WO2009046724A2 - Polymorphisms of mbl - Google Patents

Abstract

A method for determining a mannan-binding lectin (MBL) genotype in poultry is provided, wherein the serum level of MBL is determined. Specifically, a number of genetic markers is provided for genotyping poultry in respect of MBL. Also provided is a method for determining the susceptibility to an infectious disorder in poultry, comprising detecting the presence or absence of at least one genetic marker that is indicative of MBL level. Finally, a kit is provided for determining the susceptibility to an infectious disorder in poultry, comprising at least one binding member, for example an oligonucleotide primer, for detection of at least one genetic marker indicative of MBL

Description

Polymorphisms of MBL

Field of invention

The present invention relates to a method for determining a genotype of poultry in relation to high and low levels of mannan-binding lectin, detecting the presence or absence of genetic markers indicative of mannan-binding lectin levels. The present invention relates to a kit for determining a genotype of an animal.

Background of invention A number of structural oligosaccharide components on the surface of microorganisms are selectively recognised by mannan-binding lectin (MBL), also named mannan-binding protein or mannose-binding protein (MBP), or mannose-binding lectin. Upon binding of carbohydrates on microbial surfaces, MBL mediates the activation of the complement cascade, a series of enzymatic activation steps, which eventually label the target for destruction by phagocytosis or by lysis of the microorganism

(Law & Reid, 1995). MBL is also able to bind directly to phagocytotic cells via a receptor and to mediate phagocytosis.

MBL is considered as an important part of the innate immune system, that is, the immune system which at time of birth is operational, in contrast to the adaptive im- mune defence which only during infancy obtains its full power of protecting the body (Janeway et al., 1999). Therefore, MBL plays a major role in the first line innate immune defence against bacteria, viruses and parasites.

In humans it has been demonstrated that the presence of low MBL concentrations in serum is associated with an increased frequency of infectious diseases for example diarrhea (Sumiya et al. 1991 ; Garret et al. 1992). The observed low concentration of MBL in serum is due to the presence of three nucleotide substitutions in exon 1 of the human MBL gene. This results in reduced ability to form the correct three dimensional structure of the MBL protein and increase the degradation of the protein (Garret et al. 1995; Madsen et al. 1994). The concentration of MBL in serum also varies in individuals, wherein polymorphisms in the promoter region of the human MBL gene are identified (Naito et al. 1999; Madsen HO et al. 1995). It is reported that the MBL concentration is increased up to three times after/during an infection and MBL is consequently considered to be an acute phase protein (Thiel et al.1992). A mouse line has been established which is unable to produce MBL (MBL-null mice). Intravenous inoculation of MBL-null mice with Staphylococcus aureus resulted in the death of all null mice within 48 hours. In contrast, only 48% of wild type mice died upon Staphylococcus aureus inoculation (Shi et al. 2004).

In analogy with mammals, MBL is synthesised in the liver in poultry after which MBL is secreted into the blood (Laursen et al. 1998a and b). Similarly, it has been demonstrated that chicken MBL is an acute phase protein the level of which is increased 2 to 3 times during infection (Nielsen et al. 1998 and 1999).

Expression of chicken MBL mRNA is highest in liver, but reasonably high signals are seen in larynx, abdominal air sac, and infundibulum. A lower expression level is found in thymus, and a faint signal can be observed in ovary and uterus (Hogenk- amp et al., 2006).

The chicken MBL gene has been cloned (Laursen et al. 1998)

Due to the constitutive emergence of virulent microorganisms, infectious diseases still constitute a major problem in animal production despite antibiotic and vaccina- tion programmes. A need for the ability to select animals in which the animals own immune defence is better suited to withstand microorganisms consequently exists. Thus, the introduction of such selection of animals with improved immune defence and the implementation of improved immune defence measures in breeding and management procedures is of significant economic importance in animal breeding. The present invention identifies at least one genetic marker in the MBL gene of chicken which may be used to select animals which have improved immune defence characteristics.

Summary of invention One aspect of the present invention provides a method for determining the genotype of poultry in relation to high and low levels of mannan-binding lectin, comprising, in the genetic material of a sample from said animal detecting the presence or absence of at least one genetic marker that is indicative of mannan-binding lectin levels. Animals that have a high level of mannan-binding lectin are better suited to withstand microorganisms that may be virulent causing infectious diseases if the microorganisms are not combated effectively by the animal. Embodiments of this aspect comprise methods, wherein the at least one genetic marker is localised in a regulatory region of a gene encoding mannan-binding lectin; methods, wherein the at least one genetic marker is localised in the promoter region of a gene encoding mannan-binding lectin; methods, wherein the at least one genetic marker is located in the chicken MBL gene; methods, wherein the at least one genetic marker is localised in the promoter region of a chicken mannan-binding lectin gene; methods, comprising detecting the presence or absence of polymorphic markers in linkage disequilibrium with the at least one genetic marker; methods, wherein said poultry is selected from the group consisting of chicken, turkey, fowl, duck, pheasant and geese; methods, wherein said poultry is chicken; methods, wherein the at least one genetic marker is located in the MBL gene; methods, wherein the at least one genetic marker is located in the regulatory sequence of the chicken MBL gene; methods, wherein the at least one genetic marker is the poly- morphism corresponding to nucleotide position +43 and +44 of the chicken MBL gene; methods, wherein the at least one genetic marker is the polymorphism corresponding to nucleotide position -46 of the chicken MBL gene; methods, wherein the at least one genetic marker is the polymorphism corresponding to nucleotide position -49 of the chicken mannan-binding lectin gene; methods, wherein the at least one genetic marker is the polymorphism corresponding to nucleotide position -166 and -167 of the chicken MBL gene of the chicken mannan-binding lectin gene; methods, wherein the at least one genetic marker is the polymorphism, corresponding to nucleotide position -170 of the chicken mannan-binding lectin gene; methods, wherein the at least one genetic marker is the polymorphism, corresponding to nu- cleotide position -177 to -188 of the chicken mannan-binding lectin gene; methods, wherein the at least one genetic marker is the polymorphism, corresponding to nucleotide position -222 of the chicken mannan-binding lectin gene; methods, wherein the at least one genetic marker is the polymorphism, corresponding to nucleotide position -227 to -229 of the chicken mannan-binding lectin gene; and/or methods, wherein the at least one genetic marker is the polymorphism, corresponding to nucleotide position -247 of the chicken mannan-binding lectin gene. The invention also relates to any of the above-mentioned embodiments, wherein the determination of the presence or absence of said at least one genetic marker is indicative of poultry's increased or decreased ability to avoid or recover from disease. Another aspect of the invention relates to a kit for use in determining the genotype of poultry by detecting the presence or absence of at least one genetic marker that is indicative of mannan-binding lectin levels. Such a kit will be useful in for example the identification of desired breeding stocks that have improved characteristics in com- bating for example infectious diseases caused by for example virulent virus, fungi and bacteria. The kit of the present invention comprise in one embodiment at least one oligonucleotide sequence able to detect the at least one genetic marker indicative of mannan-binding lectin.

In a third aspect, the present invention relates to a method for determining the genotype of poultry in relation to mannan-binding lectin (MBL), comprising in the genetic material of a sample from said animal detecting the presence or absence of at least one genetic marker.

A fourth aspect relates to a method of determining the susceptibility to an infectious disorder in poultry, comprising detecting in genetic material of a sample from said animal the presence or absence of at least one genetic marker that is indicative of MBL level.

A fifth aspect of the present invention relates to a kit for determining the susceptibility to an infectious disorder in poultry, comprising at least one binding member for detection of at least one genetic marker indicative of MBL.

The binding member is preferably an oligonucleotide primer comprising a consecu- tive sequence of at least 10 nucleotides selected from any region of SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, and/or 21 , and/or the complementary sequences thereof.

Description of Drawings Figure 1 : Sequence comparison of the promoter region of the chicken MBL gene. The H and the L shown to the left in the figure denotes the consensus sequence for lines of chicken with high or low levels of serum MBL, respectively. Polymorphic sites are indicated by an asterix and the number of the polymorphic site is surrounded by a circle, the nucleotide position of the polymorphic site is also provided. SNP 1 (5' UTR double mutation) nt + 43 to + 44:, C → T and G→ A SNP 2 (promoter) nt - 46: A → G

SNP 3 (promoter) nt - 49: A → G SNP 4 (promoter double mutation) nt - 166 to - 167, A → T and G → T

SNP 5 (promoter) nt - 170 T → G SNP 6 (promoter) nt - 177 to - 188, Id → GGGGGGTGTGT

SNP 7 (promoter) nt - 222 Id → C

SNP 8 (promoter) nt - 227 to - 229, G → T, Id → T, and Id → T

SNP 9 (promoter) nt - 247 Id → A

Figure 2: The MBL concentration in serum in low and high MBL chicken lines of the F8 generation. Chicken MBL concentration is given as μg/ml serum.

Figure 3: MBL RFLP polymorphisms of high and low MBL lines.

Figure 4 shows the expression analysis of the MBL gene in 10 H and 10L chicken. The hybridisation pattern using a MBL specific probe is shown in the right hand panel, whereas a probe for MHC Il is shown in the left hand panel.

Figure 5: The Acute phase response after Infectious Bronchitis Virus (IBV) infection in animals with high or low MBL in serum. The curve shows the mean MBL serum concentration in chickens with high MBL (n = 7) and chickens with low MBL (n = 8) at days 21 , 14, 4 before inoculation and at day 1 , 2, 3, 4, 5, 7, 10, 14, 17, and 21 after inoculation with IBV at 0900 h in the morning at day 0. The MBL level shown at day 0 was calculated as mean of days -21 , -14, and -4 for each individual chicken.

Figure 6: Specific IBV antibodies after IBV infection in animals with high or low MBL in serum. The curve shows the IBV specific antibody titer in chickens with high MBL (n = 7) and chickens with low MBL (n = 8) at days 0, 7, 14, and 21 post inoculation with IBV.

Figur 7: RT-PCR of IBV in trachea and cloaks. IBV was measured in trachea and cloaks swabs by RT-PCR at all days post inoculation. The samples from the high MBL line (n = 7) and the low MBL line (n = 8) were pooled into 2 x 2 samples. IBV was only measurable in samples taken 3 days post infection and only in pools from the low MBL lines.

Figure 8 The acute phase response against IBV in relation to time of inoculation

The mean MBL acute phase response in chickens inoculated with IBV at different times. One group was mock infected at 0900 h, one group was IBV infected at 0900 h and one group was IBV infected at 2100 h. The acute phase response was present as a percentage up regulation in relation to a determined basic MBL level in each chicken. Chickens used in this experiment originate from a private company. The curves were built up as follows: five chickens from each experiment were bled on Days 1 , 3, 5, 9, 14, and 18 Pl and five chickens were bled on Days 2, 4, 7, 1 1 , 16, and 21. The values from these 10 chickens from each experiment were gathered in one curve and the mean value of chickens bled at the same day was calculated.

Figure 9 shows specific IBV antibodies levels in relation to time of inoculation. The mean infectious bronchitis virus (IBV) specific antibody titer in chickens inoculated with IBV at different times (further details in figure 8). One group was mock infected at 0900 h, one group was IBV infected at 0900 h and one group was IBV infected at 2100 h. The curves were built up as follows: five chickens from each experiment were bled on Days 5, 9, 14, and 18 Pl and five chickens were bled on Days 7, 1 1 , 16, and 21. The values from these 10 chickens from each experiment were gathered in one curve and the mean value of chickens bled at the same day was calculated.

Figure 10: The complement activation values measured as deposition of human complement factor C4 on the cMBL/MASP (chicken mannan-binding lectin/MBL- associated serine protease) complex. The means of two animals of each indicated experimental group are shown. The MBL concentration was measured in μg/mL whereas the C4 deposition was measured as mUnits/mL. A: Controls; B: Inoculated at 090O h; C: Inoculated at 210O h.

Figure 1 1 : The basis serum MBL concentration in animals inoculated with Pas- teurella multocida. Chickens from a indigenous Vietnamese breed (Ri) were blood sampled and analysed for serum concentration of MBL before inoculation with P. multocida. Chickens tested positive for P. multocida in spleen 4 weeks post inocula- tion are shown in one group (pos) and chickens tested negative in another group (neg).

Figure 12: Sequence comparison of the 5'region of chicken MBL gene. The consen- sus sequences T1 -T8 shown to the left in the figure denotes the consensus sequence for different haplotypes of genetic marker polymorphisms of the present invention associated with high or low level of serum MBL and increased or decreased susceptibility to disease. Polymorphic sites SNP1 1 -19 are indicated by asterixes and the number of the polymorphic site indicated under the sequence at the respective positions, with the nucleotide position of the polymorphic site also being provided. The lower sequence represents a chicken MBL consensus sequence, and the nucleotide number of that consensus sequence are provided in the left panel relative to the transcriptional start codon, which first nucleotide is numbered 1.

Figure 13: Mean concentration (with 95% Cl) of Mannan-binding lectin (MBL) in the serum of two chicken breeds, the indigenous Vietnamese Ri and the commercial Luong Phuong, at week 0 and 4 post inoculation with 2.3 x 10⁶ CFU P. multocida.

Figure 14: Baseline serum MBL concentrations in Ri chickens with (positive) or without (negative) spleen invasion of P. multocida . All chickens had been experimentally infected with 2.3 x 10⁶ CFU P. multocida.

Figure 15: Mean specific antibody response (with 95% Cl) to P. multocida in chickens of two breeds, the indigenous Vietnamese Ri and the commercial Luong Phuong recorded at weeks 0,1 , 2, 3 and 4 p.L The chickens (n=100 for each breed) were inoculated with 2.3 x 10⁶ CFU P. multocida in 0.5 ml solution, and the specific antibody titer was determined using the FlockCheck Pm (Idexx).

Figure 16: Correlation between base line serum MBL concentrations (x-axes in μg/ml) and specific antibody titers (y-axes) in Luong Phuong chickens at weeks 1 , 2, 3 and 4 after inoculation with 2.3 x 10⁶ CFU P. multocida. Statistically significant correlation was found at week 1 , 2 and 4 p.i. (p < 0.05). r2 is the fraction of the variance in Y that can be explained by the variation in X and vice versa. Fig. 17. A: Mean basic MBL values in 5 commercial chicken lines: Hellevad (He), ISA Brown (ISA), Lohman Selected Leghorn (LSL), Lohmann Braun (LB) and Bab- cock B 380 (Babcock). MBL was measured in serum from 20 randomly picked chickens at each timepoint from the flocks ISA 1 , ISA 2, LSL 1 , LSL 2, LB 1 and LB 2. In addition measurements from 25 He at 6 weeks of age and from 22 He of varying ages were obtained. Data are shown as mean MBL +/- SE. B: Mean MBL values in 8 Line 22 chickens followed from 3 weeks of age until 42 weeks of age. Data are given as mean MBL +/- SE.

Fig. 18. Changes in serum MBL of Hellevad chickens, measured 0, 2, 4 and 6 days post inoculation in chickens subjected only to saline (controls), and chickens inoculated with 106, 108 and 1010 cfu E.coli in a saline solution. n=10 in all groups. Bars indicate +/- SE.

Fig. 19. Daily weight gain (g/day) during the whole experimental period. Weight gain is shown for the chickens of the MBL H-type and MBL L-type in each of the experimental groups. Bars indicate +/- SE (n = 16 per column).

Fig. 20. Daily weight gain (g/day) during the whole experimental period. Weight gain is shown for the chickens of the MBL High-type and MBL Low-type in each of the experimental groups: no treatment (I-E-), E.coli alone (I-E+), IBDV alone (I+E-) or IBDV and E.coli (I+E+). Bars indicate +/- SE (n = 16 per column). Together IBDV and E.coli compromises daily weight gain significantly, and to a greater extent in the MBL Low animals than in the MBL High animals.

Fig. 21 . Variation in mean MBL serum concentrations for A: H-type chickens with a maximum of more than 30 μg/ml B: L-type chickens with a maximum of less than 1 1 μg/ml. n = 16 per time-point in each of the treatment groups I-E-, I-E+, I+E- and l+ E+ of both the H-type and the L-type groups. Bars indicate ± SE.

Fig. 22. E.coli antibody titres at day 28. Columns show the mean antibody titre for H- type and L-type chickens in each treatment group (n = 16 per column). Bars indicate +/- SE. Fig. 23. At day 28, peripheral mononuclear blood cells from chickens of the I-E- and the I+E+ groups were separated and grown in the presence of conA. After 3 d in culture, cells were stained with CD4-RPE (20 μg ConA/ml) or CD8-RPE (10 μg ConA/ml) and the proportion of proliferated A: CD4+ cells and B: CD8+ cells were determined. Columns show mean proportions of proliferated cells for H-type and L type chickens in the two treatment groups tested, and bars indicate +/- SD (n = 5 per column).

Detailed description of the invention One primary aspect of the present invention is to enable the identification of animals with genetic traits for a desirable MBL level. This is achieved by a method in which the genetic determinant for MBL levels in animals is detected. The present invention thus in one aspect relates to a method for determining the genotype of poultry in relation to high and low levels of MBL, comprising, in the genetic material of a sam- pie from said animal detecting the presence or absence of at least one genetic marker that is indicative of mannan-binding lectin levels. In particular, the method comprises detecting the presence of at least one genetic marker. Specifically, the genetic marker may be polymorphisms in the MBL gene, such as in the coding region of MBL, for example an untranslated region of the MBL gene, such as in a regulatory sequence of the MBL gene (the promoter region).

Poultry

According to the present invention the term "poultry" refers to poultry of any breed.

In the present context the term poultry refers to any bird species subject to breeding, and is meant to include fowl, chicken, turkey, ducks, pheasant and/or geese. Any of the various species of poultry is included in the term. Thus, in one embodiment of the methods and kits of the present invention, said poultry is selected from the group consisting of chicken, turkey, fowl, duck, pheasant and/or geese. In a specific embodiment, the poultry is chicken. Accordingly, one example of poultry covered by the term is thus chicken, such as fowl, such as turkey, such as ducks, for example geese. Poultry, whether female or male are within the scope of the present invention, Also, both new-hatched birds and adult birds are included in the term. Furthermore, the term does not refer to a particular age of the birds. Genetic material

"Genetic material" includes any nucleic acid and can be a deoxyribonucleotide or ribonucleotide polymer in either single or double-stranded form. The genetic material may be obtained from bird or poultry as described elsewhere herein by methods known to a skilled person.

Nucleotide

"Nucleotides" are generally a purine (R) or pyrimidine(Y) base covalently linked to a pentose, usually ribose or deoxyribose, where the sugar carries one or more phos- phate groups. Nucleic acids are generally a polymer of nucleotides joined by 3'5' phosphodiester linkages. As used herein "purine" is used to refer to the purine- bases, A (adenine) and G (guanosine), and more broadly to include the nucleotide monomers, deoxyadenosine-5'- phosphate and deoxyguanosine-5'-phosphate, as components of a polynucleotide chain.

A "pyrimidine" is a single-ringed, organic base that forms nucleotide bases, cytosine (C), thymine (T) and uracil (U). As used herein "pyrimidine" is used to refer to the pyrimidine bases, C, T and U, and more broadly to include the pyrimidine nucleotide monomers that along with purine nucleotides are the components of a polynucleo- tide chain.

Linkage disequilibrium

In general the term "linkage", as used in population genetics, refers to the co- inheritance of two or more non-allelic genes or sequences due to the close proximity of the loci on the same chromosome, whereby after meiosis they remain associated more often than the 50% expected for unlinked genes. However, during meiosis, a physical crossing between individual chromatids may result in recombination. "Recombination" generally occurs between large segments of DNA, whereby contiguous stretches of DNA and genes are likely to be moved together in the recombina- tion event (crossover). Conversely, regions of the DNA that are far apart on a given chromosome are more likely to become separated during the process of crossing- over than regions of the DNA that are close together. Polymorphic molecular markers, like single nucleotide polymorphisms (SNPs), are often useful in tracking mei- otic recombination events as positional markers on chromosomes. The pattern of a set of markers along a chromosome is referred to as a "Haplotype". Accordingly, groups of genes on the same small chromosomal segment tend to be transmitted together. Haplotypes along a given segment of a chromosome are gen- erally transmitted to progeny together unless there has been a recombination event. Absent a recombination event, haplotypes can be treated as alleles at a single highly polymorphic locus for mapping.

Furthermore, the preferential occurrence of a effector gene in association with spe- cific alleles of linked markers, such as SNPs, is called "Linkage Disequilibrium" (LD). This sort of disequilibrium generally implies that most of the effector chromosomes carry the same mutation and the markers being tested are relatively close to the effector gene (s).

Sample

The method according to the present invention includes analyzing a sample of an animal, wherein said sample may be any suitable sample capable of providing the genetic material for use in the method. The genetic material may for example be extracted, isolated and purified if necessary from a eggs, blood sample for example serum, or plasma,, a tissue sample (for example spleen, liver, and bursa), clipping of a body surface (feather), and/or semen. The samples may be fresh or frozen.

Genetic marker

One aspect of the present invention relates to a method for determining the geno- type of poultry in relation to mannan-binding lectin (MBL), comprising in the genetic material of a sample from said animal detecting the presence or absence of at least one genetic marker.

Another aspect relates to a method of determining the susceptibility to an infectious disorder in poultry, comprising detecting in genetic material of a sample from said animal the presence or absence of at least one genetic marker that is indicative of MBL level.

Moreover, an aspect of the present invention relates to a kit for determining the susceptibility to an infectious disorder in poultry, comprising at least one binding member for detection of at least one genetic marker indicative of MBL and/or a kit for use in determining the genotype of poultry by detecting the presence or absence of at least one genetic marker that is indicative of mannan-binding lectin levels.

The term "genetic marker" refers to a variable nucleotide sequence (polymorphism) of the DNA on the chromosome. The variable nucleotide sequence can be identified using specific oligonucleotides. Single nucleotide polymorphism (SNP) is a single nucleotide position in an ordered context that is not constant throughout the population. Note however, that in the present invention, SNP also represents polymorphisms of up to 6 nucleotides, see table 1 b.

