JP2013067656A - Inhibitor of biosynthesis of plant hormone auxin, chemical plant regulator comprising the inhibitor as active ingredient, herbicidal agent, and use thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an inhibitor of the synthesis of endogenous auxin, and further, to provide a plant growth inhibitor or a herbicidal agent utilizing the auxin biosynthesis inhibitor.SOLUTION: There are disclosed a method for screening a candidate for an auxin biosynthesis inhibitor capable of inhibiting the expression of an auxin-inducible gene, by adding each of candidate compounds for the auxin inhibitor to a plant, a method for selecting a compound capable of actually inhibiting the auxin synthesis in a plant, by adding each of candidate compounds to the plant, disrupting the plant and then measuring the amount of endogenous auxin, and a method for selecting a compound capable of inhibiting the production of indolpyruvic acid in the presence of a trytophan deaminase and trytophan which are prepared in advance. More specifically, an auxin biosynthesis inhibitor comprising AVG, AOA, AOIBA, L-AOPP or an analogue thereof, and a plant growth regulator or a herbicidal agent comprising the compound as an active ingredient are disclosed.

Description

  The present invention relates to a phytochemical regulator or herbicide containing a biosynthesis inhibitor of auxin (such as indole-3-acetic acid) as an active ingredient. Furthermore, the present invention relates to a method for artificially controlling the growth of plants in various growth stages and organs in various plant species using the phytochemical regulator.

  Auxin is the first substance recognized as a plant hormone, and has been identified as a hormone involved in plant flexibility. Later, it was revealed that the main natural auxin was indole-3-acetic acid (IAA). Besides IAA, indole-3-butyric acid, 4-chloroindoleacetic acid, and phenylacetic acid were known. Yes. As synthetic auxins, 2,4, dichlorophenoxyacetic acid (2,4-D), α-naphthaleneacetic acid (NAA), 2,6-dichlorobenzoic acid and the like are known (Non-patent Document 1).

  Synthetic auxin is often used for agricultural applications because IAA, a natural auxin, is unstable and has degradation pathways in plants. For example, 4- (4-chloro-o-tolyloxy) butyric acid (MCPB) and 2,4-D are used as dicotyledonous herbicides in paddy fields. In addition, 2,3,5-triiodobenzoic acid (TIBA) can enhance the germination and growth of side buds. Furthermore, 2,4-D or naphthalene acetic acid (NAA) is used for tissue culture. For rooting, NAA and indolebutyric acid are used. Further, for example, in tomato, 4-chlorophenoxyacetic acid has an effect of promoting fruit set even in unfertilized tomato (Non-patent Document 1).

  Auxin is synthesized from chorismate in plants, and was previously thought to be synthesized via L-tryptophan (L-Trp), but now it is broadly divided into (1) via L-Trp. Two routes have been confirmed: a route and (2) a route that does not go through L-Trp. The route via L-Trp is further branched into four or more branches, each route catalyzed by a different enzyme (Figure 1). Even now, it is unclear which route is the main route and what role it has.

  Anti-auxin that antagonizes the auxin action by synthesizing with auxin such as IAA and depriving the binding site of auxin by competing with auxin such as IAA has been synthesized. As an anti-auxin, 2,4-dichlorophenoxyisobutyric acid (PCIB) and the like are known. In addition, maleic hydrazide, maleic hydrazide choline, and the like are also known to suppress the action of auxin, inhibit cell division, and suppress elongation. It is used to suppress the emergence of buds after tobacco cores and to prevent the germination of vegetables (Non-patent Document 2).

