CN110079606A - The method for improving chicken group's salmonella resistance is marked using phylaxin gene - Google Patents

Abstract

The invention belongs to be mutated or genetic engineering technology field, a kind of method, primer, kit for marking raising chicken group's salmonella resistance using 3 phylaxin gene Bi-PASA is disclosed, two-way allele specific pcr (Bi-PASA) genetic marker of three phylaxin genes is provided.The present invention uses Bi-PASA technology for the first time, on the basis of three phylaxin gene variations are with the association analysis of salmonellosis of chicken neurological susceptibility, pass through SNP site and gene haplotype Genetic Variation Analysis, disclosing three kinds of phylaxin genes is the functional gene that chicken resists salmonellosis, simple, time saving, inexpensive and quickly and effectively 3 genes B-PASA detection label is established, there is positive directive significance to isogeneity and breeding for disease resistance.3 labels of the invention, can be used for genetic test and the molecular mark of Salmonella gallinarum resistance, have the characteristics that early screening, Rapid identification, save the time, be low in cost, accuracy it is high.

Description

The method for improving chicken group's salmonella resistance is marked using phylaxin gene

Technical field

The invention belongs to gene engineering technology fields, more particularly to improve chicken using 3 phylaxin gene Bi-PASA labels The method of group's salmonella resistance, primer, kit.

Background technique

Currently, the prior art commonly used in the trade is such that salmonellosis is a kind of common infectious diseases common to human beings and animals, Huge economic losses not only are caused to Animal husbandry production, but also seriously threaten human health.Salmonellosis of chicken is in chick table It is now white diarrhea, shows as fowl typhoid in Adult Chicken.The perpendicular and horizontal two ways of Salmonella gallinarum is propagated, and diseased chicken and is carried disease germs On the one hand chicken can be infected by the secretion of alimentary canal, respiratory tract with group raise poultry, on the other hand can also enter pathogen transmission In hatching egg, the chick hatched is made to become congenital carrier.Currently, to salmonella infection, there are no effective control measure.Cause This, cultivates salmonella resistance chicken group, establishes disease-resistant variety or strain, is the effective way for controlling salmonella infection and propagation Diameter.Poultry alexin (AvBDlinacins) host innate defence in play a crucial role, to bacterium, virus, Conveyor screw, tumor toxicity cell etc. have broad immune effect.Salmonellosis is a kind of common infectious diseases common to human beings and animals, no Huge economic losses only are caused to Animal husbandry production, and seriously threaten the health of the mankind.Salmonellosis of chicken is by gram Caused by negative salmonella infection, 2500 various serotypes are identified, wherein the overwhelming majority belongs to Bacterium enteritidis.Have The animal of a little Salmonella serogroup infection is extensive, including chicken, ox, sheep, pig etc., causes by laxativeness to dead varying degree Symptom.Wherein salmonella typhimurium (Salmonella Typhimurium, ST) and Bacterium enteritidis (Salmonella Enterica, SE) two class germs can infect the mankind, and it is the primary pollution source of human food.Also some serotypes have kind special The opposite sex causes illness outbreak and causes huge economic loss such as S. pullonum (S.Pullorum, SP).Chicken sramana Salmonella can infect the chicken of all ages and classes, and the death rate of chick is higher, and infection velocity is fast, as in 15-30 age in days broiler Infection rate may be up to 80% or more.Adult Chicken infection salmonella does not show manifest symptom generally, carries disease germs propagation in recessiveness, but It is the main infection source of salmonellosis of chicken prevalence and human foods.

The poultry products such as egg, the chicken of the recessive chicken production of carrying disease germs of adult are the important sources of human food's pollution, are thus made At food safety affair have resulted in the great economy and society crisis of many countries.About 2,000,000 causes food occurs every year for the U.S. The human infection's case caused with salmonella-polluted animal products, the expense for treatment are up to 1,400,000,000 dollars.According to 2002 The food-borne germ statistical result that year WHO is announced, Bacterium enteritidis be one of main infection bacterial strain stood out (WHO, 2002).French poultry product of the food poisoning 1/3 from salmonella infection, poisons by food as caused by egg in Britain In event, 15% comes from Bacterium enteritidis, and in China, annual salmonella food is assessed at state food security risk assessment center The number of the infected of object poisoning is up to 3,000,000 person-times, and wherein nearly half is related with Fresh chicken cross contamination.

The perpendicular and horizontal two ways of Salmonella gallinarum is propagated, on the one hand diseased chicken and the chicken that carries disease germs can lead to respiratory tract, digestion Road secretion is infected with group raise poultry, on the other hand can also be by pathogen transmission into becoming the chick hatched first Nature carrier.The means such as current prevention and treatment measure, including vaccine inoculation, antibiotic treatment and disinfection and isolation are not It is enough to control the prevalence of Salmonella gallinarum and outburst, largely can also causes the drug resistance of chicken using antibiotic and cause drug in fowl Residual in product.Therefore, new prevention approach is found, i.e. raising body autoimmunity, it appears highly desirable and urgent.

The heredity selection of Salmonella gallinarum disease resistance can be traced to the thirties in last century.Researcher generallys use Program have 4 steps: 1) confirm the authenticity of disease resistance or neurological susceptibility between different cultivars or strain；2) estimation disease is supported The genetic force of drag and related immune index, discloses whether apparent resistance or neurological susceptibility have its hereditary basis；3) identify control The related gene or genome area of resistance or neurological susceptibility；4) resistance genetic marker is integrated into marker assisted selection (MAS) breeding system accelerates the selection process of high resistance kind or strain.

In terms of different chicken kind resistance hereditary difference researchs, the research of early stage is it has proven convenient that the red chicken in Lip river island has than Leghorn Significantly high anti-salmonella infects resistivity.There is also differences for Leghorn different lines, when the different salmonella blood of use After clear type infects 7 pure lines, strain C, 72 and 15I tri- is to be listed in susceptible type, and N, 6₁It is to belong to resistance with WI tri- Type.In terms of Salmonella gallinarum resistance genetic force research, estimate blind after 4 groups of Bai Laihang F2 groups take orally chicken intestinal diorder salmonella Intestines carry the genetic force of bacterium amount, estimated heritability h²=0.20, belong in low genetic force character.To 373 commercial laying hen strains After being inoculated with Bacterium enteritidis with 312 Leghorns, different tissues organ bacterial number is determined, the results show that each organ is husky The genetic force of door Salmonella quantity is respectively that liver 0.05, spleen 0.29, sexual organ 0.16, and each organ carry bacterium amount with significant Genetic correlation, it was demonstrated that chicken immune difference has its hereditary basis.Alexin (AvBDlinacins) family, poultry are known as beta-alexin 1 Element plays a crucial role in host innate defence.Beta-alexin is for the first time in the tunica mucosa tracheae epithelial cell of ox It was found that.Alexin precursor molecule is made of 64-68 amino acid residue, and signal sequence and preceding region sequence are by 22-32 amino Sour residue composition, mature beta-alexin are made of 38-42 amino acid residue.More positive charge, space are had in molecule Structure is divided into hydrophobic region and live zone；Skin chain folding forms β layers of structure of 3 beam, and intramolecular 6 conservative cysteines form 3 pairs Disulfide bond (Cys1-Cys5, Cys2-Cys4, Cys3-Cys6).Chicken alexin (AvBDlinacins) is rich in cysteine Antibacterial peptide, there are six cysteine residues, form three pairs of disulfide bond.Chicken alexin is all some relatively small antibacterial peptides, is led to Often less than 100 amino acid, the antibacterial activity with wide spectrum.

Alexin is distributed in mammal granulocyte, epithelial cell and certain secretion, has resisting gram-positive Bacterium, Gram-negative bacteria, protozoan, certain fungies and certain envelopes virus.Antibacterial peptide acts on the cell membrane of bacterium, Cause the permeability of film to increase, is penetrated with this, kills bacterium.Comparatively, conventional antibiotic is by eliminating microorganism growth Or existence essential condition, such as make enzyme inactivation denaturation, to achieve the purpose that sterilization, but bacterium is as long as changing a kind of gene It is enough to resist the attack of such antibiotic.Therefore bacterium must change the structure of film, that is, changing substantial portion of gene could prevent The attack of imperial antibacterial peptide, this is difficult to realize in bacterium itself.Antibacterial peptide can fundamentally reduce the probability of bacterial drug resistance. Research shows that the Antibacterial Mechanism of different AvBDs is different, but positive antibacterial peptide and bacterium surface negative electrical charge interact It is its shared step.