A "polymorphic site" or "polymorphism site" or "polymorphism" or "single nucleotide polymorphism site" (SNP site) as used herein is the locus or position within a given sequence at which divergence occurs. A "polymorphism" is the occurrence of two or more forms of a gene or position within a gene (allele), in a population. Polymorphic sites may be at known positions within a nucleic acid sequence or may be determined to exist using the methods described herein. Polymorphisms may occur in both the coding regions and the non-coding regions (for example, promoters, enhancers and introns) of genes. Although the term single nucleotide polymorphism strictly speaking refers to a polymorphism of only one nucleotide, the term may also be used herein for polymorphisms of two or more nucleotides, such as for example 3, 4, 5 or 6 nucleotides.

The sequence polymorphisms of the invention comprise at least one nucleotide difference, such as at least two nucleotide differences, for example at least three nu- cleotide differences, such as at least four nucleotide differences, for example at least five nucleotide differences, such as at least six nucleotide differences, for example at least seven nucleotide differences, such as at least eight nucleotide differences, for example at least nine nucleotide differences, such as 10 nucleotide differences. The term 'nucleotide differences' comprises nucleotide differences, dele- tion, substitution, duplication and/or insertion or any combination thereof.

In one embodiment of the present invention the at least one genetic marker is localized in a DNA region comprising the chicken mannan-binding lectin gene (SEQ ID NO: 1 ). However, in another embodiment the at least one genetic marker is localized in a DNA region selected from any region of SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, and/or 21 , and/or the complement thereof. In one embodiment the at least one genetic marker is (1 ), see fig 1 , corresponding to nucleotide position +43 and +44 of the chicken MBL gene (5' untranslated region), wherein C is changed to T, and a G is changed to A, respectively in high MBL lines. In another embodiment the at least one genetic marker is (2), see fig 1 , corresponding to nucleotide position -46 of the chicken MBL gene (promoter region), wherein A is changed to G in high MBL lines. Another example of the at least one genetic marker is (3), see fig. 1 or fig 3, corresponding to nucleotide position -49 of the chicken MBL gene (promoter region), wherein A is changed to G in high MBL lines.

In yet another embodiment the at least one genetic marker is (4), see fig 1 , corresponding to nucleotide position -166 and -167 of the chicken MBL gene (promoter region), wherein A is changed to T and a G is changed to a T, respectively, in high MBL lines.

Another example of the at least one genetic marker is (5), see fig 1 , corresponding to nucleotide position -170 of the chicken MBL gene (promoter region), wherein T is changed to G in high MBL lines. In a further embodiment the at least one genetic marker is (6), see fig 1 , correspond- ing to nucleotide position -177 to -188 of the chicken MBL gene (promoter region), wherein an insertion/deletion of GGGGGGTGTGT exists between the high and low MBL lines.

In yet a further embodiment the at least one genetic marker is (7), see fig 1 , corre- sponding to nucleotide position -222 of the chicken MBL gene (promoter region), wherein C has been inserted in high MBL lines or deleted in low MBL lines. Yet another example is the genetic marker (8), see fig 1 , corresponding to nucleotide position -227 to -229 of the chicken MBL gene (promoter region), wherein a G has been changed to a T, a T has been inserted, followed by the insertion of yet a T, respectively, in high MBL lines or a T and another T has been deleted in the low MBL lines.

A further example is the genetic marker (9), see fig 1 , corresponding to nucleotide position -247 of the chicken MBL gene (promoter region), wherein an A has been inserted in high MBL lines or deleted in the low MBL lines. The at least one genetic marker of the methods and kits of the present invention is located in a genomic region comprising the MBL gene, said region spanning at least 10 cM upstream and 10 cM downstream of the MBL gene. Thus any polymorphic marker, including microsatellite markers and/or SNP markers, within that region, which are genetically linked, i.e. are in linkage disequilibrium with any genetic marker disclosed herein are claimed in the present invention In one embodiment, the at least one genetic marker of the methods and kits of the present invention is located in a gene encoding MBL, such as the chicken MBL gene. More specifically, the at least one genetic marker is located in a regulatory region of a gene encoding MBL, such as in the promoter region and/or the 5'-UTR of a gene encoding MBL, preferably the chicken MBL gene. However, in another embodiment, the at least one genetic marker is located in the coding region of a gene encoding MBL, and/or in the 3'-region, for example in regulatory sequences in the 3'-region, such as the 3'-UTR of a gene encoding MBL, preferably the chicken MBL gene.

In a specific embodiment, the genetic marker is selected from the group consisting of: the polymorphism SNP1 1 at nucleotide position +43 and +44 of the chicken MBL gene (see figure 12), corresponding to position 628 and 629 of SEQ ID NO: 10; the polymorphism SNP12 at nucleotide position -49 to -46 of the chicken MBL gene (see figure 12), corresponding to position 437 to 440 of SEQ ID NO: 10; the polymorphism SNP13 at nucleotide position -170 to -166 of the chicken MBL gene (see figure 12), corresponding to position 420-421 of SEQ ID NO: 10; the polymorphism SNP14 at nucleotide position -175 of the chicken MBL gene (see figure 12), corresponding to position 416 of SEQ ID NO: 10; the polymorphism SNP15 at nucleotide position -186 to -181 of the chicken MBL gene (see figure 12), corresponding to an insertion after position 410 of SEQ ID NO:

10; the polymorphism SNP16 at nucleotide position -188 of the chicken MBL gene (see figure 12), corresponding to position 409 of SEQ ID NO: 10; the polymorphism SNP17 at nucleotide position -224 to -219 of the chicken MBL gene (see figure 12), corresponding to position 375 to 376 of SEQ ID NO: 10; the polymorphism SNP18 at nucleotide position -229 of the chicken MBL gene (see figure 12), corresponding to position 371 of SEQ ID NO: 10; and/or the polymorphism SNP19 at nucleotide position -247 of the chicken MBL gene (see figure 12), corresponding to a nucleotide insertion after position 353 of SEQ ID NO: 10, and/or any combination thereof

More specifically, the at least one genetic marker is selected from any of the specific variants/alleles of SNP1 1 -19 as defined in table 1 b, and/or any combination of at least 2, such as 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of said variants/alleles.

Thus, in one embodiment, the at least one genetic marker of the kits and kits of the present invention is an allele of the polymorphism SNP1 1 at nucleotide position +43 and +44 of the chicken MBL gene (see figure 12), corresponding to position 628 and 629 of SEQ ID NO: 10.

In another embodiment, the at least one genetic marker is an allele of the polymorphism SNP12 at nucleotide position -49 to -46 of the chicken MBL gene (see figure 12), corresponding to position 437 to 440 of SEQ ID NO: 10.

In yet another embodiment, the at least one genetic marker is an allele of the polymorphism SNP13 at nucleotide position -170 to -166 of the chicken MBL gene (see figure 12), corresponding to position 420-421 of SEQ ID NO: 10. In a further embodiment, the at least one genetic marker is an allele of the polymor- phism SNP14 at nucleotide position -175 of the chicken MBL gene (see figure 12), corresponding to position 416 of SEQ ID NO: 10.

In another embodiment, the at least one genetic marker is an allele of the polymorphism SNP15 at nucleotide position -186 to -181 of the chicken MBL gene (see figure 12), corresponding to an insertion after position 410 of SEQ ID NO: 10. In another embodiment, the at least one genetic marker is an allele of the polymorphism SNP16 at nucleotide position -188 of the chicken MBL gene (see figure 12), corresponding to position 409 of SEQ ID NO: 10.

In yet another embodiment, the at least one genetic marker is an allele of the polymorphism SNP17 at nucleotide position -224 to -219 of the chicken MBL gene (see figure 12), corresponding to position 375 to 376 of SEQ ID NO: 10.

In another embodiment, the at least one genetic marker is an allele of the polymorphism SNP18 at nucleotide position -229 of the chicken MBL gene (see figure 12), corresponding to position 371 of SEQ ID NO: 10. However, in another embodiment, the at least one genetic marker is an allele of the polymorphism SNP19 at nucleotide position -247 of the chicken MBL gene (see figure 12), corresponding to a nucleotide insertion after position 353 of SEQ ID NO: 10.

In one embodiment, the genetic marker of the present invention is any combination of a specific allele of SNP1 1 , 12, 13, 14, 15, 16, 17, 18, and/or 19, such as the alleles identified in table 1 b, for example any combination of SNP1 -19 variants, wherein said combination comprises at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of said vari- ants/alleles.

The consensus sequences represented in figure 12 as T1 , T2, T3, T4, T5, T6, T7 and T8 (SEQ ID NO:4, 5, 6, 7, 8, and 9, respectively) represents different haplo- types with respect to the specific alleles of SNP markers 1 1 -19 of the present inven- tion. Therefore, in a preferred embodiment the genetic marker of the present invention is selected from a combination of the specific alleles of SNP1 1 , 12, 13, 14, 15, 16, 17, 18, and 19 as defined in T1 , T2, T3, T4, T5, T6, T7 and/or T8 (SEQ ID NO:4, 5, 6, 7, 8, 9, 20, and 21 , respectively). The combinations of genetic markers of each of the haplotypes T1 -T8 are summarized on table 1 a. Importantly, any combination of at least one, such as at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of the genetic marker alleles as combined in any of the haplotypes T1 -T8 are within the scope of the present invention.

Table 1 a. Overview of the specific combination of SNP variants/alleles of table 1 b in respect of each consensus haptotype T1 -T8. The symbol ":" designates a deleted nucleotide as compared with the consensus sequence of the MBL gene as defined in SEQ ID NO: 10, and illustrated in figure 12.

For example, the genetic marker of the present invention, which is comprised in the T1 haplotype comprises the specific combination of SNP1 variant 1 1 (CG), SNP12 variant 1 (AGGA), SNP13 variant 1 (A:::::), SNP14 variant 1 (T), SNP15 variant 1 (::::::), SNP16 variant 1 (C), SNP17 variant 1 (:::TTG), SNP18 variant 1 (G), and/or SNP19 variant 1 (:), wherein the polymorphic marker allele is specified in the parenthesis, and (:) denotes a deleted nucleotide relative to the MBL consensus sequence as defined by SEQ ID NO: 10. However, the combination of two, 3, 4, 5, 6, 7, or 8 of those specific variants as combined in T1 are also within the scope of the present invention.

Thus, a genetic marker of the present invention also comprises any combination of at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of SNP1 variant 1 1 (CG), SNP12 variant 1 (AGGA), SNP13 variant 1 (A:::::), SNP14 variant 1 (T), SNP15 variant 1 (::::::), SNP16 variant

I (C), SNP17 variant 1 (:::TTG), SNP18 variant 1 (G), and/or SNP19 variant 1 (:). Any such combination in respect of any of the specific haplotypes T1 -T8 is within the scope of the present invention. Thus, the present invention also comprise any combination of the aforementioned SNP1 1 -19 variants, wherein said combination com- prises at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of said variants/alleles, for example at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of any of the specific variants/alleles represented in any of the haplotypes T1 , T2, T3, T4, T5, T6, T7 and/or T8.

Thus, in another embodiment, the genetic marker of the present invention, which is comprised in the T2 haplotype comprises the specific combination of SNP1 variant

I 1 (CG), SNP12 variant 2 (GGGG), SNP13 variant 1 (A:::::), SNP14 variant 1 (T), SNP15 variant 1 (::::::), SNP16 variant 2 (T), SNP17 variant 2 (::::::), SNP18 variant 1 (G), and/or SNP19 variant 1 (:), wherein the polymorphic marker allele is specified in the parenthesis, and (:) denotes a deleted nucleotide relative to the MBL consensus sequence as defined by SEQ ID NO: 10. However, the combination of two, 3, 4, 5, 6, 7, or 8 of any of those specific variants as combined in T2 are also within the scope of the present invention. In another embodiment, the genetic marker of the present invention, which is comprised in the T3 haplotype comprises the specific combination of SNP1 1 variant 2 (TA), SNP12 variant 2 (GGGG), SNP13 variant 2 (GGGGTT), SNP14 variant 2 (G), SNP15 variant 2 (TGTGGG), SNP16 variant 2 (T), SNP17 variant 3 (TTCTTG), SNP18 variant 2 (T), and/or SNP19 variant 2 (A), wherein the polymorphic marker allele is specified in the parenthesis, and (:) denotes a deleted nucleotide relative to the MBL consensus sequence as defined by SEQ ID NO: 10. However, the combination of two, 3, 4, 5, 6, 7, or 8 of those any of specific variants as combined in T3 are also within the scope of the present invention. In another embodiment, the genetic marker of the present invention, which is comprised in the T4 haplotype comprises the specific combination of SNP1 1 variant 1 (CG), SNP12 variant 2 (GGGG), SNP13 variant 1 (A:::::), SNP14 variant 1 (T), SNP15 variant 1 (::::::), SNP16 variant 1 (C), SNP17 variant 1 (:::TTG), SNP18 variant 1 (G), and/or SNP19 variant 1 (:), wherein the polymorphic marker allele is specified in the parenthesis, and (:) denotes a deleted nucleotide relative to the MBL consensus sequence as defined by SEQ ID NO: 10. However, the combination of two, 3, 4, 5, 6, 7, or 8 of those any of specific variants as combined in T4 are also within the scope of the present invention. In another embodiment, the genetic marker of the present invention, which is com- prised in the T5 haplotype comprises the specific combination of SNP1 1 variant 2 (TA), SNP12 variant 2 (GGGG), SNP13 variant 3 (GGGGGA), SNP14 variant 2 (G), SNP15 variant 3 (::::GG), SNP16 variant 2 (T), SNP17 variant 3 (TTCTTG), SNP18 variant 2 (T), and/or SNP19 variant 2 (A), wherein the polymorphic marker allele is specified in the parenthesis, and (:) denotes a deleted nucleotide relative to the MBL consensus sequence as defined by SEQ ID NO: 10. However, the combination of two, 3, 4, 5, 6, 7, or 8 of those any of specific variants as combined in T5 are also within the scope of the present invention.

In another embodiment, the genetic marker of the present invention, which is comprised in the T6 haplotype comprises the specific combination of SNP1 1 variant 1 (CG), SNP12 variant 2 (GGGG), SNP13 variant 2 (GGGGTT), SNP14 variant 2 (G), SNP15 variant 2 (TGTGGG), SNP16 variant 2 (T), SNP17 variant 3 (TTCTTG), SNP18 variant 2 (T), and/or SNP19 variant 2 (A), wherein the polymorphic marker allele is specified in the parenthesis, and (:) denotes a deleted nucleotide relative to the MBL consensus sequence as defined by SEQ ID NO: 10. However, the combi- nation of two, 3, 4, 5, 6, 7, or 8 of those any of specific variants as combined in T6 are also within the scope of the present invention.

In another embodiment, the genetic marker of the present invention, which is comprised in the T7 haplotype comprises the specific combination of SNP1 1 variant 1 (CG), SNP12 variant 2 (GGGG), SNP13 variant 1 (A:::::), SNP14 variant 1 (T),

SNP15 variant 1 (::::::), SNP16 variant 2 (T), SNP17 variant 2 (::::::), SNP18 variant 2 (T), and/or SNP19 variant 2 (A), wherein the polymorphic marker allele is specified in the parenthesis, and (:) denotes a deleted nucleotide relative to the MBL consensus sequence as defined by SEQ ID NO: 10. However, the combination of two, 3, 4, 5, 6, 7, or 8 of those any of specific variants as combined in T7 are also within the scope of the present invention.

In yet another embodiment, the genetic marker of the present invention, which is comprised in the T8 haplotype comprises the specific combination of SNP1 1 variant

1 (CG), SNP12 variant 2 (GGGG), SNP13 variant 1 (A:::::), SNP14 variant 1 (T), SNP15 variant 1 (::::::), SNP16 variant 2 (T), SNP17 variant 2 (::::::), SNP18 variant

2 (T), and/or SNP19 variant 1 (:), wherein the polymorphic marker allele is specified in the parenthesis, and (:) denotes a deleted nucleotide relative to the MBL consensus sequence as defined by SEQ ID NO: 10. However, the combination of two, 3, 4, 5, 6, 7, or 8 of those any of specific variants as combined in T8 are also within the scope of the present invention.

The genetic markers and/or haplotypes of the present invention are indicative of MBL, such as MBL level, and/or susceptibility to an infectious disorder, as defined herein. For example, in one embodiment the at least one genetic marker indicative of increased susceptibility to disease and/or low MBL level is selected from the group consisting of SNP1 1 variant 1 , SNP1 1 variant 2, SNP12 variant 1 , SNP12 variant 2, SNP13 variant 1 , SNP13 variant 2, SNP13 variant 3, SNP13 variant 4, SNP14 variant 1 , SNP14 variant 2, SNP15 variant 1 , SNP15 variant 2, SNP15 variant 3, SNP15 variant 4, SNP16 variant 1 , SNP16 variant 2, SNP17 variant 1 , SNP17 variant 2, SNP17 variant 3, SNP18 variant 1 , SNP18 variant 2, SNP19 variant 1 , and/or SNP19 variant 2, wherein the SNP variants are as defined in table 1 b. In one embodiment, the genetic marker indicative of increased susceptibility to disease and/or low MBL level is a combination of at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of said vari- ants/alleles, for example at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of any of those specific vari- ants/alleles, for example a combination selected from any of the haplotypes T1 , 12, T3, IA, 15, 16, 11 and/or T8.

However, in another embodiment the at least one genetic marker indicative of reduced susceptibility to disease and/or high MBL level is selected from the group consisting of SNP1 1 variant 1 , SNP1 1 variant 2, SNP12 variant 1 , SNP12 variant 2, SNP13 variant 1 , SNP13 variant 2, SNP13 variant 3, SNP13 variant 4, SNP14 variant 1 , SNP14 variant 2, SNP15 variant 1 , SNP15 variant 2, SNP15 variant 3, SNP15 variant 4, SNP16 variant 1 , SNP16 variant 2, SNP17 variant 1 , SNP17 variant 2, SNP17 variant 3, SNP18 variant 1 , SNP18 variant 2, SNP19 variant 1 , and/or SNP19 variant 2, wherein the SNP variants are as defined in table 1 b. In one embodiment, the genetic marker indicative of reduced susceptibility to disease and/or high MBL level is a combination of at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of said vari- ants/alleles, for example at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of any of those specific vari- ants/alleles, for example a combination selected from any of the haplotypes T1 , 12, T3, IA, 15, T6, T7 and/or T8.

In a preferred embodiment the at least one genetic marker indicative of increased susceptibility to disease and/or low MBL level is selected from the T1 haplotype, as defined by SEQ ID NO: 4, for example, the at least one genetic marker indicative of increased susceptibility to disease and/or low MBL level is a combination of genetic markers as defined by the T1 haplotype. In a specific embodiment, the genetic marker indicative of increased susceptibility to disease and/or low MBL level is a combination of at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of said genetic marker vari- ants/alleles, for example at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of any of the specific variants of T1.

However in another embodiment, the at least one genetic marker indicative of increased susceptibility to disease and/or low MBL level is selected from the group consisting of 12, T3, IA, 15, T6, 11 and/or T8 haplotypes, as defined by SEQ ID NO: 5, 6, 7, 8, 9, 20, and/or 21 , respectively, for example the at least one genetic marker indicative of increased susceptibility to disease and/or low MBL level is a combination of genetic markers as defined by the haplotypes selected from the group consisting of T2, T3, T4, T5, T6, T7 and/or T8. Specifically, the at least one genetic marker indicative of increased susceptibility to disease and/or low MBL level is a combination of at least two, at least two, such as at least 3, for example at least

4, such as 5, such as 6, such as 7, for example 8, such as 9 of the specific SNP1 1 - 19 variants/alleles, as combined in any of the haplotypes T1 , T2, T3, T4, T5, T6, T7 and/or T8.

In a preferred embodiment, the at least one genetic marker indicative of increased susceptibility to disease and/or low MBL level is selected from SNP1 1 variant 1 (CG), SNP12 variant 1 (AGGA), SNP13 variant 1 (A:::::), SNP14 variant 1 (T), SNP15 variant 1 (::::::), SNP16 variant 1 (C), SNP17 variant 1 (:::TTG), SNP18 vari- ant 1 (G), and/or SNP19 variant 1 (:), wherein (:) denotes a deleted nucleotide relative to the MBL consensus sequence as defined by SEQ ID NO: 10. In another embodiment, the genetic marker is any combination of at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of those specific SNP1 1 -19 variants/alleles.

In another embodiment the at least one genetic marker indicative of decreased susceptibility to disease and/or high MBL level is selected from the T3 haplotype, as defined by SEQ ID NO: 6, for example, the at least one genetic marker indicative of increased susceptibility to disease and/or low MBL level is a combination of genetic markers as defined by the T3 haplotype. In another embodiment, the genetic marker is any combination of at least two, such as at least 3, for example at least 4, such as

5, such as 6, such as 7, for example 8, such as 9 of those specific SNP1 1 -19 variants/alleles of the T3 haplotype.

However in another embodiment, the at least one genetic marker indicative of decreased susceptibility to disease and/or high MBL level is selected from the group consisting of T1 , T2, T3, T4, T5, T6, T7, and/or T8 haplotypes, as defined by SEQ ID NO: 4, 5, 6, 7, 8, 9, 20, and/or 21 , respectively, for example the at least one genetic marker indicative of increased susceptibility to disease and/or low MBL level is a combination of genetic marker alleles as defined by the haplotypes selected from the group consisting of T1 , T2, T3, T4, T5, T6, T7, and/or T8. In another embodiment, the genetic marker is any combination of at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of those specific SNP1 1 -19 variants/alleles as combined in any haplotypes selected from any of T1 , T2, T3, T4, T5, T6, T7, and/or T8 haplotypes.

In a preferred embodiment, the at least one genetic marker indicative of reduced susceptibility to disease and/or high MBL level is selected from SNP1 1 variant 2 (TA), SNP12 variant 2 (GGGG), SNP13 variant 2 (GGGGTT), SNP14 variant 2 (G), SNP15 variant 2 (TGTGGG), SNP16 variant 2 (T), SNP17 variant 3 (TTCTTG),

SNP18 variant 2 (T), and/or SNP19 variant 2 (A), wherein (:) denotes a deleted nucleotide relative to the MBL consensus sequence as defined by SEQ ID NO: 10. In one embodiment, the genetic marker is any combination of at least two, such as at least 3, for example at least 4, such as 5, such as 6, such as 7, for example 8, such as 9 of those specific SNP1 1 -19 variants/alleles.