Edited by Yoshio Masuda “Introduction to Plant Hormone” Ohmsha (published July 30, 1992), pages 9-17 and 41-45 Pesticides Handbook 1998 Edition Editorial Board “Agricultural Chemicals Handbook 1998” published by Japan Plant Control Association 10th edition December 15, 1998 (pp.525-526)

  Until now, compounds that control the action of auxin such as substances that inhibit auxin signals called anti-auxin (such as PCIB) and TIBA called auxin polar transport inhibitor have been known, but endogenous auxin No substance is known to control (reduce) the amount of. In addition, even today, when molecular genetics has developed mainly in model plants, mutants that reduce endogenous auxin levels are not known, and molecular biological methods such as RNAi and antisense methods are not used. There was no technology to suppress the amount of endogenous auxin even when used. In April of this year, the PTA enzyme mutant taa1 / sav3 / wei8 was isolated, and the double mutant wei8 tar2 mutant of this gene and its family gene (TAR2) produced less than half the amount of IAA endogenous. A decrease was reported (Cell 133: 177-191 (2008); Cell 133 164-176 (2008)).

  According to today's knowledge of the auxin biosynthetic pathway, auxin is synthesized through a variety of reticulated pathways, and it is difficult to strongly inhibit its biosynthesis in the first place (ie, inhibition of one enzyme reaction). Has been considered.

  On the other hand, if the endogenous auxin synthesis amount of a plant can be adjusted, plant growth may be more efficiently controlled.

  Today, the most popular herbicide glyphosate in the international market is an inhibitor of the aromatic amino acid synthesis pathway (ie, inhibiting metabolism upstream of chorismate). On the other hand, the compound provided by the present invention inhibits the auxin biosynthesis pathway located at the downstream end of the aromatic amino acid synthesis pathway. Therefore, since the control pathway is narrower and more specific than existing herbicides, the drug provided by the present invention has fewer side effects, higher selectivity of action and more efficient than existing herbicides. Can be expected to have an effect of weeding plants (ie at low concentrations).

  Accordingly, a first object of the present invention is to provide an endogenous auxin synthesis inhibitor. Furthermore, a second object of the present invention is to provide a plant growth regulator or herbicide using the auxin biosynthesis inhibitor.

  The inventors of the present application have found a compound having an auxin biosynthesis inhibitory action based on their insight and completed the present invention.

  The present invention provides a method of screening auxin biosynthesis inhibitor candidates that interfere with auxin-inducible gene expression. This includes methods of screening candidates that interfere with auxin-inducible gene expression using a macroarray carrying probes for auxin-responsive genes. In addition, the present invention actually adds the auxin inhibitor candidate to the plant, then crushes the plant and measures the amount of auxin in the living body so that the auxin inhibitor candidate inhibits auxin synthesis in the plant. A screening method for an auxin biosynthesis inhibitor is provided that selects a candidate auxin inhibitor as an auxin inhibitor. Furthermore, among the auxin biosynthetic pathways, the auxin inhibitor candidate and L-Trp are added to the enzyme extract that synthesizes Indole-3-pyrvic acid (IPyA) from L-Trp to prevent the production of IPyA A method of screening a candidate compound is included.

  The present invention also provides an auxin biosynthesis inhibitor. The invention of the present application is a transatom that depyamidates pyridoxalphosphate (PLP) -requiring enzyme or L-tryptophan that works in the pathway for synthesizing IAA via L-trp and converts it to Indole-3-pyrvic acid (IPyA) Inhibitors that inhibit auxin biosynthesis are provided by inhibiting deaminase.

  More specifically, the present invention relates to AVG (aminoethoxyvinylglycine, 2-amino-4- (2-aminoethoxy) -3-butenoic acid (USP3869277)), AOA (aminooxyacetic acid), 2-aminooxyisobutyric acid hydlochloride (AOIBA). Auxin biosynthesis inhibitors containing L-aminooxyphenylpropionic acid (L-AOPP) and plant growth regulators containing these as active ingredients.

  This specification includes the contents described in the specification and / or drawings of Japanese Patent Application No. 2007-152808, which is the basis of the priority of the present application.

