CN108265120B

CN108265120B - 16-linked bovine mastitis pathogenic bacterium nucleic acid typing kit and detection method thereof

Info

Publication number: CN108265120B
Application number: CN201810019107.9A
Authority: CN
Inventors: 钟茂春; 游腾飞; 金虹; 付辉; 朱海; 卢菲婷
Original assignee: SHENZHEN BIOEASY BIOTECHNOLOGY CO LTD
Current assignee: Shenzhen Love Doctor Biotechnology Co., Ltd.
Priority date: 2018-01-09
Filing date: 2018-01-09
Publication date: 2020-08-14
Anticipated expiration: 2038-01-09
Also published as: CN108265120A

Abstract

The invention provides a nucleic acid typing kit for pathogenic bacteria of bovine mastitis in 16-linked cows and a detection method thereof₂、dNTP、dUTP、MgCl₂The cow mastitis PCR detection method is based on a multiple TaqMan probe real-time fluorescence PCR technology, can realize parallel detection of 15 pathogenic bacteria and β -lactamase resistance genes, only needs 4 hours in the whole process, and solves the problems that the traditional detection means of the cow pathogenic bacteria is not high in specificity, low in sensitivity, tedious in operation, incomplete in pathogenic bacteria detection in the prior art and the like.

Description

16-linked bovine mastitis pathogenic bacterium nucleic acid typing kit and detection method thereof

Technical Field

The invention belongs to the technical field of detection of cow mastitis pathogenic bacteria, and relates to a 16-linked cow mastitis pathogenic bacteria nucleic acid typing kit and a detection method thereof.

Background

Mastitis (mastitis) of dairy cows is mastitis of the dairy cows caused by stimulation of physical, chemical, microbial and other factors on mammary glands of the dairy cows, is mainly expressed by physicochemical property and bacteriological change of the milk and pathological change of mammary gland tissues, is one of four diseases in dairy cow breeding industry, and seriously influences the development of the dairy cow industry.

According to the statistics of the world dairy consortium, there are currently about 2.2 million cows worldwide, of which about 30% suffer from various types of mastitis. The national Mastitis committee NMC classifies diseased cows into Clinical Mastitis (Clinical Mastitis) and Subclinical Mastitis (Subclinical Mastitis. is) according to the presence or absence of clinically visible changes in their breasts. The incidence rate of clinical mastitis of cows in China is about 33.4 percent, the milk yield and the quality are reduced, serious cows can also cause the abandonment of breasts, suppuration in the breast area, gangrene and atrophy, so that the affected cows are eliminated because the lactation capacity of the affected cows is lost forever, the average positive rate of the cows with the recessive mastitis is 73.9 percent, the recessive mastitis has no clinical manifestation, is difficult to be found, and can be developed into clinical mastitis inevitably when the treatment is not in time. Therefore, the rapid detection and identification of the pathogenic bacteria in the milk of the dairy cow are the premise of timely and effective control and prevention of the spread of the pathogenic bacteria, which has important significance for the health of the dairy cow and human beings.

Cow mastitis is mainly caused by a variety of nonspecific pathogenic microorganisms, and about 150 species including bacteria, mycoplasma, fungi, and viruses have been found so far. According to their origin and mode of transmission, they can be classified as infectious and environmental pathogenic microorganisms. Infectious pathogenic microorganisms can be spread and diffused among cattle groups through personnel or equipment, mainly comprise staphylococcus aureus, streptococcus agalactiae, mycoplasma and the like, are widely existed in cow living environments such as excrement, sewage, bedding, soil and the like, can enter a milk pool through a papilla duct to cause mammary gland infection, and mainly comprise proteus, saccharomycetes, coagulase negative staphylococcus, escherichia coli, streptococcus uberis, streptococcus agalactiae, corynebacterium bovis, klebsiella, cryptococcus pyogenes and the like.

In acute mastitis cases, the inflammation is mainly caused by infection with a pathogenic bacterium. In many countries, mastitis in cows caused by staphylococcus is most common. Staphylococcus aureus is the most main infectious pathogenic bacterium causing mastitis, gram stain is positive, most strains are positive in coagulase and contact test, once cattle are infected, the cattle are difficult to eradicate, various suppurative diseases, mastitis, septicemia and the like of people or animals can be caused, and the staphylococcus aureus is also the most difficult pathogenic bacterium to treat clinically and causes the largest economic loss. The beta-lactamase antibiotics are generally used for treatment clinically, and the overuse of antibacterial drugs leads to the increasing of the drug resistance of bacteria, the drug resistance of staphylococcus to the beta-lactamase antibiotics is caused by the generated beta-lactamase, the beta-lactamase of staphylococcus is expressed by 'blaZ', and pathogenic bacteria containing the gene can generate the drug resistance to the beta-lactamase antibiotics and can only be treated by using other antibiotics.

