CN113528684A

CN113528684A - Digital PCR detection kit for identifying gram-negative bacteria and gram-positive bacteria and application

Info

Publication number: CN113528684A
Application number: CN202110889429.0A
Authority: CN
Inventors: 夏江; 朱海涛
Original assignee: Pilot Gene Technologies Hangzhou Co ltd
Current assignee: Pilot Gene Technologies Hangzhou Co ltd
Priority date: 2021-08-04
Filing date: 2021-08-04
Publication date: 2021-10-22

Abstract

The invention discloses a digital PCR detection kit for identifying gram-negative bacteria and gram-positive bacteria and application thereof, the digital PCR detection kit for identifying gram-negative bacteria and gram-positive bacteria comprises an F/R primer, a probe and a standard positive template, wherein the F/R primer is a BAC-F upstream primer and a BAC-R downstream primer; the probes are BAC-P probes, G-P probes and G + P probes; the invention provides a primer probe sequence for protecting general detection of bacteria, gram-negative bacteria detection and gram-positive bacteria detection. The invention provides a detection scheme for protecting the interior of an amplicon to distinguish gram-negative bacteria from gram-positive bacteria.

Description

Digital PCR detection kit for identifying gram-negative bacteria and gram-positive bacteria and application

Technical Field

The invention relates to the technical field of biology, in particular to a digital PCR detection kit for identifying gram-negative bacteria and gram-positive bacteria and application thereof.

Background

Gram-negative bacteria generally refer to bacteria that exhibit a red gram staining reaction. In gram stain experiments, gentian violet (crystal violet) was added first for primary staining and then iodine solution was added for counterstaining. After the first step of staining was completed, both gram positive and negative bacteria were stained purple. At this time, the color washing is carried out (the color washing time is important and is the key point of the dyeing, about 20-30 seconds), only gram-negative bacteria are washed out, the color is changed into colorless, and the positive bacteria are still purple. Another counterstain dye (safranin or fuchsine is usually used) is added to stain all gram-negative bacteria red or pink, while the positive bacteria are still purple. By this test we can distinguish between these two bacteria with different cell wall structures.

Gram-positive and gram-negative bacteria are two broad classes of bacteria that are identified using gram staining methods. Most pyogenes belong to gram-positive bacteria, which produce exotoxins and cause diseases, while most enterobacteria belong to gram-negative bacteria, which produce endotoxins and cause diseases by means of endotoxins.

Certain gram positive bacteria are often found to discolor when gram staining is used; some gram-negative bacteria may have inaccurate staining reactions due to age or culture media.

At present, a digital PCR detection kit with high detection sensitivity for identifying gram-negative bacteria and gram-positive bacteria and application thereof are lacked.

Disclosure of Invention

The invention aims to provide a method for solving the technical problem ofHigh detection sensitivityThe digital PCR detection kit for identifying gram-negative bacteria and gram-positive bacteria and the application thereof.

In order to achieve the purpose, the invention is realized by the following technical scheme: the invention relates to a digital PCR detection kit for identifying gram-negative bacteria and gram-positive bacteria, which comprises an F/R primer, a probe and a standard positive template, wherein the F/R primer is a BAC-F upstream primer and a BAC-R downstream primer; the probes are BAC-P probes, G-P probes and G + P probes;

the BAC-F upstream primer has a nucleotide sequence of SEQ ID No. 1: GGTCTTAGTGATCCGGTGGTTC

The BAC-R downstream primer has a nucleotide sequence of SEQ ID No. 2: CCTACTTCAGCCCCAGGATG

The BAC-P probe has a nucleotide sequence of SEQ ID No. 3: ATGGAAGGGCCATCGCTCAACG

The G-P probe has a nucleotide sequence of SEQ ID No. 4: ATCGACGGGGAGGTTTGGCACC

The G + P probe has a nucleotide sequence of SEQ ID No. 5: ATCGACGGCGGTGTTTGGCAC

The invention relates to an application of a digital PCR detection kit for identifying gram-negative bacteria and gram-positive bacteria in detection.

The invention has the following advantages: the invention provides a primer probe sequence for protecting general detection of bacteria, gram-negative bacteria detection and gram-positive bacteria detection. The invention provides a detection scheme for protecting the interior of an amplicon to distinguish gram-negative bacteria from gram-positive bacteria.