It is understood that the present invention also relates to any polymorphic marker allele, which is in linkage disequilibrium with the at least one genetic marker indicative of MBL, such as MBL level and/or susceptibility to disease according to the pre- sent invention. Thus, a genetic marker of the present invention may be identified in a sample by detecting any such alternative polymorphic marker allele, which is genetically coupled to said genetic marker of the present invention. More specifically, the present invention also relates to polymorphic marker allele, which is in linkage disequilibrium with the at least one genetic marker, wherein said polymorphic marker allele is located in a genomic region within 10 cM, such as within 5 cM upstream, and within 10 cM, such as within 5 cM downstream of the MBL gene, such as the chicken MBL gene. Accordingly, the methods of the present invention also comprise detecting the presence or absence of a polymorphic marker allele in linkage disequilibrium with the at least one genetic marker indicative of MBL level and/or suscepti- bility to disease.

According to the present invention the method for determining the genotype of an animal, comprises, in the genetic material of a sample from said animal detecting the presence or absence of at least one genetic marker that is indicative of mannan- binding lectin levels, such as at least two markers, for example at least three mark- ers, such as at least four markers, for example at least five markers, such as at least six markers, for example at least seven markers, such as at least eight markers, for example at least nine markers. It will be appreciated that in the determination of a genetic determinant in an animal more than one genetic marker may be applied. Thus, the at least one genetic marker can be a combination of two or more genetic markers which are shown to be informative of MBL levels whereby the accuracy of the test can be increased.

A genotype may be defined as the entire genetic constitution of an organism, or the genetic composition at a specific gene locus or set of loci. In the present context the genotype refers to the MBL gene, including upstream and downstream regions, especially the chicken MBL gene.

Note also that poultry are diploids, i.e. each animal comprises two copies of most genes, and thus also comprise two copies of the MBL gene. Therefore, poultry are homozygous or heterozygous with respect to the genetic markers of the present invention, wherein homozygous animals comprise two identical alleles of a specific genetic marker, while heterozygous animals comprise two different alleles of a genetic marker. The genetic markers and genetic marker alleles as described herein, are indicative of MBL, such as MBL level and/or susceptibility to disease in both heterozygous as well as homozygous animals.

Table 1 b: Overview of MBL polymorphisms

^* Note that the number of nucleotides of the polymorphism does not correspond with the actual number of nucleotides of the respective polymorphism, since one or more nucleotides are inserted relative to the consensus sequence as defined in SEQ ID NO: 10.

Detection

Detection of the genetic marker may be conducted on the DNA sequence of the

MBL sequence, specified elsewhere herein, or a complementary sequence as well as on translational (mRNA) and transcriptional products (polypeptides, proteins) therefrom.

It will be apparent to the person skilled in the art that there are a large number of analytical procedures which may be used to detect the presence or absence of variant nucleotides at one or more of positions mentioned herein in the specified region. Mutations or polymorphisms within or flanking the specified region can be detected by utilizing a number of techniques. Nucleic acid from any nucleated cell can be used as the starting point for such assay techniques, and may be isolated according to standard nucleic acid preparation procedures that are well known to those of skill in the art. In general, the detection of allelic variation requires a mutation discrimination technique, optionally an amplification reaction and a signal generation system. A number of mutation detection techniques are listed in Table 2. Some of the methods listed in Table 2 are based on the polymerase chain reaction (PCR), wherein the method according to the present invention includes a step for amplification of the nucleotide sequence of interest in the presence of primers based on the nucleotide sequence of the variable nucleotide sequence. The methods may be used in combi- nation with a number of signal generation systems, a selection of which is also listed in Table 2.

Table 2

Further amplification techniques are listed in Table 3. Many current methods for the detection of allelic variation are reviewed by Nollau et al., Clin. Chem. 43, 1 1 14- 1 120, 1997; and in standard textbooks, for example "Laboratory Protocols for Mutation Detection", Ed. by U. Landegren, Oxford University Press, 1996 and "PCR", 2nd Edition by Newton & Graham, BIOS Scientific Publishers Limited, 1997.

The detection of genetic markers can according to useful embodiment of the present invention be achieved by a number of techniques known to the skilled person, including typing of microsatellites or short tandem repeats (STR), restriction fragment length polymorphisms (RFLP), detection of deletions or insertions, random amplified polymorphic DNA (RAPIDs) or the typing of single nucleotide polymorphisms by methods such as restriction fragment length polymerase chain reaction, allele- specific oligomer hybridisation, oligomer-specific ligation assays, hybridisation with PNA or locked nucleic acids (LNA) probes.

Table 3

An oligonucleotide primer of the present invention is a nucleic acid molecule sufficiently complementary to the sequence on which it is based and of sufficiently length to selectively hybridise to the corresponding region of a nucleic acid molecule in- tended to be amplified. The primer is able to prime the synthesis of the corresponding region of the intended nucleic acid molecule in the methods described above. Similarly, a probe of the present invention is a molecule for example a nucleic acid molecule of sufficient length and sufficiently complementary to the nucleic acid sequence of interest which selectively binds to the nucleic acid sequence of interest under high or low stringency conditions.

However, the genetic markers of the present invention may be detected by any method available to the person skilled in the art, including any commercially available kit, assay and/or methodology. In one embodiment, the genetic marker is detected by the MassARRAY® iPLEX Gold technology for SNP Genotyping offered by Sequenom. In this analysis, DNA from a sample is amplified by polymerase chain reaction. After the PCR, remaining nucleotides are deactivated by SAP treatment. The single base primer extension step is performed, and the primer extension products analyzed using MALDI TOF MS. A significant advantage of this protocol is that it does not require the removal of supernatants, but rather consists of a series. Sub- sequently polymorphisms are detected by DNA chip technology and ratio analysis. See f.x. http://www.sequenom.com/Genetic-Analysis/Applications/iPLEX- Genotyping/iPLEX-Overview.aspx

MBL and MBL levels One embodiment of the present invention relates to a method for determining the genotype of poultry in relation to high and low levels of MBL, comprising, in the genetic material of a sample from said animal detecting the presence or absence of at least one genetic marker that is indicative of mannan-binding lectin levels. For example said at least one genetic marker may be present in a regulatory region of the chicken mannan-binding lectin gene. According to the methods and kits of the present invention, the at least one genetic marker is associated with high or low level of MBL, and/or reduced or increased susceptibility to disease. In fact, according to the methods and kits of the present invention, high MBL level is indicative of reduced susceptibility to disease and/or low MBL level is indicative of increased susceptibility to disease. In the present invention a method for determining the genotype of an animal is disclosed, wherein the presence or absence of at least one genetic marker is detected that is indicative of the mannan-binding lectin levels in a sample. The ability of an animal to avoid or recover from disease is related to the MBL levels of the animals. High MBL levels are indicative of an increased ability to avoid or recover from disease (reduced susceptibility) as compared to animals with average MBL levels or animals having a low MBL level. The disease may be any disease in which a high level of MBL in an animal has an effect on the disease progression or onset, such that a disease is either avoided or easily combated by the animal. For example the disease may be an infectious disease, such as a diseases caused by virus or for example bacteria.

Determination of MBL level may be performed by any method known to those of skill in the art. In one method, MBL level is determined in serum. According to one embodiment of the present invention, high MBL level are defined as serum concentration level above 10 micrograms/ml, such as at least 15, for example at least 20, such as at least 25, for example at least 30, such as at least 35 micro-grams/ml. Moreover, according to another embodiment, low MBL level are defined as serum level below 10 micrograms/ml, such as below 8, for example below 6 such as below 4, for example below 2, such as below 1 micrograms/ml.

In another embodiment, high MBL levels are levels of MBL measured in the serum in the range of 10 to 32 μg/ml serum, such as 10 to 25 μg/ml serum, for example 15 to 30 μg/ml serum, such as 20-30 μg/ml serum . In one embodiment high levels of MBL are MBL levels above 10 μg/ml serum, such as above 1 1 μg/ml serum, for example above 12 μg/ml serum. Thus, the high MBL level is 10 μg/ml serum, for example 15 μg/ml serum, such as 20 μg/ml serum, for example 25 μg/ml serum, such as 30 μg/ml serum. Moreover, in another embodiment, low MBL levels are levels of MBL measured in the serum in the range of 2 to 10 μg/ml serum, such as 4 to 10 μg/ml serum, for example 6 to 10 μg/ml serum, such as 4 to 10 μg/ml serum, for example 2 to 8 μg/ml serum. In one embodiment low levels of MBL are MBL levels below 10 μg/ml serum, such as below 8 μg/ml serum, for example below 6 μg/ml serum, such as below 4 μg/ml serum. Disorders

The terms "disease" and disorder" are used synonymously and interchangeably herein. The present invention relates to methods of determining the susceptibility to a disorder in poultry, comprising detecting in genetic material of a sample from said animal the presence or absence of at least one genetic marker that is indicative of MBL level; and kits for use in for determining the susceptibility to a disorder in poultry, comprising at least one binding member for detection of at least one genetic marker indicative of MBL. Disorder or disease in the present invention predomi- nantly relates to infection and/or infectious disorders.

The term "susceptibility" or "susceptible" as used herein refers to the likelihood or risk of acquiring or suffering from a disorder, such as an infectious disorder. The term "infectious disorder" is generally used herein synonymously with "infection". The disorder may or may not involve clinical symptoms. Thus, poultry, which is highly susceptible to a disorder is more likely to acquire a disorder and/or more likely to suffer from the disorder in a manner which may involve more or less severe clinical symptoms. Conversely, a poultry with a low susceptibility to infection is less likely to acquire and/or suffer from a disorder. Specifically, poultry which are completely resistant to a disorder have the lowest possible susceptibility to said disorder.

The presence or absence of a genetic marker according to the present invention reduce the susceptibility to an infection by at least 1 %, such as at least 3%, such as at least 5%, for example at least 10%, such as at least 15%, such as at least 20%, for example at least 25%, such as at least 30%, such as at least 35%, for example at least 40%, such as at least 45%, such as at least 50%, for example at least 55%, such as at least 60%, such as at least 65%, for example at least 70%, such as at least 75%, such as at least 80%, for example at least 85%, such as at least 90%, such as at least 95%, for example at least 100%, such as at least 1 10%, such as at least 120%, for example at least 130%, such as at least 140%, such as at least

150%, for example at least 160%, such as at least 170%, such as at least 180%, for example at least 190%, such as at least 200%, such as at least 250%, for example at least 300%, such as at least 350%, such as at least 400%, for example at least 450%, such as at least 500%, such as at least 550%, for example at least 600%, such as at least 650%, such as at least 700%, for example at least 750%, such as at least 800%, such as at least 850%, for example at least 900%, such as at least 950%, such as at least 1000%, for example at least 1500%, such as at least 2000%, such as at least 2500%, for example at least 3000%, such as at least 3500%, such as at least 4000%, for example at least 4500%.

In one embodiment, the susceptibility to an infection of poultry with the presence or absence of a genetic marker according to the present invention is reduced to less than 99% of the susceptibility of poultry, wherein said genetic marker is absent or present from the same locus. In another embodiment, said susceptibility is reduced to less than 98%, such as less than 97%, such as less than 96%, for example less than 95%, such as less than 94%, such as less than 93%, for example less than 92%, such as less than 91%, such as less than 90%, for example less than 85%, such as less than 80%, such as less than 75%, for example less than 70%, such as less than 65%, such as less than 50%, for example less than 45%, such as less than 50%, such as less than 45%, for example less than 40%, such as less than 35%, such as less than 30%, for example less than 25%, such as less than 20%, such as less than 15%, for example less than 10%, such as less than 9%, such as less than 8%, such as less than 7%, such as less than 6%, for example less than 5%, such as less than 4%, such as less than 3%, for example less than 2%, such as less than 1%, such as less than 0,5%.

An infection or an infectious disorder according to the present invention relates to the presence of an infective agent or a pathogenic agent, such as vira, bacteria, fungi, protozoa, multicellular parasites, and aberrant proteins known as prions.

Thus, an infection according the present invention comprises viral, bacterial, fungal, protozoan and parasitic infections. An infection may result in an actual infectious disorder with evident clinical symptoms and/or impaired host function. Infectious disorders are often highly contagious, and thus are easily transmitted from one individual to another. Transmission of an infectious disease may occur through one or more different pathways, including physical contact with infected individuals and also through liquids, food, body fluids, contaminated objects, airborne inhalation, or through vector-borne spread. In particular, infectious disorders of the present invention comprise any disorder, including disorder associated with bacterial infections and/or viral infections. In par- ticular, an infectious disease according to the present invention comprises bacterial infectious diseases, such as infections with pasteurella, salmonella and/or E. CoIi. In a specific embodiment, the infectious agent is pasteurella multocida, which is the causative agent of the disease fowl cholera. In another embodiment, the methods and kits of the present invention relates to a viral disorder, such as a disorder selected from the group consisting of Mareks Disease Virus (MDV), Infectious Bronchitis virus (IBV), and/or Newcastle Disease Virus (NDV).

Oligonucleotide The oligomer or polymer sequences of the present invention are formed from the chemical or enzymatic addition of monomer subunits. The term "oligonucleotide" as used herein includes linear oligomers of natural or modified monomers or linkages, including deoxyribonucleotides, ribonucleotides, anomeric forms thereof, peptide nucleic acid monomers (PNAs), locked nucleotide acid monomers (LNA), and the like, capable of specifically binding to a single stranded polynucleotide tag by way of a regular pattern of monomer-to-monomer interactions, such as Watson-Crick type of base pairing, base stacking, Hoogsteen or reverse Hoogsteen types of base pairing, or the like. Usually monomers are linked by phosphodiester bonds or analogs thereof to form oligonucleotides ranging in size from a few monomeric units, e.g. 3- 4, to several tens of monomeric units, e.g. 40-60. Whenever an oligonucleotide is represented by a sequence of letters, such as "ATGCCTG," it will be understood that the nucleotides are in 5' → 3' order from left to right and the "A" denotes de- oxyadenosine, "C" denotes deoxycytidine, "G" denotes deoxyguanosine, and "T" denotes thymidine, unless otherwise noted. Usually oligonucleotides of the invention comprise the four natural nucleotides; however, they may also comprise methylated or non-natural nucleotide analogs. Suitable oligonucleotides may be prepared by the phosphoramidite method described by Beaucage and Carruthers (Tetrahedron Lett., 22, 1859-1862, 1981 ), or by the triester method according to Matteucci, et al. (J. Am. Chem. Soc, 103, 3185, 1981 ), both incorporated herein by reference, or by other chemical methods using either a commercial automated oligonucleotide synthesizer or VLSIPS.TM. technology. When oligonucleotides are referred to as "double-stranded," it is understood by those of skill in the art that a pair of oligonucleotides exist in a hydrogen-bonded, helical configuration typically associated with, for example, DNA. In addition to the 100% complementary form of double-stranded oligonucleotides, the term "double-stranded" as used herein is also meant to refer to those forms which include such structural features as bulges and loops. For example as described in US 5.770.722 for a unimolecular double-stranded DNA. It is clear to those skilled in the art when oligonucleotides having natural or non-natural nucleotides may be employed, e.g. where processing by enzymes is called for, usu- ally oligonucleotides consisting of natural nucleotides are required. When nucleotides are conjugated together in a string using synthetic procedures, they are always referred to as oligonucleotides.

Kit In accordance with another aspect of the invention, a kit is provided for determining a genotype at a defined nucleotide position(s) within a polymorphic site in a man- nan-binding lectin gene in poultry in order to determine the ability to avoid and/or recover from infection of said animal, the kit comprising: a restriction enzyme capable of distinguishing alternate nucleotides at the polymorphic site; or a labelled oli- gonucleotide having sufficient complementary to the polymorphic site so as to be capable of hybridizing distinctively to said alternate. The polymorphic sites may be at one or more of the polymorphisms shown in figure 1 and/or figure 3 and/or figure 12, such as the polymorphism corresponding to nucleotide position +43 and +44 , for example the polymorphism corresponding to nucleotide position -46, such as the polymorphism corresponding to nucleotide position -49, for example the polymorphism corresponding to nucleotide position -166 and -167, such as the polymorphism corresponding to nucleotide position -170, for example the polymorphism corresponding to nucleotide position -177 to -188, such as the polymorphism corresponding to nucleotide position -222, for example the polymorphism corresponding to nucleotide position -227 to -229, such as the polymorphism corresponding to nucleotide position -247 of the chicken MBL gene, or a polymorphic site in linkage disequilibrium thereto. However, any polymorphism within the DNA region comprising the MBL gene is within the scope of the present invention.

One aspect of the present invention also relates to a kit for determining the susceptibility to an infectious disorder in poultry, comprising at least one binding member for detection of at least one genetic marker indicative of MBL. The binding member is in one embodiment selected from the group consisting of oligonucleotides, antibodies, polypeptides, peptides, peptide fragments, peptide aptamers, nucleic acid aptamers, small molecules, natural single domain antibodies, affibodies, affibody- antibody chimeras, and non-immonoglobulin binding members. In a preferred embodiment, the binding member is an oligonucleotide, such as an oligonucleotide primer.

In a preferred embodiment, the kit of the present invention comprises a binding member for the detection of at least one genetic marker as defined elsewhere herein. In a preferred embodiment, the genetic marker is located in a regulatory region of a gene encoding MBL, such as in the promoter region of a gene encoding MBL, preferably the chicken MBL gene. Specifically, the at least one genetic marker is selected from the group consisting of: the polymorphism SNP1 1 at nucleotide position +43 and +44 of the chicken MBL gene (see figure 12), corresponding to position 628 and 629 of SEQ ID NO: 10; the polymorphism SNP12 at nucleotide position -49 to -46 of the chicken MBL gene (see figure 12), corresponding to position 437 to 440 of SEQ ID NO: 10; the polymorphism SNP13 at nucleotide position -170 to -166 of the chicken MBL gene (see figure 12), corresponding to position 420-421 of SEQ ID NO: 10; the polymorphism SNP14 at nucleotide position -175 of the chicken MBL gene (see figure 12), corresponding to position 416 of SEQ ID NO: 10; the polymorphism SNP15 at nucleotide position -186 to -181 of the chicken MBL gene (see figure 12), corresponding to an insertion after position 410 of SEQ ID NO: 10; the polymorphism SNP16 at nucleotide position -188 of the chicken MBL gene (see figure 12), corresponding to position 409 of SEQ ID NO: 10; the polymorphism SNP17 at nucleotide position -224 to -219 of the chicken MBL gene (see figure 12), corresponding to position 375 to 376 of SEQ ID NO: 10; the polymorphism SNP18 at nucleotide position -229 of the chicken MBL gene (see figure 12), corresponding to position 371 of SEQ ID NO: 10; and/or the polymorphism SNP19 at nucleotide position -247 of the chicken MBL gene (see figure 12), corresponding to a nucleotide insertion after position 353 of SEQ ID NO: 10.

More specifically, the at least one genetic marker is selected from any of the specific variants/alleles of SNP1 1 -19 as defined in table 1 b (see also figure 12).

In one embodiment, the kit comprises at least one oligonucleotide primer for detec- tion of at least one genetic marker as defined above. Thus, in one embodiment, the oligonucleotide, such as oligonucleotide primer of the present invention comprises a consecutive sequence of at least 5, such as at least 6, such as at least 7 such as at least 8, for example at least 9, preferably at least 10, such as at least 15, such as at least 20, such as at least 25 nucleotides selected from any region of SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, and/or 21 and/or the complementary sequences thereof. The oligonucleotide, such as oligonucleotide primer, is in a further embodiment al- lele-specific, thereby allowing to distinguish between different genetic markers of the present invention by the specific binding of the respective oligonucleotide.

The kit may further include an oligonucleotide or a set of oligonucleotides operable to amplify a region including the polymorphic site. The kit may further include a polymerization agent and may also include instructions for using the kit to determine the MBL genotype. The kit may also include one or more of the following: a package; instructions for using the kit to determine genotype, reagents such as buffers, nucleotides and enzymes.

A kit as described herein may contain any combination of the following: a restriction enzyme capable of distinguishing alternate nucleotides at a mannan-binding lectin gene polymorphic site; and/or a labeled oligonucleotide having sufficient comple- mentary to a mannan-binding lectin gene polymorphic site and capable of distinguishing said alternate nucleotides; and/or an oligonucleotide or a set of oligonucleotides suitable for amplifying a region including the mannan-binding lectin gene polymorphic site. The kit may also include one or more of the following: a package; instructions for using the kit to determine genotype; reagents such a buffers, nucleo- tides and enzymes and/or containers. For example, the kit further comprises deoxy- ribonucleoside triphosphates, DNA polymerase enzyme and/or nucleic acid amplification buffer. The kit may also comprise instructions for the performance of the detection method of the kit, and for the interpretation of the results.

The kit comprising a restriction enzyme may also comprise an oligonucleotide or a set of oligonucleotides suitable to amplify a region surrounding the polymorphic site, a polymerization agent and instructions for using the kit to determine genotype.

In one embodiment, the kit of the present invention also comprises at least one ref- erence sample. The reference sample may comprise genetic material, such as nu- cleic acids comprising a specific genetic marker indicative of MBL levels and/or susceptibility to a disorder as defined herein. Thus, in one embodiment the reference sample comprises a genetic marker as defined elsewhere herein, for example a genetic marker, which is indicative of high MBL level and/or reduced susceptibility to disease; and in another embodiment the reference sample comprises a genetic marker, which is indicative of low MBL level and/or increased susceptibility to disease. In a specific embodiment, the kit comprises a reference sample comprising a genetic marker, which is indicative of high MBL level and/or reduced susceptibility to disease, and a reference sample comprising a genetic marker, which is indicative of low MBL level and/or increased susceptibility to disease.