The auxin synthesis pathway is shown. Auxin is synthesized from chorismate and has been confirmed to have two pathways: L-Trp route and non-route route. The route through L-Trp is branched into four or more branches, each route catalyzed by a different enzyme. The intermediates of each pathway and the names (abbreviations) of enzymes (or genes) that catalyze biosynthetic reactions are described. The behavior of ethylene-inducible gene (A) and auxin-inducible gene (B) with respect to AVG treatment is shown. (A) Ethylene responsive gene expression. (B) Expression of an auxin responsive gene. The change of Arabidopsis endogenous IAA amount after AVG treatment is shown. The experiment of gene expression recovery from AVG treatment using ACC and auxin biosynthesis intermediate is shown. AVG and AOA suppress the expression of auxin responsive genes. The root elongation recovery experiment from α-methyltryptophan (Met-Trp) treatment using auxin and its biosynthetic intermediate is shown. An experiment of root elongation recovery from AVG treatment using auxin and a biosynthetic intermediate is shown. Inhibitory effect of AVG on L-tryptophan to IPyA converting enzyme (derived from wheat) in vitro. Effects of AVG and AOA on the growth of Arabidopsis buds. Effect of AVG and L-AOPP on L-tryptophan to IPyA converting enzyme (derived from Arabidopsis thaliana) in vitro. Effect of AOA and AOIBA on L-tryptophan to IPyA converting enzyme (derived from Arabidopsis thaliana) in vitro. Effect of L-AOPP and D-AOPP on auxin-responsive gene expression. L, I-responsive gene expression level in D-AOPP treatment A photograph showing the effect of L-AOPP on Arabidopsis thaliana growth. Effects on Arabidopsis IAA endogenous production. (A) IAA endogenous amount after treatment with inhibitor 1h. (B) IAA endogenous amount per strain after treatment with inhibitor 1h. Effects on rice IAA endogenous production. Koshihikari inhibitor treatment 3h IAA endogenous amount. Structure of inhibitors and IAA precursors.

1. Introduction The pathway of auxin synthesis in plants has been shown to be complex and reticulated (Figure 1). To date, it has not been identified which pathway is the main synthetic pathway for endogenous auxin. Therefore, it is not clear which enzyme reaction of which pathway can be inhibited to inhibit endogenous auxin biosynthesis, thereby controlling or suppressing plant growth.

2. Gene Expression and Screening Method for Auxin Biosynthesis Inhibitor Candidate Using Microarray The present inventors have already separated a large number of genes that are affected by expression in response to auxin, that is, auxin-inducible genes.

  The inventors of the present application have found that a auxin biosynthesis inhibitor candidate that interferes with the expression of an auxin-inducible gene can be screened using a macroarray carrying a probe for such an auxin-inducible gene. As such a microarray, an arbitrary gene described in Table 1 below is appropriately selected, and at least 20 oligonucleotides identical to the base sequence of the gene are used as probes and used on any known microarray it can.

  For example, in Arabidopsis thaliana, any of the genes listed in Table 1 is selected, for example, 10 types or more, and a microarray using a probe comprising 20 oligonucleotides or more for each gene, and screening for auxin biosynthesis inhibitor candidates using the microarray Includes methods. Here, for example, an affymetrix GeneChip system can be used as the microarray system.

  Using this microarray, auxin biosynthesis inhibitor candidates are selected by comparing, for example, the degree to which expression is induced in the presence of the target compound such as auxin and the degree to which expression is suppressed in the presence of the test compound. it can. Specifically, for example, the level of gene expression when auxin is given as a target compound to a model plant such as Arabidopsis thaliana (Arabidopsis) is measured. Next, the degree of gene expression when auxin is not given is measured and compared. Furthermore, gene expression is compared between when the test compound is given to the test plant and when it is not given. If a gene group whose expression increases in the presence of auxin is related to a decrease in expression in the presence of the test compound, the test compound can be selected as an auxin biosynthesis inhibitor candidate.