The mamma and the milk of the cow suffering from clinical mastitis have macroscopic symptoms, diagnosis can be made according to the clinical symptoms, the diagnosis of the invisible mastitis needs to be confirmed by means of a laboratory diagnosis method because no clinical expression exists, and the existing detection methods of the pathogenic bacteria of the cow mastitis comprise pathogenic microorganism separation culture, a conventional physiological and biochemical identification method, PCR, a gene chip technology, fluorescent quantitative PCR and the like. The isolation culture of the bacteria is the gold standard for bovine mastitis diagnosis, and can further detect the drug resistance of the bacteria, but the time consumption is long, part of pathogenic bacteria are difficult to culture, no standardized operation is performed, and clinical treatment is started before the diagnosis result is obtained, so that ineffective treatment, drug abuse, treatment cost increase and the like can be caused. The real-time fluorescence PCR technology leads the whole process of the amplification and analysis of PCR products to be closed and completed in a single tube by introducing a specific probe and dynamically monitoring a fluorescence signal, can carry out real-time dynamic monitoring and automatic analysis on the PCR amplification products, has the characteristics of real time, accuracy, rapidness, convenience and the like, and is an advanced molecular detection technology. Particularly, the multiplex fluorescence PCR method can not only save the using amount of reagents, but also shorten the detection time, and can accurately detect the infection pathogen and the resistance gene, thereby providing more accurate guidance for the treatment, prevention and control of bovine mastitis. However, related patents in China mainly detect a plurality of pathogenic bacteria causing mastitis of the dairy cows, the detection types are too few, and the detection is only performed aiming at the pathogenic bacteria, so that the detection range is limited.

At present, the detection of mastitis pathogenic bacteria and drug resistance of dairy cows mainly comprises bacterial isolation and drug sensitivity tests, which take long time and result accuracy is not high. However, related patents in China mainly detect several pathogenic bacteria causing mastitis of dairy cows, the detection types are too few, common PCR methods are mostly adopted, and only the pathogenic bacteria are detected, and no method for simultaneously detecting the pathogenic bacteria and resistance genes exists.

Disclosure of Invention

Therefore, the invention provides a nucleic acid typing kit for pathogenic bacteria of 16-linked bovine mastitis, which comprises a test solution A and a reagent kit B, wherein the test solution A comprises 5 × PCR buffer solution, BSA, DMSO and MgCl₂、dNTP、dUTP、MgCl₂Glycerol and primers and probes;

b, test solution: UDG enzyme, ExTaq enzyme and enzyme stock solution;

c, test solution: deionized water;

positive quality control product: mixing the plasmid mother liquor of 16 detection items uniformly by using TEbuffer, wherein the recombinant plasmid mixed liquor is a recombinant plasmid mixed liquor of 15 pathogenic bacteria and beta-lactamase amplification sequences;

negative quality control product: TE buffer solution.

Preferably, the solution A contains 5.0. mu.L of 5 × PCR Buffer, 0.1. mu. L, DMSO 0.65.65. mu.L of 50mg/ml BSA, 0.4. mu.L of 25mM dNTP, 0.1. mu.L of 100mM dUTP, and 25mM MgCl₂2 mu L of the solution; 1 μ L of 50% glycerol; upstream and downstreamEach of the primers was 0.6. mu.L, and the probe was 0.3. mu.L.

The test solution B: 1 muL of 5U/. mu.L Taq enzyme, 0.4 muL of 1U/. mu.L UDG enzyme (1U/. mu.L) and 2.6 muL enzyme stock solution;

preferably, in each tube of the test solution A, four of staphylococcus, escherichia coli, cryptococcus pyogenes, yeast, staphylococcus aureus, mycoplasma, streptococcus agalactiae, corynebacterium bovis, beta-lactamase gene, streptococcus dysgalactiae, serratia marcescens, prototheca, klebsiella, streptococcus uberis, mycoplasma bovis and enterococcus are adopted as the upstream primer and the downstream primer.

