WO2008150031A1

WO2008150031A1 - Inhibitor of biosynthesis of plant hormone auxin, chemical plant regulator comprising the inhibitor as active ingredient, herbicidal agent, and use thereof

Info

Publication number: WO2008150031A1
Application number: PCT/JP2008/060811
Authority: WO
Inventors: Yukihisa Shimada; Hideki Goda; Tomoe Tachikawa; Takahiro Ishii; Kazuo Soeno; Shozo Fujioka; Tadao Asami
Original assignee: Riken
Priority date: 2007-06-08
Filing date: 2008-06-06
Publication date: 2008-12-11
Also published as: JPWO2008150031A1; JP2013067656A

Abstract

The first object is to provide an inhibitor of the synthesis of endogenous auxin. The second object is to provide a plant growth inhibitor or a herbicidal agent utilizing the auxin biosynthesis inhibitor. Thus, disclosed are: a method for screening a candidate for an auxin biosynthesis inhibitor capable of inhibiting the expression of an auxin-inducible gene, by adding each of candidate compounds for the auxin inhibitor to a plant; a method for selecting a compound capable of actually inhibiting the auxin synthesis in a plant, by adding each of candidate compounds to the plant, disrupting the plant and then measuring the amount of endogenous auxin; and a method for selecting a compound capable of inhibiting the production of indolpyruvic acid in the presence of a tryptophan deaminase and tryptophan which are prepared in advance. More specifically disclosed are: an auxin biosynthesis inhibitor comprising AVG, AOA, AOIBA, L-AOPP or an analogue thereof; and a plant growth regulator or a herbicidal agent comprising the compound as an active ingredient.

Description

Plant hormones · Auxin biosynthesis inhibitors and phytochemical regulators containing these inhibitors as active ingredients, herbicides and methods of use thereof Technical Field

The present invention relates to a phytochemical regulator or light herbicide containing an auxin (such as indole-3-acetic acid) biosynthesis inhibitor as an active ingredient. Furthermore, the present invention relates to a method for artificially controlling plant growth in various growth stages and organs in various plant species using the plant chemical regulator. Background art

Auxin was the first substance recognized as a plant hormone and was identified as a hormone involved in the flexibility of plants. Later, it was revealed that the main natural auxin was indole-3-acetic acid (IAA). In addition to IAA, indole-3-butyric acid, 4-cycloindole acetic acid, and phenol acetic acid were also used. It has been known. Synthetic auxins include 2,4, dichlorophenoxyacetic acid (2,4-D), a-naphthaleneacetic acid (NAA '), 2,6-dichlorobenzoic acid, etc. (non-patented) Reference 1).

Synthetic auxin is often used for agricultural applications because IAA, a natural auxin, is unstable and has degradation pathways in plants. For example, 4- (4_chloro-0-tolyloxy) butyri c aci d (MCPB) and 2, 4-D are used as dicotyledonous herbicides in paddy fields. In addition, 2, 3, 5-tolyodobenzoic acid (TIBA) can increase the germination and growth of side buds. In addition, 2, 4-D and naphthalene acetic acid (NAA) are used for tissue culture. In rooting, NAA and indolebutyric acid are used. For example, in tomato, 4-chlorophenoxyacetic acid has an effect of promoting fruit set even in unfertilized tomato (Non-patent Document 1).

In plants, auxin is synthesized from chorismate, formerly L-tryptophan

It was thought that it was synthesized via (L-Trp), but now it is roughly divided (1) Two routes have been confirmed: a route that passes through L-Trp and a route that does not pass through (2) L-Trp. The route through L-Trp is further branched into four or more branches, each route catalyzed by a different enzyme (Figure 1). Even today, it is unclear which route is the main route and what role it has.

Although it does not exhibit auxin activity, anti-auxin has been synthesized that competitively inhibits auxin action by competing with auxins such as IAA to deprive the binding site of auxin. 2,4-Dichlorophenoxybutyric acid (PCIB) is known as an anti-auxin. In addition, maleic hydrazide, maleic hydrazide choline, and the like are also known to suppress the action of auxin, inhibit cell division and suppress elongation. It is used to suppress the emergence of buds after the centering of tobacco and to suppress the germination of vegetables (Non-patent Document 2).

Non-Patent Document 1 Yoshio Masuda “Introduction to Plant Hormone” Ohmsha (issued July 30, 1992) No. 9-17 1741 Page 45

Non-Patent Document 2 Pesticide Handbook 1998 Edition Editorial Board “Agricultural Handbook 1998 Edition” Published by Japan Plant Control Association 10th edition 1998 December 15th pp. 525-526 Disclosure of Invention

Until now, a substance called an anti-auxin that inhibits auxin signal

(Such as PCIB) and TIBA, which is called an auxin polar transport inhibitor, were known as compounds that control the action of auxin, but no substances that control (reduce) the amount of endogenous auxin were known. . In addition, even today, when molecular genetics has been developed mainly in model plants, mutants that reduce endogenous auxin levels are not known, and molecular biological methods such as RNAi and antisense methods are not used. There was no technology to suppress the amount of endogenous auxin even when used. In April of this year, a mutant of PLP enzyme, taal / sav3 / wei8, was isolated, and IAA endogenous production was reduced to less than half in the double mutant wei8 tar2 mutant of this gene and its family gene (TAR2). A decrease was reported (Cell 133: 177-191 (2008); Cell 133 164-176 (2008)).