Antibacterial peptide can kill bacterium by four kinds of modes after penetrating bacterial outer membrane.(1) under effective antimicrobial concentration, resist Bacterium peptide can be with dissolution of bacteria；(2) antibacterial peptide influences DNA, the synthesis of RNA or protein；(3) ion channel is formed.Antibacterial peptide In epicyte surface aggregation, after reaching a certain level, it will relocate in a vertical manner and act on cell membrane, cause thin The destruction of after birth integrality, so that well-regulated ion channel is formed, a large amount of K intracellular⁺It outflows with content；(4) " blanket type " Mode.Cationic antibacterial peptide is in endochylema film surface aggregation and forms aggregation, and when reaching triggering concentration, aggregation is cooperated, It internally collapses, destroys envelope barrier.

The chicken β-defensin gene structure gene family includes 14 alexin members (AvBD1-14), on chicken, is prevented Imperial plain gene 1 to 14 is all located in the region of No. 3 chromosome 3q3.5-q3.7 site 86kb.The transcriptional orientation of each alexin It is not consistent, AvBD-1,3,4,5,8,11,12,13,14 and AvBD-2,6,7,9, it is 10 opposite.The AvBD-1 of chicken β-defensin, 2,6,7,8 genes are made of 4 exons and 3 intrones, and AvBD-3,4,5,9,10,11,13 are by 3 exons and 2 Containing sub- composition, AvBD-12 only has 2 exons and 1 introne, and AvBD-14 is newfound to be in recent years suspected to be alexin base Cause contains 2 exons and 3 intrones.The length of the same phylaxin gene, exon and introne has differences, Between different phylaxin genes, the difference in length of exon and introne is also very big.Chicken β-defensin gene expression profile, from The phylaxin gene structures of many species such as chicken, mammal and alexin from the point of view of immunological relevant tissue distribution, the base Because family is likely to first pass through the duplication of gene, then there is differentiation functionally.Chicken alexin 1 to 13 is in antimicrobial sense It is distributed in the innate immune cells of dye all very abundant.Alexin all has wide spectrum to Gram-negative and gram-positive bacterium Antibacterial activity.AvBD1, AvBD2 are mainly expressed in lung and marrow, and AvBD3 is expressed in marrow, tongue, tracheae and the bursa of farbricius, AvBD4-7 is mainly expressed in the cell of bone marrow cell and respiratory tract.On the contrary, AvBD8-13 is expressed in marrow, but in liver, Kidney, testis, ovary and the expression of male and female fowl reproductive tract tissue.Chicken phylaxin gene tissue-specific expression pattern can be by its point For two independent and different types (AvBD1-7 and AvBD8-13).Chicken phylaxin gene from marrow to bursa of Fabricius and The expression of hepatic tissue illustrates that chicken phylaxin gene plays important function served as bridge in congenital immunity and adaptive immunity reaction.Based on chicken Expression of the phylaxin gene in respective organization, in the position and structure of chicken genome and the work in innate immune response With so that they become the very ideal candidate gene (group) of research salmonella resistance.Chicken β-defensin gene cloning is ground Study carefully progress, successful clone is carried out to AvBD-2 gene.Chicken alexin two Gene As vBD-11 and AvBD-12 are cloned, And obtain prokaryotic expression protein.The albumen of In vitro Bactericidal Experiments prompt expression has anti-Escherichia coli isoreactivity.Clone 12 A chicken phylaxin gene (AvBD1-12) obtains the mRNA sequence of these genes, and using prokaryotic expression system to AvBD-12 Gene has carried out prokaryotic expression.Gene cloning and the inducing expression in Pichia pastoris are carried out to AvBD8.To AvBD-3 and AvBD-9 Gene is cloned, and prokaryotic expression and bacteriostatic activity are studied.Acquisition AvBD-2 gene is cloned, while also using big Enterobacteria detects its bacteriostatic activity, and fungistatic effect is higher than dual anti-.Chicken β-defensin (AvBDlinacins) immune function with In the progress of salmonella resistance, inject salmonella to AvBD-1 in the chicken vagina of different days, egg laying performance, The influence of AvBD-2, AvBD-3mRNA expression, the results showed that AvBD-1, AvBD-2, AvBD-3 expression are in Salmonella Bacterium it is post-stimulatory for 24 hours in significantly increase, and age older expression is higher.Have studied 5 chicken phylaxin genes (AvBD2,3, 4,5, and7) make a variation the influence being immunoreacted to salmonella.Each gene chooses 1 SNP site, analysis F1 chicken group's inoculation epidemic disease Blood antibody level changes after seedling.They have found the SNP of two genes of AvBD3 and AvBD7 and the antibody water of vaccine inoculation chicken group Flat is in significant correlation.Inoculation salmonella is recorded in the load bacterium number of spleen and caecum after 1 day-old chicks, 7 days, the results showed that The gene pleiomorphism of AvBD3,11,12,13 and caecum, which carry bacterium number, correlativity, and only AvBD-5 gene pleiomorphism and spleen carry Bacterium number is related.The mRNA expression in chicken body of this 3 chicken phylaxin genes of AvBD4,7 and 9 is had studied to exist with recombination alexin protein External sterilizing ability.Data shows that AvBD7 has expression in multiple histoorgans in vivo, and AvBD4 and AvBD7 are only It is expressed in specific epithelial tissue such as ovary, tracheae, lung.Recombinant protein in vitro anti-salmonella experiments have shown that, alexin AvBD-9 is followed successively by the antibacterial effect of salmonella and is greater than AvBD-7 greater than AvBD-4.Determine chicken alexin (AvBD1,2, 4,6), the expression of the genes such as interleukin 8, gamma interferon mRNA after chick artificial challenge salmonella, discovery Chicken alexin preceding 3 days expression highests after infection, gradually lower, and other several genes gradually increase with infection time later Add, illustrates that chicken alexin seems extremely important to removing pathogen early stage infection.

In conclusion problem of the existing technology is: salmonellosis of chicken is mainly by salmonella typhimurium Caused by the infection of (Salmonella Typhimurium, ST) and Bacterium enteritidis (Salmonella Enterica, SE), and There is various serotype in two class bacteriums, to the prevention of salmonellosis of chicken, there are no effective specific vaccines again.Remedy measures master Use antibiotic treatment, including the drugs such as tetracycline and terramycin, these antibiotic that can only inhibit or kill the intracorporal sramana of machine Salmonella, but propagation of the germ in chicken group cannot be prevented.Due to salmonellosis of chicken have from adult carry disease germs chicken to hatching egg again to The vertical transmission mode of chick, the isolation and drug therapy measure that chicken house uses at present cannot all have the salmonella for the treatment of chicken house The prevention and treatment and propagation of disease.

The difficulty of above-mentioned technical problem is solved with meaning: Salmonella gallinarum is unique parallel and vertical transmission mode is to sramana The prevention and control of Salmonella bring huge difficulty, the reason is that at this stage all can not be to chicken group pathogen and propagation with foreseeable future Approach control effectively, and improves poultry autoimmunity, and cultivating high anti-salmonella chicken group may be to solve this problem most For one of effective approach.The key for realizing the target is to parse the immunology and genetic base of poultry resistance difference, is built It is special to pathogen neurological susceptibility and resistance to filter out body for the inner link of vertical gene involved in immunity diversity and resistance difference Fixed genotype and haplotype, and applied in the breeding practice of marker assisted selection (MAS).

Chicken alexin family includes 14 broad-spectrum antibacterial polypeptides, constitutes the first line of defence of body natural immunity, coding 14 gene tandems be arranged in the same area of same chromosome, this characteristic of chicken alexin family is research single-gene Effect and polygenes synergistic effect provide rare genetic resources.The present invention utilizes gene sequencing and allele specific pcr Technology (Bi-PASA) detection technique, chicken phylaxin gene construct single-gene haplotype in the hereditary difference of Yunnan local chicken breeds chicken Haplotype is integrated with polygenes, illustrates the microevolution mode and Selective type of chicken phylaxin gene；Meanwhile to chicken alexin SNP With the incidence relation of family chicken Natural infection rate, salmonella resistance and the specific genotype of neurological susceptibility and haplotype are screened, is The breeding for disease resistance for improving chicken autoimmunity provides scientific basis.

Summary of the invention

In view of the problems of the existing technology, the present invention provides improve chicken using 3 phylaxin gene Bi-PASA labels The method of group's salmonella resistance, primer, kit.

The invention is realized in this way a kind of genetic test of anti-salmonellosis of chicken marks, 3 alexin bases of the chicken The two-way allele specific pcr of cause marks；The genetic test of the AvBD4 marks, labeled as sequence shown in SEQ ID No.1 5 ' have held the C or T of 1559 SNP；AvBD5 has held the G or A of 798 SNP labeled as sequence 5 ' shown in SEQ ID No.2； AvBD14 has held the T or A of 2095 SNP labeled as sequence 5 ' shown in SEQ ID No.3.

