobacterium expressing a compound of the present invention can also be used in a method for inhibiting the establishment of a microbe in the gastrointestinal tract of an animal.
  • Another probiotic application includes methods for establishing a
  • the method includes administering to an animal a Bifidobacterium that expresses a compound of the present invention.
  • the method also includes measuring the presence in the gastrointestinal tract of the Bifidobacterium over a period of time following the administration.
  • a Bifidobacterium flora is considered to be established in an animal when there is at least about 10 6 of the Bifidobacterium present per gram of feces.
  • the animal is an adolescent or adult human or an infant, including an immature, premature, or mature infant.
  • the present method can be used to establish a Bifidobacterium flora in a healthy human, and in humans that have had their normal intestinal flora modified by, for instance, diarrhea or by drug treatment including antibiotic therapy or chemotherapy.
  • Bifidobacteria are frequently proposed to be associated with good intestinal health primarily because of their overriding dominance in the feces of breast fed infants.
  • clinical feeding studies with exogenous bifidobacteria show they don't remain in the intestine, suggesting they may lose competitive fitness when grown outside the gut.
  • Genomic sequencing of a minimally cultured B. longum strain The power of comparative genomics can provide insights into features that are important for a species to survive and compete in its habitat.
  • the genome sequence of the culture collection strain, B. longum NCC2705 (Schell et al., 2002, Proc Natl Acad Sci USA,
  • the complete genome sequence of this strain was deciphered and consisted of one circular chromosome and two cryptic plasmids, pDOJHIOL and pDOJHIOS that were described previously (Lee and O'Sullivan, 2006, Appl Environ Microbiol 2006, 72:527-535).
  • General characteristics of the B. longum DJOlOA genome The chromosome of B. longum DJOlOA contained 2,375,792 bp, with 60.15% G+C content and 1,990 encoded genes containing four rRNA operons, 58 tRNAs, 6 insertion sequence (IS) families as well as one prophage (Table 1).
  • longum genome contains novel mobile integrase cassettes (MIC) consisting of three different contiguous integrases flanked by an inverted repeat and a palindrome structure sandwiched by two IS3-type IS elements (Fig. 1).
  • MIC novel mobile integrase cassettes
  • Analysis of the genome of B. longum NCC2705 revealed three analogous MIC elements, located in a non-linear fashion relative to strain DJOlOA indicating these elements are indeed mobile (Fig. 9).
  • analysis of the genome sequences of another Bifidobacterium species, B. adolescentis (GeneBank AP009256), as well as other intestinal bacteria, Bacteroides (AEOl 5928)
  • Lactobacillus (CP000033), and E. coli (U00096), did not reveal MIC elements, suggesting these structures may be unique to a subset of closely related bifidobacteria.
  • IS200/605 family 1 1 a refers to unique regions that encode functional or hypothetical genes in DNA regions > 3 kb, b , includes fragmented elements Table 2 Comparison of serine codon usage between chromosomal and piophage genes in strain DJOlOA
  • AGC is compatible to the extra tRNA_Ser in the prophage genome
  • strain DJOl OA This appears to have been replaced in the genome of strain DJOl OA with a different prophage, that is complete and inducible (Lee and O'Sullivan, 2006, Appl Environ Microbiol 2006, 72:527-535) and corresponds with a significant BDI peak substantiating this recent HGT event.
  • the other five unique regions in strain NCC2705 contain largely hypothetical genes or genes of diverse functions without any significant gene clusters. However one of these regions (unique region 4') does encode putative xylan degradation genes, which is a function predicted to be important for competition in the large intestine.