  On the other hand, a genetically modified plant into which a marker gene (for example, DR5-GUS, SAUR-GUS, etc.) artificially created using the promoter of an auxin-responsive gene is incorporated is treated with a candidate compound. Candidate compounds can also be selected by measuring gene expression levels. Alternatively, by treating a candidate compound in a wild-type plant, extracting total RNA from the treated plant, and measuring the expression level of the auxin-responsive gene according to a standard method, It is also possible to select candidates from among them.

  The present inventors have identified AVG as a candidate for an auxin biosynthesis inhibitor by a screening method using such a microarray.

3. Screening method for auxin biosynthesis inhibitors using IAA biosynthesis and enzyme activity as an index. Compounds that inhibit auxin synthesis in the plant body are actually added to the plant body with a test compound or a target compound such as auxin, and then the plant body body. The amount of auxin in the living body can be measured and screened using a mass spectrometer or the like.

  The above 2. Whether or not the auxin inhibitor candidate selected in step 1 inhibits auxin synthesis in the plant body is actually added to the plant body and then the plant body is crushed and mass spectrometry is performed. The amount of auxin in the living body can be measured and confirmed using a device or the like. By this method, the present inventors confirmed that AVG and its analogs are auxin biosynthesis inhibitors.

  Furthermore, whether or not the compound recovered the growth inhibition by AVG was investigated by administering an intermediate of the auxin biosynthetic pathway to plants simultaneously with AVG. Thus, the inventors of the present application have confirmed that the action point of AVG growth inhibition exists on the auxin biosynthesis pathway in the plant body. Furthermore, we established a system for in vitro evaluation of enzyme activity extracted from plants. Using this enzyme activity evaluation system, AVG action sites were investigated, and one target that inhibits auxin biosynthesis is the enzyme that requires pyridoxalphosphate (PLP), or L-tryptophan, which is deaminated to Indole-3 -Pyridoxal phosphate (PLP) that converts L-tryptophan into Indole-3-pyrvic acid (IPyA) by deaminating L-tryptophan as a target to inhibit auxin biosynthesis It was found to be an auxotrophic transdeaminase. Therefore, auxin synthesis inhibitors can also be searched by screening for inhibitors of these enzyme activities in vitro.

4). Auxin biosynthesis inhibitor containing an inhibitor of pyridoxalphosphate (PLP) -requiring enzyme or tryptophan aminotransferase as an active ingredient The auxin biosynthesis inhibitor of the present invention comprises AVG and its analogs Inhibitors of pyridoxal phosphate-requiring enzyme are included.

  In addition, the present invention is capable of inhibiting auxin biosynthesis using inhibitors of pyridoxalphosphate (PLP) -requiring enzymes (including trans-deaminase, decarboxylase, CS lyase, racemase, etc.). For the first time. In particular, among the compounds known as inhibitors of PLP-requiring enzymes, the above-mentioned 3. By this method, it is possible to newly select a compound that inhibits auxin biosynthesis. As inhibitors of PLP-requiring enzymes, for example, compounds described in Annual Review of Biochemistry 73: 383-415 (2004) are known. The present inventors have found that AOA (aminooxyacetic acid) known as an inhibitor of ACC synthase (PLP-requiring enzyme) can inhibit auxin biosynthesis by conducting such screening. Therefore, analogs of AOA are also included in the auxin biosynthesis inhibitor of the present invention.

  The present invention also shows for the first time that it is possible to inhibit auxin biosynthesis using inhibitors of transdeaminase (eg, Trp aminotransferase, phenylalanine ammonia lyase). In particular, among the compounds known as transaminase inhibitors, 3. By this method, it is possible to newly select a compound that inhibits auxin biosynthesis. An example of transamylase that does not require PLP is phenylalanine ammonia lyase (PAL). Examples of PAL inhibitors include compounds described in Phytochemistry 68: 407-415 (2007) and Phytochemistry 62: 415-422 (2003), specifically 1-amino-3-phenylpropylphosphonate, 1-amino-2- ( 4-fluorophenyl) ethylphosphonic acid, (R) -1-amino-2-phenylwthylphosphonic acid, and 1-amino-2-phenylethyl-phosphonic acid are known. The present inventors have found that L-AOPP, known as a PAL inhibitor, can inhibit auxin biosynthesis by conducting such screening. Therefore, L-AOPP analogs are also included in the auxin biosynthesis inhibitors of the present invention.