Another object of the present invention is to provide a kind of application utilization phylaxin genes to detect Salmonella gallinarum The detection method of susceptible genotype, the detection method are two-way etc. by detection phylaxin gene AvBD4's, AvBD5, AvBD14 Position gene specific PCR (Bi-PASA) is marked, and is determined the Salmonella gallinarum susceptible genotype of chicken and is resisted genotype.

Further, the detection method using phylaxin gene detection Salmonella gallinarum susceptible genotype specifically includes: The homozygous genotype TT and CC of the Bi-PASA label of AvBD4 are susceptible genotype, and heterozygous TC is to resist genotype, TT gene Type is 845bp and 616bp2 segment, and CC genotype is 845bp and two segments of 229bp, and TC genotype is 845bp, 616bp With 22bp3；The AG genotype and GG genotype of the Bi-PASA label of AvBD5 are that salmonella resists genotype, AA genotype For salmonella susceptible genotype, frequency of genotypes AA is 519bp and 1132bp2 segment, and GG type is 647bp and 1132bp2 piece Section, genotype AG are 3 segments of 519bp, 647bp and 1132bp；The AT of the Bi-PASA label of AvBD14 supports for salmonella Anti- genotype, AA genotype and TT genotype are salmonella susceptible genotype, and genotype AT is 819bp, 644bp and 175bp 3 segments, AA type are 819bp and 644bp2 segment, and genotype TT is 819bp and 175bp2 segment.

Further, AvBD4 gene Hap5 and Hap18 is salmonella resistance type, and Hap15 is the susceptible type of salmonella, In, the SNP group of Hap5 is combined into CTAGCAGACTGGTCA, and the SNP group of Hap18 is combined into CTAGCAAACTGGTCA, the SNP of Hap15 Group is combined into CTTGCAAACTGACCA；AvBD5 gene Hap10 is the susceptible type of salmonella, wherein the SNP group of Hap10 is combined into CGGTGACGTAATGATTCATA；AvBD14 gene Hap7 is salmonella resistance type, and Hap18 is the susceptible type of salmonella, In, the SNP group of Hap7 is combined into CACTTCACCTAGGCAGTTG, and the SNP group of Hap18 is combined into TTCATTGCCTATGCAGTCC.

Another object of the present invention is to provide the primers and detection mark of a kind of 3 phylaxin gene detection labels of identification chicken Note, the nucleotide of the primer are No.4~9 SEQ ID；Two-way allele specific pcr (Bi-PASA) label of AvBD4 Identify the identification base that the two-way allele specific pcr (Bi-PASA) that base is SEQ ID No.10~11, AvBD5 marks The identification base marked for the two-way allele specific pcr (Bi-PASA) of SEQ ID No.12~13, AvBD14 is SEQ ID No.14~15.

Another object of the present invention is to provide a kind of kits marked comprising the primer and detection.

Another object of the present invention is to provide a kind of chicken breeding sides of the genetic test of Salmonella gallinarum resistance Method.

In conclusion advantages of the present invention and good effect are as follows:

The present invention uses Bi-PASA technology for the first time, closes in three phylaxin gene variations with salmonellosis of chicken neurological susceptibility On the basis of connection analysis, by SNP site and gene haplotype Genetic Variation Analysis, disclose phylaxin gene 4 (AvBD4), Phylaxin gene 5 (AvBD5), (AvBD14) gene of phylaxin gene 14 are the functional gene that chicken resists salmonellosis, are established Simple, time saving, inexpensive and quickly and effectively 3 genes B-PASA detects label, has to isogeneity and breeding for disease resistance There is positive directive significance.3 labels of the invention, genetic test and the molecular labeling that can be used for Salmonella gallinarum resistance are auxiliary Help breeding, have the characteristics that early screening, Rapid identification, save the time, be low in cost, accuracy it is high.

The present invention has obtained project of national nature science fund project and (approval number: 31560629) has subsidized.

Detailed description of the invention

Fig. 1 is that 3 phylaxin genes variations of chicken provided in an embodiment of the present invention with salmonella neurological susceptibility are associated with detection side Method flow chart.

Fig. 2 is chicken genome dna electrophoresis figure provided in an embodiment of the present invention；

In figure: M.DL2000DNA molecular weight marker, 1~12 is chicken genomic DNA.

Fig. 3 is chicken AvBD4, AvBD5 and AvBD14 gene amplification product electrophoretogram provided in an embodiment of the present invention.

Fig. 4 is chicken AvBD4 gene polymorphic site provided in an embodiment of the present invention figure.

Fig. 5 is chicken AvBD5 gene polymorphic site provided in an embodiment of the present invention figure.

Fig. 6 is chicken AvBD14 gene polymorphic site provided in an embodiment of the present invention figure.

Fig. 7 is chicken AvBD4 gene Bi-PASA molecular labeling electrophoretogram provided in an embodiment of the present invention；

In figure: M is 2kb molecular weight marker, and swimming lane 3,4,5,7,8 is TT type, and swimming lane 9,10 is CC type, and swimming lane 1,2,6 is Heterozygote CT type.

Fig. 8 is chicken AvBD5 gene Bi-PASA molecular labeling electrophoretogram provided in an embodiment of the present invention；

In figure: M is 2kb molecular weight marker, and swimming lane 3,6,10 is AA type, and swimming lane 1,4,7 is GG type, and swimming lane 2,5,8,9 is Heterozygote AG type.

Fig. 9 is chicken AvBD14 gene Bi-PASA molecular labeling electrophoretogram provided in an embodiment of the present invention；

In figure: M is 2kb molecular weight marker, and swimming lane 9,10 is AA type, and swimming lane 1,2,5,6,7 is TT type, and swimming lane 3,4,8 is Heterozygote AT type.

Specific embodiment

In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to embodiments, to the present invention It is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to Limit the present invention.

As shown in Figure 1, provided in an embodiment of the present invention improve chicken group sramana using 3 phylaxin gene Bi-PASA labels The method of Salmonella resistance, primer, kit the following steps are included:

S101: the method acquisition chicken for being separately cultured identification using repetition plate agglutination test and bacterium is 147 positive, negative 132；Whole blood 5-10ml is acquired from wing venous using the anticoagulant vacuum blood collection tube of heparin sodium, 4 DEG C are transported to laboratory then -20 DEG C of guarantors It deposits；The measurement of chicken blood conventional index；The extraction and detection of chicken blood genomic DNA；

S102: the chicken issued according to NCBI (National Center for Biotechnology Information) AvBD4, AvBD5, AvBD14 coding sequence of (AvBDlus AvBDlus) whole genome sequence (build3.1), benefit It is set with primer3 (V.0.4.0) primer-design software (http://bioinfo.ut.ee/primer3-0.4.0/primer3/) Counted 3 pairs of primers, primer sequence, amplified production size are shown in Table 3, primer synthesized by Shanghai Sheng Gong bio-engineering corporation (Shanghai, in State), it is 50 μm of ol/L, -20 DEG C of preservations that Tris.HCL, which is dissolved to concentration,；

S103:PCR reaction system respectively plus 5 μ l (about 15ng) of template DNA, as needed may be used after every pipe 45ul packing Add a drop paraffin oil to cover reaction mixture, prevents from evaporating；

S104: DNA Purification Kit PCR product, the sequencing of PCR product, DNA sequence analysis and polymorphic are used Property detection；

S105:Bi-PASA genetic marker, AvBD4Bi-PASA molecular labeling, AvBD5Bi-PASA molecular labeling, AvBD14Bi-PASA molecular labeling；

S106: the calculating of data statistic analysis, gene frequency and genotype frequency, Hardy-Weinberg balance, group The calculating of heterozygosity, the calculating of polymorphism information content, the correlation analysis of single SNP and salmonella neurological susceptibility, SNPs are chain not Equilibrium analysis (Linkage disequilibrium, LD), the association analysis of haplotype and salmonellosis of chicken, blood physiology are raw Change the correlation analysis of index and salmonella neurological susceptibility, gene evolution analysis.

Application principle of the invention is further described below with reference to experiment.

The acquisition of 13 phylaxin gene polymorphic sites of chicken of embodiment

The acquisition of 1 chicken blood sample

It is being the gender for recording every chicken in detail, age, plumage color, tail portion character and pedigree information to sample acquisition, is utilizing The anticoagulant vacuum blood collection tube of heparin sodium acquires 2~3ml of whole blood from wing venous, and 4 DEG C are transported to laboratory, are then stored at -20 DEG C.