Preferably, the sequences of the primers and probes are as follows:

for RecA gene: an upstream primer: CCAGTACGGRAAATGCCTTCTCC, downstream primer: CGTGCCTTGAAATTCTATGCTTCTG, respectively;

probe for RecA gene: ACCTCTGCCACTTTAAACGGAGGAGCTACC, the 3 'end of the optical probe is marked with a fluorescence quenching group BHQ, and the 5' end is respectively marked with different fluorescence reporting groups HEX;

for the RecA gene of streptococcus uberis: an upstream primer: TCACCTGTRCGAGAGATACCTGTA, downstream primer: CTTCCGTTCGATTAGATGTTCG, respectively;

probes against the RecA gene of streptococcus uberis: ACGGTGGTGCAACTTTATYTTTAACAACCTTAATT, the 3 'end of the fluorescent probe is marked with a fluorescence quenching group BHQ, and the 5' end is respectively marked with different fluorescence reporting groups HEX; for streptococcus agalactiae specific gene cfb gene:

an upstream primer: ACATGCAAGTAGAACGCTGAGGTTTG

A downstream primer: TCCAATAGTTATCCCCCGCTAT

Probes against the streptococcus agalactiae specific gene cfb gene: TGTTTACACTAGACTGATGAGTTGCGA, the 3 'end of the fluorescent probe is marked with a fluorescence quenching group BHQ, and the 5' end is respectively marked with different fluorescence reporting groups HEX; aiming at a special gene Nuc gene of staphylococcus aureus;

an upstream primer: CATCCTAARAAAGGTGTAGAGTAGAG

A downstream primer: TCAGTTCTTTGACCTTTGT

A probe aiming at a special gene Nuc gene of staphylococcus aureus: TGTAGAGAARTATGGTCCTGAAGCA, the 3 'end is marked with a fluorescence quenching group BHQ, and the 5' end is respectively marked with different fluorescence reporter groups FAM;

for the E.coli Air gene:

an upstream primer: ACTCGAAGGCTTTTTTGA

A downstream primer: CAGACGGTAACCGGCTCGTC

Probes for the Air gene of E.coli: AGATCTGCCGACGATTTCTGCGCAACAT, respectively; the 3 'end is marked with a fluorescence quenching group BHQ, and the 5' end is respectively marked with different fluorescence reporter groups HEX;

aiming at a peculiar gene Plo gene-hemolysin expression gene of the cryptobacter pyogenes:

an upstream primer: GTTGACGGTAAGAATAAGGT

A downstream primer: GATCTTTGCAGCATGGTCAG

A probe aiming at a peculiar gene Plo gene-hemolysin expression gene of the cryptobacter pyogenes: TCCCACGAAGAGTTCCGTGACTCAA, the 3 'end of the fluorescent probe is marked with a fluorescence quenching group BHQ, and the 5' end is respectively marked with different fluorescence reporting groups ROX;

for the mycoplasma bovis RecA gene:

an upstream primer: GACAGTGGTGAGCAGGCTAT

A downstream primer: GCACTCCAACTTGCATATC

Probe for the RecA gene of mycoplasma bovis: ATGGAAATTGTTGATATTTTAGCTA, the 3 'end of the fluorescent probe is marked with a fluorescence quenching group BHQ, and the 5' end is respectively marked with different fluorescence reporting groups ROX;

for Serratia marcescens SsmE gene:

an upstream primer: GGAGCTTGGCGTGATAGGG

A downstream primer: GTAGATGGCAATCACTTCGTTGGTGCGA

Probes for the serratia marcescens ssmE gene: AACGCCGATGATAACTACA, the 3 'end of the fluorescent probe is marked with a fluorescence quenching group BHQ, and the 5' end is respectively marked with different fluorescence reporting groups ROX;

for the corynebacterium bovis 16s rRNA sequence:

an upstream primer: CGAAGAACCTTACCTGGGCTT

A downstream primer: ACAACCATGCACCACCTGT

A probe aiming at a corynebacterium bovis 16s rRNA sequence, ATGGGCAGGACCGGCGTGGAGACAC, wherein the 3 'end of the fluorescent probe is marked with a fluorescence quenching group BHQ, and the 5' end of the fluorescent probe is respectively marked with different fluorescence reporting groups Cy 5;

for the klebsiella PhoE gene:

an upstream primer: ATCAGAACCTGCTGGCCCGC

A downstream primer: GTCGCCAGGTAGATATTGTT

CCAGGGTTCGAAAGCGGAAGCCTGGGC, a 3 'end of the probe is marked with a fluorescence quenching group BHQ, and a 5' end of the probe is respectively marked with different fluorescence reporter groups FAM aiming at the PhoE gene of the Klebsiella;

against saccharomyces 18 srna sequence:

an upstream primer: AATAATAGAATAGGACGTTAT

A downstream primer: GGTAAATGCTTTCGCAGTAGT

TGGTCCTAGAAACCAACAAAATAGAACC, a fluorescence quenching group BHQ is marked at the 3 'end of the PCR probe aiming at the zymophyte 18srRNA sequence, and different fluorescence reporting groups Cy5 are respectively marked at the 5' end;