Examples

Breeding stock

To investigate the functional role of chicken mannan-binding lectin in innate immunity and disease resistance chickens were for eight generations selected for low or high concentration of MBL in serum, resulting in the establishment of two distinct lines of chickens. The L line (low levels of MBL) has a mean concentration of 4,9 μg MBL/ml serum and the H line (high levels of MBL) has a mean concentration of 18,2 μg MBL /ml serum. The H- and L lines originate from L10 which consists of 67,5% UM-19 and 33,5% White Cornish (Immunology 1998, 94: 587-593).

Figure 2 shows the cMBL levels of 29 L and 52 H birds of generation F8. The data for the MBL levels are shown in the table 4 below Table 4

Genomic DNA isolation

Genomic DNA was purified according to the method of Lahiri and Nurnberger (1991 ) with a few modifications. DNA was isolated from 200μl packed blood cells (fresh of frozen) only, mostly nucleated erythrocytes. For DNA precipitation, we used 2- propanol instead of ethanol. The DNA was finally spooled, washed in 70% ethanol and resuspended in TE (1 OmM Tris pH 8, 1 mM Na₂EDTA), (Juul-Madsen et al,

1993).

Example 1

Restriction fragment length polymorphisms

Restriction fragment length polymorphisms analysis of these animals showed differences that support the differences in serum concentration. In generation F4, 9 and 14 animals of the L and the H lines, respectively, were tested. 18 animals of both L and H lines were tested in generation F5 animals, whereas in generation F7 20 animals of each L and H lines were analysed.

DNA hybridization High molecular weight genomic chicken DNA (1 Oμg DNA/lane) was digested with the BgI Il restriction enzyme, electrophoresed on a 0.7% agarose gel, blotted onto Hybond N+ filter (Amersham) under alkaline conditions and hybridized with a MBL probe encoding a Pst I - Pvu Il fragment of the cDNA (Genebank NM 204349 ) un- der high stringency conditions, using standard procedures.

Figure 3 shows the DNA polymorphisms of MBL gene in animals of the F4 generation, where L represents animals of the L line and H represents animals of the H line. A distinctive RFLP pattern was found for each of the two lines. The band of app. 1.2 kb was only found in birds from the L line. The band of app. 2.3 kb was found in all birds from the L line and in some of the birds from the H line. The bands of app. 2.4 and 3.3 kb were exclusively found in birds from the H line. The 2.3 and 2.4 kb bands were only weakly present in some of the birds indicating that birds containing both bands were heterozygotes. In later generations the 2.3 kb band was nearly irradiated.

Example 2

Identification of single nucleotide polymorphisms in cDNA To search for single nucleotide polymorphisms (SNPs) in the chicken MBL gene the complete cDNA of MBL in four animals (2 with low MBL and 2 with high MBL) was PCR amplified, sequenced and screened for SNPs, using standard procedures following the manufacturer's recommendations.

RNA was purified from chicken liver using the RNeasy kit (Qiagen). 1 st strand cDNA was synthesised (1^st strand synthesis kit, Amersham). The MBL gene was amplified by PCR by employing primers cMBL-6F and cMBL-RR primers for first part of the gene, and cMBL-F and cMBL-7R primers for the second part of the MBL gene. CMBL-6F primer: 5'- GAT-AAG-CCG-GAA-AAC-CCT-GAA - 3'; (SEQ ID NO: 1 1 ) cMBL-RR primer: 5' - CTT-ACA-ACA-ATT-CCA-CGT-TCT-CCT- 3'; (SEQ

ID NO: 12) cMBL-F primer: 5' - GCA-GAG-ATG-GAA-GAG-ATG-GTC-CC - 3'; (SEQ

ID NO: 13) CMBL-7R: 5' - GA-AGA-TAT-TTG-AAT-TTG-AAC-AGT - 3'. (SEQ

ID NO: 14)

PCR amplification reactions contained 0.5 μl_ cDNA, 2.5 μl_ 10 x buffer, 100μM of each primer in a primer pair, 2.5 μl_ [2mM] dNTPs each, 18.75 μl_ distilled water and 0.25 μl_ Taq polymerase from Amersham in a total volume of 25 μl_.

Cycling was performed using the following programme: 95⁰C 5 min, 40 x (95⁰C 45 sec, 55⁰C 1 min, 72⁰C 1 min), 72⁰C 2 min.

For sequencing, the resulting PCR products were purified by gel elctrophoresis and excised fragments were purified using QIAquick® spin columns (Qiagen) and cloned into the TOPO TA vector following the manufacturer's protocol (TOPO^® TA Cloning Kit) and introduced into One Shot^®TOP10 chemically competent Eschericia coli cells (Invitrogen).

Positive Eschericia coli cells were selected and the presence of MBL insert was verified by the use of Pharmacia Universal/Reverse 5 pmol/25 ul total reaction (fluorescein labelled) primers in PCR reactions.

Positive clones were propagated and plasmids purified using QIAprep spin Miniprep Kit following the manufacturer's instructions, and sequencing of plasmids was performed by MWG- Biotech AG, Germany.

In total 981 bp of cMBL was sequenced which code for the 249 amino acid precur- sor of cMBL, except for 5 amino acids in the C-terminal of the precursor, and the 5' untranslated region UTR . One double SNP was detected in the UTR of the gene where a GC base pair has been substituted with an AT base pair in chickens with high concentration of MBL in serum (SNP at position + 43 and + 44 in figure 1 ).

The sequence of the promoter of the MBL gene is shown in Figure 1.

Identification of nucleotide polymorphism in the promoter region

To search for single nucleotide polymorphisms (SNPs) in the chicken MBL DNA promoter region the first 600 bp of the promoter region in four animals (2 with low MBL and 2 with high MBL) was PCR amplified, sequenced and screened for SNPs, using standard procedures following the manufacturer's recommendations.

1 μL genomic DNA was amplified by PCR using primers cMBL-585F and CMBL+93R:

CMBL-585F primer: 5'- TGG-CAA-TAT-ACT-CTG-AGG-CAA - 3'; (SEQ ID

NO: 15)

CMBL+93R primer: 5' - GGA-CCA-GCC-TGC-CAA-GAG - 3'; (SEQ ID NO:

16)

PCR amplification reactions contained 1 μL genomic DNA, 2,5 μL 10 x buffer,

100μM of each primer in a primer pair, 2,5 μL [2mM] dNTPs each, 18,75 μL distilled water and 0,25 μL Taq polymerase from Amersham in a total volume of 25 μL.

Cycling was performed using the following programme: 95⁰C 5 min, 40 x (95⁰C 45 sec, 55⁰C 1 min, 72⁰C 1 min), 72⁰C 2 min.

For sequencing, the resulting PCR products were purified by gel elctrophoresis and excised fragments were purified using QIAquick® spin columns (Qiagen) and cloned into the TOPO TA vector following the manufacturer's protocol (TOPO^® TA Cloning Kit) and introduced into One Shot^®TOP10 chemically competent Eschericia coli cells (Invitrogen).

Positive Eschericia coli cells were selected and the presence of MBL insert was verified by the use of Pharmacia Universal/Reverse 5 pmol/25 ul total reaction (fluo- rescein labelled) primers in PCR reactions.

Positive clones were propagated and plasmids purified using QIAprep spin Miniprep Kit following the manufacturer's instructions, and sequencing of plasmids was performed by MWG-Biotech AG, Germany.

Example 3

Expression analysis

Total RNA was isolated from liver using the RNeasy Midi Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Purified RNA was eluted in 500 μl RNase-free water and stored at -8O⁰C until further analysis. Total RNA (10 μg) in MOPS-buffer (20 mM MOPS, pH 7.0 (Sigma, St. Louis, Missouri), 1 mM EDTA, 5 mM sodium citrate) containing 50% deionised formamide and 2.2 M formaldehyde, was denatured for 5 min at 67⁰C. The denatured RNA samples were immediately cooled on ice for 5 min and electrophoresed on 1.0% formaldehyde-agarose gels before being blotted onto Hybond N nylon membranes (cat. no. RPN 203N, Amer- sham Biosciences, Little Chalfont, UK) in 20 x SSC. The Hybond N membranes were finally baked for 2 hrs at 8O⁰C. Assessment of the integrity of the RNA samples was based on the 28S and 18S rRNA ratio in the ethidium bromide-stained gels. The membranes were hybridised with a MBL probe encoding a Pst I - Pvu Il fragment of the cDNA (Genebank NM 204349 ) The probe was random hexamer- primed with ³²P-dCTP [31]. Prehybridisation was carried out in 6 x SSC, 1% SDS, 10 x Denhardt's solution and 10 mg/ml denatured salmon sperm DNA (carrier) at 67⁰C for 3 hrs. Hybridisation was done overnight in 6 x SSC, 1% SDS, 10 mg/ml carrier DNA and 8 x 10⁶ cpm/ml of radioactive probe at 67⁰C. The filters were washed twice in 1 x SSC, 0.1% SDS, twice in 0.1 x SSC, 0.1 % SDS, and finally twice in 0.1 x SSC without SDS for 25 min at 55⁰C. Autoradiography was performed at -8O⁰C with Kodak X-Omat XAR-5 film (Amersham Biosciences, Uppsala, Sweden). The result of the expression analysis of the MBL gene in 10L and 10H lines is shown in Figure 4.

Northern blotting analysis using the cMBL probe clarified that the observed difference in the MBL serum concentrations between animals of the high and low chicken lines was mostly due to a difference at the MBL transcriptional level since birds with low MBL in serum have a much lower level of transcripts for cMBL. However, structural mutations within the gene that disturb the structure of the protein cannot be excluded.

Example 4

MBL acute phase response in infected chickens in relation to high or low MBL basis level

The ability of an animal to have an acute phase response to bacterial and viral infections until the adapted immune response has developed reduces the effects of an infection. As described elsewhere herein MBL belongs to the innate immune response and is an important factor in combating infection in the initial phase. Therefore, the level of MBL in serum of the high and low MBL lines was determined prior to and subsequent to infection with the Infectious Bronchitis Virus (IBV). Virus

Experimental infections were performed with the M41 strain of IBV, Veterinary Laboratories Agency, Weybridge, UK. The virus was propagated and titrated by inoculation in the allantoic cavity of 9-day-old SPF chicken embryos.

Experimental Infection

The experimental IBV infections were performed by inoculation of each chicken with 10⁶²⁵ ELD₅₀ of IBV at 0900 h in the morning,

Serum Samples Serum samples were collected from all chickens at day 21 , 14, and 4 prior to the inoculation with IBV and at days 1 , 2, 3, 4, 5, 7, 10, 17, and 21 after the infection.

ELISA for Measurement of Serum MBL

Microtiter plates (Nunc A/S, Roskilde, Denmark, Polysorp) were coated overnight at 4⁰C in a humid chamber with 5 μg/mL of the monoclonal anti-chicken MBL antibody HYB182-1 diluted in PBS according to the method described in Laursen et al. (1998). Upon emptying the wells, non-specific binding was blocked by incubation with 10 mg/mL of BSA in TBS (10 mM Tris base, 140 mM NaCI, pH 7.6) for 2 h at room temperature. The plates were washed with TBS-tween after which duplicates of 100 μL of serum dilutions were added to the wells. The serum samples were diluted from 200 to 800 times in TBS-tween-EDTA. In order to determine MBL content in the samples, standard chicken serum with a known MBL concentration was diluted 1.5-fold in eight steps and transferred in duplicate to wells in the middle of the plate. Plates were incubated overnight at 4C in a humid chamber. After having washed the plates, wells were incubated for 2 h at room temperature with 1 μg/mL of biotinylated HYB182-1. Another wash was followed by a 2-h incubation at room temperature with 0.125 μg/mL alkaline phosphatase-conjugated avidin. After an hour's incubation at 37C with the substrate, para-nitro-phenyl-phosphate (PNPP, 1 mg/mL, dissolved in DEA buffer, diethanolamine, pH 9.8), the optical density (OD) at 405 nm was measured. Using OD values corresponding to each of the eight dilu- tions of the 'standard' serum, a calibration curve was constructed. OD values of samples were transformed to MBL concentrations by readings from this standard curve. The interassay coefficient of variation (CV) was 10.6% (n = 42 d), the inter plate CV was 1 1.9% (n = 2 plates), and the intra plate CV was 9.0% (n = 2 controls [9.91 μg/mL and 1 1.24μg/ml_]).

The basic cMBL level of each bird was determined as a mean value of the three samples taken before the infection, i.e. on the days 21 , 14, and 4 before the infection. The mean level was used at day 0.

ELISA for measurement of serum antibody titers to IBV

The ProFLOK IBV ELISA Test Kit (Kirkegaard and Perry Laboratories, Gaithers- burg, Maryland, cat. no. 54-82-01 ) was used to measure serum antibody titers to IBV. The ELISA assay was performed according to the kit manual.

RT-PCR of IBV

Purification of RNA was done according to the instructions for the RNeasy Kit from Qiagen. The RT-PCR was carried out according to the manufacturer's instructions (TitanTM One Tube RT-PCR System, Boehringer Mannheim), which utilizes avian myeloblastosis virus reverse transcriptase and a blend of Pwo and Taq DNA polymerases. Briely, for a 50 ml reaction (BM): 10 ml 5x reaction buffer, 2.5 ml 25 mM dithiothreitol, 0.5 ml dNTP (20 mM for each dNTP), 1 ml enzyme mixture, 100 pmol of each oligonucleotide, 5 ml of RNA and RNase-free water up to 50 ml.

The stocks and mixtures were kept on ice until the transfer to the thermocycler

(Abacus, Hybaid). The RT-PCR was carried out by use of a programme including both the RT and PCR. Cycle 1 , 45 min at 48⁰C (RT reaction); cycle 2, 95^<€ for 120 s; cycle 3 to 41 , 95 ^<€ for 30 s, 60⁰C for 60 s and 68 ^<€ for 120 s; cycle 42, 68⁰C for 7 min. The presence of a PCR product was con® rmed by agarose electrophoresis, using a 1 .5% SeaKem GTG (FMC) agarose and 0.1 m I/ml ethidium bromide.

RT-PCR was performed with the IBVN (+) and the IBVN (-) primers.:

IBVN( + ): 5' - GAA-GAA-AAC-CAG-TCC-CAG-ATG-CTT-GG - 3'(SEQ ID NO:

17) IBVN( - ): 5' - GTT-GGA-ATA-GTG-CGC-TTG-CAA-TAC-CG - 3' (SEQ ID NO: 18)

Figure 5 shows the acute phase response after IBV infection of animals with high or low serum MBL concentration. The MBL serum level of the L line increases from app. 5 to 10 μg/ml after the infection whereas the serum MBL concentration of the H line increases from app. 15 to 30 μg/ml two to three days post challenge indicating that chicken MBL functions as an acute phase reactant.

Figure 6 shows the time course of the specific antibodies developed after an IBV infection measured on day 0, 7, 14, and 21 post infection. The L line creates a significant higher titer of IBV specific-antibodies than the H line indicating that there is an inverse relationship between the cMBL basis level and the ability to produce antibodies

Figure 7 shows the RT-PCR product of IBV in trachea and cloak swabs 3 days post inoculation. PCR bands only showed up in trachea samples and only in the two pools originating from the 8 animals with low MBL.

Example 5

MBL concentrations in serum of infected chickens in relation to time of inoculation. During the initial two weeks of the experiments, the light period was reduced from constant light to 12 h beginning at 0700 h. Thus, a 12-h period of total dark started at 0700 h.

Virus

Experimental infections were performed with the M41 strain of IBV. The virus was propagated and titrated by inoculation in the allantoic cavity of 9-day-old SPF chicken embryos.

Experimental Infections and Design

The experimental infections were performed in two independent identical trials (Experiments 1 and 2), each including 30 chickens. The time span between the trials was 3 months. In each trial, the chickens were allocated to three groups of 10 birds each and placed in three isolators. At the age of 42 d, all chickens were inoculated with 0.2 ml_ of inoculum nasally and orally. One group was mock inoculated with sterile allantoic fluid at 0900 h The other two groups were inoculated at 0900 h (light) and at 2100 h (dark), respectively, and each chicken was given 10^{6 25} ELD₅₀ of IBV.

Serum Samples

Serum samples were collected from all chickens when they were 14, 21 , 28, 35, and 38 d old, respectively. This corresponds to 28, 21 , 14, 7 and 4 d before the inocula- tion with virus. Five chickens in each group were bled on Days 1 , 3, 5, 9, 14, and 18 Pl and five chickens were bled on Days 2, 4, 7, 1 1 16, and 21 Pl.

ELISA for measurement of serum antibody titers to IBV was performed as described in example 4.

Statistical Analysis

Due to the lack of normal distribution of the antibody titer data raised from the IBV infection, data were transformed to Log(e) which gave an almost normally distributed data set. Group 1 includes birds bled on Days 5, 9 14, and 18 Pl in both ex- periments and Group 2 includes birds bled on Days 7, 1 1 , 16, and 21 Pl in both experiments. The two experiments started at different times, which may have influenced the effect of the challenge with IBV. In order to analyze the difference in the antibody response titer due to infection time, the following model was used:

y_≠ = μ + T + G, + Ex_t + Tx Ex_Λ + D_{ι +} e_{≠ [Mode}, ^

where ^ ⁼ overall means, ' ^~ fixed effect of time i of infection, ^{y "} fixed effect of grouping j of birds within time of infection, Ex_k = fixed effect of experiments k, D =

fixed effect of the first day after infection, and ^y≠ and ^≠ are expected to be nor- mally distributed.

Furthermore, a statistical analysis was done on the basis of the MBL concentration before the IBV challenge according to the grouping and the age of sampling as given for Model 2: y, = μ + T₁ + b • age, + e, [Model 2] where ■ = fixed effect of the grouping i used in the subsequent experiments, b = regression on age, age = age at drawing the sample in group i, and μ, y> , and ^e- were as for Model 1.

Finally, the MBL concentration as a consequence of the IBV infection was statistically analyzed, omitting the data of the control. The time factor was included in the model as second-degree polynomium as a co-variable within treatment. Also in- eluded in the model was the probable effect of the repeated experiments. Thus the model becomes:

y_it = μ + T + Ex_t + b_λD + b₂D² + fa D + b₂ D² \ + e_Λ [Model 3]

where ^ , ■ , * , ^ , and ^e* was as for Model 1 , ^ * = regression coefficients on 1 ^st and 2^nd degree generally, ^ ' *■ = regression coefficients on 1^st and 2^nd de¬

gree specifically for trait i, = time in days, and D = time in days squared.

Figure 8 shows the acute phase response against IBV in relation to inoculation time. In order to evaluate the serum MBL concentrations during the two experimental infection trials, we inoculated 6-week-old chickens with IBV. One group of chickens was inoculated with IBV at 0900 h after a long period of dark, one group of chickens was inoculated with IBV at 2100 h after a long period of light, and one group of chickens was mock inoculated. Serum samples were collected during the acute stage of the infection and analyzed for the concentration of MBL in serum. The MBL concentration was then transformed to the percentage of up-regulation according to the basic level of MBL in each individual chicken. Only days showing the acute stage of the infection are included in Figure 8. At Days 9 to 21 the MBL level had returned to basis level in the two virus-infected groups. The control chickens did not respond to the inoculation indicating no stress as a result of handling the chickens. The virus-infected chickens responded to the treatment showing a 1.5 to 2-fold increase in the MBL concentration peaking 3 to 4 d Pl and returning to normal level on Day 7 Pl. However, a discrepancy was observed between chickens inoculated at 0900 h and those inoculated at 2100 h. The statistical analysis according to Model 3, comprising data from serum samples taken during Days 1 to 8 Pl, showed highly significant differences (P < 0.0001 ) between the two infected groups. The LS Means of the treatments, adjusted for curve-linear effects of time and the effect of experi- ments, were 23% for chickens challenged at 2100 h and 45% at 0900 h

The contemporary co-variable effect of the time after challenge was strongly significant (P < 0.0001 ) for first degree and (P < 0.001 ) for second-degree coefficient of the polynomium. There was no within treatment effect of the time after challenge pointing at the fact that the two curves of Figure 6 had the same curvature. The full Model 3 explained 31 .2% of the variation in the data set. Taking the first derivative of the polynomium for each of the treatments and equating that to zero and solving for time gives the time of maximum for the curve. This value was 3.6 d for chickens challenged at 0900 h and 4.5 d at 2100 h. When comparing with Figure 8 it may seem a bit high due to the used statistical model. However, the importance of the obtained values for the two treatments is the difference of 0.9 d for which the 210O h curve is postponed compared to the 0900 h curve.

Chickens inoculated at 0900 h had a higher MBL acute phase response to the IBV infection than chickens inoculated at 2100 h (Fig. 8). This could not be due to volume differences in the blood during the day since all blood samples were taken at the same time of the day (0900 h) - neither do we think it can be the food intake since water and food were supplied ad libitum. Apparently, the MBL response was correlated with light and dark and/or the diurnal-rhythm in general. Many neuroendocrine hormones exhibit rhythmicity. Given the close relationship between the neuroendocrine pathways and the immune system, it is expected that some immune parameters exhibit diurnal rhythmicity. As an example, the neural hormone melatonin participates in many important physiological functions, including the control of seasonal reproduction, as well as influencing the immune system (Guerrero and Reiter, 1992). In chickens, the serum concentration of melatonin reaches its maximum level at the midpoint of the dark phase and its minimum level at the midpoint of the light phase (Lynch 1971 ; Petrovsky and Harrison, 1997).

Figure 9 shows the specific IBV antibodies produced for inoculations performed morning or evening. Serum samples were analyzed for specific antibodies against IBV using an IgG specific ELISA. Only samples from Days 5 to 21 Pl were analyzed. The statistical analyses of the data according to Model 1 , comprising data from se- rum samples taken during Days 1 1 to 21 Pl showed a highly significant difference in titer (P < 0.0091 ). The model explained 15.5% of the variance. The effect of grouping was substantial (P < 0.0478) and although the interaction of grouping and time of infection was not significant, the part of the variation explained by the model in- creased from 14.5% to 15.5%. The least square means of the transformed data were 8.83 and 8.38, respectively, for infection at 2100 h and 0900 h having a standard error of 0.13. Re-transforming to titer values gives the values 6,816 and 4,349 which are the geometric means of the data adjusting for grouping effect, day of bleeding and experimental series. One possible explanation for the difference in specific antibody titer could be that the specific antibody response was subjected to a similar light and dark and/or diurnal- rhythm mechanism(s) as cMBL. However, another possibility could be an antiviral neutralizing effect of MBL through complement activation and opsonization by MBL receptors on phagocytic cells, as the first line of defence removing the IB virus be- fore the adaptive immune response takes over. The latter possibility proved to be correct as shown by analysis of the ability of chicken serum MBL to activate the MBL pathway of the complement system.