2 extracting genome DNAs

Chicken wings venous blood collection, institute's blood-sample withdrawal be 1mL/ only, EDTA it is anticoagulant, blood sample is in -20 DEG C of freezen protectives.Using routine Phenol-chloroform method extracts genomic DNA from above-mentioned chicken blood, is detected with 1.0% agarose electrophoresis, it can be seen that DNA band Clearly, it becomes clear, without miscellaneous band, complies fully with the requirement of subsequent PCR test.

3 design of primers and synthesis

The chicken issued according to NCBI (National Center for Biotechnology Information) AvBD4, AvBD5, AvBD14 coding sequence of (AvBDlus AvBDlus) whole genome sequence (build 3.1), benefit It is set with primer3 (V.0.4.0) primer-design software (http://bioinfo.ut.ee/primer3-0.4.0/primer3/) Counted 3 pairs of primers, primer sequence, amplified production size are shown in Table 3, primer synthesized by Shanghai Sheng Gong bio-engineering corporation (Shanghai, in State), it is 50 μm of ol/L, -20 DEG C of preservations that Tris.HCL, which is dissolved to concentration,.

3 phylaxin gene primer information tables of chicken

4 PCR reaction systems and gene magnification

Prepare PCR reaction mixture (50 μ l of total volume) in the following order

4 pcr amplification reaction system of table

PCR cycle parameter:

Using wooden dipper chicken blood genomic DNA as template, expanded according to the primer of 3 phylaxin genes.Gene magnification produces Object is detected with 1.0% agarose gel electrophoresis, Marker DL2000；Each sample takes 4 μ l point samples, 100 constant pressure electrophoresis 40min Left and right, gel imaging are taken pictures.PCR amplification obtains that product is consistent with expected clip size, and expanding effect is good, and sample is fed directly to The purifying sequencing of Kunming Qing Ke Biotechnology Co., Ltd.Amplification such as Fig. 3.

The purifying of 5 PCR products and determined dna sequence

Kits PCR product is rapidly purified using PCR, PCR product, which is sent after purification to the large biotechnology of holding up in Kunming, to be had Limit company (Kunming, China) carries out positive and negative chain bidirectional sequencing.

(1) to AvBD4 gene PCR amplified production be sequenced, through with NCBI Blast tetraploid rice, be sequenced arrange and AvBD4 gene order (gene accession number: the NW_001471673.2) homology of GenBank is up to 99% or more, it was demonstrated that amplification Product is chicken AvBD4 gene.Between the results show that AvBD4 gene magnification region sequence 845bp, being sent out altogether after sequence alignment chicken individuals Existing C1096T, T1117G, A1124T, A1186G, C1192T, A1193G, A1210G, A1225G, C1252T, C1332T, A1337G, A1516G, C1559T, C1679T and A1687G15 SNPs.AvBD4 Gene Partial SNP site sequencing result is shown in figure 4.AvBD4 genetic mutation site testing result is shown in Table 9, and wherein C1559T causes amino acid variation, is junket ammonia by glutamic acid variation Acid.

9 chicken AvBD4 genetic mutation site of table

(2) to AvBD5 PCR product direct Sequencing, SNPs screening is carried out to sequencing result using Seq Man program, AvBD5 gene magnification 1132bp, altogether find 20 variant sites, respectively A244C, A291G, A293G, C356G, G530T, A567G、C652T、A711G、C719T、A798G、A802G、C856T、A873G、A912G、C1049T、C1051T、C1063T、 A1065T, C1094T and A1180G, part sequencing result are shown in Fig. 5.AvBD5 genetic mutation site testing result is shown in Table 10, outer aobvious The code area of son 1 finds 1 variant sites A244C, causes threonine to the variation of proline, 3 variation positions of exon 2 discovery Point, wherein A798G cause amino acid variation, it is arginine by lysine variation.

10 chicken AvBD5 genetic mutation site of table

(3) it to AvBD14 gene PCR amplified production direct Sequencing, as a result with NCBI Blast tetraploid rice, is sequenced The homology of column and the AvBD14 gene order (gene accession number: NW_001471673.2) of GenBank is up to 98% or more, it was demonstrated that The product of amplification is chicken AvBD14 gene.It carries out SNPs screening results after sequencing to show, AvBD4 gene magnification region sequence 819bp, Altogether find C1525T, A1544T, C1565T, A1587T, C1685T, C1733T, A1756G, A1788C, C1796T, A1800T, A1856G, G1869T, G1964T, C1979T, A1982T, A2036G, A2095T, C2218T and C2226G19 SNPs, AvBD14 Gene Partial sequencing result is shown in Fig. 6.AvBD14 genetic mutation site testing result is shown in Table 11, wherein on exon 2 A2095T causes phenylalanine to the variation of tyrosine.

10 chicken AvBD5 genetic mutation site of table

2 chicken of embodiment, the three two-way allele specific pcr of phylaxin gene (Bi-PASA) genetic markers

1 AvBD4 Bi-PASA molecular labeling

According to sequencing result, the C/T in 613 site of AvBD4 gene makes a variation, and causes histidine to the variation of tyrosine, at this A pair of of forward primer and reverse primer, referred to as AvBD4-C (5 '-ggggcggggACCCCTGGGAAA are devised at variant sites again TGCCCTC-3 ') and

AvBD4-Y(5’-ggggcggggCCCAGGTAAGCATTCCCATA-3’)。

Chicken AvBD4 gene Bi-PASA coamplification goes out 3 segments, and one is 845bp segment, be primer AvBD4-FI and The product that AvBD4-R1 is amplified can be used as the positive control of PCR amplification；One is 616bp segment, be primer AvBD4-F1 and The product that AvBD4-T is amplified is TT type；The other is 229bp segment, amplifies for primer AvBD4-C and AvBD4-R1 Product is CC type.Chicken AvBD4 gene Bi-PASA electrophoresis detection result is shown in Fig. 7.

The amplification system of AvBD4 gene Bi-PASA and PCR amplification system above are almost the same, are a difference in that Bi-PASA Amplification contains 4 primers (AvBD4-F1, AvBD4-R1, AvBD4-C and AvBD4-T), and the concentration of every kind of primer is 10pmol/ μ l。

2AvBD5Bi-PASA molecular labeling

It is carried out according to the A/G variant sites that sequencing result, the present invention are found at AvBD5 sequence the 588th, and in this site BI-PASA detection.A pair of of inner primer, the positive sequence (AvBD5-A) of primer: 5 '-have been redesigned at the variant sites GCTTCTGCTCCCACAAGTCA-3'；Reverse sequence (AvBD5-G): 5 '-ATCCCTGGAGGACACGACC-3 '.

The site Gene A 798G AvBD5 obtains 3 DNA fragmentations: 519,647 and 1132bp (Fig. 8) after Bi-PASA is expanded. It is 519bp and 1132bp that frequency of genotypes AA can be clearly separated on 1.5% Ago-Gel, and GG type is 647bp and 1132bp, Genotype AG is 3 segments of 519bp, 647bp and 1132bp.

The amplification system of AvBD5 gene Bi-PASA is almost the same with AvBD4 with regular-PCR amplification system, and difference is same Sample is 4 primers (AvBD5-F1, AvBD5-R1, AvBD5-A and AvBD5-G) to be all put into PCR premixed liquid (as above figure AvBD4), the Bi-PASA amplification condition after optimization is 94 DEG C of 3min, 94 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 45s, 30 circulations；72 DEG C extend 8min.Bi-PASA amplified fragments are detected with 1.5% agarose gel electrophoresis, GoldView (GV) dyeing, gel at As observation is taken pictures on instrument.

3 AvBD14 Bi-PASA molecular labelings

According to sequencing result, there are A/T variant sites at AvBD14 gene 634, cause phenylalanine to tyrosine Variation, the present invention have redesigned a pair of primer for being exclusively used in Bi-PASA detection, and amplified fragments are respectively 175bp and 644bp. The positive sequence (AvBD14-T) of primer: 5 '-ggggcggggCGTTCTTGCTGTGTCCTTTCTT-3 '；Reverse sequence (AvBD14-A): 5 '-ggggcggggAGGTACCACTGGATCTCTTGT-3.