Today's knowledge of the auxin biosynthetic pathway shows that auxin is a diverse network of auxins. It is synthesized through a pathway, and it has been considered difficult to strongly inhibit its biosynthesis with a single compound (ie, inhibition of one enzymatic reaction) in the first place.

On the other hand, if the amount of endogenous auxin synthesized in the plant can be controlled, the plant growth may be more efficiently controlled.

Today, the most popular herbicide glyphosate in the international market is an inhibitor of the aromatic amino acid synthesis pathway (ie, inhibiting metabolism upstream of chorismate). On the other hand, the compound provided in the present invention inhibits the biosynthesis pathway of auxin located at the downstream end of the aromatic amino acid synthesis pathway. Therefore, since the control route is narrower and more specific than existing herbicides, the drug provided by the present invention has fewer side effects than existing herbicides, has higher selectivity of action, and is more efficient. Therefore, it can be expected to have an effect of weeding plants (ie at low concentrations).

Accordingly, the first object of the present invention is to provide an endogenous auxin synthesis inhibitor. Furthermore, a second object of the present invention is to provide a plant growth regulator or herbicide that uses the auxin biosynthesis inhibitor.

The inventors of the present application have found a compound having an auxin biosynthesis inhibitory action based on their insight and completed the present invention.

The present invention provides a method for squeezing an auxin biosynthesis inhibitor candidate that prevents expression of an auxin-inducible gene. This includes methods that use a macroarray carrying probes for auxin-responsive genes to screen candidates that interfere with auxin-inducible gene expression. Furthermore, the invention of the present application is that an auxin inhibitor candidate is synthesized in the plant body by actually adding the auxin inhibitor trapping to the plant, and then crushing the plant body and measuring the amount of oxin in the living body. A screening method for an auxin biosynthesis inhibitor is provided, wherein a candidate auxin inhibitor that inhibits auxin is selected as an auxin inhibitor. Furthermore, in the auxin biosynthetic pathway, the auxin inhibitor trap and L-Trp are added to the enzyme extract that synthesizes Indole-3-pyrvic acid (IPyA) from L-Trp to produce IPyA. Including a method of screening for candidate compounds to interfere.

The present invention also provides an auxin biosynthesis inhibitor. The present invention is an enzyme that requires pyridoxal phosphate (PLP), which works in the pathway for synthesizing IAA via L-trp. Alternatively, an inhibitor that inhibits auxin biosynthesis is provided by inhibiting transaminase that deaminates L-tryptophan and converts it into Indole-3-pyrvic acid (IPyA).

More specifically, the present invention relates to AVG (aminoethoxyvinylglycine, 2-amino 4- (2-aminoethoxy) -3-butenoic acid (USP3869277)), AOA (aminooxyacetic acid), 2-aminooxy isobutyric acid hydlochloride ( AOIBA), auxin biosynthesis inhibitors containing L-aminooxyphenylpropionic acid (L-AOPP), and plant growth regulators containing these as active ingredients.

This specification includes the contents described in the specification and / or drawings of Japanese Patent Application No. 2007-152808, which is the basis of the priority of the present application. Brief Description of Drawings

Figure 1 shows the auxin synthesis pathway. Auxin is synthesized from chorismate and has been confirmed to have two pathways: L-Trp route and non-route route. The route through L-Trp branches into four or more branches, each route catalyzed by a different enzyme. Describe the intermediates of each pathway and the names (abbreviations) of enzymes (or genes) that catalyze biosynthetic reactions.

Figure 2 shows the behavior of ethylene-inducible gene (A) and auxin-inducible gene (B) to AVG treatment. (A) Ethylene responsive gene expression. (B) Expression of an auxin responsive gene.

Figure 3 shows changes in Arabidopsis endogenous IAA levels after AVG treatment.

Figure 4 shows a gene expression recovery experiment from AVG treatment using ACC and an auxin biosynthesis intermediate.

Fig. 5 shows that AVG and A0A suppress the expression of auxin-responsive genes.

Figure 6 shows a root elongation recovery experiment from α-methyltryptophan (Met-Trp) treatment using auxin and its biosynthetic intermediate.

Figure 7 shows a root elongation recovery experiment from AVG treatment using auxin and a biosynthetic intermediate.

Figure 8 shows an in vitro conversion enzyme from L-tryptophan to IPyA (from wheat) AVG suppressive action on

Fig. 9 shows the effects of AVG and A0A on the growth of Arabidopsis seedlings.

Figure 10 shows the effect of AVG, L-A0PP on L-tryptophan-to-IPyA converting enzyme (derived from Arabidopsis thaliana) in vitro.

Figure 11 shows the effects of AOA and A0IBA on L-tryptophan-to-IPyA converting enzyme (derived from Arabidopsis thaliana) in vitro.

