LU503130B1 - PRIMER, KIT, AND METHOD FOR DETECTING RHODOCOCCUS RHODOCHROUS - Google Patents

Abstract

The present invention discloses a primer, a probe, a reagent, a kit, and a method for detecting Rhodococcus rhodochrous (R. rhodochrous) by quantitative real-time PCR (qPCR). Especially, the primer and the probe provided have good sensitivity and specificity. The qPCR method can qualitatively analyze whether there is R. rhodochrous in a microbial agent, which has advantages such as high-reliability results, good sensitivity, strong specificity, simple and rapid operation, and the like, and further improves the detection system of the microbial agent.

Description

DESCRIPTION

PRIMER, KIT, AND METHOD FOR DETECTING RHODOCOCCUS RHODOCHROUS

TECHNICAL FIELD

The present invention relates to the technical field of quantitative real-time PCR (qPCR) detection, particularly to a primer, a probe, a reagent, a kit, and a method for detecting Rhodococcus rhodochrous based on qPCR.

BACKGROUND

Rhodococcus rhodochrous (R. rhodochrous) is a genus of Rhodococcus (phylum:

Actinobacteria, family: Nocardiaceae), also known as Rhodococcus fuchsia. Rhodococcus is a species of obligate aerobic, gram-positive, and nonmotile bacteria with high GC (Guanine-Cytosine) content and widespread in their distribution. R. rhodochrous is a class

IV microorganism with strong adaptability and tolerance to organic solvents, which has achieved remarkable results in the bioremediation of oil pollution. In biotransformation,

Rhodococcus is used as a catalyst to prepare acrylamide at many production sites worldwide. In degrading food pollutants, Rhodococcus has the activity of degrading aflatoxin and chlorpyrifos. R. rhodochrous has a strong market demand at home and abroad and a broad development and application prospect.

At present, Rhodococcus includes 14 species, and there is no rapid and accurate detection method for distinguishing each species of Rhodococcus at home and abroad.

Traditional morphological, physiological, and biochemical methods cannot distinguish each species of Rhodococcus specifically. Based on the potential application value of R. rhodochrous in the fields of environmental control, biosynthesis and transformation, and food pollution degradation, the production and consumption of microbial agents in various countries are increasing year by year. It is urgent to establish a rapid and accurate detection method for R. rhodochrous in microbial agents to ensure the quality and safety of microbial agents and ensure the safe use of bacteria in natural environments in various countries.

SUMMARY LU503130

The purpose of the present invention is to overcome the above existing deficiencies in the prior art and provides a primer, a probe, a kit, and a method for detecting R. rhodochrous in a microbial agent by qPCR, which fills the detection gap of R rhodochrous in microbial agents. The primer and the probe can specifically and sensitively amplify R. rhodochrous. The detection method operates simple, rapid, accurate, and sensitive, which is a rapid and accurate detection method suitable for promotion and application.

On the one hand, the present invention provides a primer and a probe for detecting R. rhodochrous by qPCR. The primer includes a forward primer P1 and a reverse primer P2.

The forward primer P1 has a sequence shown in SEQ No.1.

The reverse primer P2 has a sequence shown in SEQ No.2.

The probe includes has a sequence shown in SEQ No.3.

However, a 5' end of the probe is labeled with a reporter fluorescent dye of FAM, and a 3' end of the probe is labeled with a quenched fluorescent dye of BHQ1.

The present invention also provides a reagent for detecting R. rhodochrous by qPCR, and the reagent includes the primer and the probe described above.

The present invention also provides a kit for detecting R. rhodochrous by qPCR, and the kit includes the primer and the probe described above or includes the reagent described above.

Also, the kit also includes a DNA polymerase reaction solution, a blank control, a positive control, and a negative control.

On the other hand, the present invention also provides a method for detecting R. rhodochrous by qPCR. The method uses the primer and the probe described above, the reagent described above, or the kit described above. The specific steps include:

Extracting genomic DNA from a sample to be tested;

Configuring an extracted DNA as a template; adding the primer, the probe, and a DNA polymerase reaction solution to the template to carry out a qPCR reaction; and recording a cycle threshold (Ct) value of the sample. The reaction conditions under which the qPCR reaction is carried out are as follows: 1 cycle of 95°C for 10 min; 40 cycles of 95°C for 10 s and 60°C for 30 s. A blank control, a negative control, and a positive control were set while carrying out a sample detection, where the blank control takes ddHz20 as the template for the gPCR reaction according to the above condition.

