WO2009005178A1 - Microarrays for detection and identification of microorganisms associated with periodontal diseases and method for diagnosis of infectious oral diseases using the microarray - Google Patents

Microarrays for detection and identification of microorganisms associated with periodontal diseases and method for diagnosis of infectious oral diseases using the microarray Download PDF

Info

Publication number
WO2009005178A1
WO2009005178A1 PCT/KR2007/003246 KR2007003246W WO2009005178A1 WO 2009005178 A1 WO2009005178 A1 WO 2009005178A1 KR 2007003246 W KR2007003246 W KR 2007003246W WO 2009005178 A1 WO2009005178 A1 WO 2009005178A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
genus
spiecies
microarray
oligonucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2007/003246
Other languages
French (fr)
Inventor
Cheol Min Kim
Hyun Jung Jang
Young Mi Choi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University Industry Cooperation Foundation of Pusan National University
GENEIN Co Ltd
Original Assignee
University Industry Cooperation Foundation of Pusan National University
GENEIN Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Industry Cooperation Foundation of Pusan National University, GENEIN Co Ltd filed Critical University Industry Cooperation Foundation of Pusan National University
Priority to PCT/KR2007/003246 priority Critical patent/WO2009005178A1/en
Priority to KR1020107000177A priority patent/KR20100061438A/en
Publication of WO2009005178A1 publication Critical patent/WO2009005178A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips

Definitions

  • the present invention relates to a method for detection and identification of periodontal disease-causing infectious bacteria and a method for diagnosis of oral disease using the same. More particularly, the present invention relates to a microarry comprising at least one of gram positive bacteria-specific and gram negative bacteria- specific oligonucleotides, periodontal disease-causing bacteria's genus-specific and species-specific oligonucleotides designed from the ITS target region which is hypervariable, and all kinds of bactera's universal oligonucleotides designed from 23S rDNA which is conserved, a method for detection and identification of periodontal disease-causing bacteria, and a kit for diagnosis of infectious oral disease using the microarray.
  • the oral cavity is like a gate that provide a human body with energy, so immediately reflects state of health.
  • oral bacteria causing oral disease make an invasion upon a blood vessel and arrive at other parts of body through blood, and cause heart disease, a stroke, glycosuria, premature birth, birth of underweight baby((Jin LJ, et al., Hong Kong Med J. 9:31-37(2003), Pennisi E, Science, 307:1899-
  • the periodontal disease among the oral disease is divided into gingivitis and periodontitis, and is inherent in about 7 ⁇ 16% of adults ((Tendera AB, Patnet application 10-2006-7017584(2006), Jin LJ, et al., Hong Kong Med J. 9:31-37(2003)). Like this, the periodontal disease is univeral disease but is called silent disease because the peaple feel so good before being in a bad state of health like shaking teeth.
  • the periodontal disease one of the most general infectious disease of human, destroys tissues supporting teeth including alveolar bone by bactera((Jin LJ, et al., Hong Kong Med J.
  • the periodontal disease has an effect on one more teeth, and develops when bactera in plaque cause an inflammation to gingiva.
  • the gingiva disease developing in early stage of the periodontal disease make gingiva swll up.
  • the periodontal disease differs from other infectious diseases because the periodontal disease develops when bacteria in the host is out of balance(Shay K, Clin Infect Dis. 34:1215-1223(2002)).
  • the pulp and periapical Diseases, and periodontal disease cause the oral disease and the periodontal disease play a importnat role in the change of body state((Kwak JS, et al., J Kor Acad Cons Dent, 30:335-343(2005)).
  • the influencial bacteria causing the paradenitis is reported as anaerobic bacteria((Bascones-Martinez A and Figuero-Ruiz E, Avances en Periodoncia, 3:111- 118(2005)). At least 500 species were identified in periodontal pockets. But Table 1 shows that only some species of bactera is related with the paradentitis((Slots J, J Periodontol. 75:1553-1565(2004)). Only 50% of bactera existing in the oral was successfully cultured and used to clarify if it is the cause of the oral disease.
  • Porphyromona s Prevotella Campylobacter Gram-negative gingivalis intermedia rectus enteric rods
  • the periodontal disease is divided into chronic periodontitis and aggressive periodontitis by the bactera. If the chronic periodontitis develops, spirochete increase and 90% anaerobic bacteria and 75% gram-negative bacteria exist in a dental plaque. Porphyromonas gingivalis, Campylobacter rectus, Eikenella corrodens, Fusobacterium nucleatum, Actinobacillus actinomycetemcomitans, Peptostreptococcus micros, Treponema denticola, Eubacterium nodatum, Prevotella intermedia, Tannerella forsythensis, Selenomonas noxia and so on belong to the causing bactria.
  • microarray tecnique makes many types of pathogenic bactera be analyzed at once as one microarray and many genes of many bactera be analyzed at once((Park H, et al., J Clin Microbiol. 43:1782-1788(2005), Warsen AE, Appl Environ Microbiol. 70:4216-4221(2004), Sergeev N, et al., Biosens Bioelectron. 20:684-98(2004)).
  • the micraarray can detect many types of species at once and be especially used in study associated with doouble infection and microbial ecology.
  • the microarray is the standard showing comprehensive characteristics((Smoot LM, et al., Adv Dent Res. 18:6-11(2005), Vianna ME, et al., Oral Microbiol Immunol. 20:253-258(2005), Kim JH, et al., J Kor Acad Cons Dent, 28:178-183(2003), Lee YJ, et al., J Kor Acad Cons Dent, 30: 409-422(2005)). Vianna ME et al.
  • microarray using target probe based on 16S rDNA base sequencethat to detect bacteria associated root canal, is hard to culture by traditional culturing method((Vianna ME, et al., Oral Microbiol Immunol. 20:253-258(2005)).
  • Smoot LM et al. used DNA microarray to show characteristics of oral microbial colony((Smoot LM, et al., Adv Dent Res. 18:6- 11(2005)).
  • the microarray can be used to detect and analyze not only many aerobic pathogenic bacteria but also oral microorganism and used as clinical medicine.
  • the choosing and designing of probe is important for detecting species of many pathogenic bactera at once. That is, selecting gene comprised of both genus- specific conserved region and species-specific hyvariable region as taget gene for detecting genus-specific and species-specific bacteria is important((Gilbert GL, Trends MoI Med. 8:280-287(2002)).
  • the polymorphism of target gene make molecular biological analysis speedy and perfect through speedy and perfect design((Park H, et al., J Clin Microbiol. 43:1782-1788(2005)).
  • the 16S rDNA of which base sequences are already opened through public nucleoteice database is selected as a target region to detect bacteria by using molecular biological analysis in many papers((Baker GC, et al., J Microbiol Methods,
  • the new detecting method using 23S rDNA base sequences can only detect some different bactera or some species belonging to one genus ((Anthony RM, et al., J Clin Microbiol, 38:781- 788(2000), Dunbar SA, et al., J Microbiol Methods, 53:245-252(2003), Mitterer G, et al., J Clin Microbiol, 42:1048-1057(2004)).
  • ITS internal transcribed spacer region
  • 16S rDNA base sequences
  • ITS exists between 16S rDNA and 23S rDNA and contains two characteristic regions: the conserved region differenciated in genus level and the hypervariable region differenciated in species level (Kuwahara T, et al., Microbiol Immunol. 45:191- 199(2001 ), Conrads G, et al., lnt J Syst Evol Microbiol. 52:493-499(2002), Park H, et al., J Clin Microbiol.
  • the hypervariable region is the proper target region for detecting bacteria species.
  • the present invention provides genus-specific and species-specific oligonucleotides for detecting periodontal disease-causing aerobic and anaerobic bacteria, targeting ITS having both hypervariable region and conserved region.
  • Another object of the present invention is to provide a microarray comprising the present oligonucleotides as probes for detection and diagnosing of periodontal disease-causing bacteria.
  • Another object of the present invention is to provide a microarray comprising the present oligonucleotides as probes for detection and diagnosing of oral disease-causing bacteria.
  • Another object of the present invention is to provide a method for identification and detection of oral disease including periodontal disease-causing bacteria by using the miroarray.
  • Another object of the present invention is to provide a kit for identification and detection of oral disease including periodontal disease-causing bacteria by using the microarray.
  • the present invention provides target DNAs for detection and identification of bacteria, comprising any one of one base sequence selected from SEQ ID Nos. 1 to 8 or its partial sequence.
  • target DNAs are designed from ITS regions of 6 kinds of bactera, which have importantance in a clinical study but their base sequnces have been unknown.
  • the target DNA can to be used for designing primer or probe detecting the bactera.
  • the present invention provides an oligonucleotide for gram positive-specific identification of microorganisms associated with periodontal diseases, comprising any one sequence selected from SEQ ID Nos. 10 to 11 or its complementary sequence.
  • the present invention provides an oligonucleotide for gram negative-specific identification of microorganisms associated with periodontal diseases, comprising a sequence of SEQ ID Nos. 12 or its complementary sequence.
  • the present invention provides an oligonucleotide for genus-specific identification of microorganisms associated with periodontal diseases, comprising any one of one base sequence selected from SEQ ID Nos. 13 to 32 or its complementary sequence.
  • the present invention provides an oligonucleotide for species-specific identification of microorganisms associated with periodontal diseases, comprising any one of one base sequence selected from SEQ ID Nos. 33 to 68 or its complementary sequence.
  • the oligonucleotides of the present invention are designed based on multiple sequence alignment of ITS (internal transcribed spacer) hypervariable sequences of bacteria.
  • the oligonucleotides have specificity to the gram positive and gram negative bacteria, and can be used as primers for PCR amplification or probes for hybridization in order to specifically detect genus and species of the bacteria.
  • the present invention provides a gram positive-specific and gram negative-specific probe set
  • PCT/KR2006/0002307 a genus-specific and species-specific probe set for detection of microorganisms associated with periodontal diseases, comprising more than one oligonucleotide selected from the above oligonucleotides.
  • the present invention provides a kit for diagnosing gram positive-specific and gram negative- specific microorganisms associated with periodontal diseases and genus-specific and species-specific microorganisms associated with periodontal diseases, comprising more than one oligonucleotide selected from the above oligonucleotides.
  • the oligonucleotides may be labeled with radioactive or non-radioactive labeling agent, the latter comprises conventional biotin, Dig(digoxigenin), FRET(fluorescence resonance energy transfer) and fluorescent dye
  • oligonucleotides can be used as primers or probes and the kit can comprise another primers for PCR amplification of the target DNA.
  • the present invention provides a microarray comprising more than one oligonucleotide selected from oligonucleotides for gram positive-specific and gram negative-specific detection and genus-specific and species-specific detection of microorganisms associated with periodontal diseases, as the probes attached on a support.
  • the universal oligonucleotide designed on the basis of 16S rDNA and 23S rDNA by Kim CM, et al and oligonucleotide designed for distinction of gram-positive and gram-negative bacteria by
  • the probes may be any materials having base sequence of the above oligonucleotides, preferably any one selected from a group consisting of DNA (Deoxyribose Nucleic Acid), RNA (Ribosse Nucleic Acid), and nucleic acid analogues selected from PNA (Peptide Nucleic Acid), LNA (Locked
  • nucleic acid analogues is stable to enzymes such as nuclease, has structurally specific interaction with base sequence, and has advantage of stability in heat. That is, a characteristic of the oligonucleotides is the base sequence. Because the characteristic of oligonucleotides is the base sequence hybridized with the target base, the oligonucleotides can include nucleic acid analogues having above base sequence.
  • the probes can be manufactured for sense or antisense of the oligonucleotides. Therefore, the oligonucleotides have base sequence of the SEQ ID Nos. or its complementary sequence.
  • the probes can further include QC probe for quality control of the microarray (Cheolmin Kim, et al., KR Pat. No. 10- 0590901(2006), Jang HJ, et al., J Clin Microbiol., 42:4181-4188(2004), Cheolmin Kim, et al., KR Pat. No. 10-0650162, (2006)).
  • the QC probe is an oligonucleotide which has a base sequence complementary to target sequences or any base sequence and which is labeled with a fluorescent material having an excitation/emission wavelength from that of a fluorescent material labeled on target.
  • the scanning of fluoresecent signal radioating before or after hybridization stage can illustrate whether probes are fixed to support or not and hybridized to target gene or not, and verify the formation and density of probes fixed to support and the hybridization between the probes and target gene without spectral interference.
  • the support may be made of any one selected from a group consisting of slide glass, plastic, membrane, semiconductive chip, silicon, gel, nano material, seramic, metal material and optical fiber or those mixture.
  • the microarray of the present invention can be manufactured using conventional method such as a pin microarray (Microarray printing technology, Don Rose, Ph.D., Cartesian Technologies, Inc., Anal Biochem, 320(2):281-91 (2003)), a ink jet (Nat Biotech, 18;438-441(2000), Bioconjug Chem,13(1 );97-103(2002)), photolithography (Cur Opinion Chem Biol, 2;404-410(1998), Nature genetics supplement, 21 :20-24(1999)) or a electric array method (Ann Biomed Eng. 20(4):423- 37(1992), Psychiatric Genetics, 12;181-192(2002)).
  • the microarray of the present invention may further comprise an extraction agent for isolating target DNA, a PCR kit containing primers for amplifying target gene, a hybridization reaction buffer, a washing solution for the un hybridized DNA, a cover slip, dyes, a washing solution for unbound dyes and a description sheet for the microarray, except for the microarray of the present invention.
  • the present invention provides a method for detection and identification of microorganisms associated with periodontal diseases, comprising the following steps: a) purifying nucleic acids from a sample; b) amplifying target DNA among the purified nucleic acid; c) hybridizing the amplified target DNA with probes of the microarray according to the present invention; and d) detecting signals generated from the formed hybrid.
  • the probe may further comprise the QC probe which can control the quility of all stages icuding hybridizing.
  • the step b) for amplifying target DNA can be performed using Hot-start PCR, Nested PCR, Multiplex PCR, RT- PCR (reverse transcripase PCR), DOP (degenerate oligonucleotide primer) PCR, Quantitive RT-PCR, In-Situ PCR, Micro PCR, modified PCR such as Lab-on a chip PCR and isothermal amplification method such as RCA (rolling circle amplification) as well as general PCR reaction.
  • the detection method of the present invention can be performed using probe amplification or signal amplification reaction such as tyramide signal amplification, nanoparticle probe, Raman-active dye and branched DNA((Karsten SL, et al., Nucleic Acids Res.
  • probe amplification or signal amplification reaction such as tyramide signal amplification, nanoparticle probe, Raman-active dye and branched DNA((Karsten SL, et al., Nucleic Acids Res.
  • the purifying step a) can be performed using conventional DNA or RNA purification method or kit.
  • the amplifying step b) can be performed using conventional PCR method.
  • the detection of the PCR product can be performed using conventional electrophoresis wih agarose gel.
  • the signal detecting step d) can be performed using conventional fluorescence scanner after binding with conventional dyes such as Cy5 or Cy3.
  • a method for simultaneously genotying and detecting more than one microorganisms associated with periodontal diseases selected from a group consisting of the following members: universal microorganisms(patent application No.04-68313, SEQ ID NO: 46)( SEQ ID NO: 9 in the present invention); gram positive microorganisms(PCT/KR2006/000237, SEQ ID NO: 1 to 2)( SEQ ID NO: 10 to 11 in the present invention) and gram negative microorganisms(PCT/KR2006/000237, SEQ ID NO: 3)( SEQ ID NO: 12 in the present invention); genus Actinobacillus (SEQ ID NO: 13 to 14) and spiecies Actinobacillus (SEQ ID NO: 33 to 34); genus Actinomyces (SEQ ID NO: 15 to 16) and spiecies Actinomyces (SEQ ID NO: 35 to 36); genus Campylobacter (S
  • Treponema SEQ ID NO: 30
  • spiecies Treponema SEQ ID NO: 59
  • genus Veillonella SEQ ID NO: 31
  • spiecies Veillonella SEQ ID NO: 60
  • genus Propionibacterium SEQ ID NO: 32
  • spiecies Propionibacterium SEQ ID NO: 61
  • spiecies Leptotrichia buccalis SEQ ID NO: 50
  • spiecies Tannerella forsythia SEQ ID NO: 57 to 58. Therefore, the present invention provides a method for detecting gram positive- specific and gram negative-specific detection of bateria associated with periodontal disease and a method for detecting one or more bacteria species simultaneously.
  • the present invention provides a method for detection of bateria associated with periodontal disease using SBE (Single base extension), Sequencing, RFLP (Restriction fragment length polymorphism), or REA (Restriction endonuclease analysis) based on difference of one base sequence by using the oligonucleotides which is designed for gram positive-specific and gram negative-specific detection of periodontal disease-causing bacteria and for genus-specific and species-specific detection of periodontal disease- causing bacteria.
  • SBE Single base extension
  • Sequencing Sequencing
  • RFLP Restriction fragment length polymorphism
  • REA Restriction endonuclease analysis