Figure 12 shows the effects of L-A0PP and D-A0PP on auxin-responsive gene expression. L, D-A0PP treated IAA-responsive gene expression level

Fig. 13 is a photograph showing the effect of L-A0PP on the growth of Arabidopsis thaliana.

Figure 14 shows the effect on Arabidopsis IAA endogenous production. (A) Inhibitor IAA endogenous amount after lh treatment. (B) Inhibitor IAA endogenous amount per strain after lh treatment.

Figure 15 shows the impact on rice IAA endogenous production. Koshihikari inhibitor treatment 3h IAA endogenous amount. Figure 16 shows the structures of inhibitors and IAA precursors. BEST MODE FOR CARRYING OUT THE INVENTION

1.First of all

The auxin synthesis pathway in plants has been shown to be complex and reticulated (Figure 1). To date, it has not been identified which route is the main synthetic route for endogenous auxin. Therefore, it is not clear which enzyme reaction of which pathway can inhibit endogenous auxin biosynthesis and thereby control or inhibit plant growth.

2. Screening method for candidate auxin biosynthesis inhibitors using gene expression and microarray

The inventors of the present application have already isolated a large number of genes that are affected by expression in response to auxin, that is, auxin-inducible genes.

The inventors of the present application have found that a candidate auxin biosynthesis inhibitor that interferes with the expression of an auxin-inducible gene can be screened using a macroarray carrying a probe for such an auxin-inducible gene. As such a microarray, any gene described in Table 1 below is appropriately selected, and the base of the gene is selected. A probe mounted on at least 20 known microarrays with at least 20 oligonucleotides identical to the sequence as probes can be used.

For example, in Arabidopsis thaliana, select 10 or more of the arbitrary genes listed in Table 1, for example, a microarray using a probe comprising 20 oligonucleotides or more for each gene, and a candidate for oxine biosynthesis inhibitor using the microarray Screening methods. Here, for example, an affymetrix GeneChip system can be used as the microarray system.

By using this microarray, for example, by comparing the degree of expression induced in the presence of the target compound such as auxin with the degree to which expression is suppressed in the presence of the test compound, candidate auxin biosynthesis inhibitors can be obtained. Can be selected. Specifically, for example, the level of gene expression is measured when oxine is given as a target compound to a model plant such as Shiloununa (Arabidopsis). Next, measure the level of gene expression in the absence of auxin and compare them. Furthermore, gene expression is compared between when the test compound is given to the test plant and when it is not given. If a gene group whose expression increases in the presence of auxin seems to be related to a decrease in expression in the presence of the test compound, the test compound can be selected as a candidate for an auxin biosynthesis inhibitor.

On the other hand, candidate compounds are processed on genetically engineered plants into which a gene that has been artificially created using a promoter of an auxin-responsive gene (for example, DR5-GUS or SAUR-GUS) is incorporated. A candidate compound can also be selected by measuring the expression level of a marker gene. Alternatively, by treating a candidate compound in a wild-type plant, extracting total RNA from the treated plant, and measuring the expression level of the auxin-responsive gene according to a standard method, a compound that suppresses the expression of the auxin-responsive gene It is also possible to select candidates from among them. table 1

The present inventors have identified AVG as a candidate for an auxin biosynthesis inhibitor by a screening method using such a microarray.

3. Screening of auxin biosynthesis inhibitors based on IAA biosynthesis and enzyme activity Method

A compound that inhibits auxin synthesis in the plant body is actually added to the plant body with a test compound or a target compound such as auxin, and then the plant body is destroyed, using a mass spectrometer etc. Auxin content can be measured and screened.

In addition, whether the auxin inhibitor candidate selected in 2. above has inhibited auxin synthesis in the plant body, actually add the auxin biosynthesis inhibitor candidate to the plant body, It can be crushed and the amount of auxin in the living body can be measured and confirmed using a mass spectrometer or the like. By this method, the present inventors have confirmed that AVG and its analogs are auxin biosynthesis inhibitors.

Furthermore, we investigated whether the compound restores growth inhibition by AVG by administering an intermediate of the auxin biosynthetic pathway to plants simultaneously with AVG. As a result, the inventors of the present application confirmed that the action point of AVG growth inhibition exists on the auxin biosynthesis pathway in the plant body. In addition, we established a system for in vitro evaluation of enzyme activity extracted from plants. By using this enzyme activity evaluation system to investigate the action point of AVG, one of the targets that inhibits auxin biosynthesis is the enzyme that requires pyridoxal phosphate (PLP), or L-tryptophan, which is then indole- A transdeaminase that converts to 3-pyvic acid (IPyA), and a more suitable target to inhibit auxin biosynthesis, is a pyramid that converts L-tryptophan to Indole-3-pyric acid (IPyA) by deamination. It was found to be a trans-deaminase requiring doxalphosphate (PLP). Therefore, screening of inhibitors of these enzyme activities in vitro can also search for inhibitors of auxin synthesis.

4. An inhibitor of auxin biosynthesis containing an inhibitor of pyridoxalphosphate (PLP) -required enzyme or an inhibitor of tributophanaminotransferase as an active ingredient

The auxin biosynthesis inhibitors of the present invention include inhibitors of pyridoxal phosphate-requiring enzyme consisting of AVG and its analogs.