The primer and the probe for detecting R. rhodochrous by qPCR provided by tH&503130 present invention have good sensitivity and specificity. The qPCR method can qualitatively analyze whether there is R. rhodochrous in a microbial agent, which has advantages such as high-reliability results, good sensitivity, strong specificity, simple and rapid operation, and the like and further improves the detection system of the microbial agent.

BRIEF DESCRIPTION OF THE DRAWINGS

The attached drawings here are incorporated into the specification and form part of the specification, which shows embodiments in accordance with the present invention, and explains the principles of the present invention together with the specification.

To more clearly explain the embodiments of the present invention or the technical solution in the prior art, the attached drawings in the description of the embodiments or the prior art will be briefly introduced below. Other drawings can be obtained according to those attached drawings without creative labor by those skilled in the art.

FIG. 1 is a qPCR amplification pattern of a positive sample of R. rhodochrous detected;

FIG. 2 is a qPCR amplification pattern of an actual sample detected;

FIGS. 3 and 4 are qPCR amplification patterns showing sensitivity and repeatability;

FIG. 5 is a qPCR amplification pattern showing specificity in an embodiment of the present invention.

DETAILED DESCRIPTION OF THE EMBODIMENTS

The present invention is further explained by specific embodiments below, which do not limit the scope of protection of the present invention.

If it is not explicitly specified, the technical means used in the embodiments are conventional means familiar to those skilled in the art, and the products used are purchased in the market.

The detection process of the present invention is further described in detail below in combination with the specific embodiment, and the details are as follows: 1. Design of the primer and the probe

DNA (GenBank AB040101.1) of R. rhodochrous is selected as a target sequence, and qPCR specific amplification primer and probe are designed and synthesized by Primé#503130

Explore V4 online design software. Specifically: the qPCR primer includes a forward primer P1, a reverse primer P2, and a probe, especially: the forward primer P1: CCGGTTCTGGAAAGATCATCAC (SEQ No.1); the reverse primer P2: TTTCCCGGGTGTCAGAACTT (SEQ No.2); the probe: FAM-ACTCATCTGTATGGCAGCGT-BHQ1 (SEQ No.3), and a 5' end of the probe is labeled with a reporter fluorescent dye of FAM, and a 3' end is labeled with a quenched fluorescent dye of BHQ1. 2. Extraction and purification of sample DNA 2 mL of nutrition broth with overnight enrichment of R. rhodochrous is added to a 2 mL sterile centrifuge tube and centrifuged for 2 min at 10000 r/min. The resulting supernatant is discarded as much as possible. 570 µl of TE buffer is added to the resulting precipitate for re-suspension, followed by adding 100 pL of 10 mg/mL lysozyme for incubation for 30 min at 37°C, adding 30 pL of 10% SDS for incubation for 10 min at 65°C, and adding the same volume of phenol for uniform mixing and centrifugation for 10 min at 12000 r/min. The resulting supernatant is transferred into a new centrifuge tube. The above operations are repeated once. After two times of phenol extraction, the resulting supernatant is mixed with the same volume of phenol/chloroform (1:1 volume ratio) and centrifuged for 10 min at 12000 r/min. The resulting supernatant is added to a new centrifuge tube and the same volume of anhydrous ethanol and a volume of 1/10 of 3 mol/L sodium acetate is added, subjected to gentle and uniform mixing, and centrifuged for 10 min at 12000 r/ min. The resulting supernatant is discarded. The resulting precipitation is washed twice with 500 pL of 75% ethanol. The centrifuge tube is opened and placed at room temperature for several minutes to volatilize the ethanol. 100 pL of sterile water was added, and the centrifuge tube was stored at -20°C for detection. 3. Establishment of the qPCR amplification reaction system

The qPCR amplification reaction system includes 2 pL of a DNA solution of the sample to be tested; 0.5 µL of 5 U/uL Tag DNA polymerase; 12 pL of PCR reaction solution containing 10 mM Tris-HCl, 50 mM KCl, 25 mM MgCl, 2.5 mM of each dNTP; 1 µl of 10 mol/L primer pair shown in SEQ ID NO.1/2 (SEQ ID NO.1 and SEQ ID NO.2 each are 0.5 pL); 1 µl of 5 mol/L the probe; and 8.5 µL of sterilized ultrapure water.