  Specifically, an auxin biosynthesis inhibitor containing, as an active ingredient, a compound selected from the following (formula I) or (formula II).

However, R ₁ is meant a carboxyl group or phosphonic group. R ₂ represents a hydrogen atom or a methyl group. R ₃ represents an amino group or an aminooxy group. R ₄ is hydrogen or R ₅ —CH ₂ —, wherein R ₅ is an indole ring, naphthalene ring, benzene ring, pyridine ring, which may be modified with a chlorine or methyl group, A pyrrole ring is shown.

R ₆ represents an alkyl group having 1 to 4 carbon atoms which may have an amino group.

More specifically,

However, R ₁ is meant a carboxyl group, or a phosphonic group. R ₂ represents a hydrogen atom or a methyl group. R ₃ represents an amino group or an aminooxy group (—O—NH ₂ ).

The steric structure of the asymmetric carbon is more preferably the S form when R ₁ is a carboxyl group, and the R form is preferred when R ₁ is a phosphone group.

が挙げられる。 R ₅ represents an indole ring, naphthalene ring, benzene ring, pyridine ring or pyrrole ring, the carbon atom of which may be substituted with chlorine or a methyl group. Specifically, as R ₅ ,

Is mentioned.

が、R₁がホスホン基のものとしては、1-amino-2-phenylethyl-phosphonic acidや

がそれぞれ挙げられる。 Preferably, when R ₁ is a carboxyl group, L-AOPP or

However, when R ₁ is a phosphonic group, 1-amino-2-phenylethyl-phosphonic acid and

Respectively.

Preferably, when R ₃ is an amino group, 1-amino-2- (1H-indol-3-yl) ethylphosphonic acid, 1-amino-2-phenylethyl-phosphonic acid, R ₃ is aminooxy Examples of the group include AOPP and 2- (aminooxy) -3- (1H-indol-3-yl) propanoic acid.

  Specifically, it includes 2-amino-4-methoxy-3-butenoic acid (AMB) and lysobitoxin (2-amino-4- (2-amino-3-hydroxypropoxy) -3-butenoic acid). In particular, L-tryptophan analogs, compounds having the structure of 2-amino-4-alkoxy-3-butenoic acid and their salts are effective. See FIG.

5. Plant Growth Control Agent The auxin biosynthesis inhibitor of the present invention can be used as a plant growth inhibitor, a plant growth regulator, or a herbicide, such as inhibition of root elongation, suppression of growth of seedlings. For example, the auxin biosynthesis inhibitor can be mixed with various carriers such as talc, clay, starch, water and used as a solid preparation or a liquid preparation. As the liquid preparation, liquid preparations such as liquids, emulsions, microemulsions, suspoemulsions, oils, and oily flowables can be prepared using an appropriate carrier. As a solid preparation, it can be used as a powder, granule, granule, tablet, wettable powder, wettable granule and the like. Furthermore, auxiliary agents used in preparations such as agricultural chemicals, for example, spreading agents, emulsifiers, coloring agents and the like can be added as necessary.