In addition, the present invention can inhibit the biosynthesis of auxin using inhibitors of pyridoxalphosphate (PLP) -required enzymes (including trans-deaminase, decarboxylase, C-S lyase, racemase, etc.) It is shown for the first time. In particular, among compounds known as inhibitors of PLP-requiring enzymes, it is possible to newly select a compound that inhibits auxin biosynthesis by the method described in 3. above. As inhibitors of PLP-requiring enzymes, for example, compounds described in Annual Review of Biochemistry 73: 383-415 (2004) are known. The present inventors have found that by performing such screening, AOA (aminooxyacetic acid) known as an inhibitor of ACC synthase (PLP-requiring enzyme) can inhibit auxin biosynthesis. Therefore, analogs of A0A are also included in the auxin biosynthesis inhibitor of the present invention. .

The present invention also shows for the first time that it is possible to inhibit the biosynthesis of auxin using an inhibitor of transdeamidinase (eg, Trp aminotransferase, ferulalanin ammonia lyase). In particular, it is possible to select a new compound that inhibits auxin biosynthesis from the compounds known as transaminase inhibitors by the method described in 3. As a transamylase that does not require PLP For example, phenylalanine ammonia lyase (PAL) is used as an inhibitor of PAL, for example, the compounds described in Phytochemistry 68: 407-415 (2007) and Phytochemistry 62: 415-422 (2003), specifically Are l-amino-3-phenylpropylphosphonate, 1-amino-2- (4-fluorophenyi) ethylphosphonic acid,

(R) _1-amino-2-phenylwthy 丄 phosphonic acid and l-amino-2-phenylethyl-phosphonic acid are known. The present inventors have found that L-A0PP, which is known as a PAL inhibitor, can inhibit auxin biosynthesis by performing such screening. Therefore, L-A0PP analogs are also included in the auxin biosynthesis inhibitors of the present invention. Specifically, an auxin biosynthesis inhibitor containing, as an active ingredient, a compound selected from the following (formula I) or (formula I I).

(Formula I)

However, means a carboxyl group or a phosphone group. R ₂ represents a hydrogen atom or a methyl group. R ₃ represents an amino group or an aminooxy group. Is hydrogen or R ₅ —CH ₂ —, wherein R ₅ is an indole ring, naphthalene ring, benzene ring, pyridine ring, pyrrole ring, the carbon atom of which may be modified with a chlorine or methyl group Indicates.

(Formula II)

R ₆ represents an alkyl group having 1 to 4 carbon atoms which may have an amino group. More specifically,

(Formula III)

However, R 1 means a carboxyl group or a phosphone group.

R ₂ represents a hydrogen atom or a methyl group.

R ₃ represents an amino group or an aminooxy group (-0-NH ₂ ). As for the steric structure of the asymmetric carbon, the S form is more preferable when is a force lupoxyl group, and the R form is preferable when Rj is a phosphone group.

R ₅ represents an indole ring, naphthalene ring, benzene ring, pyridine ring or pyrrole ring, the carbon atom of which may be substituted with chlorine or a methyl group. Specifically, R ₅

2,4-diclilorop enyl- 2-methyl.-4-chlo.ro-phenyl- includes ˜11 W, ''-

Preferably, when R1 is a carboxyl group, L-A0PP or

(S) -2- (aminooxy) -3- (1 W-indoi-3-yl) propanoic

acid

2- (ammooxv) -3- (lH-indol-j-yl) proDanoic acid ゝヽ

Examples of Rl having a phosphonic group include 1-amino-2-phenylethyl-phosphonic acid and

-amino-Z- (l H-indol-3-vOethylphosohonic acid l-amino-2- (lH-indol-3-yl) ethylphosphonic acid;

It is also preferable that the R3 force S amino group is

1-amino-2-nH-indol-3-vl) ethvlphosphonic acid, l-amino-2-ohenylethyl-phosphonic acid, and R3 as aminooxy group include A0PP and

2- (aminooxy) -3- (lH-indol-3-yl) propanoic acid strength

Specifically, 2-amino-4-methoxy-3-butenoic acid (AMB) (2-amino-4- (2-amino-3-hydroxypropoxy) -3-butenoic acid). In particular, L-tryptophan analogs, compounds having the structure of 2-amino-4-phenol-3-butenoic acid and their salts are effective. See Figure 17.

5. Plant growth regulator

The auxin biosynthesis inhibitor of the present invention can be used as a plant growth inhibitor, a plant growth regulator, or a herbicide, such as inhibition of root elongation, inhibition of seedling growth, and the like. For example, the auxin biosynthesis inhibitor can be mixed with various carriers such as talc, clay, starch, water, etc., and used as a solid preparation or a liquid preparation. Liquid preparations can be made into liquid preparations such as liquids, emulsions, microemulsions, suspensions, oils, and oily flowables using appropriate carriers. As a solid preparation, it can be used as a powder, granule, granule, tablet, wettable powder, wettable powder. Furthermore, auxiliary agents used in the preparation of agricultural chemicals, for example, spreading agents, emulsifiers, coloring agents and the like can be added as necessary.