According to sequencing result, the A/T in the 2095th site of AvBD14 gene variation causes phenylalanine to the change of tyrosine, Bi-PASA genetic marker is established in this site, carries out genotype detection.Chicken AvBD14 gene Bi-PASA coamplification goes out 3 pieces Section, the long segment of primer AvBD14-F1 and AvBD14-R1 amplification are 819bp, the positive control as PCR amplification；One is 175bp segment is TT type for the product that primer AvBD14-T and AvBD14-R1 are amplified；The other is 644bp segment, to draw The product that object AvBD14-F1 and AvBD14-A are amplified is AA type.Chicken AvBD14 gene Bi-PASA electrophoresis detection result is shown in figure 9。

The composition of PCR reaction solution, in addition to primer is different, other reagents and DNA profiling amount and AvBD4 are all the same.PCR reaction Condition 94 DEG C of 3min, 94 DEG C of 45s, 58 DEG C of 30s, 72 DEG C of 45s, 35 circulations；72 DEG C of extension 8min.Bi-PASA amplified fragments are used 1.5% agarose gel electrophoresis detection, GoldView (GV) dyeing, observes in gel imager and takes pictures.

The association analysis of embodiment 3 chicken 3 phylaxin genes and salmonella neurological susceptibility

1, the association analysis of the single SNP salmonella neurological susceptibility of 3 phylaxin genes

The association analysis of 1 (1) AvBD4 gene single SNPs and salmonella neurological susceptibility

With logistic regression method, the single SNPs of AvBD4 gene is analyzed under codominance (Codominant) hereditary pattern With the correlation of salmonella neurological susceptibility, SNP site is not found and salmonella is susceptible correlation (P > 0.05), the results are shown in Table 15。

The correlation analysis of table 15 AvBD4 gene polymorphism sites and Salmonella gallinarum neurological susceptibility

Note: " NA " expression is not present or does not have；OR: odds ratio；CI: credibility interval；AIC: akaike information criterion； BIC:: Bayesian information criterion.

(2) association analysis of AvBD5 gene single SNPs and salmonella neurological susceptibility

With logistic regression method (SNPststs), analyzed under codominant inheritance mode the single SNPs of AvBD5 gene and The correlation of salmonella neurological susceptibility, the results are shown in Table 16.The results show that except variant sites SNP2, SNP10, SNP15, SNP16 and SNP17 is significant related (P < 0.05) to salmonella neurological susceptibility, other equal non-correlations (P > 0.05).AvBD5 gene SNP 2 Loci gene type A/G is significantly higher than the frequency (16.1%) of control group in the frequency (33.9%) of positive group, prompts A/G type (OR =2.20,95%CI=0.68-7.15) it is the susceptible type of salmonella, GG type (OR=0) may be salmonella resistance type； SNP10 loci gene type A/G and G/G is substantially less than the frequency (54.8%) of control group in the frequency (32.3%) of positive group, mentions Show A/G (OR=0.38,95%CI=0.21-0.69) type and G/G type (OR=0.44,95%CI=0.14-1.39) to A/A type It (OR=1) may be salmonella protection type；SNP15 loci gene type T/C and T/T is significant in the frequency (54.2%) of positive group Lower than the frequency (80.6%) of control group, T/C (OR=0.25,95%CI=0.08-0.80) type and T/T type (OR=are prompted It 0.28,95%CI=0.06-1.29) may be salmonella protection type to CC type (OR=1)；SNP16 loci gene type T/C and T/T is substantially less than the frequency (83.9%) of control group in the frequency (56.7%) of positive group, prompts T/C (OR=0.23,95%CI =0.07-0.80) type and T/T type (OR=0.21,95%CI=0.05-0.99) may be salmonella to CC type (OR=1) Protection type；SNP17 loci gene type T/C and C/C is substantially less than the frequency of control group in the frequency (44%) of positive group (80.7%), T/C (OR=0.14,95%CI=0.04-0.49) type and C/C type (OR=0.19,95%CI=0.04- are prompted It 0.82) may be salmonella protection type to T/T type (OR=1).

The association analysis of table 16 AvBD5 gene polymorphism sites and Salmonella gallinarum neurological susceptibility

Note: " NA " expression is not present or does not have；OR: odds ratio；CI: credibility interval；AIC: akaike information criterion； BIC:: Bayesian information criterion.

(3) association analysis of AvBD14 gene single SNPs and salmonella neurological susceptibility

The pass of single SNP and salmonella neurological susceptibility are carried out using logistic regression method in on-line analysis software SNPstats Connection point is prayed, provide respectively odds ratio (Odds ratio, OR) and 95% credibility interval (Confidenceintervals, 95% CI).The results show that except variant sites SNP1, SNP2, SNP12 and SNP17 and significant related (the P < of salmonella neurological susceptibility 0.05), other equal non-correlations (P > 0.05).SNP1 loci gene type C/C and C/T is aobvious in the frequency (38.8%) of positive group The frequency (61.4%) for being lower than control group is write, C/C type (OR=0.17,95%CI=0.02-1.74) type and C/T type (OR are prompted =0.26,95%CI=0.10-0.68) it may be salmonella protection type to T/T type (OR=1).SNP2 loci gene type A/A Be substantially less than the frequency (56.9%) of control group in the frequency (32.7%) of positive group with A/T, prompt A/A type (OR=0.17, 95%CI=0.02-1.78) and A/T type (OR=0.22,95%CI=0.08-0.60) may be sramana to T/T type (OR=1) Salmonella protection type；SNP12 loci gene type G/T exists only in positive group, and G/T type may be salmonella to G/G type (OR=1) Susceptible type.SNP17 loci gene type A/T is substantially less than the frequency (31.8%) of control group in the frequency (20.4%) of positive group, Prompting A/T type (OR=0.56,95%CI=0.33-0.97) may be salmonella protection type (table 17).

The association analysis of table 17 AvBD14 gene polymorphism sites and Salmonella gallinarum neurological susceptibility

Note: " NA " expression is not present or does not have；OR: odds ratio；CI: credibility interval；AIC: akaike information criterion； BIC:: Bayesian information criterion.

The linkage disequilibrium value of 23 phylaxin gene polymorphic sites of chicken

(1) linkage disequilibrium value of AvBD4 gene polymorphism sites

The present invention is applied to the linkage disequilibrium value between SNPs AvBD4 gene, to chicken positive group and control group 15 sites SNPs analyzed, be shown in Table 18.The results show that the site SNP1 remove with SNP7 and SNP14 it is not chain and other There is strong chain (ˊ > 0.75 D, and D ˊ, close to 1), the site SNP2 is deposited with the site SNP3, SNP6, SNP8, SNP9 and SNP12 in site In significant chain (ˊ > 0.75 D), the site SNP3 and the site SNP5, SNP6, SNP7, SNP8, SNP9, SNP13 and SNP14 are in the presence of aobvious It writes chain (ˊ > 0.75 D), the site SNP4 and the site SNP7, SNP8, SNP9 and SNP14 have significant chain (ˊ > 0.75 D), SNP5 Site and the site SNP6, SNP7, SNP9, SNP12 and SNP13 exist significant chain (ˊ > 0.75 D), the site SNP6 and SNP9 and The site SNP12 exists significant chain (ˊ > 0.75 D), and the site SNP7 and the site SNP9, SNP13, SNP14 and SNP15 exist significantly There is significant chain (ˊ > 0.75 D) in chain (ˊ > 0.75 D), the site SNP8 and the site SNP9, SNP10 and SNP11, SNP9 is removed in site With the site SNP10 it is not chain other than, all exist significant chain (ˊ > 0.75 D) with other sites, the site SNP10 and SNP11, There is significant chain (ˊ > 0.75 D), the site SNP11 and the site SNP12, SNP13 and SNP14 in the site SNP12, SNP13 and SNP14 In the presence of significant chain (ˊ > 0.75 D), there is significant chain (ˊ > 0.75 D), SNP13 in the site SNP12 and the site SNP13 and SNP14 Site and the site SNP14 exist significant chain (ˊ > 0.75 D), the site SNP14 and the site SNP15 exist it is significant it is chain (D ˊ > 0.75).This 15 sites are constituted haplotype by the present invention, for analyzing AvBD4 gene haplotype and salmonella neurological susceptibility Relationship.