The amount of reagents in the reaction system can be adjusted according to tH&503130 specific situation or the total volume of different reactions. 4. qPCR amplification reaction

The corresponding fluorescence channels are selected according to the operational requirements of the instrument. An amplification reaction condition is set at 1 cycle of 95°C for 10 min; 40 cycles of 95°C for 10 s and 60°C for 30 s. A FAM fluorescence signal is collected at 60°C, and a Ct value of the sample during the reaction is recorded. 5. Quality control index determination ddHz0 is configured as a template in the blank control to carry out the qPCR reaction according to the condition described in items 3 and 4, and the Ct value is detected to be greater than or equal to 40.

A genomic DNA of non-R. rhodochrous is configured as a template in the negative control to carry out the qPCR reaction according to the condition described in items 3 and 4, and the Ct value is detected to be greater than or equal to 40.

A genomic DNA of R. rhodochrous is configured as a template in the positive control to carry out the qPCR reaction according to the condition described in items 3 and 4, and the

Ct value is detected to be less than or equal to 35. 6. Result determination

If the Ct value of the sample to be tested (R. rhodochrous) is greater than or equal to 40, and the results of the negative control, positive control, and blank control are normal, the sample is considered as being not detected with R .rhodochrous.

If the Ct value of the sample to be tested (R. rhodochrous) is less than or equal to 35, and the results of the negative control, positive control, and blank control are normal, the sample is considered as being detected with R. rhodochrous.

If the Ct value of the sample to be tested (R. rhodochrous) is between 35 and 40, the gPCR amplification is conducted again. If the Ct value is more than 40 after the amplification again, and the results of the negative control, positive control, and blank control are normal, the sample is considered as being not detected with R. rhodochrous. If the Ct value is still less than 40 after the amplification again, and the results of the negative control, positive control, and blank control are normal, the sample is considered as being detected with R. rhodochrous.

7. Sample detection and result verification. LU503130

After DNA is extracted from the sample of R. rhodochrous in a microbial agent, qPCR detection is carried out according to the above detection process. After detection, the amplification result of the microbial agent containing R. rhodochrous is positive, while the amplification results of the negative control and the blank control indicate no amplification phenomenon, specifically as shown in FIG. 1. batches of microbial agents, 3 batches of which contain R. rhodochrous, are subjected to morphological and PCR detection based on the detection method established in the present invention. R. rhodochrous ACCC10494 is used as a control, and the detection results are consistent with the actual sample composition, specifically as shown in FIG. 2, where, a-sample 1, b-sample 2, c-sample 3, and d-R. rhodochrous

ACCC10494. 8. Sensitivity and repeatability detection

The extracted genomic DNA of R. rhodochrous is diluted to 110 ng/reaction, 11 ng/reaction, 1.1 ng/reaction, 0.11 ng/reaction, and 0.011 ng/reaction. Each dilution is repeated 8 times to verify the sensitivity of the primer and the probe for detecting R. rhodochrous. The detection results are shown in FIG. 3.

As shown in FIG. 3, the sensitivity of qPCR for detecting genomic DNA of R. rhodochrous can reach more than 0.011 ng /reaction. When the template concentration is 0.011 ng/reaction, the Ct value of the amplification is 35. It can be determined from the above results that if the Ct value<35, then R. rhodochrous is considered to be detected; if the Ct value>40, then R. rhodochrous is considered to be not detected; if 35<Ct value<40, then detection and determination are recommended being performed again.

The R. rhodochrous solution is diluted in series according to GB 4789.2-2016 and then subjected to a plate counting. A genomic DNA is extracted from each diluent and amplified according to the reaction system of the present invention. The sensitivity of the reaction system is determined by measuring the amount of bacteria CFU/mL. The R. rhodochrous solution is diluted, a genomic DNA of each diluted solution is extracted, and each dilution is repeated 8 times to verify the sensitivity of the primer and the probe for detecting R. rhodochrous. The detection results are shown in FIG. 4.

As shown in FIG. 4, the sensitivity of qPCR for detecting genomic DNA of R. rhodochrous can reach more than 46 CFU/mL. When the template concentration is 46

CFU/mL, the Ct value of the amplification is 35. It can be determined from the abo&/503130 results that if the Ct value<35, then R. rhodochrous is considered to be detected; if the Ct value>40, then To. rhodochrous is considered to be not detected; if 35<Ct value<40, then detection and determination are recommended being performed again. 9. Specificity detection

DNA samples of 3 strains of R. rhodochrous and 40 bacterial species of Rhodococcus equi are selected as templates to verify the specificity of the primer and the probe for detecting R. rhodochrous and the quality of the DNA extraction from the above 43 samples. The detection results are shown in FIG. 5, where a represents sample 1, b represents sample 2, and c represents sample 3.