[Example 1] Behavior of auxin-inducible gene and ethylene-inducible gene upon AVG treatment

After seeding wild-type Arabidopsis (Colombia) seeds at 4 ° C for 48 hours,

1 / 2MS (Murashige & Skoog) l ° /. The cells were cultured for 7 days in a liquid medium containing Sucrose. The Arabidopsis seedlings were treated with 10 / z M AVG, 10 M ethylene precursor ACC (amino propane carboxylic acid), or ΙμΜ IAA for 3 hours. After total RNA was purified from the Arabidopsis seedlings, the gene expression level was measured using GeneChip according to the Affymetrix protocol. The result is shown in figure 2. The vertical axis is

Logarithm of ratio of gene expression response to AVG treatment to untreated control

This is indicated by (Signal Log Ratio). The horizontal axis shows ACC processing (Fig. 2A) and IAA processing (Fig.

2 B) Gene Log Response to Untreated Control Signal Log

Indicated by Ratio. AVG is known as an inhibitor of ethylene biosynthesis. When ACC treatment and AVG treatment were plotted against ethylene-inducible genes (Fig. 2A), a negative correlation was seen as is known. . On the other hand, when IAA treatment and AVG treatment were compared by plotting auxin-inducible genes (Fig. 2B), a negative correlation was observed. This result is

AVG has been considered so far, not only ethylene suppression but also auxin suppression It also suggests that it has an effect. The AVG used is all S, including the following examples.

[Example 2] Arabidopsis endogenous IAA levels after AVG treatment

Wild-type Arabidopsis thaliana (Colombia) seeds were low-temperature treated at 4 ° C. for 48 hours, and then cultured in a liquid medium containing 1/2 MS l% Sucrose for 7 days. The Arabidopsis seedlings were treated with AVG4, 10, or 40 / zM for 24 hours. After the Arabidopsis seedlings were extracted with methanol, 13C6-IAA was added as an internal standard. After concentrating the extract, it was purified by N (CH3) 2 HPLC column, and IAA elution fraction was collected. The IAA fraction was trimethylsilylated and quantitatively analyzed by GC-MS. The results are shown in Figure 3. AVG treatment reduced Arabidopsis endogenous IAA levels depending on the concentration of AVG treated.

[Example 3] Gene expression recovery from AVG treatment using ACC and auxin-related compounds

Wild-type Arabidopsis thaliana (Col.) seeds were low-temperature treated at 4 ° C for 48 hours, and then cultured in a liquid medium containing 1 / 2MS l% Sucrose for 7 days. 40 μM AVG and 10 ethylene biosynthetic precursors ACC, IAA, IAA biosynthetic precursors IPyA (Indole-3-pyruvic acid) or IAAld (Indole-3-acetaldehyde) are treated for 24 hours on the seedlings of Arabidopsis thaliana did. After purifying RNA from these Arabidopsis seedlings, we measured the expression level of the IAA19 / At3gl5540 gene, one of the genes that serve as an indicator of auxin action, using the quantitative PCR method (ABI PRISM7500) using Taqman probe. . Primer is forward (GAGCATGGATGGTGTGCCTTAT), linear primer (TTCGCAGTTGTCACCATCTTTC) ヽ TaqMan probe

(FAM-ATAAGCTCTTCGGTTTCCGTGGCATCG-TAMRA) was used, and the measurement was performed by the method described in the literature (PlantPhysioll31: 287-297). The results are shown in Fig. 4.

The vertical axis shows the relative value of the gene expression level with the control group as 1. The expression level of the IAA19 gene was restored to the control level with precursors of auxin biosynthesis via IPyA (IPyA, IAAld). This trend did not change with the addition of ACC. The result is

AVG inhibits the expression of auxin-responsive genes by inhibiting IAA biosynthesis. In addition, it is shown that the inhibitory effect of AVG on the expression of auxin-responsive genes is not an indirect action through inhibition of ethylene biosynthesis. [Example 4] Changes in expression of auxin-induced live genes after treatment with AVG and AOA

Wild-type Arabidopsis thaliana (Colombia) seeds were low-temperature treated at 4 ° C. for 48 hours, and then cultured in a liquid medium containing 1/2 MS l% Sucrose for 7 days. The Arabidopsis seedlings were treated with AVG or A0A at 1, 5, or 20 μ 又は for 24 hours. Like AVG, A0A is known to inhibit the biosynthesis of ethylene by inhibiting the action of pyridoxalphosphate-dependent enzymes. RNA was purified from Arabidopsis seedlings after treatment, and the expression levels of the IAA1 and IAA2 genes, which are indicators of auxin action, were measured by quantitative PCR using Taqman probes (Fig. 5). The vertical axis shows the relative value of gene expression level with control group as 1. In both IAA1 / At4gl4560 and IAA2 / At3g23030 genes, the expression level decreased with AVG treatment depending on the concentration. Similarly, A0A treatment also reduced auxin-induced live gene expression, but its effect was slightly weaker than AVG.