  • the method for detecting existence of periodontal disease-causing bacteria and identifying gram positive-specific, gram negative, genus-specific and species- specific bacteria using the microarray of the present invention comprises the following steps: a) if necessary, purifying nucleic acids from a cultured or clinical sample; b) if necessary, amplifying the target sequence of bacteria or its part using more than one proper primers; c) hybridizing the amplified target DNA with probes having a sense or antisense or complementary sequence of genus-specific and species-specific oligonucleotides and gram positive-specific and gram negative-specific oligonucleotides of periodontal disease-causing bacteria, disclosed in Tables 2 and 4; d) detecting signals generated from the formed hybrid; and e) predicting the existence of the periodontal disease-causing bacteria in the sample.
  • the probes in the c) step, have a diversity of probe composition and more than one probes.
  • the probes are optimized to simultaneously hybrid with its target region under the same hybrid and washing condition which can detect gram positive and gram negative bacteria and genus and species of the periodontal disease- causing bacteria at once.
  • the present invention provides a microarray comprising probes set for detecting gram positive-specific and gram negative-specific bacteria and genus and species of the periodontal disease-causing bacteria attached on the support, which can simultaneously detect gram positive and gram negative bacteria and identify genus and species of the bacteria as quickly and exactly as passible from only one experiment of a sample.
  • FIG. 1 shows the target region for detecting bacteria in biological sample and the location of primers for amplifying the target region and probes.
  • FIG. 1 shows the
  • ITS region comprising genus level conserved region and hypervariable region, the location of primers common to bacteria which can amplify the ITS region, the location of gram positive or gram negative-specific probes and genus-specific or species- specific probes of periodontal diseases-causing bacteria designed by present inventor.
  • Peptostreptococcus micro TAGTTTTATCACTGTTTTTTTGGTTCATATTTTTTT
  • Pantoea agglomerans GGGGAACCTGCGGTTGGATCACCTCCTTACCTGAAG
  • ITS ATACCTTCCCGCGCAGTGTCCACACAGATTGTCTGA : type 1 TAAAAAGTAACGAGCAGAAAAAACCACTACAGGCTT
  • ITS TTGTCTGATGAAAATGTAGCAGTAAAAAATCTCTGC : tyre 1 AGGCTTGTAGCTCAGGTGGTTAGAGCGC ⁇ CCCCTGA
  • ITS TTGTCTGATAGATGTAAAGAAGCAAGACGGCTGCGA : tyre 2 AGTCGCGACACCTCGTGTCCCCTTCGTCTAGCGGTT
  • New genus-specific oligonucleotides for detecting periodontal disease-causing bacteria developed in the present invention are as shown in Table 3. [Table 3] New probes for bacteria genus-specific detection of periodontal disease-
  • New species-specific oligonucleotides for detecting periodontal diseases- causing bacteria developed in the present invention are as shown in Table 4.
  • FIG. 1 shows location of tartet region, primers and probes used for amplifying aerobic and anaerobic periodontal disease-causing bacteria.
  • FIG. 2 shows results of PCR amplification of the target by primer designed for bacteria-specific base sequence.
  • FIG. 3 show a microarray comprising a probe set consisting of bacteria universal probes and genus-specific and eriodontal disease-specific probes for detecting bactera associated with periodontal disease, attached on a support.
  • FIG. 4 shows results of hybridization reaction of bacterial common probes and genus-specific and species-specific probes for Actinomyces viscosus and Peptostreptococcus micros among periodontal disease-causing bacteria.
  • FIG. 5 shows results of hybridization reaction of bacterial common probes and genus-specific and species-specific probes for Actinomyces viscosus and Peptostreptococcus micros among periodontal disease-causing bacteria.
  • FIG. 6 shows results of hybridization reaction of bacterial common probes and gram negative-probes and genus-specific and species-specific probes for Actinobacillus actinomycetemcomitans among periodontal disease-causing bacteria.
  • FIG. 7 shows a microarray comprising a probe set consisting of bacteria universal probes, gram-positive and gram-negative probes and genus-specific and species-specific probes attached on a support for more specific detection of the periodontal disease-causing bacteria, as one support.
  • FIG. 8 shows results of analyzing state of spot were analyzed with laser scanner after 1 :1 mixture of the QC probes and the negative control probes were fixed to the slide.
  • FIG. 9 shows results of hybridization reaction of bacterial common probes and gram negative-specific probes and genus-specific and speies-specific probes for Porphyromonas gingivalis of gram-negative bacteria related with the periodontal disease.
  • FIG. 10 shows results of hybridization reaction of bacterial common probes and gram negative-specific probes and genus-specific and speies-specific probes for Pantoea agglomerans among periodontal disease-causing bacteria.
  • Example 1 Incubation of Bacteria and isolation of Genomic DNA
  • ATCC American Type Culture Collection
  • KCTC Korean Collection for Tpe Cultures
  • the strains were selected in each culturing media under each culturing conditions according to manual provided by ATCC and KCTC. And the present inventors obtained many clinical specimens through network with General University Hospitals in pusan, Gyeongsangnam-do. From the cultured media, strain colonies were obtained with a white gold ear and input 1.ml tube, 10OuI of InstaGene matrix (Bio-Rad, USA) was added thereto and suspended, and reaction was performed at 56 0 C for 30 minutes in constant temperature bath.
  • the reactant was shook for 10 seconds, heated at 100 0 C for 8 min, shook again for 10 sec, centrifuged at 12,000 rpm for 3 min, recovered DNA.
  • the extracted DNA is storaged in a freezer at -20 0 C .
  • All probes used for detection of microorganisms associated with periodontal diseases is confirmed specificity of probes by multiple alignment and BLAST searching as selecting ITS target base sequence of microorganism associated with periodontal diseases published in Genbank.
  • the genus-specific probes of microorganism associated with periodontal diseases is only complementary in each genus, is selected from base sequence having very lower similarity to genus of other genus (length: 15-25 mer).
  • the species-specific probes is selected from base sequence having very lower similarity to polymorphism of other species.
  • Designed genus and specis-specific probes were standed for in Table 3 to Table 4. Above all probes can be used as not being limited in base sequence of Tabel 2 to Table 4 but being designed primers and probes consisted of base sequence comprising it.
  • Primer is designed as a state labeling biotin and Primer for DNA chip is designed as a state labeling biotin at 5'. PCR were carried out in follow condition.
  • Reaction composition is added to water to be 25ul of total volume after adding 10 0 C PCR buffer(100 mM KCI, 20 mM Tris HCI (pH 9.0), 15 mM MgCI 2 ) 5 /d, dNTP(deoxynucleoside triphosphates) mixture (dATP, dGTP, dTTP, and dCTP each 10 mM) 1 ⁇ &, forward and backward primers (each 10 pmole) each 1 ⁇ i, Taq polymerase (5 units//"*, QIAGEN, Inc., Valencia, USA) 0.2 ⁇ i, template DNA 4 ⁇ &.
  • 10 PCR buffer 100 mM KCI, 20 mM Tris HCI (pH 9.0), 15 mM MgCI 2 ) 5 /d
  • dNTP(deoxynucleoside triphosphates) mixture dATP, dGTP, dTTP, and dCTP each 10 mM
  • Reaction condition is denaturation at 94 0 C for 3 minutes, denaturation at 94 0 C for 1 minute.
  • Annealing reaction is carried out at 50 0 C for 1 minute, extension reaction is carried out at 72 0 C for 1 minute, and we repeated 30 times these process.
  • PCR products amplified through the procedure described in Exemple 3 were analyzed by performing A gel electrophoresis.
  • the base sequences of target bacteria not to be included in existing public nucleotide data base were acquired by analyzing.
  • FIG. 2 shows the PCR results by using a pair of primers amplifying the target sequence for the bacterial-specific detection.
  • FIG. 2 shows the PCR products in approximately 800-1500 bp that is amplified with the forward primer 1387F and 1525F((Patenet Application 04-68313(2004), by the present inventors) designed by using the 16SrDNA gene and the reverse primer 389R and 520R designed by using the 16SrDNA gene and analyzed by performing a gel electrophoresis.
  • lane M is 100bp DNA ladder as a standard maker of molecular weight
  • lane N negative control group.
  • FIG. 2(a) is the PCR result of Porphyromonas gingivalis; lane 2-6 for the mixture of 16S-1387F and 23S-520R, lane 4 for ATCC 33277, lane 5 for ATCC 49417, lane 2,3,6 for clinical specimen. And, lane 1 is mixture of 16S-1525F and 23S-389R ATCC 49417, as a smaller than lane 5.
  • ATCC 981 1 lane 2-5 for clinical specimen, lane 7-10 for Streptococcus sanguinis, lane 7 for ATCC 10556, lane 8-10 for clinical specimen, lane 1 1 for Treponema denticola ATCC 95404, lane 12 for Veillonella parvula ATCC 10790, lane 13 for clinical specimen, and lane 14 for Propionibactehum acnes ATCC 6919.
  • FIG. 2(d) lane 1 for Fusobacterium periodonticum ATCC 33693, lane 2-4 for clinical specimen F. periodonticum, lane 6 for Campylobacter concisus ATCC 33237, lane 7 ⁇ 8 for clinical specimen C. concisus, lane 9 for Enterococcus faecalis ATCC 19433, and lane 11 ⁇ 14 for Pantoea agglomerans.
  • the bacterial-specific PCR product are amplified by using each pair of specific primers, discriminating primaraily other microorganism such as human DNA and viral DNA. This enables a rapid and precise diagnosis and reduces a diagnostic cost.
  • the proes designed in Example 2 were synthesized to retain a dT spacer having amine-modification and C6-15 bases at the ⁇ '-terminus and 15-25 nucleotides.
  • the genus-specific and species-specific probes developed in the present invention are the base sequence 13 to 68 of table 3,4. All kinds of bactera-specific((Kim Cheol Min,
  • the target probes designed in Exemple 5 were diluted to 5-100 pmol, were added 1-100 pmol Qc probe designed in Exemple 6 and Micro-spotting solution or 3*
  • the probes were attached onto a slide glass substate by using a Microarryer(Cartesian Technologies, PLXSYS 7500 SQXL Microarryer, USA). Two spots per one kinds of probe were attached the supports, then, the resulting microarray was placed in a slide box at a room temperature for 24 hours or incubated with a dry oven at 50 0 C for about 5 hours to fix the probes.
  • a Microarryer Cartesian Technologies, PLXSYS 7500 SQXL Microarryer, USA. Two spots per one kinds of probe were attached the supports, then, the resulting microarray was placed in a slide box at a room temperature for 24 hours or incubated with a dry oven at 50 0 C for about 5 hours to fix the probes.
  • Example 9 Washing of unfixed probes In order to remove probes remained not to react onto the slide finished quility examination by Exemple 9, what is mentioned below was performed.
  • the microarray was washed out by using 0.2% SDS(sodium dodecyl sulfate) at a room temperate and then, washed by usig distilled water. After, the resulting microarray was put in sodium borohydride(NaBH4) for 5 minutes then, washed at 100 0 C . Again, the resulting microarray was washed out by using 0.2% SDS(sodium dodecyl sulfate) and distilled water then, surface of substrate was dried completely with the centrifuge.
  • Example 10 Hybridization
  • the biotin-labeled target products prepared in Example 3 were thermally treated to be denaturated in to single strands and cooled to 4.
  • reaction solution containing Cy5- streptavidin or Cy3- streptavidin(Amersham pharmacia biotech, USA) and 10ml or
  • Example 11 Washing of unspecific hybridized DNA
  • the cover slip was removed using a 2X SSC washing solution (300mm NaCI, 30mm Na-Citrate, pH 7.0), and the slide was washed with 2X SSC and then 0.2X SSC, followed by centrifugation to fully dry to the slide glass.
  • 2X SSC washing solution 300mm NaCI, 30mm Na-Citrate, pH 7.0
  • the hybridized result was scanned using a non-confocal laser scanner (GenePix 4000Am, Axon Instruments, USA) and analyzed by image analysis.
  • FIG. 3 show a microarray comprising a support, as a probe set, consisting of bacteria universal probes for detecting microorganism associated with periodontal diseases and genus-specific and species-specific probes.
  • the microarray can designe two and more microarrays as one support, so The microarray can analyze a number of samples for a short time simultaneously.
  • FIG. 4 shows results of hybridization reaction for Actinomyces viscosus and Peptostreptococcus micros using mircoarray, and shows scan image of bacteria common probes (Patent No. 04-68313 SEQ ID NO. 9) and Actinomyces genus- specific (SEQ ID No. 15, 16) and A. viscosus species-specific probes (SEQ ID No. 36) and Peptostreptococcus genus-specific (SEQ ID No. 24) and P. micros species- specific probes (SEQ ID No. 52, 53) when double infected by two bactera.
  • FIG. 5 shows results of hybridization reaction for Staphylococcus saprophyticus using mircoarray, and shows scan image of bacteria common probes (Patent No. 04- 68313 SEQ ID NO. 9) and Staphylococcus genus-specific (SEQ ID No. 26) and S. aureus species-specific (SEQ ID No. 56) probes.
  • FIG. 6 shows detection for the existence of periodontal diseases-causing bacteria, and shows microarray comprising a support, as a probe set, consisting of bacteria common probes, gram-positive and gram-negative probes and genus-specific and species-specific probes, and shows scan image of bacteria common probes (Patent No. 04-68313 SEQ ID NO. 9) and gram-negative-specific probes (PCT/KR2006/000237), (SEQ ID NO. 10) and Actinobacillus genus-specific probes (SEQ !D No. 13) and A. actinomycetemcomitans species-specific probes(SEQ ID No. 33).
  • FIG. 7 show a microarray comprising a support, as a probe set, consisting of bacteria universal probes for detecting bactera associated with periodontal disease (application No.04-68313), (SEQ ID No. 9) and gram-positive and gram-negative probes(PCT/KR2006/000237), (SEQ ID No. 10,1 1 ,12) and genus-specific and species- specific probes.
  • the microarrays can analyze a number of samples at once because two more than microarrays can be designed with one support.
  • FIG. 8 shows results of quility state of microarray using QC probes.
  • FIG. 9 shows results of hybridization reaction for Porphyromonas gingivalis using mircoarray checked the quility in Exemple 8, and shows scan image of bacteria common probes (Patent No. 04-68313 SEQ ID NO. 9) and gram negative-specific probes (PCT/KR2006/000237), (SEQ ID No. 10), Porphyromonas genus-specific probes (SEQ ID No. 25) and P. gingivalis species-specific probes (SEQ ID No. 55).
  • FIG. 10 shows results of hybridization reaction for Pantoea agglomerans using mircoarray, and shows scan image of bacteria common probes (Patent No. 04-68313 SEQ ID NO. 9) and gram negative-specific probes (PCT/KR2006/000237 SEQ ID NO. 10), Pantoea genus-specific probes (SEQ ID No. 23) and P. agglomerans species- specific probes (SEQ ID No. 51).
  • composition and layout of each probes can be changed because this is only tipical example of probes layout among new oligonucleotides designed in the present invention.
  • the present invention developed the miroarray and the diagnosis kit for detecting periodontal diseases-causing bacteria comprising any one selected from a group consisting of genus- and species-specific probes designed from ITS of base sequence hypervariable and conserved regions of the bacteria, and comfirmed its specificity.
  • the present invention can provide an antibiotics therapy for accurately removing infectious agent related to periodontal by detecting existence of periodontal -causing bacteria and identifying gram posive- and gram negative-bacteria and genus and species of the bacteria, at once.
  • the present invention can provide speedy and perfect microarry method, detect and care periodontal disease at the initial stage, and improve diverse diseases including Cardiovascular System disease caused by bacteria associated with periodontal disease.
  • microarray can be used for dianosis of oral microorganism because microarray can detect many microorganisms at once by using probe of high density.
  • Microarray makes many microoranisms detected at once. When dentist and clinical doctor detect pathogenic bacteria in oral, they can use microarray for improvement of diagnosis, prevention, and treatment.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a method for detection and identification of periodontal disease-causing infectious bacteria and a method for diagnosis of oral disease using the same. More particularly, the present invention relates to a microarry comprising at least one of gram positive bacteria-specific and gram negative bacteria- specific oligonucleotides, periodontal disease-causing bacteria's genus-specific and species-specific oligonucleotides designed from the ITS target region which is hypervariable, and all kinds of bactera's universal oligonucleotides designed from 23S rDNA which is conserved, a method for detection and identification of periodontal disease-causing bacteria, and a kit for diagnosis of infectious oral disease using the microarray. According to the present invention, the present invention can provide a speedy and perfect microarry method for detecting periodontal disease at the initial stage. Therefore, diverse systemic diseases including Cardiovascular System disease caused by bacteria associated with periodontal disease can be improved.