(2) linkage disequilibrium value of AvBD5 gene polymorphism sites

The present invention copes with the linkage disequilibrium value between pairs of SNPs, to the 20 of positive group and control group A vBD5 gene A site SNPs is analyzed, and is shown in Table 19.The results show that the site SNP1 and SNP2, SNP4, SNP8, SNP13 and SNP14 Point exists significant chain (ˊ > 0.75 D), and the site SNP2 and the site SNP6 exist significant chain (ˊ > 0.75 D), the site SNP3 with The site SNP4, SNP8, SNP11, SNP13 and SNP19 exists significant chain (ˊ > 0.75 D), the site SNP4 and SNP6, SNP8, There is significant chain (ˊ > 0.75 D), the site SNP5 and SNP8, SNP11 and SNP13 in the site SNP9, SNP10, SNP11 and SNP13 Site exist significant chain (ˊ > 0.75 D), the site SNP6 and SNP7, SNP8, SNP10, SNP11, SNP13, SNP15, SNP16 and There is significant chain (ˊ > 0.75 D) in the site SNP18, the site SNP7 is deposited with the site SNP9, SNP13, SNP14, SNP19 and SNP20 In significant chain (ˊ>0.75 D), the site SNP8 except in addition to SNP2 and SNP7 not chain (ˊ<0.75 D), all with other variant sites In the presence of significant chain (ˊ > 0.75 D), the site SNP9 and the site SNP11 exist significant chain (ˊ > 0.75 D), the site SNP10 with There is significant chain (ˊ > 0.75 D), the site SNP11 and the site SNP12, SNP13 and SNP19 in the site SNP11, SNP13 and SNP19 In the presence of significant chain (ˊ > 0.75 D), the site SNP13 and SNP14, SNP18, SNP19 and SNP20 exist it is significant it is chain (D ˊ > 0.75), the site SNP15 and SNP16, SNP17, SNP19 and SNP20 exist significant chain (ˊ > 0.75 D), the site SNP16 with There is significant chain (ˊ > 0.75 D), the site SNP17 and SNP19 in SNP17, SNP19 and SNP20 and SNP20 has significant chain (D ˊ > 0.75), the site SNP18 and SNP19 and SNP20 exist significant chain (ˊ > 0.75 D), and the site SNP19 and the site SNP20 exist Significant chain (ˊ > 0.75 D).This 20 sites are constituted haplotype by the present invention, for analyzing AvBD5 gene haplotype and sramana The relationship of Salmonella neurological susceptibility.

Linkage disequilibrium value between 18 site AvBD4 gene SNP s of table

Linkage disequilibrium value between 19 site AvBD5 gene SNP s of table

(3) linkage disequilibrium value of AvBD14 gene polymorphism sites

The present invention copes with the linkage disequilibrium value between AvBD14 pair of genes SNPs, tested chicken whole AvBD14 gene 19 sites SNPs analyzed, be shown in Table 20.The results show that the site SNP1 and SNP2, SNP5, SNP8, SNP9, SNP10, The site SNP11, SNP12, SNP14 and SNP15 exists significant chain (ˊ > 0.75 D), the site SNP2 and SNP5, SNP8, SNP9, The site SNP10, SNP11, SNP12, SNP14 and SNP15 exists significant chain (ˊ > 0.75 D), the site SNP3 and SNP8, SNP13, The site SNP15, SNP16 and SNP17 exists significant chain (ˊ > 0.75 D), the site SNP4 and SNP5, SNP6, SNP7, SNP8, The site SNP11, SNP13, SNP16 and SNP17 exists significant chain (ˊ > 0.75 D), the site SNP5 and SNP6, SNP7, SNP10, The site SNP11, SNP12, SNP13, SNP14, SNP16 and SNP17 exists significant chain (ˊ > 0.75 D), the site SNP6 and SNP7, The site SNP8, SNP11, SNP12, SNP13, SNP16 and SNP17 exists significant chain (ˊ > 0.75 D), the site SNP7 and SNP8, The site SNP9, SNP11, SNP12, SNP13, SNP16 and SNP17 exists significant chain (ˊ > 0.75 D), the site SNP8 and SNP9, There is significant chain (ˊ > 0.75 D), the site SNP9 in the site SNP10, SNP13, SNP14, SNP15, SNP16, SNP17 and SNP18 Exist significant chain (ˊ > 0.75 D) with the site SNP10, SNP12, SNP13, SNP16 and SNP18, the site SNP10 and SNP12, There is significant chain (ˊ > 0.75 D), the site SNP11 and the site SNP12, SNP13 and SNP16 in the presence of aobvious in the site SNP16 and SNP18 Write chain (ˊ > 0.75 D), the site SNP12 and the site SNP13, SNP15, SNP16, SNP17 and SNP19 exist it is significant it is chain (D ˊ > 0.75), the site SNP13 and SNP14, SNP15, SNP16, SNP17 and SNP18 exist significant chain (ˊ > 0.75 D), and SNP14 There is significant chain (ˊ > 0.75 D), the site SNP15 and SNP16 in point and the site SNP16 and SNP17 exist it is significant it is chain (D ˊ > 0.75), the site SNP16 and SNP17, SNP18 and SNP19 exist significant chain (ˊ > 0.75 D), the site SNP17 and SNP18 and SNP19 exists significant chain (ˊ > 0.75 D), and the site SNP18 and SNP19 have significant chain (ˊ > 0.75 D).The present invention this 19 A site constitutes haplotype, for analyzing the relationship of AvBD14 gene haplotype Yu salmonella neurological susceptibility.

Linkage disequilibrium value between 20 site AvBD14 gene SNP s of table

3, the correlation analysis of 3 phylaxin gene haplotypes and salmonella neurological susceptibility of chicken

(1) association analysis of chicken AvBD4 gene haplotype and salmonella neurological susceptibility

Logic-based homing method, using online software SNPstats analysis AvBD4 gene haplotype and salmonella it Between correlation, AvBD4 gene finds that 15 become site altogether, forms 21 haplotypes, haplotype of the frequency less than 0.01 is not It analyzes, the results are shown in Table 21.

The results show that other are without phase except haplotype 5,15,18 is significant related (P < 0.05) to salmonella neurological susceptibility Closing property (P > 0.05)；Haplotype 5 is substantially less than the frequency (0.0735) of negative group, and OR in the frequency (0.0218) of positive group Value is 0.11,95%CI 0.01-0.92, and prompting the 5th article of haplotype may be salmonella protection type.15th haplotype is only deposited It is positive group, is not present in negative control group, OR value 164720377.70,95%CI is (164720352.50- 164720402.89), prompting 15 haplotypes may be the susceptible type of salmonella.18th haplotype exists only in negative control group, And do not occur in positive group, and OR value is infinitesimal, prompting 18 haplotypes may be salmonella protection type.

The association analysis of table 21 each gene SNP s site haplotype and salmonella neurological susceptibility

(2) association analysis of chicken AvBD5 gene haplotype and salmonella neurological susceptibility

Logic-based homing method, using online software SNPstats analysis AvBD5 gene haplotype and salmonella it Between correlation, AvBD5 gene finds that 20 become site altogether, forms 15 haplotypes, haplotype of the frequency less than 0.01 is not It analyzes, the results are shown in Table 22.The results show that other are except haplotype 10 is significant related (P < 0.05) to salmonella neurological susceptibility Non-correlation (P > 0.05)；Haplotype 10 the positive group frequency be 0.0286, negative control group without, and OR value be 1.62, 95%CI is 0.11-24.2, and prompting haplotype 10 may be the susceptible type of salmonella.

The association analysis of table 22 each gene SNP s site haplotype and salmonella neurological susceptibility

(3) association analysis of chicken AvBD14 gene haplotype and salmonella neurological susceptibility

Logic-based homing method, using online software SNPstats analysis AvBD14 gene haplotype and salmonella it Between correlation, AvBD14 gene finds that 19 become site altogether, forms 24 haplotypes, haplotype of the frequency less than 0.01 is not It analyzes, the results are shown in Table 23.The results show that except haplotype 7,18 is significant related (P < 0.05) to salmonella neurological susceptibility, other Equal non-correlation (P > 0.05)；Haplotype 7 is substantially less than the frequency of negative group in the frequency (0.0102) of positive group (0.0795), and OR value is 0.01,95%CI 0.00-0.92, and prompting the 7th article of haplotype may be salmonella protection type. 18th haplotype exists only in positive group, is not present in negative control group, and OR value is infinity, and prompting 18 haplotypes may be sand The door susceptible type of Salmonella.

The association analysis of table 23 each gene SNP s site haplotype and salmonella neurological susceptibility

Embodiment 4 is suitable for the 3 two-way allele specific pcr of phylaxin gene gene (Bi-PASA) genetic markers of chicken Detection kit

AvBD4 gene detecting kit includes following reagent

AvBD5 gene detecting kit includes following reagent

AvBD14 gene detecting kit includes following reagent

The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.