The ability of chicken serum MBL to activate the MBL pathway of the complement system was tested in two randomly chosen animals of each of the three experimental groups in a heterologous complement activation assay by means of deposition of human C4 on the chicken MBL/MASP complex (Figure 10). When bound to microorganism, the MBL/MASP complex activates the complement components C4 and C2, thereby generating the C3 convertase and leading to opsonization by the depo- sition of C4b and C3b fragments. The contribution from the classical complement pathway was inhibited by means of high ionic strength in the experimental buffer (data not shown; Petersen et al., 2000, 2001 ). The control group showed no difference in the ability to deposit C4 on MBL/MASP complex before and after the inoculation (Fig. 10 a), whereas the test groups showed an increase in the ability to de- posit C4 (Fig. 10 b,c). This increase in C4 deposition was parallel with the increase in cMBL concentrations on Days 3 to 4 Pl. This suggests that a quick removal of the IB virus by opsonization is a probable explanation of the lower specific antibody titer in serum samples from chicken inoculated at 0900 h than in those inoculated at 210O h. Thus, the nature of the immune response was modified by the time of the day the inoculation was performed. From a practical point of view, it seems important to investigate the interaction between components of the innate immune system and the adaptive immune system further when designing new vaccine strategies for chick- ens. Moreover, it also seems important to investigate the involvement of intermittent lighting to chickens in relation to immunological factors.

Example 6

Basis MBL concentrations in serum of chickens in relation to the presence of Pas- teurella multocida in spleens after inoculation

Experimental animals and housing conditions

The present study was performed at the National Institute of Veterinary Research

(NIVR) in Hanoi, Vietnam where 100 chickens from the indigenous Vietnamese breed (Ri) were experimentally infected with P. multocida. All animals were purchased from a governmental breeding station, the Thuy Phuong Poultry Research Centre, and kept here until 1 week prior to inoculation at which time they were moved to the experimental facilities at NIVR. Each group of chickens was housed in a separate room with concrete floor and sawdust bedding. Standard chicken feed and water was given ad libitum. All animals were vaccinated against Gumboro and Newcastle disease.

Experimental infection

All chickens were inoculated at the age of 17 weeks with an isolate of P. multocida subsp. multocida, strain 40605-1 isolated from an outbreak of fowl cholera in wild birds in Denmark (Christensen et al., 1998). The inoculum was prepared as follows: Two days before inoculation, the isolate was spread onto blood agar plates (BA) containing 5% citrated sheep blood and incubated aerobically at 37^QC for 24 hours to check for purity. One day before inoculation, 3-5 colonies were inoculated into BHI broth and incubated overnight at 37^QC with a moderate horizontal shaking. The overnight culture was later estimated to contain 4.6 x 10⁹ colony forming units (cfu) P. multocida from two dilution arrays each counted twice after incubation on BA. Each chicken was inoculated intratracheal^ with a dose of 2.3 x 10⁶ cfu P. multocida in 0.5 ml solution. Sampling

Serum samples were taken from all animals at week 0, 1 , 2, 3 and 4 post infection

(p. L), stored at -20^QC and subsequently transported to Denmark.

The base line serum MBL level for each chicken was defined as the lower of the two serum samples taken at week 0 and 4 p.i. as these were the most likely samples not to have been affected by infections. The samples were tested in duplicate sets using a previously described sandwich ELISA method (Juul-Madsen et al., 2003).

Furthermore, at the end of the experiment all chickens were examined post mortem for pathologic lesions, where particularly lungs, liver, spleen and kidneys were inspected. The spleen was removed from all animals for later examination for P. mul- tocida using the mouse inoculation model (Muhairwa et al., 2000).

Figure 9 shows the significant differences in basis level of cMBL in chickens inoculated with P. multocida. Chickens positive for P. multocida in the spleen had a significant lower basic level of MBL ib serum.

Example 7 The objective of this example is to provide an evaluation of the base line serum MBL concentration in an outbred versus an inbred chicken breed, represented by a typical indigenous scavenging breed from Vietnam (Ri) and a commercial breed (Luong Phuong) originating from China. Furthermore, the possible association of base line serum MBL concentration with pathological findings is examined, as well as the specific immune response during an experimental infection with P. multocida.

Methods

Experimental animals and housing conditions

The present study included 125 chickens of each of two breeds, an indigenous Viet- namese breed (Ri) and a commercial breed (Luong Phuong) of Chinese origin. One hundred chickens of each breed were experimentally infected with P. multocida, and 25 chickens of each breed were used as uninfected control animals. All animals were purchased from a governmental breeding station, the Thuy Phuong Poultry Research Centre, and moved to the experimental facilities when they reached 16 weeks of age. Each group of chickens was housed in a separate stall room with concrete floor and sawdust bedding. Standard chicken feed and water were given ad libitum. All animals were vaccinated against Gumboro and Newcastle disease.

Experimental infection

After 1 week of adaptation to the new environment at NIVR, all chickens were inoculated at the age of 17 weeks with an isolate of P. multocida subsp. multocida, strain 40605-1 isolated from an outbreak of fowl cholera in wild birds in Denmark. The inoculum was prepared as follows: Two days before inoculation, the isolate was spread onto blood agar plates (BA) containing 5% citrated sheep blood and incubated aerobically at 37^QC for 24 hours to check for purity. One day previous to the inoculation of the chickens, 3-5 colonies were incubated in BHI broth overnight at 37^QC with a moderate horizontal shaking. The overnight culture was later estimated to contain 4.6 x 109 colony forming units (CFU) P. multocida from two dilution ar- rays, each counted twice after 19 incubation on BA. Each chicken was inoculated intratracheal^ with a dose of 2.3 x 106 CFU P. multocida in 0.5 ml solution. The control chickens were sham inoculated with an equivalent amount of saline water.

Sampling Serum samples were taken from all animals at week 0, 1 , 2, 3 and 4 post infection (p. L), stored at -20^QC and subsequently transported to Denmark. Due to the risk of carrying exotic viruses or other infectious agents from Vietnam, the samples were subjected to an inactivation treatment with electron beam irradiation of 25 kGy. The impact of this procedure was evaluated in a pilot study where serum samples from Lohman Brown chickens were separated in two tubes for each sample. One sample from each chicken was irradiated, whereas the other was left untreated. The serum MBL was subsequently measured in all samples as described below.

ELISA for measurement of specific antibodies to P. multocida and concentration of MBL in serum

The specific antibody response to P. multocida was tested at all sampling days using an indirect sandwich ELISA according to the manufacturer's recommendations (FlockChek® Anti-Pm, Idexx Europe, Schiphol-Rijk, The Netherlands). In short, 96- well plates, coated with antigen by the manufacturer, were incubated with test sam- pies as well as positive and negative controls for 30 minutes at room temperature. Each well was washed with deionized water 3 times and subsequently incubated with (Goat) Anti-Chicken: Horseradish Peroxidase Conjugate for 30 minutes at room temperature. The plates were again washed with deionized water 3 times and Tetramethylbenzidine (TMB) substrate solution was added to each well, followed by 15 minutes of incubation at room temperature. The reaction was stopped by adding Stop Solution into each well and the absorbance measured at 650nm in an ELISA reader. All samples were run in duplicates.

Serum MBL concentrations were determined in duplicates using the sandwich ELISA method. In short, microtiter plates coated with monoclonal anti-chicken MBL antibody (HYB182-1 ) were incubated overnight at 4^QC. Upon emptying the wells, non-specific binding was blocked by incubation with BSA in TBS for 2 h at room temperature and subsequently washed with TBS-Tween. After dilution with TBS- Tween-EDTA, the serum samples were added to the wells, with each sample tested in duplicate. To determine the MBL content in the samples, standard 1 chicken serum with a known MBL concentration was added to the plates. The plates were incubated overnight at 4^QC and subsequently washed. Biotinylated HYB182-1 was then added and the plates incubated for 2 h at room temperature. Another wash was followed by 2 h of incubation at room temperature with alkaline phosphatase- conjugated avidin. Afterwards, the plates were incubated for 1 h at 37^QC with the substrate paranitrophenylphosphate and the optical density (OD) subsequently measured at 405 nm. A calibration curve was constructed from the OD values of the 'standard' serum. OD values of samples were transformed to MBL concentrations according to this standard curve. Serum MBL concentrations were determined for each chicken from the serum samples taken at week 0 and 4 p.i., as these were the most likely samples not to have been affected by the experimental infection. The base line serum MBL concentration for each chicken was subsequently defined as the lower of the two serum samples.

Bacteriological examinations

After euthanasia, the spleen was removed aseptically from all chickens for later examination for P. multocida invasion using the mouse inoculation model. In short, the spleens were macerated under sterile conditions and cultured on Blood Agar (BA). Suspect P. multocida colonies from overnight cultures were then inoculated by in- traperitoneal injection into Pasteurella-free mice. The mice were observed for 48 h, euthanized and dissected. The spleens of the mice were aseptically removed and macerated under sterile conditions. Spleen material was subsequently inoculated on BA and incubated overnight under aerobic conditions at 37^QC. Pure colonies were subjected to motility test, catalase test, oxidase test, and Gram staining to confirm the identity of Pasteurella.

Statistical analysis

Due to the high number of samples (N = 100, for each breed), parametric tests were considered appropriate for statistical analyses of the data. Mean specific P. multo- cida antibody titers were tested for differences between groups and sampling days using the unpaired t test. The unpaired t test was likewise used to test for differences in mean serum MBL concentrations, except for the comparison between chickens with or without spleen invasion of P. multocida. These data did not follow a normal distribution and the number of chickens included (18 and 82, respectively) were considered too low to use a parametric test and the non-parametric Mann- Whitney U test was therefore used. Pearson correlation calculations were used to evaluate possible correlations between base line serum MBL concentrations and specific P. multocida antibody titers at the different sampling days. P12 values less than 0.05 were considered significant. All above mentioned tests were performed using the statistical software GraphPad Prism (GraphPad Software, 2005).

Results

Both breeds were found to have a statistically significant higher mean serum MBL concentration at week 0 p.i. compared to week 4 p.i. (Fig. 13). Although most of the chickens were found to have the lowest serum MBL concentration at week 4 p.i., some chickens were found to have the lowest serum MBL concentration at week 0 p.i The base line serum MBL concentration was therefore determined for each chicken as the lower of the two serum samples assessed, with means of 12.46 μg/ml for the Ri and 12.72 μg/ml for the Luong Phuong chickens. No statistically significant difference was found between the two breeds. P. multocida was re- isolated from the spleen of 18 of the Ri chickens but in none of the Luong Phuong chickens. The mean base line serum MBL concentration of the chickens with spleen invasion of P. multocida was found to be 9.74 μg/ml, whereas the mean base line serum MBL concentration of the rest of the Ri chickens was 12.83 1 μg/ml (Fig. 14). This difference was found to be statistically significant (p=0.0087). Statistically, the specific P. multocida antibody titers increased significantly for both groups of chickens from week 0 and peaked at week 2 p.i. after which the titers decreased significantly until the end of the study (Fig. 15). At weeks 2, 3 and 4 p.i., the Ri chickens were found to mount a significantly higher antibody response to P. multocida than the Luong Phuong chickens. No statistically significant difference was found between the two breeds at week 0 and 1 p.i.. In the group of Luong Phuong chickens, a statistically significant correlation was found between the base line serum MBL concentrations and the P. multocida antibody titers at week 1 , 2 and 4 p.i. (Fig. 16a). No statistically significant correlation was found at week 0 and 3, although the p- value at week 3 was in proximity of the significance level (p = 0.073). Correlation was likewise found in the group of Ri chickens, where the P. multocida antibody titers were found statistically to be significantly correlated with base line serum MBL concentrations at weeks 2, 3 and 4 p.i. (Fig. 16b). No statistically significant correlation was found at week 0 and 1 , although the p-value at week 1 also was in prox- imity of the significance level (p = 0.066). The r squared (r2), indicating the fraction of the variance in the two variables that is shared, ranged from 0.03 to 0.26 (Fig. 16a and 16b).

Discussion

It is possible that MBL has an antibacterial effect on Gram-negative P. multocida in chickens, and that the course of infection with this pathogen is correlated with the individual's base line serum concentration of MBL. In the present example, the serum MBL concentration in two chicken breeds is determined and the possible asso- ciation with the specific immune response to an experimental infection with P. multocida is examined. The base line serum 1 MBL concentration was furthermore examined for possible association with P. multocida invasion of the spleens. Initially, a pilot experiment was performed to examine the impact of virus inactivation with a 25 kGy electron beam irradiation on MBL activity. No difference was found between irradiated and control samples (data not shown), and it was therefore concluded that this virus inactivation procedure could be used on the imported Vietnamese serum samples without compromising the results of the MBL ELISA method. Most of the chickens were found to have a lower serum MBL concentration at week 4 p.i. than at week 0 p.i.. Although no symptoms were observed, it is possible that these chickens had an infection at the arrival at NIVR, or that stress related to the transfer from the Thuy Phuong Poultry Research Centre in some way may have caused an elevation of the serum MBL concentration. A similar elevation of serum MBL concentration has previously been observed in relation to stress in chickens (unpublished). As the measured serum MBL concentration from week 4 was not always the lowest, we defined the base line serum MBL concentration for each chicken as the lower of the two serum samples assessed. No statistically significant difference in mean base line serum MBL concentration was found between the indigenous Ri chickens and the commercial Luong Phuong chickens. This is in accordance with a study of 308 chickens where no differences in serum MBL concentrations were found between 14 different breeds, including commercial (such as New Hampshire and White Leghorn) and indigenous breeds (Danish Landrace and the Red Jungle Fowl) (Laursen et al., 1998). In contrast to these results, inter-breed variation was recently observed between ISA Brown and the Hellevad type (a White Leghorn x New Hampshire cross), which were found to have mean serum MBL concentrations of 6.57 and 18.81 μg/ml, respectively (unpublished). In humans, differences in serum MBL concentrations between populations have likewise been found and also shown to be attributed to differences in frequencies of MBL alleles. Although the present study was unable to demonstrate a difference in serum MBL concentration between 1 Ri and Luong Phuong chickens, great variations were found within each of the two breeds which probably reflect the presence of different MBL alleles in the populations (Fig. 14). Infection with P. multocida may lead to acute septicaemia where internal organs such as the liver and spleen are invaded. In the present example, systemic infection was observed in 18 of the Ri chickens infected with P. multocida. These chickens were found to have a statistically significant lower mean base line serum MBL con- centration than chickens with no spleen invasion (Fig. 14), suggesting that MBL plays an important role in the chicken immune defence against P. multocida. It has previously been shown that the concentration of serum MBL increases during viral infections, such as infectious laryngotracheitis virus (ILTV), infectious bursal disease virus (IBDV) and IBV but this is the first demonstration of an association of chicken MBL with bacterial infections. However, other factors in the host have also been shown to be associated with the course of infection with P. multocida, for example that resistance of a low dosage of P. multocida is linked with genes of the chicken Major Histocompatibility Complex. An association with heterophil leukocytes have also been demonstrated, although these cells were found to have a dual function: recruitment of heterophils into the lungs led to tissue damage and invasion, but as the infection progressed, heterophils limited the infection by promoting clearance of the bacteria from the lungs and spleen. In a mouse model of MBL deficiency, neutrophils, the mammalian homologue to the avian heterophils, has likewise been found to play a role in Staphylococcus aureus infections. The results of these au- thors indicated that neutrophils, MBL and macrophages together provide an efficient barrier to organ invasion of S. aureus in mice. The progression of specific P. multo- cida antibody titers during the experiment was, for both breeds, identical to the immune response typically seen in initial infections. A statistically significant negative correlation was found 1 between the specific antibody response and the base line serum MBL concentration for both breeds (Fig. 16a and 16b). The r squared (r2), determined from the Pearson correlation calculations, was found to range from 0.05 to 0.26 at sampling days, at which a significant negative correlation was demonstrated. The r2 designates the fraction of the variance in the two variables that is shared. In other words, 5% to 26% of the variance of the antibody titers can be ex- plained by the variation in base line serum MBL concentration. Although also influenced by other factors, the specific P. multocida antibody response was clearly associated with the base line serum MBL concentration. This indicates that MBL in chickens is capable of acting as the first line of defence against P. multocida by diminishing the infection before the adaptive immune response takes over, hence re- ducing the specific antibody titer. An equivalent explanation was suggested by in a study where a similar correlation was seen in chickens inoculated with infectious bronchitis virus (IBV). Statistically significant differences in the specific antibody response between the two breeds were also found, with Ri chickens showing a higher response than Luong Phuong chickens. In an experimental infection study with SaI- monella Enteritidis, Ri chickens were similarly found to mount a higher antibody response than Luong Phuong chickens. These results suggest that the indigenous Ri chickens have a genetic potential for a higher humoral immune response than the commercial Luong Phuong chickens. However, the higher antibody response in the group of Ri chickens did not seem to have an impact on the course of infection as systemic infection occurred in 18 of these chickens and none of the Luong chickens. A similar observation has been made in turkeys where line differences in antibody concentrations did not appear to be associated with resistance to P. multocida. Support of the importance of MBL in chickens has furthermore indirectly been found in the fact that the lowest serum MBL found in chickens is considerably higher than in humans, and that, in contrast to man, no chickens so far have been found MBL deficient. A pilot breeding study where 5 hens with high or low MBL levels were inseminated with semen from one cock with corresponding high or low levels of MBL, resulted in significant differences in MBL expression between the F1 generations, indicating that the base line serum MBL concentration is under genetic influence. These results were confirmed by an extension of the breeding study for another 6 generations which resulted in two distinct groups of chickens, with mean serum MBL concentrations of 8.6 μg/ml and 23.6 μg/ml, respectively. The apparent importance of MBL to the susceptibility to infectious diseases in chickens and the ease of breeding for MBL expression together suggest the obvious possibility of employing base line serum MBL concentration as a parameter in disease control. This could probably be of particular significance in organic production systems where potentially high levels of disease, together with regulations on prophylactic treatment call for alternative disease control methods. Introducing chicken lines with high MBL concentrations could similarly be a possible measure in poverty alleviation in developing coun- tries, where disease control through treatment or vaccination programmes in rural areas often are lacking or simply too expensive for smallholder farmers.

Examples 8-1 1

These examples relates to the influence of serum mannose-binding lectin levels on the immune response to E.coli.

General methods

Bacterial Culture for Inoculation: A mixture of three E.coli strains 02, 01 1 and 078 was used for inoculation. The E.coli strains are isolated field strains known to be able to cause colibacillosis in chicken flocks. Each of the E.coli strains was cultured for 4 to 5 h at 37DC in BactoTM Veal Infusion Broth (Becton Dickinson, France), centrifuged at 17000 g at 4DC for 15 min, and resuspended in 0.9% NaCI. A mixture from each of the three isotypes of E.coli of 1010 colony forming units/ml (cfu/ml) was prepared. The mixture was then made in three dilutions for the experiment infections in part 3 namely 106 cfu/ml, 108 cfu/ml and 1010 cfu/ml and in a dilution of 2 x 108 cfu/ml for the experimental infections in part 4.

E.coli in Lung Tissue: Lung tissue was placed in sterile NaCI 0.9%, and the lungs were shredded with scissors. The tissue was mixed for 2 min in sterile Steriblend bags (Bibby Sterilin, Staffordshire, UK) on a BagMixer (Interscience, France) before they were tested in culture on blood agar and MacCONKEY-Agar (Merck, Darmstadt, Germany) for the presence of E.coli.

ELISA Measurements of Serum MBL: Serum MBL was determined in a sandwich ELISA as described by Norup and Juul-Madsen (2007). Mouse anti MBL (HYB 182- 01 , Statens Serum Institut, Copenhagen, Denmark) was used as capture antibody and biotin conjugated HYB 182-01 (Statens Serum Institut, Copenhagen, Denmark). Dilution series of a normal chicken serum (stored at 2O DC in aliquots) was used as a standard, and selected serum samples were used as high and low level controls. ELISA Measurements of Serum IBDV Antibody Titres: The ProFLOKD IBD ELISA Test Kit (Kirkegaard and Perry Laboratories, Gaithersburg, MD) was used to measure serum IgG antibody titres against IBDV. The ELISA assay was performed according to the kit manual. Briefly, 96-well micro titre plates coated with IBDV antigen were incubated for 30 min at RT with 5 DL serum samples and positive and negative controls included in the kit, followed by incubation for 30 min at RT with a horse- radish peroxidase (HRP) conjugated affinity purified antibody from a pool of serum from goats immunized with chicken IgG (H+L). 2,2'-Azinodi 3-Ethyl Benzthiazoline Sulfonic Acid (ABTS) was used as chromogen and 5% sodium dodecyl sulphate (SDS) as stop solution. The result was monitored as optical density (OD) at 405 nm and the antibody titre was calculated from the following equation format: SP = (sam- pie absorbance) - (average normal Control absorbance)/corrected positive Control absorbance). Titres exceeding 1000 were considered positive. ELISA Measurements of Serum E.coli Antibody Titres: Micro titre wells (Maxisorp, Nunc, Roskilde, Denmark) were coated with 100 Dl of sonicated E.coli (mixture of the three strains 02, 01 1 and 078) suspended in a carbonate buffer of 15 mM Na2CO3, 35 mM NaHCO3, pH 9.6 (a stock of sonicated E.coli with an OD600/1 cm at 1.63 diluted 1 :30). After incubation overnight at 4 ^QC, residual protein-binding sites were blocked by 200 Dl PBS containing 1 % (w/v) bovine serum albumin (BSA) in 130 mM NaCI, 9.6 mM Na2 HPO4.2H2O, 2.2 mM KH2PO4, pH 7.4 (phosphate buffered saline, PBS) for at least 1 h at room temperature. Following washing in 200 Dl PBS containing BSA 0.05% (w/v) (PBS-BSA), 100 Dl diluted serum in PBS-BSA was added to the wells. Wells receiving only buffer were used as negative controls, and as standard a dilution series of a serum, selected on basis of a high OD, was used (units are given arbitrarily in proportion to this serum). All dilutions were added in duplicate. After incubation for 1¹/2 h at room temperature and washing in PBS- BSA the wells received 10 ng horseradish peroxidase (HRP) conjugated goat anti chicken IgG (AA129P, Serotec,UK) in 100 Dl PBS-BSA. Upon further incubation for 1 h and washing using PBS-BSA, the presence of HRP was determined by adding 100 Dl of substrate solution (<0.0 5% w/w 3, 3', 5,5" Tetramethylbenzidin). Colour development was stopped with a 1 M solution of H2SO4 and determined by reading the absorbance at 450 nm with absorbance at 650 nm as a reference.