against mycoplasma 16 srna sequence:

an upstream primer: ACTCCTACGGGAGGCAGCA

A downstream primer: CGCGGCTGCTGGCACATAGTT

CAGTAGGGAATATTCCACAATGGACG, a 3 'end of the probe is marked with a fluorescence quenching group BHQ, and a 5' end of the probe is respectively marked with different fluorescence reporter groups ROX aiming at the mycoplasma 16srRNA sequence;

against the staphylococcus 16s rRNA sequence:

an upstream primer: AACAACTTTATGGGATTTGCT

A downstream primer: GGCACTCTAAGTTGACTGCC

ACCTCGCGGTTTCGCTGCCCTTTGTATT, a 3 'end of the probe is marked with a fluorescence quenching group BHQ, and a 5' end of the probe is respectively marked with different fluorescence reporter groups FAM aiming at a staphylococcus 16s rRNA sequence;

for plasmodium 18s rRNA:

an upstream primer: AGGGAGGTAGTGACAATAC

A downstream primer: CGCGGCTGCTGGCACCAGACTT

A probe for 18s rRNA of the genus prototheca, ACGTAGCGATGCCGAACTATCACTTTGGCA, wherein the 3 'end of the fluorescent probe is marked with a fluorescence quenching group BHQ, and the 5' end of the fluorescent probe is respectively marked with different fluorescence reporting groups Cy 5;

against enterococcus 16s rRNA:

an upstream primer: TGGCGAACGGGTGAGTAAC

A downstream primer: CCGCGGGTCCATCCATCA

GGGTAACCTACCCATCAGAGGGGGATAACACT, a fluorescence quenching group BHQ is marked at the 3 'end of the probe aiming at the enterococcus 16s rRNA, and different fluorescence reporting groups Cy5 are respectively marked at the 5' end;

for the beta-lactamase BlaZ gene:

an upstream primer: GGAGATAAAGTAACAAATCCAG

A downstream primer: TGTTTTCTTTGCTTAATTTTCCA

The probe aiming at the beta-lactamase BlaZ gene is ATATGAGATAGAATTAAATTACTATTCACCAAA, wherein a fluorescence quenching group BHQ is marked at the 3 'end, and different fluorescence reporter groups FAM are respectively marked at the 5' end.

The invention also correspondingly provides a multiple Q-PCR method for detecting bovine mastitis pathogenic bacteria and beta-lactamase anti-gene, which comprises the following steps:

step (1): extraction of sample DNA: the sample DNA is obtained by using the kit according to claim 1;

step (2): taking a sample DNA to be detected as a template, and respectively preparing 4 tubes of Q-PCR reaction liquid 1-4, wherein the reaction system is as follows: adding Q-PCR Master Mix 1-419 uL, enzyme mixture 1u L, DNA template 5 uL, and setting positive control and negative control respectively;

and (3): amplification procedure Q-PCR amplification was performed according to the following procedure

The gene designations and markers were set as follows:

the invention further adopts the technical scheme, and has the advantages that genetic materials (DNA) are amplified in vitro, and are identified according to the uniqueness of DNA sequences of different pathogenic bacteria, the technology has the advantages of high sensitivity, strong specificity, large flux, reliable result and the like, the whole process operation only needs 4 hours, and the technology can be used for analyzing fresh or preservative-treated milk samples in milk regions, DHI detection milk samples and vat milk samples on site. The technology can simultaneously detect 15 pathogenic bacteria and beta-lactamase resistance genes appearing in a milk sample, and solves the problems existing in conventional bacterial culture methods such as difficult culture, incapability of culture and the like. Provides more accurate information for the improvement of pasture environment and the treatment and prevention of bovine mastitis.

Preferably, the quality control comprises the steps of:

negative control: the FAM channel, the HEX channel, the ROX channel and the Cy5 channel of the PCR reaction solution 1-4 have No amplification curve, the Ct value is shown as Undet and No Ct or not, negative control of the individual channel generates a tail warping signal, and when the Ct value is more than or equal to 35, result interpretation is not influenced.

Positive control: FAM channels, HEX channels, ROX channels and Cy5 channels of the PCR reaction solution 1-4 all have amplification curves, and Ct values are all less than or equal to 30;

the two requirements need to be met in the same experiment, otherwise, the experiment is invalid and needs to be carried out again.