Sequence table

<110>Yunnan Prov Agriculture University

<120>method for improving chicken group's salmonella resistance using phylaxin gene label

<160> 41

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1870

<212> DNA

<213>chicken (Gallus gallus)

<400> 1

ctgcaacgtt ttggcagcaa taccttggtc cctcacagga ggacgctaac agagaagatc 60

tgctgaacgg cgcctcgact ctctccagaa ctgcagacat ctcctgattg gccccaggaa 120

ggctgtgaag agcaagcatc cttcccagcc tccagaagcc acgtagagcc acgctctgct 180

cctccatctt aatgcgtttg ggtggctgac gctgatctgc aggactactc caacccagag 240

cctcctcttt ggtggtaatg acccaaatct tctcattatt cagcctctct tctacagctc 300

tgtacttctg aaaatggctg gagatttcag atcttccatg gatagctgct ttactctgtc 360

gtaaccttaa ctgtgcagtg actcagttca tcaagcatta gtttaggcaa atattgattg 420

gaaagaagaa atgtttgttg gctgcagaag gagatctagg aggaaatttg tcttggaaat 480

agttctggaa ttgaacaaaa aagcggtggt tggactagat gaccttcatg gtctttccaa 540

ccttaatgat tccttctcta ctcttgcttt agaaaggttt gagaacgtgc ttcgtgttgc 600

cttgcatgaa tgtagtaaga attgtcatgt tctggtttct gaattaacaa cttccacaga 660

gcaggttcaa tttattgcag tgtattgcaa catgtcaagc aatttaggat aaacgtctac 720

ttaattaaca tggtaattaa aagttggatt taaaatggca tagttctgca cagaagcttc 780

tgccatgatc ttacgtgtgg tccagggaac ccttaagaca aagcacatga ttgtgaagaa 840

agtgtattct atatgattct caatgataat ttctgtcctt cactcctcag cccactgtgt 900

ctgtaggtgg acaacatctc agtgtcgttt ctctgcagtg acaggatttc ccagtctgcc 960

ttctgccatg aaaatccttt gctttttcat cgtgctcctc tttgtggcag ttcatggagc 1020

tgtgggtaag gagtaagtga aagcgtgagg ctgtatacaa gccgtatgat attggtgtct 1080

cataaaggtc ttctgtcccc tttgggaggt ggcccagttt ggatattagt aaaaattctc 1140

ataaggagca gtgctgcagt ggcacagctg cccagggggg cggtggggtc accatccctg 1200

gaggtgttca atgtggagat gtggcgctga gggacatagt gggcagtggg cacggtgggg 1260

gtggggttgg acttggggat cttagaggtc ttttccaacc tgagtgattc tatgattcca 1320

tgaatagggt ggtaagtgtc ctccaggtga ttatggatgg gaaaagactg tgacggattg 1380

agaaagagaa gggagaagtg ggagaaatat cgtatctgca acagtctccc tttttctttt 1440

ctttcttttt ttcaattttt cttttctctt ttttaaatac tgcaggcttt tcccgttctc 1500

caagatatca catgcaatgt ggatatcgcg ggaccttctg cacccctggg aaatgccctc 1560

atgggaatgc ttacctgggg ctatgccgtc ccaagtattc ttgctgtaga tggtaagatt 1620

aagacttgac tatggctaaa ctgacttccc agattttaag ttctatatgg tgggattttc 1680

cccttcaact taggtgtgaa aaccctgtac tcttctttct tttgcatagg ttgtagtgtg 1740

aataattgca caggatctcc agaagtctgg aaatggtctc ttcttgcatt gttggatttg 1800

gggaaccatt gtaccggtca ttcttttaac aaatttttgc cattctttta ataaaagcaa 1860

tatctgggga 1870

<210> 2

<211> 1404

<212> DNA

<213>chicken (Gallus gallus)

<400> 2

caggatgaca caagagccgg ggctgaaggc ctagggggaa agccattccg tgtcatctct 60

gacaggggaa gaaacaggaa aaggtgcttt gggaacaatc ggtggtgtca gggatactgc 120

ctgcgtggca ggaggacgcc agctgggatc aaactgctgc tgccagcaag aaaggaacct 180

gccctgtttt ttcttctccc cacagctgtg accctccggg catctcccag ccatgcagat 240

cctgactctc ctgctccggg cagaaccagg tgagatatac atacgttgtg ggagggtggt 300

gtgtttgccc tttgttgata ttttgtaggg gataatggag ggtttgatga tgattggtca 360

tagaatcata gaatggcctg ggttgaatga tcatccagtt tcaacccccc tgctatgtga 420

agggtcacca accagcagac caggctcttt gctgtcctcc tcctgatgcc cagagccaca 480

tccagcctgg ccttgaatgc ctccagggat ggggcatcca cttactgtgg tacccaatgg 540

atttccattg gaaagtttgc cttggctggt agaaaaaaag gaagaatagg cagcccaggg 600

gtgtggggag agctttccac ttgtgttcag caaggagaca gtcagggtgc accgatgttg 660

gctgtacagg ggcagaaggc tgcgctcaca gctgggcaga actgtgctga ggtgttctcc 720

ttctgctctc tgcagggctg tcccttgctc gaggattacc ccaggactgt gagcgccgtg 780

ggggcttctg ctcccacaag tcatgtcctc cagggatcgg ccgcattggc ctctgctcca 840

aggaagactt ctgctgccgg aggtaggctc agcgctgcct gatgcggggt ggctgcttcc 900

tgttggggtt gggggtgagg tccttgaaga agggaaataa cacacagccc aatggcatgg 960

gggcatcccc gggtccctgc tactgcgtta tccaaactgg gagatgctgc tggggctgca 1020

gcaatccggt gtcctccttc caccactaat gttggcagcc cagccaccac ctgtagagag 1080

catggggact cttctcaggc ttccaccagc cccagaaccg tagttcagaa gcagtcccaa 1140

agggagatgg gcattttaac tgagggttct ggcctcatag agttgggatg aacactgcca 1200

cacctttcct cccacagccg atggtattcc tgatggcctc tgatgtccct tcacgttcat 1260

ctccatgcag agcatcgaag ccaccaccta cctttgcagt gcaccagagg caacaatcac 1320

cactgggagc ggtggtgacc ctggacaacc agacctcagc cctgtgagaa cccctctgtc 1380

cccaatacaa ggtggcagct tgca 1404

<210> 3

<211> 3000

<212> DNA

<213>chicken (Gallus gallus)

<400> 3

gaagaggagg aggaaacacg ggagcacctc cccagatgcc tccccccgcc ccgccgcgga 60

gttgttacgt cacgctgctt gcttctcgcc ggctttttgg ggccccggtt ggtacatccc 120

gatgtccccc gttgtccccg cgggactgag cgctaggtgg cagccggggc acggtgtgcg 180

gtgctgccga agatcaactg cgttattttt cctcccctcc gtcggaagag atggctgcta 240

atgaagtcca aatagcgtcc acagatttgt gagtggtttt ggaaaatcat gcgggatgct 300

cccgaagctc agtggatcca ctgagctgtc aggagttatc ccatgccatg ccctgccctg 360

ccatgccatc tcgtcccgtg ccatgccgtg ccatgccatg ccatgccatg ccatgccatc 420

ccatccnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 480

nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 540

nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 600

nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 660

nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 720

nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 780

nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnt cccatcccat cccatcccat 840