To be certain that all antibodies bound were specific for E.coli, serum samples were prepared in a non-precipitated and a precipitated version. Serum was precipitated with a suspension of sonicated E.coli (0.7 Dl E.coli stock/Dl serum), incubated for 1 h at room temperature followed by centrifugation (17,000 g for 15 min, 20 DC). All titres were calculated from the standard curve, and the actual antibody titre for each sample was thereafter calculated as the difference between the non-precipitated and the precipitated titre value. Intra and inter assay variations were 8.5 and 12.1 , respectively, for the high E.coli Ab serum control and 6.3 and 9.0, respectively, for the low E.coli Ab serum control. T-cell Stimulation Assay: Peripheral blood mononuclear cells (PBMC) were obtained from heparinized blood by separation on a Ficoll-PaqueTM Plus (Amersham Biosci- ences, Sweden) gradient. A total of 2 x 107 cells were resuspended in 2 ml phosphate buffered saline (PBS) containing 0.1 % fetal bovine serum (FBS, Gibco, Invi- trogen Corp. USA) and carboxyfluorescein diacetate succinimidyl ester (CFSE, Cell TraceTM CFSE Cell Proliferation Kit, Molecular Probes, USA) at a 0.5 DM concentration. After incubation for 10 min at 37 ^QC, an equal amount of RPMI 1640 containing Streptomycin, Penicillin and L-glutamin (RPMI, Cambrex, USA) supplemented with 10% FBS was added to stop the reaction. Subsequently, cells were washed twice with RPMI by centrifugation for 5 min at 296 x g at 20 ^QC. Following washing, the cells were resuspended in RPMI at a final concentration of 1 x 107 cells/ml.

Cells were cultivated in RPMI 1640 with 10% FBS in the presence of concanavalin A (ConA, Sigma-Aldrich, USA) at a concentration of 10 μg/ml or 20 μg/ml for 3 d (5% Co2, 40 ^QC). Cells cultivated in RPMI with 10% FBS only were used as negative controls. Flow Cytometry: For flow cytometric analysis, cells cultured in the presence of 10 μg/ml ConA were stained with CD4-RPE antibody (clone: CT-4, Southern Biotech, USA) and cells cultured in the presence of 20 μg/ml ConA were stained with CD8D- RPE antibody (clone: EP42, Southern Biotech, USA). Cells were stained for 25 min at room temperature, washed twice in FACS-buffer (PBS with 0.05% horse serum, 0.1% BSA and 0.2% Azid), and resuspended in FACS-buffer to a final concentration of 106 cells/ml. Flow cytometric analysis was performed on a FACS-Canto (BD Bio- sciences) flow cytometer using the FACS-Diva software. Random samples were tested by propidium iodide staining to evaluate the amount of dead cells. Statistical Analysis: Part3: The MBL acute phase response as a result of inoculated doses of E.coli and days after inoculation was examined. The analysis showed a significant difference in basic MBL levels of the 4 treatment groups at day 0. Visual inspection of the time series also indicated a general decline in MBL in the untreated group. Therefore, the response in MBL was analysed rather than the absolute MBL concentration. The response was calculated as (treatment value - day 0 value) for individual chickens, adjusted for the average decline from day 0 to day 6 in the untreated controls. The adjusted data was then analysed using Proc Mixed in SAS (SAS Institute Inc., 2001 ) with the following model: Yij = Ei + Dj + Ei^*Dj + eij , where Ei = effect of inoculated dose of E.coli and Dj = effect of day after first inoculation. Chicken ID within treatment was used as a random factor to account for the fact that samples were repeated measures within chickens. There was no significant difference in MBL between repeats, and as the dependent variable was adjusted response values, repeat was left out of the model. The MBL response values were not transformed as they were nearly normally distributed, and residuals vs. calculated values did not show a pattern indicating that transformation was needed.

As there were no significant effects of day after first inoculation or interaction between day and dose, the model reduced to significant terms was: Yj = Dj + eij.

Part 4: Analysis of IBDV antibody titres, E.coli antibody titres, daily weight gain, bursa to body weight ratio and data from T-cell stimulation was performed using Proc Mixed in SAS (SAS Institute Inc., 2000) with the following model: Yijkl = Ii + Ej + Mk + li^*Ej + li^*Mk +Ej^*Mk + li^*Ej^* Mk + eijkl , where Yijkl is one of the above response variables for the 1st chicken in the ith IBDV level, the jth E.coli level and the kth MBL type, Ii = effect of IBDV vaccination, Ej = effect of E.coli inoculation and Mk = effect of MBL type.

Analysis of data for MBL serum concentration was performed using Proc Mixed in SAS with the following model Yijkl = Ii + Ej + Mk + Dl + eijkl , where Ii = effect of IBDV vaccination, Ej = effect of E.coli inoculation, Mk = effect of MBL type and Dl = effect of day after first E.coli inoculation. Chicken ID within treatment was used as a random factor, to account for the fact that samples were repeated measures within chickens.

Examples 8

Study on the basic serum MBL level in 4 different chicken lines.

Methods

To determine the basic levels of MBL in chickens of different commercial layer lines, a study was performed with chickens of the ISA Brown (ISA), Lohman Selected Leghorn (LSL), Lohman Braun (LB) and Hellevad (HE) types. Two flocks of ISA, LSL and LB were used for the study, and at each time-point 20 chickens were randomly selected for blood-sampling. ISA flock 1 , ISA flock 2 and LSL flock 1 were tested at 16, 25, 35, 45 and 55 weeks of age. LB flock 1 were tested at 17, 25, 36, 47 and 56 weeks of age and LB flock2 and LSL flock 2 were tested at 3, 6, 9, 14 and16 weeks of age. 25 MBL 6 weeks of age were bled before onset of an experiment, and in addition 22 HE of unknown age were tested.

Results The basic serum levels of MBL in chickens are known to vary from less than 1 μg/ml to 35 μg/ml or more (Laursen and Nielsen, 2000) due to genetic variation. In the present study MBL levels were measured in two flocks of ISA Brown (ISA), Loh- mann Selected Leghorn (LSL), Lohmann Braun (LB) and Hellevad (HE), as shown in Figure 17. In general, HE chickens have mean MBL values 2 to 3 times higher than the mean MBL values in the other commercial chicken lines tested, although one of the LSL flocks do have mean MBL values almost at the same level as HE.

Discussion

See example 9 for a joint discussion of the results of examples 8 and 9.

Examples 9

Study on the ontogenetic development of serum MBL in an experimental chicken line.

Methods The Ontogenetic development in basic serum levels of MBL in 8 chickens of a single line was determined in L22 chickens (The Cornel line K; Cole and Hutt, 1973). MBL levels were measured regularly from week 3 to week 42.

Results

In order to test differences due to age, an ontogenetic study of the variation in serum MBL in a chicken line (L22) between 3 and 42 weeks of age was performed. The mean MBL level in this flock (n = 8) varied only a little from 2 to 18 weeks of age, with an elevation at 5 to 7 weeks of age. From week 19 the serum MBL level showed a more constant elevation that was maintained at least until 38 weeks of age. There were no differences between serum MBL levels of female and male chickens.

Discussion Results in this study show that chickens of the Hellevad line have basic MBL levels 2 to 3 times higher than the basic MBL levels in chickens from the other commercial chicken lines tested (Figure 17). Hellevad is generally believed to be a very robust breed due to the way of selection. Through 30 to 40 generations the Hellevad breed has not been vaccinated, and the breed has been selected for its high egg produc- tion in floor systems combined with characteristics that generally promote an appropriate behavior in a flock (Sørensen et al., 2004).

Chickens in one of the Hellevad groups were only 6 weeks of age, and those in the other group were of mixed ages, while the four other breeds were tested during a time span of 16 to 39 weeks. Within each flock, the serum MBL values are very ho- mogeneous over time, even though the tested chickens were randomly picked in the flock at each time. On the other hand, the two LSL flocks differ largely. This could be due to the different ages these two flocks were tested at (3 - 16 weeks of age vs. 17 - 55 weeks of age). To test this we performed an ontogenetic study with chickens of an experimental line (L22). The results supported that age was a possible explanation for the difference between the two flocks, in that an increase in the mean MBL level was seen around 19 weeks of age. This elevation was maintained for several weeks and did not differ between males and females. This difference was not equally pronounced between the two LB flocks. The data support, that basic MBL levels are relatively constant within each of the age groups 9 - 18 weeks of age and 19 - 38 weeks of age, but may be weakly elevated at 5 to7 weeks of age.

Examples 10

Assessment of serum MBL levels after inoculation with different concentrations of

E.coli in chickens

Methods

Chickens: The experiment was performed with layer chickens of the Hellevad type. For the first 6 weeks the chickens were commercially raised according to normal Danish standards. At 6 weeks of age the chickens were transferred to positive- pressure isolation chambers at the Research Centre Foulum (University of Aarhus, Denmark), and individually marked. Water and commercial chicken feed were supplied ad libitum. The lighting period was 12 h daily from 7.00 am to 7.00 pm, and the chickens were subjected to a constant temperature of 21 DC.

Infections and Design: The experimental infections were performed in two independent, identical trials, each including 44 chickens. The chickens in each experiment were allocated at random to four groups of 1 1 birds and placed in four isolation chambers. The experimental groups were Control (mock inoculated with sterile NaCI 0.9%), 106, 108 and 1010 (inoculated with 106, 108 and 1010 cfu of E.coli in NaCI 0.9% respectively). All chickens were inoculated orally and nasally with 1 ml of inoculum at days 0, 1 and 2. The experiment was terminated after 8 d. Serum and Tissue Samples: Serum samples were collected from five chickens in each group at days 0, 2, 4 and 6. All samples were taken between 8.00 and 10.00 am. A further two chickens from each group were killed at days 1 , 2 and 3 post inoculation, the left lung was aseptically removed to be tested for the presence of E.coli.

Results The acute phase response in chickens after nasal and oral inoculation with 3 different concentrations of E.coli was investigated in order to find the amount of E.coli necessary to provoke a measurable immune response. The experiment was repeated twice. Lung tissues were tested 1 , 2 and 3 days post inoculation for as a control of coloni- zation of E.coli. In lung cultures from mock-inoculated chickens, E.coli never ap- peared. On the other hand, E.coli appeared on all 3 test days in lung cultures from chickens of the 3 treatment groups, though not from all the chickens tested. At day 1 only a few colonies were seen in cultures of lung tissue from all 3 treatment groups. At days 2 and 3 the lowest number of colonies was seen in lungs from chickens in- oculated with 106 cfu, and most colonies appeared in lungs from chickens inoculated with 108 and 1010 cfu (results not shown). Selected colonies from tested lungs were all typed to be one of the three isotypes in the original inoculum. None of the chickens showed signs of diseases caused by E.coli infections. The basic serum MBL level for each chicken was measured on day 0 prior to the first E.coli inoculation. There were no significant differences between the treatment groups (Figure 18), and therefore MBL statistics were calculated as effect of treatment vs. control. A clear effect of inoculation with E.coli was seen, with significantly elevated responses at day 2 (P = 0.0007) and day 4 (P = 0.0102) compared to the mock-inoculated group. The highest level of MBL was seen at day 2 in the group inoculated with 108 cfu per chicken per day (P = 0.0057).

However, in this group MBL levels declined with the fastest rate. At day 4, chickens receiving 106 and 1010 cfu E.coli responded with an elevation (106 cfu: P = 0.0581 and 1010 cfu: P = 0.0630). The MBL levels in all E.coli inoculated groups declined towards basic levels at day 6 (Figure 18).

Discussion

This experiment was performed to find the amount of E.coli for inoculation of chickens to gain a measurable immune response. The Hellevad breed was used for this experiment because of its robustness and high level of MBL. As only a few colonies were seen in cultures of lung tissue from chickens inoculated with 106 cfu E.coli, this seems to be a dose too small to be able to colonize, and the lungs and the respiratory tract were actually cleared of bacteria too fast. Compared to that, the doses of 108 and 1010 were large enough to pass the first barriers and colonize the lungs, but not heavily enough to cause diseases. In chickens, no reports on the MBL serum levels in response to E.coli inoculations have been published, but it is well known that human MBL has a strong ability to bind to various carbohydrate structures of bacteria and other pathogens, deposit complement factor 4 (C4) on the surface of microorganisms, and thereby be able to initiate the complement cascade (Neth et al., 2000; Norup and Juul-Madsen, 2007). MBL also has a very strong ability to bind to E.coli in humans (Shang et al., 2005), and therefore the MBL levels in chickens were expected to be affected by inoculation with E.coli.

The present findings are in agreement with the levels found after experimental inoculation with avian infectious bronchitis virus (IBV) (Juul-Madsen et al., 2002; Juul- Madsen et al., 2003; Nielsen et al., 1999) and infection with infectious laryngotra- cheitis virus (ILTV) (Nielsen et al., 1999), which showed elevated MBL levels at days 3 to 4 and a subsequent decline approaching normal levels at day 7. Though not all of these vira contain binding sites for MBL, they initiate an acute phase response which includes a systemic elevation of MBL. In the present study, we only found an up-regulation of approximately 30 to 40% after infection, which is lower than the 60 to 90% up-regulation found by Juul-Madsen et al. (2003) and the approx. 100% increase found by Laursen et al. (2000), where chickens were exposed to viral in- fetions. One reason for the relatively weak MBL response to inoculation could be that our chickens had high basic levels of MBL, and therefore "had no reason" for a larger up-regulation. An indication of this was found by Juul-Madsen et al. (2004) when two groups of chickens were infected with IBV. One group had a low basic level of MBL (~4 μg/ml) and up-regulated MBL with 130% after infection, while another group with a high basic level of MBL (-21 μg/ml) only up-regulated MBL with 25 to 60%. Participation of other local immune mechanisms in the lungs could also reduce the systemic acute phase response. This is a mechanism observed by Shi et al. (2004) when they found that in MBL knock out mice an i.v. injection with Staphylococcus aureus (S. auresus) caused 100% mortality compared to 45% in wild-type mice. In contrast, when injected in the peritoneal cavity, the mortality in both groups was reduced to 0%. Shi et al. (2004) found that a normal population of neutrophils combat the intra peritoneal infection with S. aureus and therefore MBL was not needed.

In conclusion the serum concentration of MBL was elevated at day 2 after inoculation with 106 - 1010 cfu E.coli in Hellevad chickens.

Examples 1 1

Effect of serum MBL levels on susceptibility to E.coli after immune suppression.

Methods

Chickens: The experiment was performed with chickens from a line selected for a high (H-line) or low (L-line) basic level of MBL for several generations. The parents had not been vaccinated against IBDV. The chickens comprised 67.5% UM-19 and 33.5% White Cornish (Laursen et al., 1998). The chickens were raised in flocks, wing banded, and transferred to positive-pressure isolation chambers at 2¹/2 weeks of age. Water and commercial chicken feed were supplied ad libitum. The lighting period was 12 h daily, and the chickens were subjected to a temperature of 21 DC in the isolation chambers.

Infections and Design: The experiment lasted for 28 d and the experimental infections were performed in two independent identical trials, each including 72 chickens of the H-line and 72 chickens of the L-line. The chickens were allocated to 2 x 4 groups of 9 birds of each line and placed in eight isolation chambers (two isolation chambers for each experimental group). On day 0 all chickens were inoculated orally with live attenuated vaccine against Infectious Bursal Disease (Nobilis® Gum- boro D78 Vet, Intervet), or water. The vaccine was dissolved in sterilized water and given as 0.5 ml containing 104 Tissue Culture Infectious Dose 50 (TCID50) per chicken. On days 7, 8, and 9 all chickens were inoculated orally and nasally either with 0.5 ml of E.coli inoculum (108 cfu) or with 0.5 ml sterile NaCI 0.9%.

Serum and Tissue Samples: Serum samples were collected from four chickens from each line in each isolation chamber at days 7, 9, 10, 1 1 , 14, 21 and 28 (a total of 64 samples per day). All samples were taken between 8 and 10 a.m. On each of the days 7, 9, 10, 1 1 , and 14, one chicken from each line in each isolation chamber was killed. Bursa of Fabricius were removed and weighed. Furthermore, on days 7, 9 and 10 the left lung was aseptically removed, and tested for the presence of E.coli.

Results

At the age of 2¹/2 weeks, chickens of high and low MBL type were placed in isolation chambers and subjected to either water or live attenuated IBDV vaccine at day 0.

Subsequently the chickens were subjected to either NaCI or E.coli inoculum at day

7. Two repetitions of the experiment were run at the same time in separate isolation chambers.

IBDV titres were measured at day 7 and 28 (results not shown). The IBDV antibody titres were positive only for chickens vaccinated with IBDV. IBDV antibody titres were equally high at day 7 and day 28.

Chickens were inoculated with E.coli on 7, 8 and 9, and lung tissues were tested on days 7, 9 and 10 for the presence of E.coli. In cultures of lungs from chickens in the

I-E- or I+E- groups E.coli never appeared. On the other hand E.coli appeared in cultures of lungs from chickens in both the I-E+ and the I+E+ groups on days 2 and 3 p.i. although it did not appear in lung cultures from every chicken tested (results not shown).

In order to test the immune suppression, the bursa to bodyweight ratio was determined in killed chickens at days 7, 9, 10, 1 1 and 14 (Fig. 19). Bursa to bodyweight ratio was significantly reduced after vaccination with IBDV (P < 0.0001 ), while the subsequent inoculation with E.coli did not alter this ratio. The effect of IBDV vaccination on bursa to bodyweight ratio was seen on days 10 to 14, and the ratio was independent of MBL type. Body weight was measured in all blood-sampled chickens throughout the experi- ment. At day 0 of the experiment there were no differences in body weight between L-type and H-type chickens or between any of the experimental groups. The mean daily body weight gain was calculated for each of the experimental groups (Fig. 20). The IBDV vaccine significantly lowered daily weight gain (P < 0.0001 ), and E.coli also lowered daily weight gain significantly (P = 0.0024). In addition, it was found that in the groups given E.coli, chickens of the MBL L-type had a significantly lower daily weight gain than chickens of the H-type (P = 0.0090).

Mean basic levels of serum MBL in chickens of the H-type and the L-type were 24.1 μg/ml and 6.6 μg/ml, respectively, at day 7 (3¹/2 weeks of age, Fig. 21 a and 21 b). No increase in MBL was seen at day 3 to 4 p.i. in H-type chickens (Fig. 21 A). In the L- type chickens on the other hand, there was an increase in MBL in the group of chickens given both IBDV and E.coli compared to any of the other groups (Fig. 21 B), although this increase was non-significant.

Antibody titres to E.coli were measured in serum at day 28 (21 days after inoculation with E.coli, Fig. 22). Development of antibodies against E.coli was significantly sup- pressed by IBDV vaccination (P = 0.0174). There were no interactions between

IBDV vaccination and the E.coli challenge or the MBL type. Inoculation with experimental E.coli elevated the antibody titres against E.coli, though not significantly, but only in the group of chickens that did not receive the IBDV vaccine. On day 28, T-cell stimulation was performed using PBMC from chickens in the I-E- and the I+E+ groups of both the L-type and the H-type (5 chickens in each group of each type, Fig. 23). After culture for 3 d in the presence of conA (10 μg/ml for CD4 and 20 μg/ml for CD8), the percentage of proliferating CD4+ T-cells from H-type chickens was significantly higher than those from the L-type chickens (P = 0.0410; Fig 23A). The percentage of proliferating CD8+ T-cells was also significantly higher in H-type chickens compared to L-type chickens (P = 0.0279, Fig 23B). The eleva- tion in percentage of proliferating CD8+ T-cells in the H-type compared to the L-type chickens was more pronounced for chickens of the I-E- group than in chickens from the I+E+ group. However, there was no significant effect of treatment with IBDV and E.coli for chickens within a MBL type.

Discussion

Chickens from an experimental line selected for a high (H-line) or low (L-line) basic level of MBL for several generations were used for this experiment. The H-line and L-line had basic serum MBL levels of 24.1 μg/ml and 6.6 μg/ml respectively, which very well represents the highest and the lowest MBL values of the examined commercial chicken lines.

IBDV titres and the bursa to bodyweight ratio showed, that the immunosuppression was successfully performed and that there had been no contamination between the isolation chambers in that only chickens in the groups given IBDV vaccine were seropositive.

Bursa to bodyweight ratio was significantly reduced 10 to 14 d after vaccination with IBDV (Fig. 20). This is a well-known effect of vaccination with most live IBDV vaccines (Bumstead et al., 1993; Hair-Bejo et al., 2004; Tanimura et al., 1995). After infection with IBDV, or after vaccination with live attenuated IBDV vaccines, the bursa becomes oedematous with a subsequent state of atrophy. It is quite clear that the bursa in the period measured in this experiment was in the state of atrophy. The bursa to body weight ratio was not affected by E.coli infection. Both vaccination with IBDV vaccine and infection with E.coli affected chicken body weight gain negatively during the experimental period, while no overall effect of MBL type was seen (Fig. 19). Growth retardation is common as a consequence of vaccination with the D78 IBDV vaccine, but the extent of retardation greatly depends on vaccination regimen in the flock (Paul et al., 2004). Growth retardation in flocks infected with E.coli is also normal, depending on the severity of the infection. Ask et al. (2006a) found that increased susceptibility to infections with E.coli was associ- ated with increased growth retardation. Ask et al. (2006b) also found a genotypic effect on growth retardation in broiler chickens due to infection with an E.coli 078 K80 strain. In the present study, an effect of MBL-type was found in that the E.coli infection affected growth in chickens of the L-type more severely than chickens of the H-type. As chickens of the H-type and the L-type had the same body weight at the start of the experiment, the difference between MBL types in growth depression due to the E.coli cannot be attributed to differences in size and may thus be a direct consequence of basic levels of serum MBL.