Description

Microarrays for detection and identification of microorganisms associated with periodontal diseases and Method for diagnosis of infectious oral diseases using the microarray
TECHNICAL FIELD
The present invention relates to a method for detection and identification of periodontal disease-causing infectious bacteria and a method for diagnosis of oral disease using the same. More particularly, the present invention relates to a microarry comprising at least one of gram positive bacteria-specific and gram negative bacteria- specific oligonucleotides, periodontal disease-causing bacteria's genus-specific and species-specific oligonucleotides designed from the ITS target region which is hypervariable, and all kinds of bactera's universal oligonucleotides designed from 23S rDNA which is conserved, a method for detection and identification of periodontal disease-causing bacteria, and a kit for diagnosis of infectious oral disease using the microarray.
BACKGROUND ART
The oral cavity is like a gate that provide a human body with energy, so immediately reflects state of health. Especially oral bacteria causing oral disease make an invasion upon a blood vessel and arrive at other parts of body through blood, and cause heart disease, a stroke, glycosuria, premature birth, birth of underweight baby((Jin LJ, et al., Hong Kong Med J. 9:31-37(2003), Pennisi E, Science, 307:1899-
1901 (2005), Xu P, et al., J Bacteriol. 189:3166-3175(2007)). The periodontal disease among the oral disease is divided into gingivitis and periodontitis, and is inherent in about 7 ~ 16% of adults ((Tendera AB, Patnet application 10-2006-7017584(2006), Jin LJ, et al., Hong Kong Med J. 9:31-37(2003)). Like this, the periodontal disease is univeral disease but is called silent disease because the peaple feel so good before being in a bad state of health like shaking teeth. The periodontal disease, one of the most general infectious disease of human, destroys tissues supporting teeth including alveolar bone by bactera((Jin LJ, et al., Hong Kong Med J. 9:31-37(2003)). The periodontal disease has an effect on one more teeth, and develops when bactera in plaque cause an inflammation to gingiva. The gingiva disease developing in early stage of the periodontal disease make gingiva swll up. The periodontal disease differs from other infectious diseases because the periodontal disease develops when bacteria in the host is out of balance(Shay K, Clin Infect Dis. 34:1215-1223(2002)). The pulp and periapical Diseases, and periodontal disease cause the oral disease and the periodontal disease play a importnat role in the change of body state((Kwak JS, et al., J Kor Acad Cons Dent, 30:335-343(2005)). The influencial bacteria causing the paradenitis is reported as anaerobic bacteria((Bascones-Martinez A and Figuero-Ruiz E, Avances en Periodoncia, 3:111- 118(2005)). At least 500 species were identified in periodontal pockets. But Table 1 shows that only some species of bactera is related with the paradentitis((Slots J, J Periodontol. 75:1553-1565(2004)). Only 50% of bactera existing in the oral was successfully cultured and used to clarify if it is the cause of the oral disease.
Relation between the periodontal bacteria and the paradentitis
Early Stage of
Very Strong Strong Moderate Investigation
Porphyromona s Prevotella Campylobacter Gram-negative gingivalis intermedia rectus enteric rods
ΛcUnobacilliis Dialister Pep to strep tococcus Pseudomonas species actinomycctcmconritans pneumosintes/ micros Dia lister invisus
Tannerella forsythensis Eubacterium Fusobacterium Staphylococcus
(=Bacteroides nodatum nucleatum species forsythus)
Spirochetes of acute Treponema Selenomonas noxia Enterococcus faecalis necrotizing gingivitis denticola Eikenella corrodens Candida albicans
Beta-hemolytic streptococci
The periodontal disease is divided into chronic periodontitis and aggressive periodontitis by the bactera. If the chronic periodontitis develops, spirochete increase and 90% anaerobic bacteria and 75% gram-negative bacteria exist in a dental plaque. Porphyromonas gingivalis, Campylobacter rectus, Eikenella corrodens, Fusobacterium nucleatum, Actinobacillus actinomycetemcomitans, Peptostreptococcus micros, Treponema denticola, Eubacterium nodatum, Prevotella intermedia, Tannerella forsythensis, Selenomonas noxia and so on belong to the causing bactria. gram- negative, capnophilic, a aneorobic bacillus, Actinobacillus actinomycetemcomitans, T.annerella forsythensis, Eikenella corrodens, Campylobacter rectus, Porphyromonas gingivalis belong to the bacteria causing aggressive periodontitis((Rhu In-Cheol, KRIBB CONFERENCE(2004), Lilian Edesi-Neuss, DISSERTATION(2005)).
And this anaerobic bacteria exists in several places of body as normal flora, sometimes causes strong infection. The specimen for cultuhng of anaerobic bacteria apts to be contaminated with normal flora. And the care of infectious disease caused by anaerobic bacteria is difficult beacause anaerobic bacteria apts to be mixed with aerobic bacteria((Shin HJ, et al., Korean J Clin Pathol, 19:70-77(1999)).
Up to recently, the classical culturing method, checkerboard DNA-DNA hybridization method, method using species-specific antibody, PCR using species- specific primer, 16S rDNA base sequencing method and so on have been used as becterial detection methods. But the conventional culturing method needs a lot of time, money, labor and proper invention environment for culturing sensitive anaerobic bacteria. The method using DNA probe and primer can detect not all bacteria but specific bacteria in a short time. Although techniques like clone library, quantitative PCR, and florescence in situ hybridization are beneficial, the techniques need a number of labor, and is difficult to be in general use for patient monitoring ((LM, et al., Adv Dent Res. 18: 6-11(2005), Lee YJ, et al., J Kor Acad Cons Dent, 30: 409- 422(2005), Eick S and Pfister WJ, Clin Periodontol, 29:638-644(2002), Shin HJ, et al., Korean J Clin Pathol, 19:70-77(1999)).
Especially, in case of the anaerobic bacteria, new technique detecting perfectly the anaerobic bacteria is demanded solve problems, slow seperation and detection caused by slow rate of growth, hard culturing condition and so on. The diagnosis and care throgh speed and perfect microbiological experiment stage influence formation of an incurable periodontitis and an aggravating periodontitis. The development of speedy and perfect diagnosis method is quite demended to quickly detect and diagnose the anaerobic bacteria including bacteria causing periodontal disease. ((LM, et al., Adv Dent Res. 18:6-11(2005), Eick S and Pfister WJ, Clin Periodontol, 29:638- 644(2002), Shin HJ, et al., Korean J Clin Pathol, 19:70-77(1999)). The method analyzing high-fidelity data by high-throughput format is demanded to characterize complex microorganic colony.
In case of genom, toxicity, mutation, single nucleotide polymorphism study and so on, the importance of microarrays inncluding DNA chip, oligonucleodite chip and so on tends to increase. The microarray tecnique makes many types of pathogenic bactera be analyzed at once as one microarray and many genes of many bactera be analyzed at once((Park H, et al., J Clin Microbiol. 43:1782-1788(2005), Warsen AE, Appl Environ Microbiol. 70:4216-4221(2004), Sergeev N, et al., Biosens Bioelectron. 20:684-98(2004)).
The micraarray can detect many types of species at once and be especially used in study associated with doouble infection and microbial ecology. The microarray is the standard showing comprehensive characteristics((Smoot LM, et al., Adv Dent Res. 18:6-11(2005), Vianna ME, et al., Oral Microbiol Immunol. 20:253-258(2005), Kim JH, et al., J Kor Acad Cons Dent, 28:178-183(2003), Lee YJ, et al., J Kor Acad Cons Dent, 30: 409-422(2005)). Vianna ME et al. acquired new data by microarray using target probe based on 16S rDNA base sequencethat to detect bacteria associated root canal, is hard to culture by traditional culturing method((Vianna ME, et al., Oral Microbiol Immunol. 20:253-258(2005)). Smoot LM et al. used DNA microarray to show characteristics of oral microbial colony((Smoot LM, et al., Adv Dent Res. 18:6- 11(2005)). Like above examples, the microarray can be used to detect and analyze not only many aerobic pathogenic bacteria but also oral microorganism and used as clinical medicine.
The choosing and designing of probe is important for detecting species of many pathogenic bactera at once. That is, selecting gene comprised of both genus- specific conserved region and species-specific hyvariable region as taget gene for detecting genus-specific and species-specific bacteria is important((Gilbert GL, Trends MoI Med. 8:280-287(2002)). The polymorphism of target gene make molecular biological analysis speedy and perfect through speedy and perfect design((Park H, et al., J Clin Microbiol. 43:1782-1788(2005)).
The 16S rDNA of which base sequences are already opened through public nucleoteice database is selected as a target region to detect bacteria by using molecular biological analysis in many papers((Baker GC, et al., J Microbiol Methods,
55:541-555(2003), Vianna ME, et al., Oral Microbiol Immunol. 20:253-258(2005), Harris KA and Hartley JC, J Med Microbiol, 52:685-691 (2003), Smoot LM, et al., Adv Dent Res. 18:6-1 1 (2005), Shang S, et al., Pediatr Res, 58:143-148( 2005)). But, it is difficult to detect bacterial species by using 16S rDNA because 16S rDNA have conserved base sequences and few nuleotide polymorphism. The new detecting method using 23S rDNA base sequences can only detect some different bactera or some species belonging to one genus ((Anthony RM, et al., J Clin Microbiol, 38:781- 788(2000), Dunbar SA, et al., J Microbiol Methods, 53:245-252(2003), Mitterer G, et al., J Clin Microbiol, 42:1048-1057(2004)).
Recentely several papers are publicated that analyze base sequences of ITS(internal transcribed spacer region) instead of 16S rDNA base sequences as target for detecting species of anaerobic bacteria and analyzing Systematics. ITS exists between 16S rDNA and 23S rDNA and contains two characteristic regions: the conserved region differenciated in genus level and the hypervariable region differenciated in species level (Kuwahara T, et al., Microbiol Immunol. 45:191- 199(2001 ), Conrads G, et al., lnt J Syst Evol Microbiol. 52:493-499(2002), Park H, et al., J Clin Microbiol. 38:4080-4085( 2000), Park H, et al., J Clin Microbiol. 43:1782- 1788(2005)). The hypervariable region is the proper target region for detecting bacteria species. But the papers executed with the anaerobic bactera as a destination stated about detecting bacterial species by PCR with primers designed for ITS region. According to above papers, detecting a number of bactera at once is impossible and sensitivity is shorter than microarray.
DETAILED DESCRIPTION OF THE INVENTION Technical Goal of the invention To solve the above problem, the present invention provides genus-specific and species-specific oligonucleotides for detecting periodontal disease-causing aerobic and anaerobic bacteria, targeting ITS having both hypervariable region and conserved region.
In addition, another object of the present invention is to provide a microarray comprising the present oligonucleotides as probes for detection and diagnosing of periodontal disease-causing bacteria.
In addition, another object of the present invention is to provide a microarray comprising the present oligonucleotides as probes for detection and diagnosing of oral disease-causing bacteria.
In addition, another object of the present invention is to provide a method for identification and detection of oral disease including periodontal disease-causing bacteria by using the miroarray.
In addition, another object of the present invention is to provide a kit for identification and detection of oral disease including periodontal disease-causing bacteria by using the microarray.
Disclosure of the Invention
In order to achieve the object of the present invention, the present invention provides target DNAs for detection and identification of bacteria, comprising any one of one base sequence selected from SEQ ID Nos. 1 to 8 or its partial sequence. Above target DNAs are designed from ITS regions of 6 kinds of bactera, which have importantance in a clinical study but their base sequnces have been unknown. The target DNA can to be used for designing primer or probe detecting the bactera.