As shown in FIG. 5, only R. rhodochrous is amplified, while no fluorescence signal is detected in all other samples and negative control. Therefore, the primer and the probe for detecting R. rhodochrous in the present invention are highly specific and suitable for detecting R. rhodochrous.

In summary, the primer, probe, reagent, and kit used in detection provided by the present embodiment have good sensitivity and specificity and involve simple and rapid operations with accurate and reliable detection results, which provides a simple, effective, and accurate detection method for identifying and detecting R. rhodochrous and further improves the detection system of a microbial agent.

Claims (6)

CLAIMS LU503130 1. A primer and a probe for detecting Rhodococcus rhodochrous (R. rhodochrous) by quantitative real-time PCR (qPCR), wherein the primer comprises a forward primer P1 and a reverse primer P2; the forward primer P1 comprised a sequence shown in SEQ No.1, the reverse primer P2 comprised a sequence shown in SEQ No.2, and the probe comprised a sequence shown in SEQ No.3. 2. The primer and the probe for detecting the А. rhodochrous by the qPCR according to claim 1, wherein a 5' end of the probe is labeled with a reporter fluorescent dye of FAM, and a 3' end of the probe is labeled with a quenched fluorescent dye of BHQ1. 3. A regent for detecting R. rhodochrous by qPCR, wherein the reagent comprehends the primer and the probe according to claim 1. 4. A kit for detecting R. rhodochrous by qPCR, wherein the kit comprises the primer and the probe according to claim 1 or the regent according to claim 3. 5. The kit for detecting the R. rhodochrous by the qPCR according to claim 4, wherein the kit further comprises a DNA polymerase reaction solution, a blank control, a positive control, and a negative control. 6. A method for detecting R. rhodochrous by qPCR, wherein the method uses the primer and the probe according to claim 1, or the regent according to claim 3, or the kit according to claim 4 or 5; wherein the method comprises the following steps: extracting a genomic DNA from a sample to be tested, configuring an extracted DNA as a template, adding the primer, the probe, and the DNA polymerase reaction solution to the template to carry out a qPCR reaction, and recording a cycle threshold (Ct) value of the sample during the reaction, wherein a reaction condition is as follows: 1 cycle of 95°C for 10 min; 40 cycles of 95°C for 10 s and 60°C for 30 s; and setting a blank control, a negative control, and a positive control while carrying out a sample detection; wherein the blank control takes ddH20 as a template for the qPCR reaction according to the reaction condition, and the Ct value is detected to be greater than or equal to 40; the negative control takes a genomic DNA of non-R. rhodochrous as a template for the qPCR reaction according to the reaction condition, and the Ct value is detected to be greater than or equal to 40; the positive control takes a genomic DNA of R. rhodochrous or a target gene plasmid fragment as a template for the qPCR reactidr}503130 according to the reaction condition, and the Ct value is detected to be less than or equal to 35; if the Ct value of the sample to be tested (R. rhodochrous) is greater than or equal to 40, and results of the negative control, the positive control, and the blank control are normal, then the sample is considered as being not detected with R. rhodochrous; if the Ct value of the sample to be tested (R. rhodochrous) is less than or equal to 35, and results of the negative control, the positive control, and the blank control are normal, then the sample is considered as being detected with R.rhodochrous; if the Ct value of the sample to be tested (R. rhodochrous) is between 35 and 40, then qPCR amplification is recommended being performed again; if the Ct value is more than 40 after the amplification again, and results of the negative control, the positive