cccatcccaa cccatatgag tgtgtttggg ggctttaact catttttctg ctgttttttg 900

tttgtttgtt tgtttttaat ctttagcaag tttcttggca acccttggaa ctaagcctgg 960

acactgctgg tttaagcagc agtctgtcat ccaactcggt ttccagagtt ctctatagat 1020

ccccagtgtg tgatgcctgt ctctctgtgc cctatgcttc cctcttgata cttgcatatg 1080

aacagtgacc caaacctgtg tgctcaggga tgtgctgctg gctggggagc caagctactc 1140

tctctgattt tagaaggagt gtatctggga tctctgtctc cagtactgat ttttaccaac 1200

tatggaagaa ctttgcatcc ttcatcctta catttaagca gcccctgaat gaaaaaaggg 1260

gtgcatggcc tacagcctat ttttcctctt ggtgtgctaa atagccattc acatctccag 1320

tgaagcaaaa tatagacagt ggtgaaatca cctctgcaca tggcatggca tgggctggca 1380

caggatggca tagtggcatg gggtgtctgc cccatttttg caggcttatt gaggtggggc 1440

atgttgtgct atgcatccac acaggaattg taattagagg ttacaagaca cgtccttcaa 1500

agctgttatt tataagattg ctaaatccct ggtgatcaca ttcatcaaag ctttataaag 1560

agaggctcat tccttcctct tggtctcagc agcttcaggg cgacacgaca atgtcaacca 1620

aagccatggg catattcctc ctgtttcttg ttctcctggc agtaccccag gctgcaccag 1680

gtaagcgtaa atataatcaa aggtcatttt tatgtttggg aaacagggaa ctgttctgca 1740

aatgaagaat gaactcatgg cacattgacg tgatgcttgg tgctggatct ggtagacgag 1800

tgttgagtag gcaaactctg gttggcactt tcagggctgg aggggagaac ctcacaatct 1860

gcaactcatg aatgctttca gacatggcag caaaactcaa cagtgggttc acgttcctct 1920

tgctgaactg acctgtgcta cctgcaggct gagctggtag catggagacc agccttcttc 1980

acacttggaa atccaatgga agagtctcac aggttctttt tctccattac agagtcggac 2040

actgtcacat gtcggaagat gaagggcaag tgttcgttct tgctgtgtcc tttcttcaag 2100

agatccagtg gtacctgcta caatggactg gcaaagtgct gcagaccctt ttggtgacat 2160

tccgtggtct gtgttgagct ggtagccttg gtggtgtcat tagcagcgac agcagtagtg 2220

tagcatggtt cttccctatg cagccatgct gttgtttggg gtgctgctat ccctggtgct 2280

ggggaaggca ctttggcagg aagcctcacg tctgctcttc gtccgtggat ccacacctgg 2340

ggaatcactg ctctcctcat cccctggatg ctgcccctct gccatcacca aggcagggtt 2400

gagctgtgtg cctgaaatgg gacaactcct ctgttttcca aagatgtttc ttgttgggaa 2460

tttcccactt gtgtcaaggg cagtgccatt tgtcccatgc gatgcagagg cgccccagca 2520

gacctcacac acccaacata ctgtcctgtg acagctgccc acagagcctc aagggccaca 2580

tccaatttag gaggctcatg tctattaacc tgccttcctt cttcatgcag tattttctga 2640

acagatgtgt gaatgtgaaa tatcaccctc atcttccttt cttcactgta ggatctctct 2700

tcttttcttt taggccctaa atttcctcac atcccctttt aaatgtcttg gctgaaggct 2760

tttatcttcc acctgtttca ttccacatca tggccaactc ctatctgccc tctattgtga 2820

cccagctgga cgctgaagtc ttctgctctc ctgcaagctc tgaacaatag ctcagcctta 2880

caaagtagaa gtgatctgtg ctctttttct cttctgtaac atgtattcaa agagcctact 2940

ctgcaacttg tttgacttgt gtaaatacct aataaagcac gggtaataac gctaggcttt 3000

<210> 4

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

ggatttccca gtctgccttc 20

<210> 5

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

tgcaagaaga gaccatttcc a 21

<210> 6

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

aaaggaacct gccctgtttt 20

<210> 7

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

gcactgcaaa ggtaggtggt 20

<210> 8

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

tgcatccaca caggaattgt 20

<210> 9

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

atagcagcac cccaaacaac 20

<210> 10

<211> 28

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

ggggcgggga cccctgggaa atgccctc 28

<210> 11

<211> 29

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

ggggcggggc ccaggtaagc attcccata 29

<210> 12

<211> 29

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

ggggcggggg cttctgctcc cacaagtca 29

<210> 13

<211> 28

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

ggggcgggga tccctggagg acacgacc 28

<210> 14

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

ggggcggggc gttcttgctg tgtcctttct t 31

<210> 15

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 15

ggggcgggga ggtaccactg gatctcttgt 30

<210> 4

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

tacaacttgc atacgacata gg 22

<210> 5

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

ttcatctcca tccatcataa cc 22

<210> 6

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

ttgcttgacc gtcgttgtg 19

<210> 7

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

tttctcctcc ctccctttct ct 22

<210> 8

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

cagtgcttat tcacaatgga 20

<210> 9

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

gttcataggg atctttaggc a 21

<210> 10

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

agagaagaga gatgtggttg gtttg 25

<210> 11

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

gtcgcagaat gtggcaagaa 20

<210> 12

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

aagcgactac caaaacacac aca 23

<210> 13

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

gtcagtacag ccagagccag aa 22

<210> 14

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

agctggaact tgacccagag a 21

<210> 15

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 15

acaccaaatc ggcagtcctt 20

<210> 16

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 16

atggcaactt acatgtcaac gattc 25

<210> 17

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 17

ttgtgtaacc ttggaacgcg c 21

<210> 18

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 18

ggagttctag actcaatggt tcagt 25

<210> 19

<211> 27

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 19

accaactcta tagtgcttaa tgtcaga 27

<210> 20

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 20

ggtattcctg ggcatgtcct g 21

<210> 21

<211> 24

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 21

ctgatgccgc acattatatt cttc 24

<210> 22

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 22

gccaaatcac tcatgagagg tttaa 25

<210> 23

<211> 26

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 23

ttgctctaca acaacatcat gatcaa 26

<210> 24

<211> 24

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 24

gctaaacatt ctgcgtggat gtat 24

<210> 25

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 25

ttgatggtgc acttcataag tatcg 25

<210> 26

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 26

ggaaatgaca caatcgatgc ag 22

<210> 27

<211> 26

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 27

cagttcttga ctccaagtag agtatg 26

<210> 28

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 28

agagtttgat cctggctcag g 21

<210> 29

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 29

aaggaggtgg tgatccagcc gca 23

Claims (7)

1. a kind of genetic test of anti-salmonellosis of chicken marks, which is characterized in that 3 phylaxin genes of the chicken it is two-way etc. Position gene specific PCR label；The genetic test of the AvBD4 marks, and has held 1559 labeled as sequence 5 ' shown in SEQ ID No.1 The C or T of position SNP；AvBD5 has held the G or A of 798 SNP labeled as sequence 5 ' shown in SEQ ID No.2；AvBD14 is labeled as Sequence 5 ' shown in SEQ ID No.3 has held the T or A of 2095 SNP.

2. it is a kind of using described in claim 1 utilize phylaxin gene detection Salmonella gallinarum susceptible genotype detection method, It is characterized in that, the detection method passes through detection phylaxin gene AvBD4, the two-way allele specific of AvBD5, AvBD14 PCR (Bi-PASA) label determines the Salmonella gallinarum susceptible genotype of chicken and resists genotype.

3. utilizing the detection method of phylaxin gene detection Salmonella gallinarum susceptible genotype, feature as claimed in claim 2 Be, the detection method specifically includes: the homozygous genotype TT and CC of the Bi-PASA label of AvBD4 are susceptible genotype, miscellaneous Mould assembly TC is to resist genotype, and TT genotype is 845bp and 616bp2 segment, and CC genotype is 845bp and two pieces of 229bp Section, TC genotype are 845bp, 616bp and 22bp3；The AG genotype and GG genotype of the Bi-PASA label of AvBD5 are sand Door Salmonella resist genotype, AA genotype be salmonella susceptible genotype, frequency of genotypes AA be 519bp and 1132bp2 segment, GG type is 647bp and 1132bp2 segment, and genotype AG is 519bp, 647bp and 1132bp3 segment；The Bi- of AvBD14 The AT of PASA label is that salmonella resists genotype, and AA genotype and TT genotype are salmonella susceptible genotype, gene Type AT be 819bp, 644bp and 175bp3 segment, AA type be 819bp and 644bp2 segment, genotype TT for 819bp with 175bp2 segment.

4. special as claimed in claim 3 using the detection method of phylaxin gene detection Salmonella gallinarum susceptible genotype Sign is that AvBD4 gene Hap5 and Hap18 are salmonella resistance types, and Hap15 is the susceptible type of salmonella, wherein Hap5's The SNP group that SNP group is combined into C T A G C A G A C T G G T C A, Hap18 is combined into C T A G C A A A C T G The SNP group of G T C A, Hap15 are combined into C T T G C A A A C T G A C C A；AvBD5 gene Hap10 is Salmonella The susceptible type of bacterium, wherein the SNP group of Hap10 is combined into C G G T G A C G T AA T G A T T C A T A；AvBD14 base Because Hap7 is salmonella resistance type, Hap18 is the susceptible type of salmonella, wherein the SNP group of Hap7 is combined into C A C T T C The SNP group of A C C T A G G C A G T T G, Hap18 are combined into T T C A T T G C C T A T G C A G T C C。

5. a kind of primer for identifying 3 phylaxin gene detection labels of chicken described in claim 1 and detection label, feature exist In the nucleotide of the primer is No.4~9 SEQ ID；Two-way allele specific pcr (Bi-PASA) label of AvBD4 Identify the identification base that the two-way allele specific pcr (Bi-PASA) that base is SEQ ID No.10~11, AvBD5 marks The identification base marked for the two-way allele specific pcr (Bi-PASA) of SEQ ID No.12~13, AvBD14 is SEQ ID No.14~15.

6. a kind of kit comprising primer described in claim 5 and detection label.

7. a kind of chicken selection of the genetic test of Salmonella gallinarum resistance as described in claim 1.