[Example 1]
Behavior of Auxin-Inducible Gene and Ethylene-Inducible Gene upon AVG Treatment Wild-type Arabidopsis (Colombia) seeds were chilled at 4 ° C for 48 hours, then cultured in liquid medium containing 1 / 2MS (Murashige & Skoog) 1% Sucrose for 7 days did. The Arabidopsis seedlings were treated with 10 μM AVG, 10 μM ethylene precursor ACC (aminocyclopropanecarboxylic acid), or 1 μM IAA for 3 hours. After total RNA was purified from the Arabidopsis seedlings, the gene expression level was measured using GeneChip according to the protocol of Affymetrix. The result is shown in figure 2. The vertical axis shows the gene expression response to AVG treatment as a logarithm of the ratio (Signal Log Ratio) to the untreated control. The horizontal axis shows the gene expression response to ACC treatment (FIG. 2A) and IAA treatment (FIG. 2B), respectively, as a Signal Log Ratio with respect to the untreated control. AVG is known as an inhibitor of ethylene biosynthesis. When ACC treatment and AVG treatment were plotted for ethylene-inducible genes (FIG. 2A) and compared, a negative correlation was seen as is known. On the other hand, when IAA treatment and AVG treatment were compared by plotting auxin-inducible genes (FIG. 2B), a negative correlation was observed. This result suggests that AVG has not only an ethylene inhibitory action that has been considered so far, but also an auxin inhibitory action. The AVG used is all S-body including the following examples.

[Example 2]
Changes in Arabidopsis Endogenous IAA Amount after AVG Treatment Wild-type Arabidopsis (Colombia) seeds were cold-treated at 4 ° C. for 48 hours, and then cultured in a liquid medium containing 1 / 2MS 1% Sucrose for 7 days. The seedlings of Arabidopsis were treated with AVG4, 10, or 40 μM for 24 hours. After the Arabidopsis seedlings were extracted with methanol, 13C6-IAA was added as an internal standard substance. After concentrating the extract, it was purified by N (CH ₃ ) ₂ HPLC column, and the IAA elution fraction was fractionated. The IAA fraction was trimethylsilylated and quantitatively analyzed by GC-MS. The results are shown in Figure 3. The amount of Arabidopsis endogenous IAA decreased by AVG treatment depending on the concentration of AVG treated.

[Example 3]
Gene expression recovery from AVG treatment using ACC and auxin-related compounds Wild-type Arabidopsis (Col.) seeds were chilled at 4 ° C for 48 hours, then in a liquid medium containing 1 / 2MS 1% Sucrose for 7 days Cultured. The Arabidopsis seedlings were treated with 40 μM AVG and 10 μM ethylene biosynthesis precursor ACC, IAA, IAA biosynthesis precursor IPyA (Indole-3-pyruvic acid), or IAAld (Indole-3-acetaldehyde) for 24 hours. After purifying RNA from these Arabidopsis seedlings, the expression level of the IAA19 / At3g15540 gene, which is one of the genes for auxin action, was measured using a quantitative PCR method (ABI PRISM7500) using a Taqman probe. The primer was forward (GAGCATGGATGGTGTGCCTTAT), reverse primer (TTCGCAGTTGTCACCATCTTTC), TaqMan probe (FAM-ATAAGCTCTTCGGTTTCCGTGGCATCG-TAMRA), and the measurement was performed by the method described in the literature (PlantPhysiol131: 287-297). The results are shown in FIG.

  The vertical axis shows the relative value of the gene expression level with the control group as 1. The expression level of IAA19 gene was restored to the control level with the precursor of auxin biosynthesis via IPyA (IPyA, IAAld). This trend did not change with the addition of ACC. This result indicates that AVG suppresses the expression of auxin-responsive genes by inhibiting the biosynthesis of IAA. Moreover, it is shown that the inhibitory effect of auxin-responsive gene expression by AVG is not an indirect action through inhibition of ethylene biosynthesis.