  • this region corresponds to a BDI peak, it suggests it may be a recent acquisition by this strain and its evolution in the large intestine would provide the selective pressure for acquiring this unique region.
  • DJOlOA eight encode significant gene clusters involved in functions predicted to be important for competition in the large intestine, specifically oligosaccharide and polyol utilization, arsenic resistance and lantibiotic production.
  • DJOlOA of which 5 are fully present and 2 are partially present in strain NCC2705 (Fig. l l). It is noteworthy that one of these clusters (Cluster 7 in Fig. 11) contains an ISL3 element in the NCC2705 genome at the precise location of the extra oligosaccharide utilization genes in strain DJOlOA (Fig. 3).
  • a BDI analysis suggested that the extra oligosaccharide gene clusters in strain DJOlOA were not acquired following evolutionary divergence from strain NCC2705, as neither corresponds with a BDI peak (Fig. 2A). The majority of BDI peaks suggesting recent HGT events were the same in both genomes substantiating this analysis.
  • strain NCC2705 does not contain genes involved in polyol metabolism
  • unique region 13 of strain DJOlOA is dedicated to this (Fig. 4), containing genes involved in polyol recognition, transport and dehydration, and there are also some polyol metabolism genes in unique region 11.
  • unique region 13 does coincide with a BDI peak (Fig. 2A), it may represent gene acquisition by strain DJOlOA.
  • a similar polyol locus was found in B.
  • adolescentis ATCC 15703 at a similar genome location (Fig. 4).
  • Arsenic resistance Other unique regions in strain DJOlOA encode gene clusters predicted to be involved in characteristics that would be important for survival and competition in the human intestine.
  • Two operons encoding ATP- dependent arsenic resistance genes are in unique regions 5 and 7 and may be important for intestinal survival as the human intestine contains low concentrations of arsenic from the diet (Ratnaike 2003, Postgrad Med J 2003, 79:391-396).
  • Many intestinal bacteria such as E. coli, Lactobacillus and Bacteroides contain arsenic resistance genes (Fig. 5A), substantiating the competitive advantage for having this ability in the intestine.
  • bacteriocins Lantibiotic production.
  • One exceptionally broad spectrum class of bacteriocins is the lantibiotics, which are post-translationally modified to form lanthionine residues and to date none have been isolated from any bifidobacteria.
  • a 10.2 kb gene cluster encoding all the genes indicative of a lantibiotic was detected in the unique region 12 of strain DJOlOA (Fig. 6A). It was also noted that this unique region did not correspond to a BDI peak, suggesting a likely loss of this region from strain NCC2705.
  • strain DJOlOA was grown in a typical laboratory medium without pH control for ⁇ 1,000 generations. Isolated colonies were then screened for seven unique regions encoding functions predicted to be useful for survival in the human gut. One of these regions (no. 12) involved in the lantibiotic production was found to be missing from 40% of the isolates (Fig. 14) substantiating this hypothesis.
  • DJOcdl in a simulated anaerobic fecal environment revealed that B. longum DJOlOA had a significantly greater ability to compete against both E. coli and C. difficile (Fig 8).
  • the significantly greater reduction in both these groups of bacteria by B. longum DJOlOA supports the genome analysis hypothesis that the genome reduction exhibited in pure-culture growth may compromise a bacterium's ability to compete in its original environment.
  • Bifidobacterium longum strain DJOlOA was isolated from a healthy young adult's feces (Islam, 2006, MS thesis. University of Minnesota, Department of Food Science and Nutrition) and B. animalis subsp. lactis BB 12 was obtained from Chr. Hansen (Denmark).
  • B. animalis subsp. lactis strains S l , S2, and Sl 4 are genetically distinct isolates from fermented foods.
  • Clostridium difficile DJOcdl was isolated from fresh feces by plating on Clostridium difficile Selective Agar (BD Diagnostics) and speciated using a sequence analysis of its 16S rRNA gene.