control, and the blank control are normal, then the sample is considered as being not detected with R. rhodochrous; if the Ct value is still less than 40 after the amplification again, and results of the negative control, the positive control, and the blank control are normal, then the sample is considered as being detected with R. rhodochrous. PATENTANSPRÜCHE LU503130 1. Primer und Sonde zum Nachweisen von Rhodococcus rhodochrous (R. rhodochrous) durch quantitative Echtzeit-PCR (qPCR), wobei der Primer einen Vorwärtsprimer P1 und einen Rückwärtsprimer P2 umfasst; der Vorwärtsprimer P1 eine in SEQ No.1 gezeigte Sequenz umfasst, der Rückwärtsprimer P2 eine in SEQ No.2 gezeigte Sequenz umfasst, und die Sonde eine in SEQ No.3 gezeigte Sequenz umfasst. 2. Primer und Sonde zum Nachweisen von R. rhodochrous durch qPCR nach Anspruch 1, wobei ein 5'-Ende der Sonde mit einem Reporterfluoreszenzfärbemittel FAM markiert ist und ein 3'-Ende der Sonde mit einem gelôschten Fluoreszenzfärbemittel BHQ1 markiert ist . 3. Reagens zum Nachweisen von R. rhodochrous durch qPCR, wobei das Reagens den Primer und die Sonde nach Anspruch 1 umfasst. 4. Kit zum Nachweisen von R. rhodochrous durch qPCR, wobei das Kit den Primer und die Sonde nach Anspruch 1 oder das Reagens nach Anspruch 3 umfasst. 5. Kit zum Nachweisen von R. rhodochrous durch qPCR nach Anspruch 4, wobei das Kit ferner eine DNA-Polymerasereaktionslosung, eine Blindkontrolle, eine positive Kontrolle und eine negative Kontrolle umfasst. 6. Verfahren zum Nachweisen von R. rhodochrous durch qPCR, wobei das Verfahren den Primer und die Sonde nach Anspruch 1 oder das Reagens nach Anspruch 3 oder das Kit nach Anspruch 4 oder 5 verwendet; wobei das Verfahren die folgenden Schritte umfasst: Extrahieren von genomischer DNA aus einer zu priifenden Probe, Konfigurieren extrahierter DNA als Matrize, Zusetzen des Primers, der Sonde und der DNA-Polymerasereaktionslôsung zu der Matrize zum Ausführen einer qPCR-Reaktion un d Aufzeichnen eines Zyklusschwellen(Ct )-Werts der Probe während der Reaktion, wobei eine Reaktionsbedingung wie folgt ist: 1 Zyklus von 95 °C für 10 min; 40 Zyklen von 95 °C for 10 s and 60 °C for 30 s; und Einsetzen einer Blindkontrolle, einer positiven Kontrolle und einer negativen Kontrolle während des Ausführens einer Probendetektion; wobei die Blindkontrolle ddH,0 als Matrize für die qPCR-Reaktion gemäß der Reaktionsbedingung nutzt und ein Ct-Wert größer oder gleich 40 detektiert wird; die negative Kontrolle genomische DNA von Nicht-R. rhodochrous als Matrize für die qPCR-Reaktion gemäß der Reaktionsbedingung nutzt und ein Ct-Wert größer oder gleighys03130 40 detektiert wird; die positive Kontrolle genomische DNA von R. rhodochrous or ein Zielgen-Plasmidfragment als Matrize für die qPCR-Reaktion gemäB der Reaktionsbedingung nutzt und ein Ct-Wert grôBer oder gleich 35 detektiert wird; wenn der Ct-Wert der zu prüfenden Probe (R. rhodochrous) größer oder gleich 40 ist und Ergebnisse der negativen Kontrolle, der positiven Kontrolle und der Blindkontrolle normal sind, gilt, dass R. rhodochrous nicht in der Probe nachgewiesen wurde; wenn der Ct-Wert der zu prüfenden Probe (R. rhodochrous) kleiner als oder gleich 35 ist und Ergebnisse der negativen Kontrolle, der positiven Kontrolle und der Blindkontrolle normal sind, gilt, dass R. rhodochrous in der Probe nachgewiesen wurde; wenn der Ct-Wert der zu prifenden Probe (R. rhodochrous) zwischen 35 und 40 liegt, eine erneute Durchführung der qPCR-Verstärkung empfohlen wird; wenn der Ct-Wert nach der Verstärkung erneut größer als 40 ist und Ergebnisse der negativen Kontrolle, der positiven Kontrolle und der Blindkontrolle normal sind, gilt, dass R. rhodochrous nicht in der Probe nachgewiesen wurde; wenn der Ct-Wert nach der Verstärkung weiterhin kleiner als 40 ist und Ergebnisse der negativen Kontrolle, der positiven Kontrolle und der Blindkontrolle normal sind, gilt, dass R. rhodochrous in der Probe nachgewiesen wurde.