In order to achieve another object of the present invention, the present invention provides an oligonucleotide for gram positive-specific identification of microorganisms associated with periodontal diseases, comprising any one sequence selected from SEQ ID Nos. 10 to 11 or its complementary sequence. In order to achieve another object of the present invention, the present invention provides an oligonucleotide for gram negative-specific identification of microorganisms associated with periodontal diseases, comprising a sequence of SEQ ID Nos. 12 or its complementary sequence.
In order to achieve another object of the present invention, the present invention provides an oligonucleotide for genus-specific identification of microorganisms associated with periodontal diseases, comprising any one of one base sequence selected from SEQ ID Nos. 13 to 32 or its complementary sequence. In order to achieve another object of the present invention, the present invention provides an oligonucleotide for species-specific identification of microorganisms associated with periodontal diseases, comprising any one of one base sequence selected from SEQ ID Nos. 33 to 68 or its complementary sequence.
The oligonucleotides of the present invention are designed based on multiple sequence alignment of ITS (internal transcribed spacer) hypervariable sequences of bacteria. The oligonucleotides have specificity to the gram positive and gram negative bacteria, and can be used as primers for PCR amplification or probes for hybridization in order to specifically detect genus and species of the bacteria.
In order to achieve another object of the present invention, the present invention provides a gram positive-specific and gram negative-specific probe set
(PCT/KR2006/000237) and a genus-specific and species-specific probe set for detection of microorganisms associated with periodontal diseases, comprising more than one oligonucleotide selected from the above oligonucleotides.
In order to achieve another object of the present invention, the present invention provides a kit for diagnosing gram positive-specific and gram negative- specific microorganisms associated with periodontal diseases and genus-specific and species-specific microorganisms associated with periodontal diseases, comprising more than one oligonucleotide selected from the above oligonucleotides.
In the kit of the present invention, the oligonucleotides may be labeled with radioactive or non-radioactive labeling agent, the latter comprises conventional biotin, Dig(digoxigenin), FRET(fluorescence resonance energy transfer) and fluorescent dye
(Cy5 or Cy3). And, the oligonucleotides can be used as primers or probes and the kit can comprise another primers for PCR amplification of the target DNA.
In order to achieve another object of the present invention, the present invention provides a microarray comprising more than one oligonucleotide selected from oligonucleotides for gram positive-specific and gram negative-specific detection and genus-specific and species-specific detection of microorganisms associated with periodontal diseases, as the probes attached on a support.
In the microarray of the present invention, the universal oligonucleotide designed on the basis of 16S rDNA and 23S rDNA by Kim CM, et al and oligonucleotide designed for distinction of gram-positive and gram-negative bacteria by
Kim CM, et al (KR Application No. 2004-68313, PCT/KR2006/000237) can be further provided at once. in the microarray of the present invention, the probes may be any materials having base sequence of the above oligonucleotides, preferably any one selected from a group consisting of DNA (Deoxyribose Nucleic Acid), RNA (Ribosse Nucleic Acid), and nucleic acid analogues selected from PNA (Peptide Nucleic Acid), LNA (Locked
Nucleic Acid) and HNA (Hexitol Nucleic Acid). The nucleic acid analogues is stable to enzymes such as nuclease, has structurally specific interaction with base sequence, and has advantage of stability in heat. That is, a characteristic of the oligonucleotides is the base sequence. Because the characteristic of oligonucleotides is the base sequence hybridized with the target base, the oligonucleotides can include nucleic acid analogues having above base sequence.
In the microarray of the present invention, the probes can be manufactured for sense or antisense of the oligonucleotides. Therefore, the oligonucleotides have base sequence of the SEQ ID Nos. or its complementary sequence. In the microarray of the present invention, the probes can further include QC probe for quality control of the microarray (Cheolmin Kim, et al., KR Pat. No. 10- 0590901(2006), Jang HJ, et al., J Clin Microbiol., 42:4181-4188(2004), Cheolmin Kim, et al., KR Pat. No. 10-0650162, (2006)). The QC probe is an oligonucleotide which has a base sequence complementary to target sequences or any base sequence and which is labeled with a fluorescent material having an excitation/emission wavelength from that of a fluorescent material labeled on target. The scanning of fluoresecent signal radioating before or after hybridization stage can illustrate whether probes are fixed to support or not and hybridized to target gene or not, and verify the formation and density of probes fixed to support and the hybridization between the probes and target gene without spectral interference.
In the microarray of the present invention, the support may be made of any one selected from a group consisting of slide glass, plastic, membrane, semiconductive chip, silicon, gel, nano material, seramic, metal material and optical fiber or those mixture. The microarray of the present invention can be manufactured using conventional method such as a pin microarray (Microarray printing technology, Don Rose, Ph.D., Cartesian Technologies, Inc., Anal Biochem, 320(2):281-91 (2003)), a ink jet (Nat Biotech, 18;438-441(2000), Bioconjug Chem,13(1 );97-103(2002)), photolithography (Cur Opinion Chem Biol, 2;404-410(1998), Nature genetics supplement, 21 :20-24(1999)) or a electric array method (Ann Biomed Eng. 20(4):423- 37(1992), Psychiatric Genetics, 12;181-192(2002)).
The microarray of the present invention, being provided in the form of diagnosis kit, may further comprise an extraction agent for isolating target DNA, a PCR kit containing primers for amplifying target gene, a hybridization reaction buffer, a washing solution for the un hybridized DNA, a cover slip, dyes, a washing solution for unbound dyes and a description sheet for the microarray, except for the microarray of the present invention.
In order to achieve another object of the present invention, the present invention provides a method for detection and identification of microorganisms associated with periodontal diseases, comprising the following steps: a) purifying nucleic acids from a sample; b) amplifying target DNA among the purified nucleic acid; c) hybridizing the amplified target DNA with probes of the microarray according to the present invention; and d) detecting signals generated from the formed hybrid.
In the detection method of the present invention, the probe may further comprise the QC probe which can control the quility of all stages icuding hybridizing.
In the detection method of the present invention, the step b) for amplifying target DNA can be performed using Hot-start PCR, Nested PCR, Multiplex PCR, RT- PCR (reverse transcripase PCR), DOP (degenerate oligonucleotide primer) PCR, Quantitive RT-PCR, In-Situ PCR, Micro PCR, modified PCR such as Lab-on a chip PCR and isothermal amplification method such as RCA (rolling circle amplification) as well as general PCR reaction.
Also, the detection method of the present invention, with or without the step b) for amplifying target DNA, can be performed using probe amplification or signal amplification reaction such as tyramide signal amplification, nanoparticle probe, Raman-active dye and branched DNA((Karsten SL, et al., Nucleic Acids Res.
30:e4(2002), Cao YC, et al., Science, 297; 1536-1540(2002)). In the method of the present invention, the purifying step a) can be performed using conventional DNA or RNA purification method or kit. The amplifying step b) can be performed using conventional PCR method. The detection of the PCR product can be performed using conventional electrophoresis wih agarose gel. And, the signal detecting step d) can be performed using conventional fluorescence scanner after binding with conventional dyes such as Cy5 or Cy3.
According to the present invention, there can be provided a method for simultaneously genotying and detecting more than one microorganisms associated with periodontal diseases selected from a group consisting of the following members: universal microorganisms(patent application No.04-68313, SEQ ID NO: 46)( SEQ ID NO: 9 in the present invention); gram positive microorganisms(PCT/KR2006/000237, SEQ ID NO: 1 to 2)( SEQ ID NO: 10 to 11 in the present invention) and gram negative microorganisms(PCT/KR2006/000237, SEQ ID NO: 3)( SEQ ID NO: 12 in the present invention); genus Actinobacillus (SEQ ID NO: 13 to 14) and spiecies Actinobacillus (SEQ ID NO: 33 to 34); genus Actinomyces (SEQ ID NO: 15 to 16) and spiecies Actinomyces (SEQ ID NO: 35 to 36); genus Campylobacter (SEQ ID NO: 17) and spiecies Campylobacter (SEQ ID NO: 37); genus Enterococcus (SEQ ID NO: 18) and spiecies Enterococcus (SEQ ID NO: 38); genus Fusobacterium (SEQ ID NO: 19 to 21) and spiecies Fusobacterium (SEQ ID NO: 39 to 48); genus Klebsiella (SEQ ID NO: 22) and spiecies Klebsiella (SEQ ID NO: 49), genus Pantoea (SEQ ID NO: 23) and spiecies Klebsiella (SEQ ID NO: 51); genus Peptostreptococcus (SEQ ID NO: 24) and spiecies Peptostreptococcus (SEQ ID NO: 52 to 53); genus Porphyromonas (SEQ ID NO: 25) and spiecies Porphyromonas (SEQ ID NO: 54 to 55); genus Staphylococcus (SEQ ID NO: 26) and spiecies Staphylococcus (SEQ ID NO: 56); genus Streptococcus (SEQ ID NO: 27 to 29) and spiecies Streptococcus (SEQ ID NO: 62 to 68); genus
Treponema (SEQ ID NO: 30) and spiecies Treponema (SEQ ID NO: 59); genus Veillonella (SEQ ID NO: 31) and spiecies Veillonella (SEQ ID NO: 60); genus Propionibacterium (SEQ ID NO: 32) and spiecies Propionibacterium (SEQ ID NO: 61); spiecies Leptotrichia buccalis (SEQ ID NO: 50); and spiecies Tannerella forsythia (SEQ ID NO: 57 to 58). Therefore, the present invention provides a method for detecting gram positive- specific and gram negative-specific detection of bateria associated with periodontal disease and a method for detecting one or more bacteria species simultaneously.
And, in order to achieve another object of the present invention, the present invention provides a method for detection of bateria associated with periodontal disease using SBE (Single base extension), Sequencing, RFLP (Restriction fragment length polymorphism), or REA (Restriction endonuclease analysis) based on difference of one base sequence by using the oligonucleotides which is designed for gram positive-specific and gram negative-specific detection of periodontal disease-causing bacteria and for genus-specific and species-specific detection of periodontal disease- causing bacteria.
Hereafter, the present invention will be described in more detail. The method for detecting existence of periodontal disease-causing bacteria and identifying gram positive-specific, gram negative, genus-specific and species- specific bacteria using the microarray of the present invention comprises the following steps: a) if necessary, purifying nucleic acids from a cultured or clinical sample; b) if necessary, amplifying the target sequence of bacteria or its part using more than one proper primers; c) hybridizing the amplified target DNA with probes having a sense or antisense or complementary sequence of genus-specific and species-specific oligonucleotides and gram positive-specific and gram negative-specific oligonucleotides of periodontal disease-causing bacteria, disclosed in Tables 2 and 4; d) detecting signals generated from the formed hybrid; and e) predicting the existence of the periodontal disease-causing bacteria in the sample. According to an example of the microarray of the present invention, in the c) step, the probes have a diversity of probe composition and more than one probes. In a particular embodiment, the probes are optimized to simultaneously hybrid with its target region under the same hybrid and washing condition which can detect gram positive and gram negative bacteria and genus and species of the periodontal disease- causing bacteria at once.