  • coli DJOecl was obtained from fresh feces by plating on MacConkey agar (Difco) and speciated using a sequence analysis of its 16S rRNA gene.
  • E. coli K12 was obtained from the American Type Culture Collection (ATCC). Bifidobacteria were cultivated at 37 0 C in MRS (Difco) supplemented with 0.05% L-cysteine ⁇ Cl (Sigma), Bifidobacteria Low-Iron Medium (BLIM) (Islam, 2006, MS thesis.
  • BFM Bifidobacteria Fermentation Medium
  • JGI US Department of Energy Joint Genome Institute
  • Gap closure and genome sequence finishing was carried out at Fidelity Systems using ThermoFidelase-Fimer direct genome sequencing technology (Slesarev et al., 2002, Proc Natl Acad Sci USA, 99:4644- 4649). Shotgun reads with and without IS30 elements covering A5, A6 and A7 loci were identified and assembled separately. The presence and location of long repeated sequences in genomic DNA samples were verified by direct genomic sequencing of the unique/repeat junctions. The resolution of the most complex high GC-rich repeats was achieved by sequencing of PCR products amplified with a hybrid TopoTaq DNA polymerase with increased strand displacement capacity.
  • the base- deviation index (BDI) was performed by scaled ⁇ 2 analysis of Artemis8. To predict gene functions, the two conserved protein domain databases of GAMOLA and InterProScan were used. COG functional categories were used for functional classification of all genes in both B. longum genome sequences. Molecular techniques. General sequencing was conducted using a Big-Dye terminator and ABI Prism 3730x1 Auto sequencer (Applied Biosystems). All PCR primers are listed in Table 5. For Southern blot analysis of unique region 12, a 646 bp probe from the lanM gene was obtained using PCR with LANT-F and LANT-R primers. Probes for IS elements were also PCR amplified.
  • Probes were DIG-labeled and hybridized with digested genomic DNA according to the manufacturer's instructions (Roche). Pulsed field gel electrophoresis of Xbal-digested B. longum genomes was performed using a CHEF-DR III Variable Angle Pulsed Field Electrophoresis System according to manufacturer's instructions (Bio-Rad).
  • ISL3-R 5 '-ATCAGGGCGATGAGGTTGG -3' a as defined in the text , b, Y (OT), R (AJG), H (AJOT), D (A/G/T), N (A/T/G/C), W (AJT) SEQ ID NOs 26-55
  • BLIM was supplemented with different concentrations of sodium arsenite (AsO2-, 1 to 100 mM) and sodium arsenate (AsO3-, 1 to 500 mM).
  • Freshly grown cultures were sub-inoculated into the arsenite/arsenate media and incubated anaerobically at 37°C for 48 hours.
  • Adaptation of B. longum DJOlOA to in vitro fermentation conditions B. longum DJOlOA was grown in BFM continuously up to ⁇ 1,000 generations. The culture was then serially diluted and plated on BFM agar. Ten colonies were randomly selected for analysis.
  • Bioassay for lantibiotic activity B. longum DJOlOA was inoculated into the center of an MRS agar plate and incubated anaerobically at 37°C for 2 days. After incubation, molten 0.5% top agar of the same medium containing 1% of an indicator strain was overlaid on the plates prior to incubation.
  • B. longum strain DJOlOA was grown in MRS broth supplemented with 0.05% L-cysteine-HCl (Sigma) or Bifidobacteria Low-Iron Medium (BLIM). The broth was then used to cover the surface of an MRS agar plate supplemented with 100 mM PIPES or a BLIM agar plate supplemented with 100 mM PIPES. The plates were incubated under under anaerobic conditions using either the BBL Anaerobic system (BBL) or the Bactron II Anaerobic/Environmental Chamber (Sheldon Manufacturing) at 37°C for 2 days. Twenty plates were used.
  • BBL BBL Anaerobic system
  • Bactron II Anaerobic/Environmental Chamber Sheldon Manufacturing
  • the cells and agar medium were crushed and the mixture was extracted with 95% methanol using routine methods. The extraction was allowed to proceed overnight. The final volume was placed in a SpeedVac to remove the methanol and concentrate the lantibiotic.