[Example 4]
Changes in Auxin-Induced Live Gene Expression after AVG and AOA Treatment Wild-type Arabidopsis (Colombia) seeds were chilled at 4 ° C. for 48 hours and then cultured in a liquid medium containing 1 / 2MS 1% Sucrose for 7 days. The Arabidopsis seedlings were treated with AVG or AOA at 1, 5, or 20 μM for 24 hours. Like AVG, AOA is known to inhibit the biosynthesis of ethylene by inhibiting the action of pyridoxalphosphate-dependent enzymes. RNA was purified from the Arabidopsis seedlings after the treatment, and the expression levels of IAA1 and IAA2 genes, which serve as indicators of auxin action, were measured using a quantitative PCR method using a Taqman probe (FIG. 5). The vertical axis shows the relative value of the gene expression level with the control group as 1. In both IAA1 / At4g14560 and IAA2 / At3g23030 genes, the expression level decreased with AVG treatment depending on the concentration. Similarly, AOA treatment also reduced the expression of auxin-induced live genes, but the effect was slightly weaker than AVG.

[Example 5]
Root extension recovery from Met-Trp or AVG treatment using auxin and related compounds Wild-type Arabidopsis (Col.) seeds were chilled at 4 ° C for 48 hours, then 1 / 2MS 1% Sucrose The cells were cultured for 2 days on the agar medium containing them. The Arabidopsis seedlings were transplanted to 1 / 2MS 1% Sucrose agar medium containing α-methyltryptophan (Met-Trp) and allowed to grow vertically for 6 days. Met-Trp inhibited the L-Trp synthesis pathway upstream, but we observed whether growth inhibition by Met-Trp could be recovered by IAA and its biosynthetic precursors, and root elongation recovery as an indicator. The results are shown in FIG.

  Compared to the control group (A), Met-Trp treatment significantly inhibited root elongation (B). This root elongation inhibitory effect was restored by indole and tryptophan (Trp) (C, D) but not by other auxin precursors (E-K). This result indicates that Met-Trp inhibits their biosynthesis upstream of tryptophan and indole.

  Similarly, Arabidopsis seedlings 2 days after germination were arranged vertically in 1 / 2MS 1% Sucrose agar medium containing AVG, auxin and its precursors, and 6 days later, root recovery was observed. The results are shown in FIG. Compared with the control group (A), AVG treatment significantly inhibited root elongation (B). This root elongation inhibitory effect was restored by indole and L-tryptophan (C, D), a precursor of the auxin synthesis pathway via IPyA (IJ), but not by other precursors not via IPyA (EH). ). The recovery of auxin synthesis pathway compounds via indolepyruvic acid was remarkable compared with the recovery of indole and L-tryptophan. This result indicates that AVG inhibits auxin synthesis at a step during the synthesis of IAA from indole. On the other hand, indole and L-tryptophan partially recover root elongation because there are multiple IAA synthetic pathways, and indole and L-tryptophan are converted to IAA via a pathway that is not inhibited by AVG. It is thought that.

[Example 6]
Inhibitory effect of AVG and AOA on L-tryptophan to IPyA conversion in vitro Wheat germ extract (Wg) and 5 mM L-tryptophan, 0.2 mM pyridoxal phosphate (PLP), 0.5 mM 2 oxoglutarate (20X), and 4 mM EDTA was reacted for 90 minutes at 30 ° C. in borate buffer. The product is derivatized to oxime with hydroxyamine in imidazole buffer containing MeOH. The solution was acidified with hydrochloric acid, extracted with ethyl acetate, purified with an OASIS MCX column, and the amount of IPyA produced was measured using LC / MS / MS (LC: HP 1100 Series HPLC System (Hewlett Packard / Agilent Technologies ), MS: QSTAR Pulsar (PE Sciex / Applied Biosystems)). The results are shown in FIG. In FIG. 8, -Trp did not add L-tryptophan, -2OX did not add 2 oxoglutaric acid (20X), and -PLP did not add pyridoxal phosphate (PLP). It shows that each. The amount of IPyA generated from L-tryptophan increased depending on the addition of PLP and 2OX. And the amount was reduced by adding AVG or AOA. This indicates that the auxin biosynthesis step from tryptophan to indole pyruvate is catalyzed by PLP enzyme, and its activity is inhibited by AVG and AOA.