In part 4, the measured MBL levels after inoculation with E.coli (Fig 21 ), large variation between chickens were found, and therefore none of the effects on MBL levels in this experiment were significant. However, the largest increase in MBL serum concentration was seen in L-type chickens of the I+E+ group (Figure 21 b), but the increase was not found to be significant, which is in contrast to the findings in experiment 1. For the H-type chickens the absence of an acute phase response to E.coli measured by MBL was not very surprising, as chickens with a high basic level of MBL may not need to or even be able to react with an elevated response to infections, as already mentioned.

Antibody titres to E.coli were depressed in the groups vaccinated with IBDV compared to the non-vaccinated groups, even in chickens not infected with experimental E.coli inoculum (Fig. 22). As E.coli is a fecal bacterium that all individuals are in con- tact with continuously, all the chickens are expected to develop antibodies against E.coli. Only those chickens not immune-suppressed responded to the experimental E.coli inoculation with elevated antibody titres to E.coli. In the present experiment, chickens suppressed with IBDV clearly had their antibody production to E.coli abrogated at an early stage. Others have found similar observations on antibody devel- opment using Newcastle Disease virus (NDV) as challenging antigen (Giambrone, 1979; Muskett et al., 1979; Nakamura et al., 1992).

From studies in humans, E.coli is among the pathogens that MBL is known to bind to with an intermediate to strong affinity (Shang et al., 2005; Shi et al., 2004; Turner, 1996; Valdimarsson et al., 1998), and since MBL is a potent opsonin and comple- ment activator via the lectin-pathway (Neth et al., 2000; Norup and Juul-Madsen, 2007), H-type chickens were expected to clear lungs from E.coli faster than L-type chickens which could lead to a lower antibody response to E.coli in H-type chickens. However, in this experiment the E.coli antibody titres were not significantly affected by the basic serum MBL level. Earlier investigations into T-cell function after an IBDV infection or vaccination have revealed impaire T-cell function in bursa, thymus, spleen and peripheral blood, all depending on IBDV strain and strain virulence (Corley et al., 2001 ; Corley and Giambrone, 2002; Poonia and Charan, 2004; Williams and Davison, 2005), age at infection (Giambrone et al., 1977; Sivanandan and Maheswaran, 1980b), and time after infection (Kim et al., 1998; Kim et al., 2000; Sharma et al., 2000; Williams and Davison, 2005). In the present study, T-cell function in peripheral blood lymphocytes was evaluated in H-type and L-type chickens 28 d p.v. (21 d post inoculation, Fig. 23). No significant effect of IBDV vaccination and infection with E.coli on CD4+ and CD8+ T-cell proliferation potential was observed. This was not very surprising in that other investigators conclude that impairment of peripheral blood lymphocyte function by IBDV is short and transient or even absent (Poonia and Charan, 2004; Roden- berg et al., 1994). On the other hand the subsequent infection with E.coli could have revealed some degree of interaction between treatment and MBL type. However, in respect to MBL type, it was found that T-cell proliferation in response to conA was high in H-type chickens compared to L-type chickens for both CD4+ and CD8+ cells. Several investigations have established that chickens are dependent on T-cell function in controlling an IBDV infection (Kim et al., 2000; Rautenschlein et al., 2002; Williams and Davison, 2005; Yeh et al., 2002). In relation to this dependency, this experiment has shown that genetic selection against MBL may have changed T-cell function in one of the sublines, which is an issue for further investigation.

In conclusion, it has been found that the basic level of MBL seems to be important in protecting chickens against E.coli infections due to lower body weight gain in E.coli infected chickens with low MBL. Therefore MBL may be a future selection parameter in choosing chickens for outdoor or organic farming. It was also shown, that the basic level of MBL seems to be of importance for both humoral and cellular immune responses. However, further investigations concerning the level of MBL and the possible impact on responses to vaccines and vaccination programs commonly used in poultry production have to be performed.

Sequences

SEQ ID NO:1

Chicken mannan-binding lectin gene

Promoter ΪGGCAAΪAΪACΪCΪGAGGCAAACΪAΪΪCCΪAΪΪACΪGΪACΪΪCΪCAΪGCAGGCΪCΪAΪΪGA- GAATTTTAGCCTGATCACTGTGTCATTATCTTTGTAGGAAGAGAAGTAGTAGGTGACTTATT- TAAATGTTTTAAGATTTGCTTCTTCAAGCAATGTTGTCTTTTCTAATCTACACACAAATGTA- CATGTTTGAGTTGGCCTATTTTTTTCCATGGATAATTCAGAGTATATTGCAGGAAAAATAGT-

CACTGCAGTCAAGCAAGATCCAAGTCTTTATTTGAAGATTAATCTATTGACTGAATTAAGGGGAAAAGCATTATGGTCAAAATGA ATACCTTTCAGATATCCTGATTTTTTTT-

TAGTTGTTTGGTTTTTTGTTGTTGTTGTTCTTTTTTTCTGTGTGTGTGCGGGGGGTGGGAGGG-

GAGAGGTTTTGTTTTGTTCTTCATTTGTACTGTAACAAAGTCAATATATATCCAAGGCCAGGCAAAGAGCAAAGGGTTTACTCAC

AGAGTGTCATACGCAATTCCTGTAAATAGGGGTGGTAAGGTTGAAGTAGATGATCGCTAGGATTGTGCAAGACAGA

Exon 1

GGCACGAGGATAAGCCGGAAAACCCTGAATAAAGCTAAAAATTACAGCTTTCGGTGGAAACGTGAAGGACTTTTTTTTTT

TGGCTGTCAGGAAAGCCAATGAAGTGATAAGATTTTCACTGTGCACTAAGCAGGTAAAGGTGCT

Intron 1

GGTAAGTAAAACTCTCTTTTGCTGTGATAAGTATTTGACCATACTGAGGCCTTGCAACCCTTGCAAGCACGAGCATACCA CTTAGAAAGTGGCTGCCCGAATGGTGCACAATAAGCTGATGAAGAAGACTAATTAGCAGGATGTGATCTGTCCATTTAAC AGCATTCTATCCCTTAGTATTCTCTATACTAATGTAATATTTACTTTTGAAGAGGAGTTTCCCCAGTATTTGACTCAACA GGGCTGTCCTTTTCTGTCAGAATTTTGGCTTCAAGGCTGATATACTCAGAGCTGTCAGCTCCATGATTAGGACTCCATGA TTTTGCCTCCTGGCTGCCTCTTCCAGGATCATTCCTCTGATTCCTGCTTTCATTGGGCAAGTCACAATATACTTTTTATG GGAGAATGGAAGAATTTTCTGAGATATAATCTCTTTAAATAGGTGTTCTGATATCACTTCCAGAACTAGCTACCTCCTAA GTATAAAAGAAGCTCCATTTCAGGGCCTGATTCTGATCTTTCTTCTTAAATATTCTGCAGTTGTGTAAGCCTTGGGACTC AAGGAGTGTTACTGCACCCACACTTGGCATGATTCTCCCTGTTGGAATCTCCATCTTCTCTAAATTTAAATATGGATTGC AAAATCTGTTTCCTATTTTAGGAAATCCCTAAGATTTTTCTGCTAGAGTGGGAATACTTTGCTTTTTTTTTTTTTTTTTT TTAAATCCAAACTAATGTTGATACAAACTGTCATTAATGTCTTTTTGAAGTGATACAGGTGCCAGGAAACCCTGCCACCA ATTTCTCAGAGGTGAAAGAGACCCTTTTGTTCTCCTAGAGTTAAGACTCGGAGCGTTCATATTGGAAAACTTTAGAGGTA AACAGGTGGTAGCTTCAGAAGGCCAGCAGCCAAAAACAAGTCTGTGTGTTAGGGACTCTGTGATGACAGTATTCTCTGCG AGCTTTTGGTTTTTAATTTTATTTTGTTGGACCATGATTATGAACATTTTCGTACTGCCTTCATGAGAGAGAGAAGTGGT ATCTTCCCTGGTACCAAATAATGAGCCAGGTATAAAAATCCAGCAGGAAAAGCCCCTTGGATGGATGAAAAGAGCTGTCT TTTGTCCACGATGCTGGATAGAAAAAATAATCTGGATGCAAGCTCTATTATTACTGGTCAGCTAAGTAATTCTCATGTGT TATTTTGATATAGGCACTTGCTCCAGATTTAGATGTGAGCCTACAGAGAAGTACACAGAAAAGTGGTGCTTCTTAAACTG CTTTCTTTTCCTAGTGATAATGTTCTCACAGTAGTAAGCTAGTGAGTGCATTTTATATTTCACTTTATCAGATGAAACAA

AATTCATGTTGGGTATGATTTTGTCTCCTTATCCCCATGTTTAAGACAATATTTCCTTAAACGTGTTTCCTACCTTAGGC TGATTAGTAGAACCGAGAGAAAATAAAGCCAGTTGTCTTAGTACTCATTTACCCTTTAAGTTTGTCCGATTGTGTTTGTG GTAGTTTCATTTTGTTGTTGTTTGTTTGCTTGCTTTTGTTTTCAGTTAAACACAAAATATATTGGACATGTTTGCATCAA ATTTGACCATCATATTAAAATTGAGGATAATTATTTTGGTGCAGCTAATCAGAACATAATGCAGAGCTTTATCTTATGAT GGCATTGCCTGTCACTGTTCTGCTCAGAGAGGGCAGCAAAGTATTGCAGATCTGAGATCCAAGAGAACTTTAGCTCTGAG GCATAATACTGAAGAAGTATCATATCTTAACTAAAATACAAGATGTGAAAGGAGAAACTGAGAGGGAGTCAGATGATGAC TATCTAAGCATACCTGAAATTTTTGTCCTTTAAGCTATCAGTATTTGCTAGTACTGAAGATATTATAAAAAAAAATATCT TAATCACTTCTAAGTTTCAACATACAGTAATCCTAATAGCTGTAGAGAGAAGATTCCCTGCAGAGATGAAGTAGCTGGAA AGTTTAGGATTCATTGCAAACTGTCATTCTGTATGCATCATTTTGGCATAAAGAGAAATTATTTAAGTTTAAACTTGCAA TGAAAAAAATACATTAAAATGGATTTGCAGCATGGTGAAATGGATGATATTTTCATTATACCTTGACATTTTCAGATTTT TGTAAGCTTCATTGTCTTTTTTCTGGTTTCCACACATAAGGATGCAATCAGAGGCTAGATTAAATGGTTCATACACTACC CCCTGTTCTTGCTCTTTGGAACAGCAGGCATCTGGGCAACACAGGCAACTCTTTCCTAGACAACCCTTTAAAATGATCAT GTAAGTGGAGAAATCTATGATATGACTCTGCTTTATTTGTCACA

Exon 2

GATCTGTGGACTTAGCA

M T L L Q P F S A L L L C L S L M M A ATGACTCTTCTTCAGCCTTTCAGTGCCTTACTACTTTGTCTATCACTGATGATGGCA

T S L L T T D K P E E K M Y S C P I I ACAAGTTTACTTACCACAGATAAACCTGAAGAGAAAATGTATTCCTGTCCCATCATT

Q C S A P A V N G L P G R D G R D G P CAGTGTAGTGCTCCTGCAGTCAATGGATTACCAGGCAGAGATGGAAGAGATGGTCCC

K G E K G D P AAAGGGGAAAAGGGAGACCCAG

Intron 2

GTACAGAGTATTTATCAGTAGTGTATTTTTGACGCTCCTTTTCATCCCTTTAGTCTTATTTTATGCCTTTTCTGTTCTTC TACTTTTCTGCTTCTCTGCTCTATTCACCTTTTGTAGTTTCTGTAAGTTTGCAGAAAGCTGTCTATAAAGCACTTGCTCC ATTTTTAATTCTATTCTAGATATTTGGATTTAATAAATAATTTTTTTTTAAAAAAGCCATACAAACATAAAATCACATTT TCACAGCAGCCCATAAAACAGAGATAAAACGAGATTTCAATCTCAATGTACCATTTGTATTCTGAGCCACTTACAGGTTT TCCTACATACCTTACTATATTACGTCTGCTTTCCTTTCCAGGGGCCAGTTTCAAAACCAGAAATCATGCTTGCTAAGGTT GGCTACTAACCTAATGATAATAATTGGATTGCTTCAAATTAACTAAGTCCCAGCAACTGAATTCCCCCAAGACATGATTT GACAAACAGTTGCTGCAAACAAACAGATCAGGAAGTGCTTTCTGACACACGATAGAACAAAGTCACCACCTTTCCCAAGA

ATTTTTCCTCATATTCACAAGGAATTTCTTGTTCTGTGACTGGGCACCGCTGAAAAGAACCTGCCCCCACTTGACTCCTG CTCCTTAGATATTTACAAGCATTGATAAGATCCCCTCTCAGTTTCCTCTACTGCAGGCTGAACAGTCCCAGGTCTCTCAG TCTTTCCTCATACGAGATGCTCCAGGCCCCTAATCATCTTTGTGGACCTCCACTGAACTCTTTCTAGGAGATCTCTGTCT TTTTGAACTAGGGATCCCAGAGCTGAACACAGTACTCCAAATCTGGTCTCACTAGGGCAGAGTAGAGGGTGAGGATTATC TCCTTTGACCTGCTGGCCGCACTCTTTTTAGTGCACCCTAGGATACCTTT- GGCCTTCCTGGCCACAAAGGCACACTGCTGGCTCATGGCCAACCTTCT GTCCACCAGGAGACCCAGATCCTTACCCTCAGAGTTAATTTCCAGCAGGTCAGCCCCTAACTTGCACTGATGTGCAGTTA ATCTTCTTTCAGTGTAGGACTCTACACTTGCCCTTGTTGAACCTCCTAAGGTTCCTATTCGTCCAGCTCTCCAGTCTGTT CAGGTATTGCCGAATGGCAGCACAGCCTTCTGGTATGTCAGCCACTCATCCCAGCTTTATGTCATCATGTTGTGTGTATA CTACGCCTCTTGGAGTTAGTTAATTACTTTTCAACATCCAAGCAAATTCCTATCAGTATGAATACCACTTGATAGGTTGC TCAGAGAAGCCGTGGATGCTCCATCCCTGGAAGCATTCGAGGCTGGGTTAGATGGAGCTCTGCGCTTTCTGATGTAGTGG GTGGCAACCTTGCCTACAGCAGGGAGTTGGAACTTGATGATCTTTAGGATCCCTTCCAACACAAGGCAATCTATGATTCA ATTATGTAATATAAGACATAAAATTTATGTGGAGTGTAACAATGTTCTGTATAGACATTTTCAGTGTCATGTATCCTCAG TATGCTCCCTGCAGTATCATGGCTGAAATATGTAAAGCCAACACTGCCTGATTAAATAACCACTTCAGAGGTATGCTTGA CCTTTATTACATTTTATCTAATTTTCTAGATAATATATTATCATATATGGTTGGATTACACATAATGGCTTTTTGATTTT AGAGCATGTGTACTTCGGCAATAACTGTTAATTACATTGGATTTTCATTTTCTATAAATAGATATAGTAAGGAATTTTGC ATCACAATGATTTTTCATCAAAGTAATGCATTTCCTAGCAAATGACTATTTTGACAGGAACAATTTTCAGTTGGAAGTAC GGGGTGGTGTTTGACACAATGAATGGTTGGAAGACTTGGACAATGGCAAAATGAAATGTTATTGACCGCTAAAAGTTAAT ATAGTGTTGTAACACCTTGAGGATATTTTTGCCGTGTGTTTCATTTATCTCCTTTCTACTGAATTAGGACTTCTGGCCAT ACTCTATTTCTTGATTCTTTGCTGTTCATGATGTATATTACAAATTATTATTCTTTTGAGATAAAATGCATTTACCATGT GGGGTGTTTTTTTCAGCCTTTGTTGTTTCTACAATTAGTATTCACCTTCAATTTGAGGATATTTTGTGTTTCATGTCCAA ACCTCAAATACTGAGTATTTCTAAGAAGAATTTTATCATTCATAAAGTGCAGGGTAATCTTGCAGTGTACCACAGAAAAC TTAACATGACAAGTGAGTATTAGGAAATCATGGGTGACCAAGAAGTCCTCTAACGCTGTGAATTATCTCCTTTTCTGATT GGTGTGAATGTAGGGGCTTTATTTTGTTGTTGAAAAGTTTTCTCAAAGCAGAAAGACAGATAGCTCTACCAACATTATCC ATTTCCTGTTCACTTACCAATTTACCCTTTCTTCCGAGTGTATTCGTCTCTTTACCCCCTATCCTCAGCTGGGCTTTGCA ACCATCTTCCTAAGAGGGACTTCAGTGTTTGTGTCTTCTGCACACTGTTGCTAGTTGTTAAACTATTCCTGAGTTCGAGT CTCTCTTCAAGCATGAAGGAGACATGGTGGGAGAACACTCTCAGAAAACGTTTAAGCTATTTTCTCTCAAATCAAACTCT AG

Exon 3

G E G L R G L Q G L P G K A G P Q G L GAGAAGGACTGAGAGGTCTGCAGGGTTTGCCTGGAAAAGCAGGACCCCAAGGATTAA

K G E V G P Q G E K G Q K G E R G AAGGAGAGGTGGGACCACAAGGAGAGAAAGGTCAAAAAGGAGAACGTGGAA

Intron 3

GTAAGTAGTAAAGCTCTCATGTTTCTATAATCTATTTTTCAACCACTTAGTGTATTATCTTTAAAATATTTGTTTTAATG TCTGGTGTTCTTAGAGTGTCATTTGAGGAAAGGTGAGAAGGTGTGATTTCCAGAAGTGTAAGGAGCAAAAAGATAAAATG CCTGTTACTTAGGGGATGAGTTGCCTAGCATAACTTGGGAAAAAAAGTGTCTGGAGTGAGTCACTAGTTTTTTGTTGTTT GAATCTGAAATAACAAATCCTTTCACACACATCACAAAAGGCATTGCCCTTTAATTCTTTGTCTGTTCATGTTTTTTCCT CTTTAATTCATTTGAAGTGCTTACATTTGTGTTTTTCCTTTGAGATCTGGGCTTCTCCAGTTGAATTGATGAGCTTGTCA GCTCTGAGAATTCAAAGCCCACCCAAATATTCATCCTAGTTAGAAATGTGGCTTTCTCACCGGCACAATTTCCTAGAGAA TGATTCTACAATGTGGCCTATGGTTTCTGCTCTGGAAACCAAATGTGTCTCACATAGAATCACATTAGATGAAAGACAGC AGTGGTGTAGTTATTTTTAAGATAAATTACTAAATAATACCCTTATTTCCTAG

Exon 4

I V V T D D L H R Q I T D L E A K I R TTGTTGTAACTGATGACCTGCACCGACAAATAACTGATTTGGAAGCAAAAATCCGGG

V L E D D L S R Y K K TAT T GGAAGAT GAC T TAAGCAGATACAAAAAAG

Intron 4

GTAAGAGACAATCATATTAATTTTCTTTTTGGAGTTCCATACAATTATTATCAGATGGTAGACTCCCTTGACACTAATCC TGGATACCTGTTAAAGACAGTAAGGTAAAATAAATGTCTGGCAAAGAAAGCAAATGCATTTCAAAAGGGTTGTTGCAAGC CCAGTCTTAACTATTAAATGAGCAAGAGCCCCGCTTTCCATTGTTGGGTTTGTATTTTTTTTTTTTTTTTCATGAAAACC TGACAGGAGTATGAACTATAGATGTATATTTCTCCCAAGATCWTTAATGTTTTCAAGACAAATACTCAGTTCCCCGGGCT CACTAAAGCTGTCCCTATATGTCTTTTTTGCGCTCCCTGGTTTTAAACCCTGAATTTCATTACAGCCTCTTTAGCTTTAG TTTCTGTGATCCCAGGTTAAAGCTAATGGGTGGGAAAAGATCTCCTAATGGCAGCTCAGTTCCTCTGCATGAATTTTAAT GAGTTTCTGATTTTTGCATTGAGACCTGGCAAGCTTTTCTGTGGTGCTCGCAATTTGATTTAGGGAGCCAAGTTCCTTCA GATCTTGATTCAAGAGCTGTAATATGTGAACAGGGAACAAAAAATTATTAAAAATGACTTGTGATCCAAGCCTTGTGAAA ATCTTGTTTTATTAAAAAGTGGATTTGGTATATCCAGGTGTTAATTTTGTTTGATTTCTGTTGGATTCTACCTACTACTA CAAGAAGTCCACTTGTACTAAATAGCAAAAAACAGTTATAATTGAGATATTATGGATAAATTACTTTACAATCTTCAATT GATGGTGTAATTCAACATGGTGTTTACTTTTTCTTCTAG

Exon 5

A L S L K D V V N V G K K M F V S T G CCTTGAGTTTAAAGGACGTCGTAAACGTTGGTAAAAAAATGTTTGTCCCAACTGGAA K K Y N F E K G K S L C A K A G S V L AGAAATATAATTTTGAAAAGGGAAAATCCCTTTGTGCAAAAGCTGGAAGTGTGCTTG