The invention has the beneficial effects that:

the PCR detection method for the mastitis of the dairy cattle is based on a multiple TaqMan probe real-time fluorescent PCR technology, can realize the parallel detection of 15 pathogenic bacteria and beta-lactamase resistance genes, only needs 4 hours in the whole process, and solves the problems that the traditional detection means for the pathogenic bacteria of the dairy cattle is not high in specificity, low in sensitivity, tedious and time-consuming in operation, incomplete in pathogenic bacteria detection in the prior patent technology and the like. The dominant bacterial strain infected by the sick dairy cow can be judged through the fluorescent quantitative result, and more accurate, faster and more comprehensive guidance is provided for the treatment, prevention and control of the dairy cow mastitis in the pasture.

Drawings

FIG. 1 is a schematic diagram of the use of the cow mastitis data analysis software.

Detailed Description

The following further details preferred embodiments of the invention:

example 1

The cow mastitis detection kit innovatively adopts a 4-fold Q-PCR technology, and realizes the detection and identification of 15 common pathogenic bacteria and beta-lactamase genes for cow mastitis through 4-tube PCR MIX. The kit comprises the following test solutions:

Q-PCR Master Mix1 containing 5.0. mu.L of 5 × PCR Buffer, 0.1. mu.L of BSA (50mg/ml), 0.4. mu.L of dNTP (25mM), 0.1. mu.L of dUTP (100mM), MgCl₂2 μ L (25 mM); 1 μ L of 50% glycerol; 0.6. mu.L of each of the upstream and downstream primers (10. mu.M) of Staphylococcus genus and 0.3. mu.L of each of the probes (10. mu.M); coli upstream and downstream primers (10. mu.M) 0.4. mu.L each, and probe (10. mu.M) 0.2. mu.L; 0.4 mul of each of the upper and lower primers (10 mul) of the cryptococcus pyogenes, and 0.2 mul of the probe (10 mul); yeast genus upstream and downstream primers (10. mu.M) 0.4. mu.L each, and probe (10. mu.M) 0.2. mu.L; DMSO 0.65 μ L; deionized water was replenished to 19. mu.L.

Q-PCR Master Mix 2 containing 5 × PCR Buffer 5.0. mu.L, BSA (50mg/ml) 0.1. mu.L, dNTP (25mM) 0.4. mu.L, dUTP (100mM) 0.1. mu.L, MgCl₂2 μ L (25 mM); 1 μ L of 50% glycerol; staphylococcus aureus upstream and downstream primers (10. mu.M) each 0.6. mu.L, and probe (10. mu.M) 0.3. mu.L; mycoplasma upstream and downstream primers (10. mu.M) 0.4. mu.L each, and probe (10. mu.M) 0.2. mu.L; 0.5. mu.L of each of the primers (10. mu.M) for the upstream and downstream of Streptococcus agalactiae, and 0.3. mu.L of each of the probes (10. mu.M); 0.4. mu.L of each of the upstream and downstream primers (10. mu.M) of Corynebacterium bovis and 0.2. mu.L of the probe (10. mu.M); deionized water was replenished to 19. mu.L.

Q-PCR Master Mix 3 containing 5 × PCR Buffer 5.0. mu.L, BSA (50mg/ml) 0.1. mu.L, dNTP (25mM) 0.4. mu.L;dUTP(100mM)0.1μL；MgCl₂2 muL (25mM), 1 muL of 50% glycerol, 0.6 muL of each of the upstream and downstream primers (10 muM) of β -lactamase gene, 0.3 muL of probe (10 muM), 0.4 muL of each of the upstream and downstream primers (10 muM) of Streptococcus dysgalactiae, 0.2 muL of probe (10 muM), 0.4 muL of each of the upstream and downstream primers (10 muM) of Serratia marcescens, 0.2 muL of probe (10 muM), 0.4 muL of each of the upstream and downstream primers (10 muM) of Prokinensis, 0.2 muL of probe (10 muM), and 19 muL of deionized water.

Q-PCR Master Mix 4 containing 5 × PCR Buffer 5.0. mu.L, BSA (50mg/ml) 0.1. mu.L, dNTP (25mM) 0.4. mu.L, dUTP (100mM) 0.1. mu.L, MgCl₂2 μ L (25 mM); 1 μ L of 50% glycerol; klebsiella upstream and downstream primers (10. mu.M) 0.6. mu.L each, and probe (10. mu.M) 0.3. mu.L; mu.L of the upstream and downstream primers (10 mu.M) of Streptococcus uberis, respectively, and 0.2 mu.L of the probe (10 mu.M); 0.4. mu.L of each of the upstream and downstream primers (10. mu.M) of Mycoplasma bovis and 0.2. mu.L of the probe (10. mu.M); 0.4. mu.L of each of the primers (10. mu.M) of the enterococcus upstream and downstream and 0.2. mu.L of each of the probes (10. mu.M); deionized water was replenished to 19. mu.L.