[Example 5] Root elongation recovery experiment from Met_Trp treatment or AVG treatment using auxin and related compounds

Wild-type Arabidopsis thaliana (Col.) seeds were low-temperature treated at 4 ° C. for 48 hours, and then cultured on an agar medium containing 1/2 MS l% Sucrose for 2 days. The Arabidopsis seedlings were transplanted to 1 / 2MS l% Sucrose agar medium containing α-methylliptophan (Met-Trp) and allowed to grow vertically for 6 days. Met-Trp inhibits the L-Trp synthesis pathway upstream, but we observed whether growth inhibition by Met-Trp could recover IAA and its biosynthetic precursors using the elongation recovery of roots as an indicator. The result is shown in FIG.

Compared to the control group (A), Met-Trp treatment significantly inhibited root elongation (B). This root elongation inhibitory effect was restored by indole and tryptophan (Trp) (C, D), but not by other auxin precursors (E-K). This result indicates that Met-Trp inhibits their biosynthesis upstream of tryptophan yandol.

Similarly, Arabidopsis seedlings 2 days after germination were arranged vertically in 1/2 MS l% Sucrose agar medium containing AVG, auxin and its precursors, and 6 days later root elongation recovery was observed. The results are shown in FIG. Compared to the control group (A), AVG treatment significantly inhibited root elongation (B). This root elongation inhibitory action is indole and L-tributophan (C, D), but recovered with precursors of the auxin synthesis pathway via IPyA (I-J), but not with other precursors not via IPyA (E-H). In addition, recovery of compounds in the auxin synthesis pathway via indole pyruvate was significant compared with recovery of indole and L-tryptophan. This result indicates that AVG inhibits auxin synthesis during the process of IAA synthesis from indole. On the other hand, indole and L-tryptophan partially recover root elongation because there are multiple IAA synthesis pathways, and indole and L-tryptophan are converted to IAA via a route that is not inhibited by AVG. This is thought to be because of this.

[Example 6] Inhibitory effect of AVG and A0A on in vitro conversion of L-tryptophan to IPyA

Wheat germ extract (Wg) and 5 mM L-tryptophan, 0.2 mM pyridoxal phosphate

(PLP), 0.5 mM 2-oxoglutaric acid (20X), and 4 mM EDTA in borate buffer

The reaction was carried out at 30 ° C for 90 minutes. The product is derivatized to oxime with hydroxyamine in an imidazole buffer containing MeOH. The solution was acidified with hydrochloric acid, extracted with ethyl acetate, purified with an OASIS MCX column, and the amount of IPyA produced was measured using LC / MS / MS (LC: HP 1100 Series HPLC System (Hewlett Packard / Agilent

Technologies), MS: QSTAR Pulsar (PE Sciex / Applied Biosystems)). Figure the result

Shown in 8. In Fig. 8, one Trp added no L-tryptophan, one 20X added two oxodaltaric acid (20X), and one PLP added pyridoxal phosphate (PLP). Indicates that they did not. The amount of IPyA generated from L-tryptophan increased with the addition of PLP and 20X. And the amount is

Decreased by adding AVG or A0A. This indicates that the auxin biosynthesis step from tryptophan to indole pyruvate is catalyzed by PLP enzyme, and its activity is inhibited by AVG and A0A.

[Example 7] Effects of AVG and A0A on the growth of Arabidopsis seedlings

Wild-type Arabidopsis (Colombia) seeds were treated with 4 at 48 hours, then l / ² MSl ° /. Sucrose was cultured in an agar medium containing 10 μΜ (Β) and 2 M (D) of AVG. The results are shown in Fig. 9. (A) (C) is the control zone. 2 Incubate at 1 ° C, 1 Day 4 (C) (D) and 3

Observations were made on Day 0 (A) and (B). Growth of seedlings after germination by AVG treatment Development was inhibited (D). In ΙΟμΜ, the seedlings were whitened and died immediately after germination. The direction of root extension does not follow gravity and the direction is not fixed.

Wild type Arabidopsis thaliana (Colombia) seeds were treated at 4 ° C for 72 hours, and then cultured for 6 days at 21 ° C in a liquid medium (F) containing lOO w M A0A in 1 / 2MS l% Sucrose. (E) is the control zone. With the addition of A0A, the growth of seedlings was suppressed both above and below, but the effect was slower than AVG (Fig. 9).

[Example 8] Effect of AVG and L-A0PP on L-tryptophan to IPyA converting enzyme (derived from Arabidopsis thaliana) in vitro

Arabidopsis seedlings were grown in 1/2 MS l% sucrose medium for 3 days. The seedlings were frozen and crushed at -80 ° C, extracted buffer (4 O mM HEPES-OKH (pH7.6), 10 raM potassimu chloride, 5 mM magnesium chloriae, 2 mM calcium chloride,

Protein was extracted with 4 mM dithiothreitol). This was centrifuged at 20000 g for 10 minutes and then subjected to gel filtration using a Sephadex G-25 column to obtain a polymer fraction as a crude enzyme extract. Using this, an enzymatic reaction from L-tryptophan to indole pyruvate was performed.