To achieve the obect of the present invention, the present invention provides a microarray comprising probes set for detecting gram positive-specific and gram negative-specific bacteria and genus and species of the periodontal disease-causing bacteria attached on the support, which can simultaneously detect gram positive and gram negative bacteria and identify genus and species of the bacteria as quickly and exactly as passible from only one experiment of a sample.
Moreover, it is possible to detect a bacteria species which is not comprised in the microarray within at least level of genus. Furthermore, it is possible to detect existence of a bacteria species which is not pertained to the genus in the microarray by using universal probe.
FIG. 1 shows the target region for detecting bacteria in biological sample and the location of primers for amplifying the target region and probes. FIG. 1 shows the
ITS region comprising genus level conserved region and hypervariable region, the location of primers common to bacteria which can amplify the ITS region, the location of gram positive or gram negative-specific probes and genus-specific or species- specific probes of periodontal diseases-causing bacteria designed by present inventor.
Eight (8) types of ITS base sequence and 3 types of 23S rDNA base sequence of 6 kinds of bactera which were newly sequenced and developed by the present inventors as target sequences for detecting of oral disease-causing bacteria including periodontal disease-causing bacteria are as shown in Table 1.
And the universal probe invented by the present inventors to detect existence of a bacteria (KR Patent Application 04-68313, Seq.lD No. 46) and the probe used to detect gram-positive and gram-positive bacteria(PCT/KR2006/000237, 2006) are as shown in Table 2.
[Table 1]
8 types of ITS base sequence and 3 types of 23S rDNA base sequence of 6 kinds of bactera
Figure imgf000016_0001
ATTCGGTGGATGCCTTGGCATCAAGAGCTGATGAAG
GACGTTGCGGCCTGCGATATGCCTCGGGGAGCTGGC
GAGCGAGCGTTATTATCCGAGGGTGTCCGAATGGGG
GAACCTAACCTGGGTTGTGCTGGGTTACCATCATCT
GAACGTGTATAGGGTGGTGGGGGGAACGCGGGGAAG
TGAAACATCTCAGTACCCGCAGGAAAAGATATTCCG
TGAGTAGTGGCGAGCGAAAGCGGAGGAGGCTAAACC
AGATGCGTGTGAGAGGCGGCGGCCGTTGCGTGTTTG
GTGTTGTGGGGCCATGTTGGACTCTTCTGCCGGAGG
GTCGCGCCGCATGATGCTTGGAGTTGAACAGTGTGG
GAAAGCTGACCGAAGAGCGTGAGAGTCGTGTAGATG
GACTGGTGTTGTGTGGTGTGGATGTGGTACCCGAGT
AGCGCGGGACTCGTGAAATCTCGTGTGAATCTGCCA
AGACCACTTGGTAAGCCTAAATACTACTTGATGACC
GATAGTGCATAGTACCGTGAGGGAATGGTGAAAAGT
ACCCCGGGAGGGGAGTGAAATAGAACCTGAAACCG
Act inomyces vi scosus GCCGTACCGGAAGGTGCGGCTGGATCACCTCCTTTC
( ITS-23S rDNA) TAGGGATTGATTGTGCTTGCGGCGCCCCTGGTGTCC
TGGTTTGTTTCNCCCCTTTTGTTCTTGTGGGGGTGG
CTGGGGTGCTGGGTGCCGTGGGGAAGATGATGGTGT
AAGGAACACGCCTGCCTGGGCTGGTTGGTCTGGGTG
GGTGCCCCTGCGTGTGCGTGCTTGGTGTGCGTGTGT
GTGGGGGTGGCATGCTGTCGGGGTTCTGGGGCAGTG
CGCCCTGGTTGCCTGGCCTGTAGGGTCTGCTGGTTT
GTTGCTGGTGGGTCTTGTGGGTGTGGGTGGGTTGGT TGTGAACTGTATAGTGGACGCGAGCATCTTACTGTA
AGTGTTTTCTGCGACAAGCGCGTGGATGCGCATGGT
CTTGTGTGGGTCGTGTGTGTTTGTGTGTTGTTGTGG
TTCTTGTTGTTTGTTTTTGTTGAGCGTTCGGTGGAT
GCCTTGGCATCAGGGGCCGATGAAGGACGTGGTGGC
CTGCGATATTCCTCGGGGAGCCGGCTGGCGGGCTGT
GATCCGAGGGTTTCCGAATGGGGGGACCCGGCACGA
GTTATGTCGTGTCACCTGCATCTGAATTGTATAGGG
TGTGGGGGGTGACGCGGGGAAGTGAAACATCTTAGT
ACCCGTAGGAGAAGATATTCCGTGAGTAGTGGCGAG
CGAAAGCGGATGATGGTTAAACCGTGTGCGTGTGAT
ACTCGGCAGGGGTTGCGTGTGCGGGGTTGTGGGGCT
GTTCTGTCGTCTTCTGCCGGAGGCGGGGCGCGTGTG
CTGGCTGGTAGCTGAAACGTCTGGGAAGGCGTGGCG
TAGTGGGTGATACCCCCGTAGGTGTAACTGGTTGGT
GCGTGTCTGGGATGGTGCCCGAGTAGCACGGGGCTC
GTGGAATCCTGTGTGAATCTGCCAAGACCACTTGGC
TGCCTGAATACCTCCTGATGACCGATAGTGGATAGT
ACCGTGAGGGAATGGTGAAAAGTACCCCGGGAGGGG
AGTGAAATAGAACCTGAAACCGTGTGC
Peptostreptococcus micro TAGTTTTATCACTGTTTTTTTGGTTCATATTTTTTT
( ITS-23S rDNA) TAAAATTTTTGAAGTTTTTAAAATTTTΛACCAAAAG
CTGTAAGGCTAACTAAAAGAGAATACCAAAATGATA
GTATAAAACATTTAATGATTAGTAGTAAATACTTAA
ATTAATAGTAAATACTTAATAATTATTGAGTGGGGG TGCACCCAATCTATGAAATTTAΛACAAAAATAAATT
TTTGTAAATTTCAAAGCTGGGTACGCAAAACCCCCA
AAAATTTGTACTGTCGTAAΛAATTTTTGGGGGTGTA
GCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGG
GTCAGGAGTTCGAATCTCCTCATCTCCACCAAGGAA
CCTGACAATTAAAGAGAAATATATTTCTGGTCΛAGC
GACCAAGGGCATAAGGTGAATGCCTTGGCACTGAGA
GCCGAAGAAGGACGTGACAAGCTGCGAAAAGTCTCG
GGGAGGAGCAAATATCCTTAGATCCGGGAATGTCCG
AATGGGGAAACCCACTTGAGCAAACCTCΛAGTATCT
AGTTGTGAATACATAGCAACAAGAGGGAAAAGTTGG
TGAACTGAAACATCTAAGTAGCCAGACGAAAAGAAA
GAAAAAATTCGATTTTCAAAGTAGCGGCGAGCGAAA
TGGAAAGAGCCCAAATTAAGTTAAGGAAGAGGTAAG
ATAGTTGAATGGTCTGGAAAGATTCAACCGAAGAAA
GTGAAAGTCTTGTAAACGAAATCAAGCCGAATCTGA
CTTTAAAAGAGTAGCATGGGACACGAGAAATCCTGT
GNGAAAATGGGGGGACCACCCCCTAAGGCTAAATAC
TACTCAGTGACCGATAGAGAATAGTACCGTGAGGGA
AAGGTGAAAAGAACCCCGGGAGGGGGGTGΛAATAGA
ACCTGAAACCGTGTGC
Pantoea agglomerans GGGGAACCTGCGGTTGGATCACCTCCTTACCTGAAG
(ITS) ATACCTTCCCGCGCAGTGTCCACACAGATTGTCTGA : type 1 TAAAAAGTAACGAGCAGAAAAAACCACTACAGGCTT
GTAGCTCAGGTGGTTAGAGCGCACCCCTGATAAGGG
Figure imgf000020_0001
GGTAAGGTGATATGAACCGTTACAGCCGGCGATGTC
CGAATGGGGAAACCCAGTGCAA
Klebsiella oxytoca ACCTTAAAGAACCTGCCTTTGTAGTGTCCACACAGA
( ITS) TTGTCTGATGAAAATGTAGCAGTAAAAAATCTCTGC : tyre 1 AGGCTTGTAGCTCAGGTGGTTAGAGCGCΛCCCCTGA
TAAGGGTGAGGTCGGTGGTTCGAGTCCACTCAGGCC
TACCAAATTTCTGCTGATGCTGCGTTGCGGCGACAC
TCACATACTTTAGTATGCTTCGTGTCACCACGCCTT
GCCTCAACAGAAATTAAGGTTGATGAGATTTAACTA
CGATGGGGCTATAGCTCAGCTGGGAGAGCGCCTGCT
TTGCACGCAGGAGGTCTGCGGTTCGATCCCGCATAG
CTCCACCATCTTTACTGCACAACACAAGAAAACTTC
AGAGTGTACCTGAAAAGGTTCACTGCGAAGTTTTGC
TCTTTAAAAATCTGGATCAAGCTGAAAATTGAAACG
ACACACAGTTAATGTGTGTTCGAGTCTCTCAAATTT
TCGCGACACGΛCGATGTTTTACGAAACATCTTCGGG
TTGTGAGGTTAAGCGACTAAGCGTACACGGTGGATG
CCCTGGCAGTCAGAGGCGATGAAGGACGTGCTAATC
TGCGAAAAGCGTCGGTAAGGTGATATGAACCGTTAC
AGCCGGCGATGTCCGAATGGGGAAACCCAGTGCAA
Klebsiel la oxytoca ACCTTAAAGAACCTGCCTTTGTAGTGCTCACACAGA
( ITS) TTGTCTGATAGATGTAAAGAAGCAAGACGGCTGCGA : tyre 2 AGTCGCGACACCTCGTGTCCCCTTCGTCTAGCGGTT
AGGACTCCGCCCTTTCACGGCGGCAACAGGGGTTCG
AATCCCCTAGGGGACGCCACTTGCTGGCTGTGAGTG AAAGGCACAACCAACCGATATCTCAAAACTCATCTT
CGGGTGACGTTTGAGATATTTGCTCTTTAAAAATCT
GGATCAAGCTGAAAATTGAAACGACACACAGTTAAT
GTGTGTTCGAGTCTCTCAAATTTTCGCGACACGATG
ATGTTTTACGAAACATCTTCGGGTTGTGAGGTTAAG
CGACTAAACGTACACGGTGGATGCCCTGGCAGTCAG
AGGCGATGAAGGACGTGCTAATCTGCGAAAAGCGTC
GGTAAGGTGATATGAACCGTTACAGCCGGCGATGTC
CGAATGGGGAAACCCAGTGCAA
Campylobacter conci sus TGAAGTCGTAACAAGGTAACCGTAGGAGAACCTGCG 8
GTTGGATCACCTCCTTTCTAGAGTACATATAGATAT
( ITS)
TCTCTCACAAGATATCTATAAGAAAGATATTCTCAA
TCATCCTTGTTTAGTTTTGAAAGATTGATAGACCTA
TAGGGGCCTATAGCTCAGCTGGTTAGAGTGCACCCC
TGATAAGGGTGAGGTCACAAGTTCAAGTCTTGTTAG
GCCCACCAGAGAATTTAATTGGGGAATTAGCTCAGC
TGGGAGAGCGCCTGCTTTGCACGCAGGAGGTCAGCG
GTTCGATCCCGCTATTCTCCACCATAAAATAGTTTA
ACCGTATTAAGTCTAATTAGAGAGCTTAAATTTTTA
AACTTTCTAATTAGACTTTTGTCTAAATGTTCTTTT
AATTAATATTGTTAATAGTCACAAGCAAGTTTTAAA
AACAATTTTACAGGACTTGTTAAAGATTTAAATTTC
TATTCTCTTTGCATTTAATGCAAAAGTTTGACATCA
CAATCTATTTAGGATTTAAAACTTATCTAAATAGTA
GTCAATGCTTTCCGTCTTGAGAGCTAGAATTTAAAT
Figure imgf000023_0001
Code Name of Mixed Base V:G+A + C, Y:C + T
[Table 2]
Universal, gram positive-specific and gram negative-specific oligonucleotide for detection of bacteria
Figure imgf000023_0002
Figure imgf000024_0001
Code Name of Mixed Base W:A + T, M:A + C, Y:C + T, R:A + G, K:G + T
New genus-specific oligonucleotides for detecting periodontal disease-causing bacteria developed in the present invention are as shown in Table 3. [Table 3] New probes for bacteria genus-specific detection of periodontal disease-
Figure imgf000024_0002
Figure imgf000025_0001
Code Name of Mixed Base
W : A + T, K : G + T
New species-specific oligonucleotides for detecting periodontal diseases- causing bacteria developed in the present invention are as shown in Table 4.
[Table 4]
New probes for bacteria species-specific detection of periodontal disease- causing bacteria
Figure imgf000025_0002
Figure imgf000026_0001
Figure imgf000027_0001
Code Name of Mixed Base
W : A + T, M : A + C, S : G + C, V : G + A
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows location of tartet region, primers and probes used for amplifying aerobic and anaerobic periodontal disease-causing bacteria.
FIG. 2 shows results of PCR amplification of the target by primer designed for bacteria-specific base sequence. FIG. 3 show a microarray comprising a probe set consisting of bacteria universal probes and genus-specific and eriodontal disease-specific probes for detecting bactera associated with periodontal disease, attached on a support.
FIG. 4 shows results of hybridization reaction of bacterial common probes and genus-specific and species-specific probes for Actinomyces viscosus and Peptostreptococcus micros among periodontal disease-causing bacteria.
FIG. 5 shows results of hybridization reaction of bacterial common probes and genus-specific and species-specific probes for Actinomyces viscosus and Peptostreptococcus micros among periodontal disease-causing bacteria.
FIG. 6 shows results of hybridization reaction of bacterial common probes and gram negative-probes and genus-specific and species-specific probes for Actinobacillus actinomycetemcomitans among periodontal disease-causing bacteria. FIG. 7 shows a microarray comprising a probe set consisting of bacteria universal probes, gram-positive and gram-negative probes and genus-specific and species-specific probes attached on a support for more specific detection of the periodontal disease-causing bacteria, as one support. FIG. 8 shows results of analyzing state of spot were analyzed with laser scanner after 1 :1 mixture of the QC probes and the negative control probes were fixed to the slide.
FIG. 9 shows results of hybridization reaction of bacterial common probes and gram negative-specific probes and genus-specific and speies-specific probes for Porphyromonas gingivalis of gram-negative bacteria related with the periodontal disease.
FIG. 10 shows results of hybridization reaction of bacterial common probes and gram negative-specific probes and genus-specific and speies-specific probes for Pantoea agglomerans among periodontal disease-causing bacteria.
BEST MODE FOR CARRYING OUT THE INVENTION
The present invention will be decribed in greater detail by means of following examples. The following examples are for illustrative purpose and are not intended to limit the scope of the invention.
Example 1 : Incubation of Bacteria and isolation of Genomic DNA
Total 56 kinds of strains were obtained from the American Type Culture
Collection (ATCC) and Korean Collection for Tpe Cultures(KCTC, Korea). The strains were selected in each culturing media under each culturing conditions according to manual provided by ATCC and KCTC. And the present inventors obtained many clinical specimens through network with General University Hospitals in pusan, Gyeongsangnam-do. From the cultured media, strain colonies were obtained with a white gold ear and input 1.ml tube, 10OuI of InstaGene matrix (Bio-Rad, USA) was added thereto and suspended, and reaction was performed at 560C for 30 minutes in constant temperature bath. And then, the reactant was shook for 10 seconds, heated at 1000C for 8 min, shook again for 10 sec, centrifuged at 12,000 rpm for 3 min, recovered DNA. The extracted DNA is storaged in a freezer at -200C .
The strains used were as followed Tabel 5 : [Table 5]
Figure imgf000029_0001
Figure imgf000030_0001
Figure imgf000031_0001
Example 2; Preparation of probes
All probes used for detection of microorganisms associated with periodontal diseases is confirmed specificity of probes by multiple alignment and BLAST searching as selecting ITS target base sequence of microorganism associated with periodontal diseases published in Genbank. The genus-specific probes of microorganism associated with periodontal diseases is only complementary in each genus, is selected from base sequence having very lower similarity to genus of other genus (length: 15-25 mer). And The species-specific probes is selected from base sequence having very lower similarity to polymorphism of other species. Designed genus and specis-specific probes were standed for in Table 3 to Table 4. Above all probes can be used as not being limited in base sequence of Tabel 2 to Table 4 but being designed primers and probes consisted of base sequence comprising it.
Example 3: Preparation of taget DNA