Enzyme mixture liquid: hot start Taq enzyme (5U/. mu.L), 1. mu. L, UDG enzyme (1U/. mu.L), 0.4. mu.L enzyme stock solution, 2.6. mu.L enzyme stock solution. Positive quality control product: is a recombinant plasmid mixed solution of 15 pathogenic bacteria and beta-lactamase amplification sequences, and plasmid mother solutions of 16 detection items are uniformly mixed according to a certain proportion by using TE buffer.

Negative quality control product: TE buffer (no nucleic acid).

Example 2

A multiplex Q-PCR method for detecting bovine mastitis pathogenic bacteria and a beta-lactamase anti-gene comprising the steps of:

1) extraction of sample DNA: the sample DNA can be extracted by adopting a column type extraction kit for producing the bacterial DNA by Shenzhen Yirui biotechnology Limited and according to the kit specification.

2) Taking a sample DNA to be detected as a template, and respectively preparing 4 tubes of Q-PCR reaction liquid 1-4, wherein the reaction system is as follows: Q-PCR Master Mix 1-419. mu.L was added, and the enzyme mixture 1. mu. L, DNA template 5. mu.L. And positive control and negative control were set up separately.

3) Amplification procedure Q-PCR amplification was performed according to the following procedure

The gene designations and markers were set as follows:

4) and (4) analyzing results:

4.1 after the experiment is finished, the detection data file is saved.

4.2 analysis conditions set: adjusting the Start Value and the Stop Value of a Baseline (Baseline) and the Value of a Threshold (Threshold) according to the analyzed images (the user can adjust the values according to actual conditions, the Start Value can be 3-15, the end Value can be 5-20, and the amplification curve of the negative control is adjusted to be flat or lower than the Threshold line), so that the instrument gives correct results.

5) Quality control:

5.1 negative control: the FAM channel, the HEX channel, the ROX channel and the Cy5 channel of the PCR reaction solution 1-4 have No amplification curve, the Ct value is shown as Undet and No Ct or not, negative control of the individual channel generates a tail warping signal, and when the Ct value is more than or equal to 35, result interpretation is not influenced.

5.2 Positive control: FAM channels, HEX channels, ROX channels and Cy5 channels of the PCR reaction solution 1-4 all have amplification curves, and Ct values are all less than or equal to 30;

6) Interpretation of test results

Judging the experimental result according to the interpretation standard listed in the following table and combining with an amplification curve, and avoiding false positive or false negative caused by some abnormal amplification signals when the result is interpreted as far as possible;

note: 1. because the copy numbers of target genes selected by different detection items in the thallus are different, the judgment standards of different items are different;

2. if the negative control has an amplification signal, and the CT negative control-CT sample is more than or equal to 3, the sample can be judged to be weak positive.

7) Use of cow mastitis data analysis software

7.1 output ". xls" file on YR-8000 software, the operation is as follows: on the interface of the amplification curve, a data hole to be output is selected, then a 'file' pull-down menu at the upper left corner is clicked, an 'export' key is selected, a popup report is popped up to set a popup window, a report type is selected to be 'Lis', and a 'export' key is clicked to output a file in which an xls format is generated, as shown in fig. 1.

7.2 click to open Yirui data analysis software, select model "YR-8000", click "select sample data"

And importing xls data to be analyzed, and clicking 'export analysis data' to finish analysis and sorting of the data. 8) Interpretation of the results of the assay

8.1 bovine mastitis infection-type pathogenic bacteria include Staphylococcus aureus, Streptococcus agalactiae, Mycoplasma bovis, Corynebacterium bovis, Mycoplasma genus, etc.

8.2 environmental pathogens include Staphylococcus, Escherichia coli, Klebsiella, Streptococcus dysgalactiae, Proteus, Streptococcus uberis, Cryptobacterium pyogenes, Serratia marcescens, Saccharomyces, enterococcus, etc.

8.3 judging the type of the cow mastitis pathogenic bacteria infected by the sample according to the dominant bacteria of the detection result of the sample.

The multiple Taqman probe real-time fluorescence PCR detection method for the mastitis of the dairy cattle, disclosed by the invention, is used for designing primers and probes aiming at conserved sequences of the 15 concurrent pathogens and the beta-lactase gene, can be used for detecting 15 pathogens and beta-lactase DNA in a specific manner in a parallel manner, is wide in detection range and strong in specificity, and greatly shortens the detection time required by a traditional culture method.