The reaction was carried out in the presence of extracted protein 76yg / ml, 0.1M borate buffer (pH 8.5), 0.25mM L-tryptophan, 0.5mM 2-oxoglutaric acid, 0.05mM PLP at 35 ° C. C Incubated at some point for 1 hour. The amount of indolpyruvic acid produced was quantified according to Example 6. The result is shown in FIG. As a control, an Arabidopsis thaliana extract enzyme treated at 95 ° C for 5 minutes was used (EE Heat). Also shown is the amount of IPyA that can be produced when PLP and 2-oxodaltalic acid are removed from the reaction (No CoE). No activity was detected when the extract was heat-treated, and activity was removed when PLP and 2-oxoglutaric acid were removed.

Since it is 50% or less, it is understood that this reaction is an enzyme reaction depending on PLP and 2-oxodaltal.

Next, the reaction was performed by adding no inhibitor (complete), AVG (10, 20, 50, 100 μΜ) or L-A0PP (0.1, 0.3, 1, 2 μΜ).

The vertical axis shows the amount of IPyA produced as a relative value. Figure 10A shows the average of three iterations. Both AVG and L-A0PP inhibited the activity of IPyA synthase in Arabidopsis thaliana.

Based on these results, IC50 was calculated to be 47.9 for AVG and 0.77 μΜ for L-A0PP. Thus, L-AOPP was about 2 orders of magnitude more active than AVG. (Fig. 10 B, C)

[Example 9] Effects of AOA and A0IBA on L-tryptophan to IPyA converting enzyme (derived from Arabidopsis thaliana) in vitro

In the same manner as in Example 8, a crude enzyme extract was produced from Arabidopsis seedlings and subjected to enzyme reaction. The reaction conditions were the same as in Example 8. As a control, Arabidopsis thaliana extract enzyme treated at 95 ° C for 5 minutes (EE Heat) and the amount of IPyA produced when PLP and 2-oxoglutaric acid were removed from the reaction were shown (No CoE). Indole pyruvate was quantified according to Example 6. The results are shown in Figure 11. The vertical axis shows the amount of indole pyruvic acid produced as a relative value. The graph shows the average of three repetitions. Next, the reaction was performed by adding no inhibitor (complete) and A0IBA (1, 3, 10, 30 μΜ) or A0A (0.1, 0.3, 1, 3 μΜ).

Both A0IBA and A0A inhibited the IPyA synthase activity of Arabidopsis thaliana. Based on the results, IC50 was calculated to be 0.4 μΜ for A0A and 1.26 μΜ for A0IBA, both of which were more active than AVG.

[Example 10] Effects of L-A0PP and D-A0PP on the expression of auxin-responsive genes

To elucidate the specificity of the conformation when A0PP inhibits indolepyruvate synthase, we investigated the effect of L-A0PP and D-A0PP on auxin-responsive gene expression.

Arabidopsis thaliana is grown in a liquid medium containing l / 2MS and l% sucrose for 7 days and treated with L-AOPP (1: 3, 10, 30) and D-A0PP (1, 3, 10, 30 yM) for 3 h. Plants were sampled and RNA was purified. According to the method of Example 3, the expression levels of the IAA19 / At3gl5540 and IAA1 / At4gl4560 genes were measured using quantitative PCR. Figure 12 shows the results. D-A0PP suppressed IAA gene expression from 3 μΜ. On the other hand, D-A0PP inhibited IAA1 gene expression at 30 μΜ, but did not inhibit IAA19 gene expression. From this, it can be said that S-form is more effective than R-form by inhibiting the expression of sputum gene. The steric structure of S-form has a homologous relationship with that of L-trybutophane, and that these compounds work as analogs of L-tryptophan, that is, S-form is more effective in inhibiting oxine biosynthesis. It was shown that. (The experiment is the average of two repetitions.) [Example 1 1] Effect of L-AOPP on Arabidopsis thaliana growth

Arabidopsis thaliana was grown in 1% sucrose 1 / 2MS medium containing L-A0PP, but no growth inhibition was observed. This was due to the instability of L-A0PP in MS medium. Therefore, we investigated the effect of L-A0PP on the growth of Arabidopsis thaliana in sugar agar without MS medium components. Arabidopsis seedlings were grown for 4 days in 1 / 2MS medium containing 1% sucrose to a length of about 1 cm. These seedlings were transplanted to 1% sucrose agar supplemented with drugs and cultured at 21 ° C for 4 days. The results are shown in FIG. 13 and FIG.

30 μΜ (In the presence of L-A0PP, Arabidopsis roots slanted to the left and wavy and elongated. This indicates that the gravitropism of the roots is not working properly. In contrast, the addition of indole, L-tryptophan, and indolepyruvic acid restored the root's gravitropism, while the addition of 1 nM IAA almost recovered the gravitropism. When 0 nM IAA was added, there was a slight inhibition of root elongation, but the gravitropism of the roots was completely restored, which suggests that L-A0PP is a biosynthesis of auxin that controls gravitropism. This inhibition was shown to be recovered with IAA intermediate via tributophan and IAA In addition, when L-A0PP was treated at a concentration of 50 μΜ or more, the elongation of the main root was inhibited. It recovered with IAA and IPyA.