A S P R N E A E N T A L K D L I D P S CCTCTCCTAGGAACGAGGCTGAGAATACAGCTTTAAAAGACTTAGTTGACCCTTCAA

S Q A Y I G I S D A Q T E G R F M Y L GCCAAGCTTATATTGGGATATCTGATGCACAAACTGAGGGCAGATTCATGTACCTGA

S G G P L T Y S N W K P G E P N N H K

GTGGTGGGCCTTTAACTTACAGCAACTGGAAACCTGGAGAACCAAATAATCACAAAA

N E D C A V I E V S G K W N D L D C S ATGAAGACTGTGCGGTGATAGAAGACTCTGGAAAATGGAATGATTTAGACTGTTCAA

N S N I F I I C E L

ATTCAAATATCTTCATTATTTGTGAATTGTGAACAGCTGATATATCTACGAAAATCAATCCAACTTACTTCTCTCAGTTA TGTGGTTGTGTAGAAGTTTGTTACTATATAGCTGAATAGAATAATCAGAACCAGACTATATTTACCGTGGTCTTCCCTTC GACATCCAGTTTTGAATCTCCTAGTGAAACAGACCTATTTGTTCACTCATTGTGAATTAACTTTTTTACCGCATGATATG CTGAGGACCTTATGTTTATGCTGTAGGCTTCAGAGGTTTAACTCCATGTCAAGCTCCAGTATAATCCCCTGGACTTGGTG CTTACTAACATTTGAAATGTATTTGCCATTTCACATTCTAGCACAATCTGGCTTTTTAGCTTTATCTGCACTTTGTGAAT

TTAAGAGGGCATTTTGAATCTAGTTTATGGAATATAATGAGCTATTTTTAAACAAATTATTATTATTAGGTGAGTAAGCT AATAAATGGTATTTCTGCTCCATCAC

SEQ ID NO: 2

Consensus sequence Low MBL (fig 1)

TGGCAATATA CTCTGAGGCA AACTATTCCT ATTACTGTAC TTCTCATGCA GGCTCTATTG AGAATTTTAG CCTGATCACT GTGTCATTAT CTTTGTAGGA AGAGAAGTAG TAGGTGACTT ATTTAAATGT TTTAAGATTT

GCTTCTTCAA GCAATGTTGT CTTTTCTAAT CTACACACAA ATGTACATGT TTGAGTTGGC CTATTTTTTT CCATGGATAA TTCAGAGTAT ATTGCAGGAA AAATAGTCAC TGCAGTCAAG CAAGATCCAA GTCTTTATTT

GAAGATTAAT CTATTGACTG AATTAAGGGG AAAAGCATTA TGGTCAAAAT GAATACCTTT CAGATATCCT

GATrTTTTTT TTAGTTGTTT G::GTTTT:T TGTTGTTGTT GTTCTTTTTT TCTGTGTGTG TG: :::::: :

:::CGGGGGG TGGGAGGGGA GAGGTTTTGT TTTGTTCTTC ATTTGTACTG TAACAAAGTC AATATATATC

CAAGGCCAGG CAAAGAGCAA AGGGTTTACT CACAGAGTGT CATACGCAAT TCCTGTAAAT AAGGATGGTA AGGTTGAAGT AGATGATCGC TAGGATTGTG CAAGACAGAG I ATAAGCCGGA AAACCCTGAA

TAAAGCTAAA

AATTACAGCT TTCGGTGGAA ACGTGAAGGA CTTTTTTTTT TTCCTCTTGG CAGGCTGGTC C

SEQ ID NO: 3

Consensus sequence High MBL (fig 1 )

TGGCAATATA CTCTGAGGCA AACTATTCCT ATTACTGTAC TTCTCATGCA

GGCTCTATTG AGAATTTTAG

CCTGATCACT GTGTCATTAT CTTTGTAGGA AGAGAAGTAG TAGGTGACTT ATTTAAATGT TTTAAGATTT

GCTTCTTCAA GCAATGTTGT CTTTTCTAAT CTACACACAA ATGTACATGT

TTGAGTTGGC CTATTTTTTT

CCATGGATAA TTCAGAGTAT ATTGCAGGAA AAATAGTCAC TGCAGTCAAG

CAAGATCCAA GTCTTTATTT GAAGATTAAT CTATTGACTG AATTAAGGGG AAAAGCATTA TGGTCAAAAT

GAATACCTTT CAGATATCCT

GATATTTTTT TTAGTTGTTT GTTTTTTTCT TGTTGTTGTT GTTCTTTTTT

TCTGTGTGTG TGTGTGTGGG

GGGGGGGGGG GGGTTGGGGA GAGGTTTTGT TTTGTTCTTC ATTTGTACTG TAACAAAGTC AATATATATC

CAAGGCCAGG CAAAGAGCAA AGGGTTTACT CACAGAGTGT CATACGCAAT

TCCTGTAAAT AGGGGTGGTA

AGGTTGAAGT AGATGATCGC TAGGATTGTG CAAGACAGAG D AT AAGCCGGA

AAACCCTGAA TAAAGCTAAA AATTACAGCT TTT AGTGGAA ACGTGAAGGA CTTTTTTTTT TTCCTCTTGG

CAGGCTGGTC C

SEQ ID NOs: 4-9 and 20-21 represent examples of specific haplotypes of the genetic marker alleles of the present invention, in those sequences, ":" represents a position, wherein a nucleotide is deleted relative to a consensus sequence of the MBL gene, as represented in SEQ ID NO: 10.

SEQ ID NO: 4

Consensus sequence T1 (see figure 12) TTAAGGGGAA AAGCATTATG GTCAAAATGA ATACCTTTCA GATATCCTGA TrTTTTTTTT AGTTGTTTGG TTTT:::TTG TTGTTGTTGT TCTTTTTTTC TGTGTGTGTG CG::::::GG GGGTGGGA:: ::: GGGGAGA GGTTTTGTTT TGTTCTTCAT

TTGTACTGTA ACAAAGTCAA TATATATCCA AGGCCAGGCA AAGAGCAAAG GGTTTACTCA CAGAGTGTCA TACGCAATTC CTGTAAATAA GGATGGTAAG GTTGAAGTAG ATGATCGCTA GGATTGTGCA AGACAGAGIAT AAGCCGGAAA ACCCTGAATA

AAGCTAAAAA TTACAGCTTT CGGTGGAAAC GTGAAGGACT _TTTTTTTTTT TCCTCTTGGC AGGCTGGTCC

SEQ ID NO: 5

Consensus sequence T2 (see figure 12)

TTAAGGGGAA AAGCATTATG GTCAAAATGA ATACCTTTCA GATATCCTGA T: TTTTTTTT

AGTTGTTTGG TTTT: : : : : :

TTGTTGTTGT TCTTTTTTTC TGTGTGTGTG TG :::::: GG GGGTGGGA:: ::: GGGGAGA GGTTTTGTTT TGTTCTTCAT

TTGTACTGTA ACAAAGTCAA TATATATCCA AGGCCAGGCA AAGAGCAAAG GGTTTACTCA

CAGAGTGTCA TACGCAATTC

CTGTAAATAG GGGTGGTAAG GTTGAAGTAG ATGATCGCTA GGATTGTGCA AGACAGAGIAT

AAGCCGGAAA ACCCTGAATA AAGCTAAAAA TTACAGCTTT CGGTGGAAAC GTGAAGGACT _{ττττττττττ} TCCTCTTGGC

AGGCTGGTCC

SEQ ID NO: 6

Consensus sequence T3 (see figure 12) TTAAGGGGAA AAGCATTATG GTCAAAATGA ATACCTTTCA GATATCCTGA TATTTTTTTT

AGTTGTTTGT TTTTTTCTTG

TTGTTGTTGT TCTTTTTTTC TGTGTGTGTG TGTGTGGGGG GGGGGGGGGG GTTGGGGAGA

GGTTTTGTTT TGTTCTTCAT

TTGTACTGTA ACAAAGTCAA TATATATCCA AGGCCAGGCA AAGAGCAAAG GGTTTACTCA CAGAGTGTCA TACGCAATTC

CTGTAAATAG GGGTGGTAAG GTTGAAGTAG ATGATCGCTA GGATTGTGCA AGACAGAG|AT

AAGCCGGAAA ACCCTGAATA

AAGCTAAAAA TTACAGCTTT TAGTGGAAAC GTGAAGGACT _{ττττττττττ} TCCTCTTGGC

AGGCTGGTCC

SEQ ID NO: 7

Consensus sequence T4 (see figure 12)

TTAAGGGGAA AAGCATTATG GTCAAAATGA ATACCTTTCA GATATCCTGA T : TTTTTTTT

AGTTGTTTGG TTTT ::: TTG TTGTTGTTGT TCTTTTTTTC TGTGTGTGTG CG :::::: GG GGGTGGGA:: ::: GGGGAGA

GGTTTTGTTT TGTTCTTCAT

TTGTACTGTA ACAAAGTCAA TATATATCCA AGGCCAGGCA AAGAGCAAAG GGTTTACTCA

CAGAGTGTCA TACGCAATTC

CTGTAAATAG GGGTGGTAAG GTTGAAGTAG ATGATCGCTA GGATTGTGCA AGACAGAG|AT AAGCCGGAAA ACCCTGAATA

AAGCTAAAAA TTACAGCTTT CGGTGGAAAC GTGAAGGACT _{ττττττττττ} TCCTCTTGGC

AGGCTGGTCC

SEQ ID NO: 8 Consensus sequence T5 (see figure 12) TTAAGGGGAA AAGCATTATG GTCAAAATGA ATACCTTTCA GATATCCTGA TATTTTTTTT AGTTGTTTGT TTTTTTCTTG

TTGTTGTTGT TCTTTTTTTC TGTGTGTGTG TG::::GGGG GGGGGGGGGG VVΛGGGGAGA GGTTTTGTTT TGTTCTTCAT TTGTACTGTA ACAAAGTCAA TATATATCCA AGGCCAGGCA AAGAGCAAAG GGTTTACTCA CAGAGTGTCA TACGCAATTC

CTGTAAATAG GGGTGGTAAG GTTGAAGTAG ATGATCGCTA GGATTGTGCA AGACAGAGIAT AAGCCGGAAA ACCCTGAATA

AAGCTAAAAA TTACAGCTTT TAGTGGAAAC GTGAAGGACT _TTTTTTTTTT TCCTCTTGGC AGGCTGGTCC

SEQ ID NO: 9

Consensus sequence T6 (see figure 12)

TTAAGGGGAA AAGCATTATG GTCAAAATGA ATACCTTTCA GATATCCTGA TATTTTTTTT AGTTGTTTGT TTTTTTCTTG

TTGTTGTTGT TCTTTTTTTC TGTGTGTGTG TGTGTGGGGG GGGGGGGGGG GTTGGGGAGA

GGTTTTGTTT TGTTCTTCAT

TTGTACTGTA ACAAAGTCAA TATATATCCA AGGCCAGGCA AAGAGCAAAG GGTTTACTCA

CAGAGTGTCA TACGCAATTC CTGTAAATAG GGGTGGTAAG GTTGAAGTAG ATGATCGCTA GGATTGTGCA AGACAGAG|AT

AAGCCGGAAA ACCCTGAATA

AAGCTAAAAA TTACAGCTTT CGGTGGAAAC GTGAAGGACT _{ττττττττττ} TCCTCTTGGC

AGGCTGGTCC

SEQ ID NO: 10

Consensus sequence of a chicken MBL gene, including the promoter region of figure 12.

TG

GCAATATACT CTGAGGCAAA CTATTCCTAT TACTGTACTT CTCATGCAGG CTCTATTGAG AATTTTAGCC TGATCACTGT GTCATTATCT TTGTAGGAAG AGAAGTAGTA GGTGACTTAT

TTAAATGTTT TAAGATTTGC

TTCTTCAAGC AATGTTGTCT TTTCTAATCT ACACACAAAT GTACATGTTT GAGTTGGCCT

ATTTTTTTCC ATGGATAATT

CAGAGTATAT TGCAGGAAAA ATAGTCACTG CAGTCAAGCA AGATCCAAGT CTTTATTTGA AGATTAATCT ATTGACTGAA

TTAAGGGGAA AAGCATTATG GTCAAAATGA ATACCTTTCA GATATCCTGA _{τττττττττ}

AGTTGTTTGG TTTTTTG

TTGTTGTTGT TCTTTTTTTC TGTGTGTGTG YGGG GGGTGGGA GGGGAGA GGTTTTGTTT

TGTTCTTCAT TTGTACTGTA ACAAAGTCAA TATATATCCA AGGCCAGGCA AAGAGCAAAG GGTTTACTCA

CAGAGTGTCA TACGCAATTC

CTGTAAATAG GGGTGGTAAG GTTGAAGTAG ATGATCGCTA GGATTGTGCA AGACAGAG

AT AAGCCGGAAA ACCCTGAATA AAGCTAAAAA TTACAGCTTT CGGTGGAAAC GTGAAGGACT _{ττττττττττ} TCCTCTTGGC AGGCTGGTCC

SEQ ID NO: 1 1

CMBL-6F primer: 5'- GAT-AAG-CCG-GAA-AAC-CCT-GAA - 3'; SEQ ID NO: 12 cMBL-RR primer: 5' - CTT-ACA-ACA-ATT-CCA-CGT-TCT-CCT- 3';

SEQ ID NO: 13 cMBL-F primer: 5' - GCA-GAG-ATG-GAA-GAG-ATG-GTC-CC - 3';

SEQ ID NO: 14

CMBL-7R: 5' - GA-AGA-TAT-TTG-AAT-TTG-AAC-AGT - 3'.

SEQ ID NO: 15

CMBL-585F primer: 5'- TGG-CAA-TAT-ACT-CTG-AGG-CAA - 3';

SEQ ID NO: 16

CMBL+93R primer: 5' - GGA-CCA-GCC-TGC-CAA-GAG - 3';

SEQ ID NO: 17

IBVN( + ): 5' - GAA-GAA-AAC-CAG-TCC-CAG-ATG-CTT-GG - 3'

SEQ ID NO: 18 IBVN( - ): 5' - GTT-GGA-ATA-GTG-CGC-TTG-CAA-TAC-CG - S'

SEQ ID NO: 19

CMBL-298F: 5' - TTAAGGGGAAAAGCATTA - 3'

SEQ ID NO: 20

Consensus sequence T7 (see figure 12)

TTAAGGGGAA AAGCATTATG GTCAAAATGA ATACCTTTCA GATATCCTGA TATTTTTTTT

AGTTGTTTGT TTTT: : : : : :

TTGTTGTTGT TCTTTTTTTC TGTGTGTGTG TG::::::GG GGGTGGGA:: ::: GGGGAGA GGTTTTGTTT TGTTCTTCAT

TTGTACTGTA ACAAAGTCAA TATATATCCA AGGCCAGGCA AAGAGCAAAG GGTTTACTCA

CAGAGTGTCA TACGCAATTC

CTGTAAATAG GGGTGGTAAG GTTGAAGTAG ATGATCGCTA GGATTGTGCA AGACAGAGAT

AAGCCGGAAA ACCCTGAATA AAGCTAAAAA TTACAGCTTT CGGTGGAAAC GTGAAGGACT _TTTTTTTTTT TCCTCTTGGC

AGGCTGGTCC SEQ ID NO: 21

Consensus sequence T8 (see figure 12)

TTAAGGGGAA AAGCATTATG GTCAAAATGA ATACCTTTCA GATATCCTGA TrTTTTTTTT AGTTGTTTGT TTTT: : : : : : TTGTTGTTGT TCTTTTTTTC TGTGTGTGTG TG::::::GG GGGTGGGA:: ::: GGGGAGA GGTTTTGTTT TGTTCTTCAT

TTGTACTGTA ACAAAGTCAA TATATATCCA AGGCCAGGCA AAGAGCAAAG GGTTTACTCA CAGAGTGTCA TACGCAATTC

CTGTAAATAG GGGTGGTAAG GTTGAAGTAG ATGATCGCTA GGATTGTGCA AGACAGAGIAT AAGCCGGAAA ACCCTGAATA

AAGCTAAAAA TTACAGCTTT CGGTGGAAAC GTGAAGGACT _TTTTTTTTTT TCCTCTTGGC AGGCTGGTCC

Claims

Claims

1. A method for determining the genotype of poultry in relation to mannan- binding lectin (MBL), comprising in the genetic material of a sample from said animal detecting the presence or absence of at least one genetic marker.

2. A method of determining the susceptibility to an infectious disorder in poultry, comprising detecting in genetic material of a sample from said animal the presence or absence of at least one genetic marker that is indicative of MBL level.

3. The method according to any of the preceding claims, wherein said at least one genetic marker is associated with high or low level of MBL.

4. The method according to any of the preceding claims, wherein high MBL level is indicative of reduced susceptibility to disease and/or wherein low MBL level is indicative of increased susceptibility to disease.

5. The method according to any of the preceding claims, wherein the level of

MBL is determined in serum.

6. The method according to claim 5, wherein high MBL level are defined as serum level above 10 micrograms/ml, such as at least 15, for example at least 20, such as at least 25, for example at least 30, such as at least 35 micro- grams/ml.

7. The method according to claim 5, wherein low MBL level are defined as serum level below 10 micrograms/ml, such as below 8, for example below 6 such as below 4, for example below 2, such as below 1 micrograms/ml.

8. The method according to any of the preceding claims, wherein the at least one genetic marker is located in a gene encoding MBL.

9. The method according to any of the preceding claims, wherein the at least one genetic marker is located in a regulatory region of a gene encoding MBL

10. The method according to any of the preceding claims, wherein the at least one genetic marker is located in the promoter region of a gene encoding

MBL

1 1 . The method according to any of the preceding claims, wherein said poultry is selected from the group consisting of chicken, turkey, fowl, duck, pheasant and/or geese.

12. The method according to any of the preceding claims, wherein said poultry is chicken.

13. The method according to claim 12, wherein the at least one genetic marker is located in a chicken MBL gene.

14. The method according to claim 13, wherein the at least one genetic marker is located in the regulatory sequence of the chicken MBL gene.

15. The method according to claim 13, wherein the at least one genetic marker is located in the promoter region of a chicken MBL gene.

16. The method according to any of the preceding claims, wherein the at least one genetic marker is an allele of the polymorphism SNP1 1 at nucleotide position +43 and +44 of the chicken MBL gene, corresponding to position 628 and 629 of SEQ ID NO: 10.

17. The method according to any of the preceding claims, wherein the at least one genetic marker is an allele of the polymorphism SNP12 at nucleotide position -49 to -46 of the chicken MBL gene, corresponding to position 437 to 440 of SEQ ID NO: 10.

18. The method according to any of the preceding claims, wherein the at least one genetic marker is an allele of the polymorphism SNP13 at nucleotide position -170 to -166 of the chicken MBL gene of the chicken mannan- binding lectin gene, corresponding to position 420-421 of SEQ ID NO: 10.

19. The method according to any of the preceding claims, wherein the at least one genetic marker is an allele of the polymorphism SNP14 at nucleotide position -175 of the chicken mannan-binding lectin gene, corresponding to position 416 of SEQ ID NO: 10.

20. The method according to any of the preceding claims, wherein the at least one genetic marker is an allele of the polymorphism SNP15 at nucleotide position -186 to -181 of the MBL gene, corresponding to an insertion after position 410 of SEQ ID NO: 10.

21 . The method according to any of the preceding claims, wherein the at least one genetic marker is an allele of the polymorphism SNP16 at nucleotide position -188 of the chicken MBL gene, corresponding to position 409 of SEQ ID NO: 10.

22. The method according to any of the preceding claims, wherein the at least one genetic marker is an allele of the polymorphism SNP17 at nucleotide position -224 to -219 of the chicken MBL gene, corresponding to position 375 to 376 of SEQ ID NO: 10.

23. The method according to any of the preceding claims, wherein the at least one genetic marker is an allele of the polymorphism SNP18 at nucleotide position -229 of the chicken MBL gene, corresponding to position 371 of SEQ ID NO: 10.

24. The method according to any of the preceding claims, wherein the at least one genetic marker is an allele of the polymorphism SNP19 at nucleotide position -247 of the chicken MBL gene, corresponding to a nucleotide insertion after position 353 of SEQ ID NO: 10.

25. The method according to any of the preceding claims, wherein the at least one genetic marker indicative of increased susceptibility to disease and/or low MBL level is selected from the T1 haplotype, as defined by SEQ ID NO: 4.

26. The method according to claim 25, wherein the at least one genetic marker indicative of increased susceptibility to disease and/or low MBL level is selected from SNP1 1 variant 1 (CG), SNP12 variant 1 (AGGA), SNP13 variant 1 (A:::::), SNP14 variant 1 (T), SNP15 variant 1 (::::::), SNP16 variant 1 (C), SNP17 variant 1 (:::TTG), SNP18 variant 1 (G), and/or SNP19 variant 1 (:), wherein (:) denotes a deleted nucleotide relative to the MBL consensus sequence as defined by SEQ ID NO: 10.

27. The method according to any of the preceding claims, comprising detecting the presence or absence of a polymorphic marker allele in linkage disequilib- rium with the at least one genetic marker indicative of MBL level.

28. A kit for determining the susceptibility to an infectious disorder in poultry, comprising at least one binding member for detection of at least one genetic marker indicative of MBL.

29. The kit according to claim 28, wherein said at least one genetic marker is as defined in any of claims 8 to 27.

30. The kit according to any of claims 28 and 29, wherein said binding member is selected from the group consisting of oligonucleotides, antibodies, poly- peptides, peptides, peptide fragments, peptide aptamers, nucleic acid ap- tamers, small molecules, natural single domain antibodies, affibodies, affi- body-antibody chimeras, and non-immonoglobulin binding members.

31. The kit according to claim 30, wherein said binding member is an oligonucleotide.

32. The kit according to claim 31 , wherein said oligonucleotide is an oligonucleotide primer comprising a consecutive sequence of at least 10 nucleotides selected from any region of SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, and/or 21 , and/or the complementary sequences thereof.

33. The kit according to claim 32, wherein said oligonucleotide primer is allele- specific.

34. The kit according to any of claims 28 to 33, further comprising deoxyribonu- cleoside triphosphates, DNA polymerase enzyme and/or nucleic acid amplification buffer.

35. The kit according to any of claims 28 to 34, further comprising instructions for the performance of the detection method of the kit, and for the interpretation of the results.

36. The kit according to any of claims 28 to 35, further comprising at least one reference sample comprising at least one genetic marker as defined in any of claims 8 to 27.