  • the remaining agar was removed by size fractionation using Millipore CentriPrep filtration for partial purification.
  • the extract was fractionated with a Centriprep-30 (30 kDa cut-off) by centrifugation twice at 1,500 X g for 15 minutes and 10 minutes, respectively, and the filtrate ( ⁇ 30 kDa) transferred to a Centriprep- 10 (10 kDa cut-off). This was subjected to centrifugation twice at 3,000 X g for 40 minutes and 10 minutes, respectively.
  • the filtrate was transferred to a Centriprep-3 (3 kDa cut-off). This was subjected to centrifugation twice at 3,000 X g for 95 minutes and 35 minutes, respectively.
  • the fractionated solution (3-10 kDa) was collected and concentrated by SpeedVac machine.
  • the concentrated lantibiotic was resuspended, and immediately tested using a diffusion method.
  • Agar plates were made with MRS or BLIM and supplemented with PIPES, and a well of 5 millimeters cut into the middle of each plate.
  • One hundred microliters of the suspended lantibiotic were placed in the well and allowed to diffuse until the liquid in the well was gone. The plates were then overlayed with the indicator strain.
  • the lantibiotic inhibited the growth of the indicator strains M. leuteus, L. lactis, S. aureus, S. epidermdis, E. coli, S. marcescens, and P. vulgaris.
  • the lantibiotic did not inhibit P. aeuruginosa in this assay; however, it is not possible to conclude from these data that the lantibiotic will not inhibit P. aeuruginosa.
  • the lantibiotic from example 2 was placed in a boiling water bath for 10 minutes and then tested for activity using the diffusion method and M. leuteus as the indicator strain. The lantibiotic was active after boiling for 10 minutes.
  • Proteolytic analysis of the extracted Bifidobacterum lantibiotic Stock solutions of the proteolytic enzymes were prepared as follows. Pepsin (Sigma No. P6887) was dissolved in 2 mM Tris ⁇ Cl or water at pH 2, 37°C, at a concentration of 34600 U/ml (10 mg/ml). Pronase E (Sigma No. P5147) was dissolved in 20 mM Tris-HCl or 50 mM phosphate buffer at pH 7.5, 37°C, at a concentration of 5500 U/ml (500 mg/ml). ⁇ -Chymotrypsin (Sigma No. C4129) was dissolved in 80 mM Tris ⁇ Cl at pH 7.8, 25°C, at a concentration of 5100 U/ml (100 mg/ml).
  • Proteinase K (Sigma P2308) was dissolved in 10 mM Tris-HCl at pH 7.5, 37°C, at a concentration of 6000 U/ml (200 mg/ml).
  • Trypsin MP biochemical (ICN) No. 15021310
  • pH 7.6, 25°C was used at the concentration 4750 U/ml (50 mg/ml).
  • Thermolysin (Fluka No. 88303), pH 7.2, 37 0 C, was used at the concentration 6000 U/ml (150 mg/ml).
  • concentration 6000 U/ml 150 mg/ml.
  • the proeolytic enzymes were added to separate 100 mis of the lantibiotic as follows: pepsin, 5 ⁇ l (173 U); pronase E, 20 ⁇ l (1 10 U); ⁇ -Chymotrypsin, 20 ⁇ l (102 U); proteinase K, 20 ⁇ l (120 U); trypsin, 20 ⁇ l (95 U); and thermolysin, 20 ⁇ l (120 U).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Environmental Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Dentistry (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Pest Control & Pesticides (AREA)
  • Biotechnology (AREA)
  • Agronomy & Crop Science (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Cosmetics (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
PCT/US2008/070511 2007-07-20 2008-07-18 Lantibiotics from bifidobacterium longum and uses thereof Ceased WO2009058440A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CA2693307A CA2693307A1 (en) 2007-07-20 2008-07-18 Lantibiotics and uses thereof
NZ582529A NZ582529A (en) 2007-07-20 2008-07-18 Lantibiotics from bifidobacterium longum and uses thereof
EP08845118.2A EP2176284B1 (en) 2007-07-20 2008-07-18 Lantibiotics and uses thereof
DK08845118.2T DK2176284T3 (da) 2007-07-20 2008-07-18 Lantibiotika og anvendelser deraf
JP2010517194A JP2010534063A (ja) 2007-07-20 2008-07-18 ランチビオティックス及びこれらの使用
AU2008319177A AU2008319177B2 (en) 2007-07-20 2008-07-18 Lantibiotics from bifidobacterium longum and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US96137407P 2007-07-20 2007-07-20
US60/961,374 2007-07-20