[Example 12] Effects on Arabidopsis IAA endogenous production

Arabidopsis seedlings were cultured on 1 / 2MS agar medium for 6 days under 22 ° C continuous light. Sprouting seedlings of 20 strains were transferred to 1 / 2MS liquid medium (5 ml), cultured for 24 hours, and treated with 30 AVG or L-A0PP for 1 hour. D5-IAA was added as an internal standard, extracted with MeOH, purified with Oasis HLB, MCX force ram, and the amount of IAA was quantified by LC-MS / MS. The quantitative analysis by LC-MS / MS was performed according to the method described in Example 6. The results are shown in Fig. 15. The average and standard error of the results of three independent experiments are shown. The vertical axis shows the amount of IAA. The left shows the amount of IAA per gram of fresh weight, and the right shows the amount of IAA per seedling. As a result, both AVG and L-A0PP greatly reduced the endogenous amount of IAA.

[Example 13] Effect on rice IAA endogenous production Rice (Koshihikari) seeds were sterilized and allowed to germinate by absorbing water at 25 ° C for 3 days. Seed this on agar, 2 8. C. cultured for 2 days.

The grown seedlings were transferred to 10 ml of water one by one and cultured with shaking at 28 ° C. for 3 hours in the presence of 30 μΜ of inhibitors Met-Trp, AVG, AOA, and L-AOPP. After incubation, the aerial part of the seedlings, roots, divided into seeds, d5 as 100 p _g / mgFW each of shoot and root portion (Fresh Weight, also FW in other figures same.) A - internally IAA In addition to the standard substance, the amount of IAA was quantified using LC-MS / MS according to Example 12. The results are shown in Figure 16. The vertical axis of the graph indicates the amount of IAA per 1 mg of raw weight. The average and standard error of this experiment repeated three times are shown. Met-Trp, which inhibits triftophan biosynthesis, had no effect on endogenous IAA levels. On the other hand, AVG, AOA and L-A0PP decreased the endogenous amount of IAA. Industrial applicability

The invention of the present application has an extremely excellent effect of providing an auxin biosynthesis inhibitor and a screening method thereof for the first time. This makes it possible to control the amount of auxin in the plant, which was impossible before, and it will be possible to develop completely new plant growth regulators and herbicides in the future.

The present invention can be used in plant growth regulators, herbicides and the field of production thereof.

All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety.

Claims

The scope of the claims

1. In a method of treating a plant with a test compound and a control compound, measuring the expression level of an auxin responsive gene, and screening a candidate for an auxin biosynthesis inhibitor from compounds that suppress the expression of the auxin responsive gene. Using a microarray carrying a probe for an auxin-responsive gene, treating the plant with a test compound or a control compound, measuring the gene expression, and using a compound that suppresses the expression of the auxin-responsive gene group as an auxin biosynthesis inhibitor candidate A method for screening candidate auxin biosynthesis inhibitors to be selected.

2. The method for screening a candidate for an auxin biosynthesis inhibitor according to claim 1, wherein an inhibitor of pyridoxalphosphate-requiring enzyme or aminotransferase is used as a test compound.

3. A plant is treated with a test compound and a control compound, endogenous auxin is extracted from the treated plant, the amount thereof is measured, and one that inhibits auxin synthesis is selected as an auxin biosynthesis inhibitor. A method of screening biosynthesis inhibitors.

4. The method for screening an inhibitor of auxin biosynthesis according to claim 3, wherein an inhibitor of pyridoxalphosphate-requiring enzyme or aminotransferase is used as the test compound.

5. Treat tributophan deaminase extract containing tributophan with test compound and control compound, measure the amount of indolepyruvic acid in the treated extract, and inhibit auxin biosynthesis by inhibiting the production of indolepyruvic acid. A method of screening for an auxin biosynthesis inhibitor selected as an agent.

6. The method for screening an auxin biosynthesis inhibitor according to claim 5, wherein an inhibitor of pyridoxalphosphate-requiring enzyme or aminotransferase is used as the test compound.

7. An auxin biosynthesis inhibitor containing a compound selected from the following formula (I) or formula (II) as an active ingredient.

(I)

は means a carboxyl group or a phosphone group. R ₂ represents a hydrogen atom or a methyl group. R ₃ represents an amino group or an aminooxy group (10-NH ₂ ). R ₄ is hydrogen or R ₅ —CH ₂ —, where R ₅ is an indole ring, naphthalene ring, benzene ring, pyridine ring, pyro, which may be modified with a chlorine or methyl group. Indicates one ring.

(II)

R ₆ represents an alkyl having 1 to 4 carbon atoms which may have an amino group.

8. An auxin biosynthesis inhibitor containing AVG, A0A, A0IBA, A0PP or an analog thereof as an active ingredient.

9. An auxin biosynthesis inhibitor comprising an inhibitor of pyridoxalphosphate-requiring enzyme or an inhibitor of tributophan aminotransferase.

1 0. A plant growth regulator or herbicide containing an auxin biosynthesis inhibitor as an active ingredient.