To amplication of ITS target region for detecting microorganisms associated with periodontal diseases, there is used as common 2 primers ((Applied and Environmental Microbiology, 64:795-799(1998)) of 16S rDNA having been known and common 2 primers (Patent No. 04-68313, SEQ ID NO. 54, SEQ ID NO. 42) of 23S rDNA which the present inventor develops directly and is pending patent. (16S-1387F: 5'-biotin-GCCTTGTACACWCCGCCC-3; 23S-520R: 5'-biotin-
NAGAACCTGAAACCGTGTGC-3' ; 16S-1525F: 5'-biotin-GGYTGGAWCACCTCCTT- 3'; 23S-389R: 5'-biotin-ATTTCACGTGTCCCGCCNTA-3') Primer is designed as a state labeling biotin and Primer for DNA chip is designed as a state labeling biotin at 5'. PCR were carried out in follow condition. Reaction composition is added to water to be 25ul of total volume after adding 100C PCR buffer(100 mM KCI, 20 mM Tris HCI (pH 9.0), 15 mM MgCI2) 5 /d, dNTP(deoxynucleoside triphosphates) mixture (dATP, dGTP, dTTP, and dCTP each 10 mM) 1 β&, forward and backward primers (each 10 pmole) each 1 βi, Taq polymerase (5 units//"*, QIAGEN, Inc., Valencia, USA) 0.2 μi, template DNA 4 β&. Reaction condition is denaturation at 940C for 3 minutes, denaturation at 940C for 1 minute. Annealing reaction is carried out at 500C for 1 minute, extension reaction is carried out at 720C for 1 minute, and we repeated 30 times these process.
Example 4: Confirming of amplified prducts and analyzing of base sequences
PCR products amplified through the procedure described in Exemple 3 were analyzed by performing A gel electrophoresis. The base sequences of target bacteria not to be included in existing public nucleotide data base were acquired by analyzing.
FIG. 2 shows the PCR results by using a pair of primers amplifying the target sequence for the bacterial-specific detection. FIG. 2 shows the PCR products in approximately 800-1500 bp that is amplified with the forward primer 1387F and 1525F((Patenet Application 04-68313(2004), by the present inventors) designed by using the 16SrDNA gene and the reverse primer 389R and 520R designed by using the 16SrDNA gene and analyzed by performing a gel electrophoresis. In FIG. 2(a)-2(d), lane M is 100bp DNA ladder as a standard maker of molecular weight; lane N, negative control group.
FIG. 2(a) is the PCR result of Porphyromonas gingivalis; lane 2-6 for the mixture of 16S-1387F and 23S-520R, lane 4 for ATCC 33277, lane 5 for ATCC 49417, lane 2,3,6 for clinical specimen. And, lane 1 is mixture of 16S-1525F and 23S-389R ATCC 49417, as a smaller than lane 5.
FIG. 2(b) lane 1 -4 for Enterococcus faecalis; lane 5-14 for Fusobacterium nucleatum - lane 5 for ATCC 51191 , lane 6 for ATCC 51 190, lane 7 for ATCC 25586, lane 8 for ATCC 23726, lane 9 for ATCC 10953, lane 10 for ATCC 49256, lane 1 1 ~14 for clinical specimen. FIG. 2(c) lane 1-6 for Streptococcus mitis - lane 1 for ATCC 49456, lane 6 for
ATCC 981 1 , lane 2-5 for clinical specimen, lane 7-10 for Streptococcus sanguinis, lane 7 for ATCC 10556, lane 8-10 for clinical specimen, lane 1 1 for Treponema denticola ATCC 95404, lane 12 for Veillonella parvula ATCC 10790, lane 13 for clinical specimen, and lane 14 for Propionibactehum acnes ATCC 6919. FIG. 2(d) lane 1 for Fusobacterium periodonticum ATCC 33693, lane 2-4 for clinical specimen F. periodonticum, lane 6 for Campylobacter concisus ATCC 33237, lane 7~ 8 for clinical specimen C. concisus, lane 9 for Enterococcus faecalis ATCC 19433, and lane 11~14 for Pantoea agglomerans.
As a result, it is clarified that the bacterial-specific PCR product are amplified by using each pair of specific primers, discriminating primaraily other microorganism such as human DNA and viral DNA. This enables a rapid and precise diagnosis and reduces a diagnostic cost.
Exemple 5: Design of target probe
The proes designed in Example 2 were synthesized to retain a dT spacer having amine-modification and C6-15 bases at the δ'-terminus and 15-25 nucleotides.
The genus-specific and species-specific probes developed in the present invention are the base sequence 13 to 68 of table 3,4. All kinds of bactera-specific((Kim Cheol Min,
Application Number 04-68313, Seq. ID No 46)), gram positive-specific and gram negative-specific probes((Kim CM et al.,, PCT/KR2006/000237(2006), Seq. ID No 1 to 3)) were additionally used for diagnosis method and identification.
Exemple 6 : Design of the QC probe labeled with fluorescent dyes
The QC probe developed by inventors of the present invention, patented was used for the present invention. ((Kim Cheol Min et al., Patent No, 10-0590901(2006), Jang HJ, et al., J Clin Microbiol., 42:4181-4188(2004), Kim Cheol Min et al., Patent No,
10-0650162, (2006)).
Exemple 7 ; Attachment of probes onto a substrate
The target probes designed in Exemple 5 were diluted to 5-100 pmol, were added 1-100 pmol Qc probe designed in Exemple 6 and Micro-spotting solution or 3*
SSC solution ,and were mixed. The probes were attached onto a slide glass substate by using a Microarryer(Cartesian Technologies, PLXSYS 7500 SQXL Microarryer, USA). Two spots per one kinds of probe were attached the supports, then, the resulting microarray was placed in a slide box at a room temperature for 24 hours or incubated with a dry oven at 500C for about 5 hours to fix the probes.
Exemple 8 : Checking the quilitv associated with Whether probes was fixed to a slide glass or not
Whether probes was attached onto a slide glass or not and how probes was attached onto a slide glass are able to have an importnat effect on result analyzing, so, before washing, state of slide was checked by using quality control probe(QC probe) developed by the present inventors and patented. ((Kim Cheol Min, et al., Patent No, 10-0590901 (2006), Jang HJ, et al., J Clin Microbiol., 42:4181-4188(2004), Kim Cheol Min et al., Patent No 10-0650162(2006)). attachment, fixing of the target probe, and DNA chip state and so on are able to have an importnat effect on result analyzing, so, before washing, the state was checked whether the probes were fixed to the slide or not and state of spot were analyzed with laser scanner after probes were fixed to the slide in Exemple 7. The figure 8 shows the resulting.
Exemple 9 : Washing of unfixed probes In order to remove probes remained not to react onto the slide finished quility examination by Exemple 9, what is mentioned below was performed. The microarray was washed out by using 0.2% SDS(sodium dodecyl sulfate) at a room temperate and then, washed by usig distilled water. After, the resulting microarray was put in sodium borohydride(NaBH4) for 5 minutes then, washed at 1000C . Again, the resulting microarray was washed out by using 0.2% SDS(sodium dodecyl sulfate) and distilled water then, surface of substrate was dried completely with the centrifuge. Example 10: Hybridization
The biotin-labeled target products prepared in Example 3 were thermally treated to be denaturated in to single strands and cooled to 4. To detect interaction PCR product with probes, there is manufactured reaction solution containing Cy5- streptavidin or Cy3- streptavidin(Amersham pharmacia biotech, USA) and 10ml or
60ml of hybridization reaction solution comprising 1~5ul of target DNA. This hybridization reaction solution was portioned on the slide glass performed embodiment
8 and the slide glass was covered with a cover seal, blocked out light and reacted at 400C for 30 minutes.
Example 11 : Washing of unspecific hybridized DNA
To wash out unhybridized target DNAs, the cover slip was removed using a 2X SSC washing solution (300mm NaCI, 30mm Na-Citrate, pH 7.0), and the slide was washed with 2X SSC and then 0.2X SSC, followed by centrifugation to fully dry to the slide glass.
Example 12: Analysis of the results
The hybridized result was scanned using a non-confocal laser scanner (GenePix 4000Am, Axon Instruments, USA) and analyzed by image analysis.
FIG. 3 show a microarray comprising a support, as a probe set, consisting of bacteria universal probes for detecting microorganism associated with periodontal diseases and genus-specific and species-specific probes. The microarray can designe two and more microarrays as one support, so The microarray can analyze a number of samples for a short time simultaneously. FIG. 4 shows results of hybridization reaction for Actinomyces viscosus and Peptostreptococcus micros using mircoarray, and shows scan image of bacteria common probes (Patent No. 04-68313 SEQ ID NO. 9) and Actinomyces genus- specific (SEQ ID No. 15, 16) and A. viscosus species-specific probes (SEQ ID No. 36) and Peptostreptococcus genus-specific (SEQ ID No. 24) and P. micros species- specific probes (SEQ ID No. 52, 53) when double infected by two bactera.
FIG. 5 shows results of hybridization reaction for Staphylococcus saprophyticus using mircoarray, and shows scan image of bacteria common probes (Patent No. 04- 68313 SEQ ID NO. 9) and Staphylococcus genus-specific (SEQ ID No. 26) and S. aureus species-specific (SEQ ID No. 56) probes.
FIG. 6 shows detection for the existence of periodontal diseases-causing bacteria, and shows microarray comprising a support, as a probe set, consisting of bacteria common probes, gram-positive and gram-negative probes and genus-specific and species-specific probes, and shows scan image of bacteria common probes (Patent No. 04-68313 SEQ ID NO. 9) and gram-negative-specific probes (PCT/KR2006/000237), (SEQ ID NO. 10) and Actinobacillus genus-specific probes (SEQ !D No. 13) and A. actinomycetemcomitans species-specific probes(SEQ ID No. 33).
FIG. 7 show a microarray comprising a support, as a probe set, consisting of bacteria universal probes for detecting bactera associated with periodontal disease (application No.04-68313), (SEQ ID No. 9) and gram-positive and gram-negative probes(PCT/KR2006/000237), (SEQ ID No. 10,1 1 ,12) and genus-specific and species- specific probes. The microarrays can analyze a number of samples at once because two more than microarrays can be designed with one support. FIG. 8 shows results of quility state of microarray using QC probes. First, mixture of target probe and quality control probe(Patent Number, 10-0650162) were fixed to support, second, unfixed probes were washed, third, quility state of microarray was analyzed by a scanner), good states(form, density, and so on)of fixed probe to support.
FIG. 9 shows results of hybridization reaction for Porphyromonas gingivalis using mircoarray checked the quility in Exemple 8, and shows scan image of bacteria common probes (Patent No. 04-68313 SEQ ID NO. 9) and gram negative-specific probes (PCT/KR2006/000237), (SEQ ID No. 10), Porphyromonas genus-specific probes (SEQ ID No. 25) and P. gingivalis species-specific probes (SEQ ID No. 55).
FIG. 10 shows results of hybridization reaction for Pantoea agglomerans using mircoarray, and shows scan image of bacteria common probes (Patent No. 04-68313 SEQ ID NO. 9) and gram negative-specific probes (PCT/KR2006/000237 SEQ ID NO. 10), Pantoea genus-specific probes (SEQ ID No. 23) and P. agglomerans species- specific probes (SEQ ID No. 51).
The composition and layout of each probes can be changed because this is only tipical example of probes layout among new oligonucleotides designed in the present invention.
INDUSTRIAL APPLICABILITY As described above, the present invention developed the miroarray and the diagnosis kit for detecting periodontal diseases-causing bacteria comprising any one selected from a group consisting of genus- and species-specific probes designed from ITS of base sequence hypervariable and conserved regions of the bacteria, and comfirmed its specificity. According to the present invention, the present invention can provide an antibiotics therapy for accurately removing infectious agent related to periodontal by detecting existence of periodontal -causing bacteria and identifying gram posive- and gram negative-bacteria and genus and species of the bacteria, at once.
According to the present invention, the present invention can provide speedy and perfect microarry method, detect and care periodontal disease at the initial stage, and improve diverse diseases including Cardiovascular System disease caused by bacteria associated with periodontal disease. Especially, microarray can be used for dianosis of oral microorganism because microarray can detect many microorganisms at once by using probe of high density. Microarray makes many microoranisms detected at once. When dentist and clinical doctor detect pathogenic bacteria in oral, they can use microarray for improvement of diagnosis, prevention, and treatment.