Publications (2)

Publication Number Publication Date
WO2009058440A2 true WO2009058440A2 (en) 2009-05-07
WO2009058440A3 WO2009058440A3 (en) 2009-09-24

Family

ID=40432080

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/070511 Ceased WO2009058440A2 (en) 2007-07-20 2008-07-18 Lantibiotics from bifidobacterium longum and uses thereof

Country Status (9)

Country Link
US (2) US7960505B2 (https=)
EP (1) EP2176284B1 (https=)
JP (1) JP2010534063A (https=)
KR (1) KR20100043252A (https=)
AU (1) AU2008319177B2 (https=)
CA (1) CA2693307A1 (https=)
DK (1) DK2176284T3 (https=)
NZ (1) NZ582529A (https=)
WO (1) WO2009058440A2 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8933193B2 (en) 2007-07-20 2015-01-13 Regents Of The University Of Minnesota Lantibiotics and uses thereof

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX350993B (es) * 2010-10-28 2017-09-27 Procter & Gamble Composiciones para el cuidado personal que comprenden una piritiona y un quelante de hierro.
EP2532232A1 (en) 2011-06-10 2012-12-12 InterMed Discovery GmbH Long chain glycolipids useful to avoid perishing or microbial contamination of materials
CN104302307B (zh) * 2012-02-27 2018-10-26 奥洁克公司 羊毛硫抗生素mu1140的变体以及具有改善的药理性质和结构特征的其它羊毛硫抗生素
US9573980B2 (en) 2013-03-15 2017-02-21 Spogen Biotech Inc. Fusion proteins and methods for stimulating plant growth, protecting plants from pathogens, and immobilizing Bacillus spores on plant roots
GB201409451D0 (en) 2014-05-28 2014-07-09 Ipabc Ltd Antimicrobial preparations, methods for preparing the same and uses thereof to combat microorganisms
US20200181595A1 (en) * 2015-05-12 2020-06-11 Novozymes A/S Bacillus Licheniformis Host Cell
CN106188253B (zh) * 2016-08-26 2020-08-18 上海交通大学 抗菌肽Lexapeptide及其制备方法和用途
US10738338B2 (en) 2016-10-18 2020-08-11 The Research Foundation for the State University Method and composition for biocatalytic protein-oligonucleotide conjugation and protein-oligonucleotide conjugate
CN108170988B (zh) * 2018-01-23 2021-01-01 成都希盟泰克科技发展有限公司 基于bim技术的隧道开挖三台阶七步方法
CN113905715B (zh) 2019-06-28 2025-04-15 宝洁公司 光增强处理方法
CA3187327A1 (en) * 2020-06-19 2021-12-23 Healthy Cow Corporation Ready-to-use probiotic compositions and uses thereof
JP7570216B2 (ja) * 2020-11-30 2024-10-21 株式会社ヤクルト本社 ヒト腸内に長期定着する微生物のスクリーニング方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020128186A1 (en) 1997-06-10 2002-09-12 Hillman Jeffrey Daniel Antimicrobial polypeptide, nucleic acid, and methods of use

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5260271A (en) * 1988-06-22 1993-11-09 Applied Microbiology, Inc. Nisin compositions for use as enhanced broad range bactericides
EP1294851A2 (en) * 2000-06-19 2003-03-26 Regents Of The University Of Minnesota Siderophores-producing bifidobacteria thereby and uses thereof
CA2404356A1 (en) 2002-09-18 2004-03-18 Canadian Inovatech Inc. Gram-positive antibacterial composition and method for use
EA200500804A1 (ru) 2002-12-10 2005-12-29 Биосинексус Инкорпорейтед Топические противоинфекционные композиции
WO2005107787A1 (en) * 2004-05-06 2005-11-17 Molichem Medicines, Inc. Treatment of membrane-associated diseases and disorders using lantibiotic containing compositions
EP1753445A4 (en) * 2004-05-06 2009-05-20 Molichem Medicines Inc TREATMENT OF EYE DISEASES AND EYE TREATMENTS WITH LANTIBIOTIC COMPOSITIONS
US20060024414A1 (en) * 2004-07-30 2006-02-02 Kraft Foods Holdings, Inc. Methods for preserving food products
DK2176284T3 (da) 2007-07-20 2013-10-14 Univ Minnesota Lantibiotika og anvendelser deraf