The detection system contains an UDG enzyme-dUTP anti-pollution system, so that false positive caused by laboratory PCR product pollution is reduced to the maximum extent, and the accuracy of the detection result is improved.

The foregoing is a more detailed description of the invention in connection with specific preferred embodiments and it is not intended that the invention be limited to these specific details. For those skilled in the art to which the invention pertains, several simple deductions or substitutions can be made without departing from the spirit of the invention, and all shall be considered as belonging to the protection scope of the invention.

。

Claims

1. A typing kit for detecting 15 pathogenic bacteria and 1 beta-lactamase drug-resistant gene is characterized in that the kit comprises the following components:

the sample A contains 5 × PCR buffer solution, BSA, DMSO, and MgCl₂dNTP, dUTP, glycerol and primers and probes;

b, test solution: UDG enzyme, ExTaq enzyme and enzyme stock solution;

c, test solution: deionized water;

positive quality control product: mixing the plasmid mother liquor of 16 detection items uniformly by using TE buffer, wherein the recombinant plasmid mixed liquor is a recombinant plasmid mixed liquor of 15 pathogenic bacteria and beta-lactamase amplification sequences;

negative quality control product: TE buffer solution;

the sequences of the primers and the probes are as follows:

for streptococcus dysgalactiae RecA gene: an upstream primer: CCAGTACGGRAAATGCCTTCTCC, downstream primer: CGTGCCTTGAAATTCTATGCTTCTG, respectively;

probes against the streptococcus dysgalactiae RecA gene: ACCTCTGCCACTTTAAACGGAGGAGCTACC, the 3 'end of the fluorescent probe is marked with a fluorescence quenching group BHQ, and the 5' end is marked with a fluorescence reporter group HEX;

probes against the RecA gene of streptococcus uberis: ACGGTGGTGCAACTTTATYTTTAACAACCTTAATT, the fluorescent probe is marked with a fluorescence quenching group BHQ at the 3 'end and a fluorescence reporter group HEX at the 5' end;

for streptococcus agalactiae specific gene cfb gene:

an upstream primer: ACATGCAAGTAGAACGCTGAGGTTTG

A downstream primer: TCCAATAGTTATCCCCCGCTAT

Probes against the streptococcus agalactiae specific gene cfb gene: TGTTTACACTAGACTGATGAGTTGCGA, the fluorescent probe is marked with a fluorescence quenching group BHQ at the 3 'end and a fluorescence reporter group HEX at the 5' end;

aiming at a special gene Nuc gene of staphylococcus aureus;

an upstream primer: CATCCTAARAAAGGTGTAGAGTAGAG

A downstream primer: TCAGTTCTTTGACCTTTGT

A probe aiming at a special gene Nuc gene of staphylococcus aureus: TGTAGAGAARTATGGTCCTGAAGCA, a fluorescence quenching group BHQ is marked at the 3 'end, and a fluorescence reporter group FAM is marked at the 5' end;

for the E.coli Air gene:

an upstream primer: ACTCGAAGGCTTTTTTGA

A downstream primer: CAGACGGTAACCGGCTCGTC

Probes for the Air gene of E.coli: AGATCTGCCGACGATTTCTGCGCAACAT, respectively; a fluorescence quenching group BHQ is marked at the 3 'end, and a fluorescence reporter group HEX is marked at the 5' end;

an upstream primer: GTTGACGGTAAGAATAAGGT

A downstream primer: GATCTTTGCAGCATGGTCAG

A probe aiming at a peculiar gene Plo gene-hemolysin expression gene of the cryptobacter pyogenes: TCCCACGAAGAGTTCCGTGACTCAA, the 3 'end of the fluorescent probe is marked with a fluorescence quenching group BHQ, and the 5' end is marked with a fluorescence reporter group ROX;

for the mycoplasma bovis RecA gene:

an upstream primer: GACAGTGGTGAGCAGGCTAT

A downstream primer: GCACTCCAACTTGCATATC

Probe for the RecA gene of mycoplasma bovis: ATGGAAATTGTTGATATTTTAGCTA, the 3 'end of the fluorescent probe is marked with a fluorescence quenching group BHQ, and the 5' end is marked with a fluorescence reporter group ROX;

for Serratia marcescens SsmE gene:

an upstream primer: GGAGCTTGGCGTGATAGGG

A downstream primer: GTAGATGGCAATCACTTCGTTGGTGCGA

Probes for the serratia marcescens ssmE gene: AACGCCGATGATAACTACA, the fluorescent probe is marked with a fluorescence quenching group BHQ at the 3 'end and a fluorescence reporter group ROX at the 5' end;

for the corynebacterium bovis 16s rRNA sequence:

an upstream primer: CGAAGAACCTTACCTGGGCTT

A downstream primer: ACAACCATGCACCACCTGT

A probe aiming at a corynebacterium bovis 16s rRNA sequence, ATGGGCAGGACCGGCGTGGAGACAC, wherein the 3 'end of the fluorescent probe is marked with a fluorescence quenching group BHQ, and the 5' end of the fluorescent probe is marked with a fluorescence reporting group Cy 5;

for the klebsiella PhoE gene:

an upstream primer: ATCAGAACCTGCTGGCCCGC

A downstream primer: GTCGCCAGGTAGATATTGTT

CCAGGGTTCGAAAGCGGAAGCCTGGGC, a 3 'end of the probe aiming at the PhoE gene of the Klebsiella is marked with a fluorescence quenching group BHQ, and a 5' end of the probe is marked with a fluorescence reporter group FAM;

against saccharomyces 18 srna sequence:

an upstream primer: AATAATAGAATAGGACGTTAT

A downstream primer: GGTAAATGCTTTCGCAGTAGT

TGGTCCTAGAAACCAACAAAATAGAACC, a fluorescence quenching group BHQ is marked at the 3 'end, and a fluorescence reporting group Cy5 is marked at the 5' end of the PCR probe aiming at the zymophyte 18srRNA sequence;

against mycoplasma 16 srna sequence:

an upstream primer: ACTCCTACGGGAGGCAGCA

A downstream primer: CGCGGCTGCTGGCACATAGTT

CAGTAGGGAATATTCCACAATGGACG, a fluorescence quenching group BHQ is marked at the 3 'end and a fluorescence reporting group ROX is marked at the 5' end of the probe aiming at the mycoplasma 16srRNA sequence;

against the staphylococcus 16s rRNA sequence:

an upstream primer: AACAACTTTATGGGATTTGCT

A downstream primer: GGCACTCTAAGTTGACTGCC

ACCTCGCGGTTTCGCTGCCCTTTGTATT, a fluorescence quenching group BHQ is marked at the 3 'end and a fluorescence reporter group FAM is marked at the 5' end of the probe aiming at the staphylococcus 16s rRNA sequence;

for plasmodium 18s rRNA:

an upstream primer: AGGGAGGTAGTGACAATAC

A downstream primer: CGCGGCTGCTGGCACCAGACTT

A probe for 18s rRNA of the genus prototheca, ACGTAGCGATGCCGAACTATCACTTTGGCA, wherein the 3 'end of the fluorescent probe is marked with a fluorescence quenching group BHQ, and the 5' end of the fluorescent probe is marked with a fluorescence reporting group Cy 5;

against enterococcus 16s rRNA:

an upstream primer: TGGCGAACGGGTGAGTAAC

A downstream primer: CCGCGGGTCCATCCATCA

GGGTAACCTACCCATCAGAGGGGGATAACACT, a fluorescence quenching group BHQ is marked at the 3 'end and a fluorescence reporting group Cy5 is marked at the 5' end of the probe aiming at the enterococcus 16s rRNA;

for the beta-lactamase BlaZ gene:

an upstream primer: GGAGATAAAGTAACAAATCCAG

A downstream primer: TGTTTTCTTTGCTTAATTTTCCA

The probe aiming at the beta-lactamase BlaZ gene is ATATGAGATAGAATTAAATTACTATTCACCAAA, wherein the 3 'end is marked with a fluorescence quenching group BHQ, and the 5' end is marked with a fluorescence reporter group FAM.

2. The kit of claim 1, wherein the A test solution contains 5.0 μ L of 5 × PCR Buffer, 0.1 μ L, DMSO 0.65.65 μ L of 50mg/ml BSA, 0.4 μ L of 25mM dNTP, 0.1 μ L of 100mM dUTP, and 25mM MgCl₂2 muL; 1 muL of 50% glycerol; the upstream and downstream primers are 0.6 muL each, and the probe is 0.3 muL.

3. The kit of claim 1, wherein the reagent solution B comprises: 1 muL of 5U/muL Taq enzyme, 0.4 muL of 1U/muL UDG enzyme and 2.6 muL of enzyme stock solution.

4. The kit of claim 1, wherein the upstream primer and the downstream primer are selected from four of staphylococcus, escherichia coli, cryptococcus pyogenes, yeast, staphylococcus aureus, mycoplasma, streptococcus agalactiae, corynebacterium bovis, beta-lactamase gene, streptococcus dysgalactiae, serratia marcescens, plasmodium, klebsiella, streptococcus uberis, mycoplasma bovis, and enterococcus in each tube of the test solution a.