Claims

5 1. An ITS (Internal transcribed spacer) target DNA for detecting microorganisms, comprising any one sequence selected from SEQ ID Nos. 1 to 8 or it's partial sequence.
2. An oligonucleotide for gram positive-specific identification of K) microorganisms associated with periodontal diseases, comprising any one sequence selected from SEQ ID Nos. 10 to 11 or its complementary sequence.
3. An oligonucleotide for gram negative-specific identification of microorganisms associated with periodontal diseases, comprising a sequence of SEQ
15 ID Nos. 12 or its complementary sequence.
4. An oligonucleotide for genus-specific identification of microorganisms associated with periodontal diseases, comprising any one sequence selected from SEQ ID Nos. 13 to 32 or its complementary sequence.
20
5. An oligonucleotide for species-specific identification of microorganisms associated with periodontal diseases, comprising any one sequence selected from SEQ ID Nos. 33 to 68 or its complementary sequence.
25 6. A primer set for amplifying microorganisms associated with periodontal diseases, comprising more than one oligonucleotide according to claims 2 to 5.
7. A probe set for identifying microorganisms associated with periodontal diseases, comprising more than one oligonucleotide according to claim 2 or 5.
8. A diagnosing kit, comprising more than one oligonucleotide according to claims 2 to 5.
9. A PCR kit comprising the oligonucleotide for gram positive-specific identification of microorganisms associated with periodontal diseases according to claim 2 as a primer.
10. A PCR kit comprising the oligonucleotide for gram negative-specific identification of microorganisms associated with periodontal diseases according to claim 3 as a primer.
1 1. A PCR kit comprising the oligonucleotide for genus-specific identification of microorganisms associated with periodontal diseases according to claim 4 as a primer.
12. A PCR kit comprising the oligonucleotide for species-specific identification of microorganisms associated with periodontal diseases according to claim 5 as a primer.
13. A microarray comprising the oligonucleotide for gram positive-specific identification of microorganisms associated with periodontal diseases according to claim 2 as a probe attached on a support.
14. A microarray comprising the oligonucleotide for gram negative-specific identification of microorganisms associated with periodontal diseases according to claim 3 as a probe attached on a support.
15. A microarray comprising the oligonucleotide for genus-specific identification of microorganisms associated with periodontal diseases according to claim 4 as a probe attached on a support.
16. A microarray comprising the oligonucleotide for species-specific identification of microorganisms associated with periodontal diseases according to claim 5 as a probe attached on a support.
17. The microarray according to any one of claims 13 to 16, wherein the probe is any one selected from a group consisting of DNA, RNA, PNA(peptide nucleotide), LNA(locked nucleotide) and HNA(de-hexitol nucleotide).
18. The microarray according to any one of claims 13 to 16, wherein the probe further comprises a QC probe for quality control of the microarray.
19. The microarray according to any one of claims 13 to 16, wherein the substrate is made of slide glass, plastic, membrane, semi-conductive chip, silicon, gel, nano material, ceramic, metallic substance, optical fiber, or their mixture.
20. A method for the detection and identification of microorganisms associated with periodontal diseases, comprising following steps: (1 ) isolating nucleic acids from a specimen; (2) amplifying a target DNA within the nucleic acids; (3) hybridizing the amplified DNA with the probe onto the microarray according to any one of claims 13 to 16; and (4) detecting a signal generated from the DNA hybrid.
21. The method for the detection and identification of microorganisms associated with periodontal diseases according to claim 20, wherein one or more microorganism selected from a group consisting of universal microorganisms(patent application No.04-68313, SEQ ID NO: 46)( SEQ ID NO: 9 in the present invention), gram positive microorganisms(PCT/KR2006/000237, SEQ ID NO: 1 to 2)( SEQ ID NO: 10 to 11 in the present invention) and gram negative microorganisms(PCT/KR2006/000237, SEQ ID NO: 3)( SEQ ID NO: 12 in the present invention), genus Actinobacillus (SEQ ID NO: 13 to 14) and spiecies Actinobacillus (SEQ ID NO: 33 to 34), genus Actinomyces (SEQ ID NO: 15 to 16) and spiecies Actinomyces (SEQ ID NO: 35 to 36), genus Campylobacter (SEQ ID NO: 17) and spiecies Campylobacter (SEQ ID NO: 37), genus Enterococcus (SEQ ID NO: 18) and spiecies Enterococcus (SEQ ID NO: 38), genus Fusobacterium (SEQ ID NO: 19 to 21) and spiecies Fusobacterium (SEQ ID NO: 39 to 48), genus Klebsiella (SEQ ID NO: 22) and spiecies Klebsiella (SEQ ID NO: 49), genus Pantoea (SEQ ID NO: 23) and spiecies Klebsiella (SEQ ID NO: 51), genus Peptostreptococcus (SEQ ID NO: 24) and spiecies Peptostreptococcus (SEQ ID NO: 52 to 53), genus Porphyromonas (SEQ ID NO: 25) and spiecies Porphyromonas (SEQ ID NO: 54 to 55), genus Staphylococcus (SEQ ID NO: 26) and spiecies Staphylococcus (SEQ ID NO: 56), genus Streptococcus (SEQ ID NO: 27 to 29) and spiecies Streptococcus (SEQ ID NO: 62 to 68), genus Treponema (SEQ ID NO: 30) and spiecies Treponema (SEQ ID NO: 59), genus Veillonella (SEQ ID NO: 31) and spiecies Veillonella (SEQ ID NO: 60), genus
Propionibacterium (SEQ ID NO: 32) and spiecies Propionibacterium (SEQ ID NO: 61), spiecies Leptotrichia buccalis (SEQ ID NO: 50), and spiecies Tannerella forsythia (SEQ ID NO: 57 to 58), can be diagnosed simultaneously.
PCT/KR2007/003246 2007-07-04 2007-07-04 Microarrays for detection and identification of microorganisms associated with periodontal diseases and method for diagnosis of infectious oral diseases using the microarray Ceased WO2009005178A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
PCT/KR2007/003246 WO2009005178A1 (en) 2007-07-04 2007-07-04 Microarrays for detection and identification of microorganisms associated with periodontal diseases and method for diagnosis of infectious oral diseases using the microarray
KR1020107000177A KR20100061438A (en) 2007-07-04 2007-07-04 Microarrays for detection and identification of microorganisms associated with periodontal diseases and method for diagnosis of infectious oral diseases using the microarray

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2007/003246 WO2009005178A1 (en) 2007-07-04 2007-07-04 Microarrays for detection and identification of microorganisms associated with periodontal diseases and method for diagnosis of infectious oral diseases using the microarray

Publications (1)

Publication Number Publication Date
WO2009005178A1 true WO2009005178A1 (en) 2009-01-08

Family

ID=40226207

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2007/003246 Ceased WO2009005178A1 (en) 2007-07-04 2007-07-04 Microarrays for detection and identification of microorganisms associated with periodontal diseases and method for diagnosis of infectious oral diseases using the microarray

Country Status (2)

Country Link
KR (1) KR20100061438A (en)
WO (1) WO2009005178A1 (en)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010054445A1 (en) * 2008-11-17 2010-05-20 Oral Health Australia Pty Ltd Detection of tannerella forsythia infection
US8883423B2 (en) 2010-10-22 2014-11-11 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
WO2015188178A1 (en) * 2014-06-06 2015-12-10 The Regents Of The University Of Michigan Compositions and methods for characterizing and diagnosing periodontal disease
US9488648B2 (en) 2010-10-22 2016-11-08 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US9562271B2 (en) 2012-04-20 2017-02-07 T2 Biosystems, Inc. Compositions and methods for detection of Candida species
CN109790531A (en) * 2016-07-11 2019-05-21 三菱化学株式会社 Intraoral examination method
CN113528684A (en) * 2021-08-04 2021-10-22 领航基因科技(杭州)有限公司 Digital PCR detection kit for identifying gram-negative bacteria and gram-positive bacteria and application
US11519016B2 (en) 2016-01-21 2022-12-06 T2 Biosystems, Inc. NMR methods and systems for the rapid detection of bacteria
CN116334263A (en) * 2023-04-21 2023-06-27 四川农业大学 Dual PCR primer, kit and detection method for detecting fish gill sarcoidosis pathogen
CN118711657A (en) * 2024-08-30 2024-09-27 杭州杰毅生物技术有限公司 A method and system for eliminating false positives from label jumping contamination in NGS sequencing

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20170011036A (en) 2015-07-21 2017-02-02 대한민국(관리부서: 행정자치부 국립과학수사연구원장) Primer sets for the detection of oral and vaginal bacteria, and method for detecting the bacteria using the same
KR102448350B1 (en) * 2020-11-30 2022-09-28 주식회사 힐릭스코 Information provision method and kit for diagnosis of dental caries
KR102573767B1 (en) * 2021-05-17 2023-09-01 주식회사 힐릭스코 Information provision method and kit for diagnosis of periodontal disease in Korean

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006025672A1 (en) * 2004-08-28 2006-03-09 Genein Co., Ltd. Oligonucleotide for detection of microorganism diagnostic kits and methods for detection of microorganis using the oligonucleotide

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006025672A1 (en) * 2004-08-28 2006-03-09 Genein Co., Ltd. Oligonucleotide for detection of microorganism diagnostic kits and methods for detection of microorganis using the oligonucleotide

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
AAS J.A. ET AL.: "Defining the normal bacterial flora of the oral cavity", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 43, no. 11, November 2005 (2005-11-01), pages 5721 - 5732 *
DATABASE GENBANK [online] 1 June 2004 (2004-06-01), accession no. NCBI Database accession no. (AY116899) *
DATABASE GENBANK [online] 8 August 2006 (2006-08-08), accession no. NCBI Database accession no. (AB222637) *
MITSUO SAKAMOTO ET AL.: "Molecular analysis of human oral microbiota", JOURNAL OF PERIODONTAL RESEARCH, vol. 40, no. 3, June 2005 (2005-06-01), pages 277 - 285, XP002511642 *
SMOOT L.M. ET AL.: "DNA microarrays as salivary diagnostic tools for characterizing the oral cavity's microbial community", ADVANCES IN DENTAL RESEARCH, vol. 18, June 2005 (2005-06-01), pages 6 - 11 *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010054445A1 (en) * 2008-11-17 2010-05-20 Oral Health Australia Pty Ltd Detection of tannerella forsythia infection
US9714940B2 (en) 2010-10-22 2017-07-25 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US9046493B2 (en) 2010-10-22 2015-06-02 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US9702852B2 (en) 2010-10-22 2017-07-11 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US9360457B2 (en) 2010-10-22 2016-06-07 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US9488648B2 (en) 2010-10-22 2016-11-08 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US8883423B2 (en) 2010-10-22 2014-11-11 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US11098378B2 (en) 2012-04-20 2021-08-24 T2 Biosystems, Inc. Compositions and methods for detection of candida species
US9562271B2 (en) 2012-04-20 2017-02-07 T2 Biosystems, Inc. Compositions and methods for detection of Candida species
US10760109B2 (en) 2014-06-06 2020-09-01 The Regents Of The University Of Michigan Compositions and methods for characterizing and diagnosing periodontal disease
WO2015188178A1 (en) * 2014-06-06 2015-12-10 The Regents Of The University Of Michigan Compositions and methods for characterizing and diagnosing periodontal disease
US11713478B2 (en) 2014-06-06 2023-08-01 The Regents Of The University Of Michigan Compositions and methods for characterizing and diagnosing periodontal disease
US11519016B2 (en) 2016-01-21 2022-12-06 T2 Biosystems, Inc. NMR methods and systems for the rapid detection of bacteria
CN109790531A (en) * 2016-07-11 2019-05-21 三菱化学株式会社 Intraoral examination method
CN113528684A (en) * 2021-08-04 2021-10-22 领航基因科技(杭州)有限公司 Digital PCR detection kit for identifying gram-negative bacteria and gram-positive bacteria and application
CN116334263A (en) * 2023-04-21 2023-06-27 四川农业大学 Dual PCR primer, kit and detection method for detecting fish gill sarcoidosis pathogen
CN118711657A (en) * 2024-08-30 2024-09-27 杭州杰毅生物技术有限公司 A method and system for eliminating false positives from label jumping contamination in NGS sequencing

Also Published As

Publication number Publication date
KR20100061438A (en) 2010-06-07

Similar Documents

Publication Publication Date Title
WO2009005178A1 (en) Microarrays for detection and identification of microorganisms associated with periodontal diseases and method for diagnosis of infectious oral diseases using the microarray
Barken et al. Advances in nucleic acid-based diagnostics of bacterial infections
KR100850193B1 (en) Bacterial specific, genus specific and species specific oligonucleotides for the discrimination of all bacteria, diagnostic kits comprising the same, and detection methods using the same
Mitterer et al. Microarray-based identification of bacteria in clinical samples by solid-phase PCR amplification of 23S ribosomal DNA sequences
EP2143805B1 (en) Asymmetric PCR amplification
KR101038519B1 (en) Differential diagnosis of infectious disease pathogens in humans and methods for determining antibiotic resistance thereof, multiplex kits and chips including the same
JP2004313181A (en) Probe and probe set for detecting causative bacteria of infectious disease, carrier and gene testing method
KR101385733B1 (en) Primers for detecting bacteria related to oral infectious diseases and use thereof
EP2240605A2 (en) Nucleic acid probes and broad-range primers
Anthony et al. DNA array technology and diagnostic microbiology
De Muro Probe design, production, and applications
AU776981B2 (en) Identification of bacteria by amplification and probing
JP2004201679A (en) Primer for detecting Fusobacterium nucleatum by PCR and method for detecting the same
US20090286691A1 (en) Oligonucleotide for Detection of Bacteria Associated with Sepsis and Microarrays and Method for Detection of the Bacteria Using the Oligonucleotide
Dhalluin et al. Genotypic differentiation of twelve Clostridium species by polymorphism analysis of the triosephosphate isomerase (tpi) gene
EP1565573B1 (en) Nucleic acid probes and broad-range primers from regions in topoisomerase genes, and methods in which they are used
FI115637B (en) Diagnostic Method for Detection and Identification of Bacteria Causing Respiratory Infections and Primer Mixture for Use in the Method
US20070065828A1 (en) Oligonucleotide for genotyping of mycoplasma, microarray comprising the oligonucleotide, and method for detection of species using the microarray
JP7390736B2 (en) Simultaneous detection method and primer kit for rot fungi
Flores-Gallegos et al. Molecular Methods for Microorganism Detection
Nsofor et al. DNA microarray-based detection of antibiotic resistance genes of human isolates of Escherichia coli in Nigeria
JP2007014351A (en) Infectious disease detection probe, gene detection probe, infectious disease pathogen amplification reaction primer, infectious disease pathogen amplification reaction primer set, and infectious disease pathogen detection method
US20070059714A1 (en) Detection of presence and antibiotic susceptibility of enterococci
Nayak et al. Molecular diagnostic methods in endodontics
Li et al. Design and development of a DNA array for rapid detection and genotyping of seven kinds of pathogenic microbes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07768594

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20107000177

Country of ref document: KR

Kind code of ref document: A

122 Ep: pct application non-entry in european phase

Ref document number: 07768594

Country of ref document: EP

Kind code of ref document: A1