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020128186A1 (en) 1997-06-10 2002-09-12 Hillman Jeffrey Daniel Antimicrobial polypeptide, nucleic acid, and methods of use

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8933193B2 (en) 2007-07-20 2015-01-13 Regents Of The University Of Minnesota Lantibiotics and uses thereof

Also Published As

Publication number Publication date
US7960505B2 (en) 2011-06-14
WO2009058440A3 (en) 2009-09-24
JP2010534063A (ja) 2010-11-04
CA2693307A1 (en) 2009-05-07
US20110305763A1 (en) 2011-12-15
US20090068121A1 (en) 2009-03-12
US8933193B2 (en) 2015-01-13
DK2176284T3 (da) 2013-10-14
EP2176284A2 (en) 2010-04-21
KR20100043252A (ko) 2010-04-28
AU2008319177A1 (en) 2009-05-07
AU2008319177B2 (en) 2012-07-05
EP2176284B1 (en) 2013-09-04
NZ582529A (en) 2012-01-12

Similar Documents

Publication Publication Date Title
US7960505B2 (en) Lantibiotics and uses thereof
EP0821736B1 (en) Bacteriocins
KR101372200B1 (ko) 락토바실러스 플란타룸(Lactobacillus plantarum) SY99 및 이의 용도
US10781236B2 (en) Bacteriocin composition and method
JP2010207227A (ja) 新規な抗菌性ポリペプチド及び使用方法
Strompfová et al. Effect of bacteriocin-like substance produced by Enterococcus faecium EF55 on the composition of avian gastrointestinal microflora
WO2016176729A1 (en) Bacteriocin polypeptides and uses thereof
EP2280990B1 (en) Nisin derivatives and the use thereof
Franz et al. The genus Enterococcus: biotechnological and safety issues
Santos et al. Bacteriocins as antimicrobial and antibiofilm agents
WO2018195467A1 (en) Lantibiotics, lantibiotic-producing bacteria, compositions and methods of production and use thereof
AU2017296061B2 (en) Lantibiotic variants and uses thereof
AU748950B2 (en) Zoocin A immunity factor
Nabizadeh et al. Bacteriocins and bacteriocin-like compounds synthesized by lactic acid bacteria
WO2022140630A1 (en) Altering the normal balance of microbial populations
US20230381249A1 (en) Probiotic strain for countering caries pathogens
Collins An investigation into antimicrobial production in the Lactobacillus genus and the fish microbiome
Oladipo et al. Bioprotective potential of bacteriocinogenic Enterococcus gallinarum strains isolated from some Nigerian fermented foods, and of their bacteriocins
Kumar LANTIBIOTICS A NOVEL ANTIMICROBIAL AGENTS: A REVIEW.
Fen Isolation, Purification and Mode of Action of Antimicrobial Peptides Produced by Lactic Acid Bacteria of Dairy Origin
LE CHENG Novel Synthetic Antimicrobial Peptides with In-Vivo and In-Vitro Activity Against Streptococcus Pneumoniae
Le Novel synthetic antimicrobial peptides with In-Vivo and In-Vitro activity against Streptococcus Pneumoniae/Le Cheng Foh
CN105188730A (zh) 用作抗菌产品的Garvicin A

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08845118

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 582529

Country of ref document: NZ

Ref document number: 2008319177

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2693307

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2010517194

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2008319177

Country of ref document: AU

Date of ref document: 20080718

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2008845118

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20107003649

Country of ref document: KR

Kind code of ref document: A