Drawings

FIG. 1 is a technical schematic of the present invention; F/R: universal upstream and downstream primers for bacteria, FAM probe: a bacterial universal probe; CY5 probe: a gram-negative bacteria universal probe; ROX probe: a universal probe for gram-positive bacteria.

FIG. 2 is a schematic view of the FAM and ROX channels of gram-negative bacteria according to the present invention;

FIG. 3 is a schematic scatter plot of the FAM and CY5 channels of gram-negative bacteria of the present invention;

FIG. 4 is a schematic view of the FAM and ROX channels of gram-positive bacteria according to the present invention;

FIG. 5 is a schematic view of the scatter plot of the FAM and CY5 channels of gram-positive bacteria of the present invention.

Detailed Description

The invention is further described with reference to the accompanying drawings and specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

As described in relation to figure 1 of the drawings,

1 primer Probe design

1.1 designing a pair of bacterial universal primers and a bacterial universal probe, and a gram-negative bacteria specific probe and a gram-positive bacteria specific probe according to the bacterial 23S gene sequence. The specific information is as follows:

TABLE 1

1.2 samples

Bacterial DNA samples: and (3) externally purchasing dead bacteria, and extracting genome DNA by a magnetic bead method.

2 digital PCR amplification system

2.150 XBAC primer Probe mixture

TABLE 2

Components	Stock solution (mu M)	Volume (mu L/person)
			Water (W)	/	0.1125
BAC-F	400	0.0375
			BAC-R	400	0.0375
BAC-P	100	0.0375
			G+P	100	0.0375
G-P	100	0.0375
			Total up to	/	0.3

2.2 ddPCR reaction System

TABLE 3

Reagent	Volume (μ L)	Final concentration
			Water (W)	10.4
5XddPCR Mix	3	1X
			VIC dyes	0.3	1X
50XBAC	0.3	1X
			DNA
	1
			Total up to	15

3 amplification procedure

98℃5min【98℃15s，60℃1min】*40

4 results

TABLE 4

5 conclusion

5.1 the blank control NTC showed a few false positives due to endogenous factors. However, the detection values of G-bacterium and G + bacterium were higher than those of the blank control.

5.2 above blank control, the system can detect bacterial DNA and distinguish whether the bacteria are gram-negative bacteria or gram-positive bacteria; further, by calculating the ratio, the ratio of the gram-negative bacteria DNA or the gram-positive bacteria DNA in the sample to the bacteria DNA can be calculated.

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the foregoing description only for the purpose of illustrating the principles of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the invention as defined by the appended claims, specification, and equivalents thereof.

Sequence listing

<110> pilotage Gene science and technology (Hangzhou) Co., Ltd

<120> digital PCR detection kit for identifying gram-negative bacteria and gram-positive bacteria and application

<130> 2021

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence (BAC-F upstream primer)

<400> 1

ggtcttagtg atccggtggt tc 22

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (BAC-R downstream primer)

<400> 2

cctacttcag ccccaggatg 20

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence (BAC-P Probe)

<400> 3

atggaagggc catcgctcaa cg 22

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (ROX-BHQ2 Probe)

<400> 4

atcgacgggg aggtttggca cc 22

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (CY5-BHQ2 Probe)

<400> 5

atcgacggcg gtgtttggca c 21

Claims

1. A digital PCR detection kit for identifying gram-negative bacteria and gram-positive bacteria comprises an F/R primer, a probe and a standard positive template, and is characterized in that: the F/R primer is a BAC-F upstream primer and a BAC-R downstream primer; the probes are FAM probes, CY5 probes and ROX probes;

the BAC-F upstream primer has a nucleotide sequence of SEQ ID No. 1;

the BAC-R downstream primer has a nucleotide sequence of SEQ ID No. 2;

the BAC-P probe has a nucleotide sequence of SEQ ID No. 3;

the G-P probe has a nucleotide sequence of SEQ ID No. 4;

the G + P probe has a nucleotide sequence of SEQ ID No. 5.

2. Use of the digital PCR assay kit of claim 1 for the identification of gram negative and gram positive bacteria for detection.