[Example 7]
Effects of AVG and AOA on the growth of Arabidopsis seedlings After treatment of wild-type Arabidopsis (Colombia) seeds at 4 ° C for 48 hours, 1 / 2MS1% Sucrose in an agar medium containing 10 µM (B) and 2 µM (D) of AVG Cultured. The results are shown in FIG. (A) and (C) are control plots. The cells were cultured at 21 ° C. and observed on the 14th day (C) (D) and the 30th day (A) (B). 2 μM AVG treatment inhibited the growth of seedlings after germination (D). At 10 μM, the seedlings were whitened and died immediately after germination. The direction of root extension does not follow gravity and the direction is not fixed.

  Wild type Arabidopsis thaliana (Colombia) seeds were treated at 4 ° C. for 72 hours, and then cultured in a liquid medium (F) containing 100 μM AOA in 1 / 2MS 1% Sucrose at 21 ° C. for 6 days. (E) is the control group. With the addition of AOA, the growth of seedlings was suppressed in both the above-ground and underground parts, but the action was slower than AVG (Fig. 9).

[Example 8]
Effect of AVG and L-AOPP on L-tryptophan to IPyA converting enzyme (derived from Arabidopsis thaliana) in vitro Arabidopsis seedlings were grown in a medium of 1 / 2MS 1% sucrose for 3 days. The seedlings were frozen at -80 ° C and pulverized, and the protein was extracted with an extraction buffer (40 mM HEPES-OKH (pH 7.6), 10 mM potassimu chloride, 5 mM magnesium chloride, 2 mM calcium chloride, 4 mM dithiothreitol). . After centrifugation at 20000 g for 10 minutes, gel filtration was performed using a Sephadex G-25 column to obtain a polymer fraction as a crude enzyme extract. Using this, an enzymatic reaction from L-tryptophan to indole pyruvate was performed.

  The reaction was incubated at 35 ° C. for 1 hour in the dark in the presence of extracted protein 76 μg / ml, 0.1 M borate buffer (pH 8.5), 0.25 mM L-tryptophan, 0.5 mM 2-oxoglutaric acid, 0.05 mM PLP. The amount of indole pyruvic acid produced was determined according to Example 6. The results are shown in FIG. As a control, an Arabidopsis thaliana extract enzyme treated at 95 ° C. for 5 minutes was used (EE Heat). In addition, the amount of IPyA produced when PLP and 2-oxoglutaric acid were removed from the reaction was also shown (No CoE). When the extract was heat-treated, no activity was detected, and when PLP and 2 oxoglutaric acid were removed, the activity was 50% or less, indicating that this reaction is an enzyme reaction dependent on PLP and 2 oxoglutar.

  Next, the reaction was performed by adding complete inhibitor, AVG (10, 20, 50, 100 μM) or L-AOPP (0.1, 0.3, 1, 2 μM).

The vertical axis shows the amount of IPyA produced as a relative value. FIG. 10A shows the average value of three repetitions. Both AVG and L-AOPP inhibited the activity of IPyA synthase in Arabidopsis thaliana.
Based on these results, IC50 was calculated. As a result, AVG was 47.9 μM, L-AOPP was 0.77 μM, and L-AOPP was about two orders of magnitude more active than AVG (FIGS. 10B and C).

[Example 9]
Effect of AOA and AOIBA on L-tryptophan to IPyA converting enzyme (derived from Arabidopsis thaliana) in vitro In the same manner as in Example 8, a crude enzyme extract was produced from Arabidopsis seedlings and subjected to enzymatic reaction. The reaction conditions were the same as in Example 8. As controls, an Arabidopsis thaliana extract enzyme treated at 95 ° C. for 5 minutes (EE Heat) and the amount of IPyA produced when PLP and 2-oxoglutaric acid were removed from the reaction (No CoE) are shown. Indolepyruvic acid was quantified according to Example 6. The results are shown in FIG. A vertical axis | shaft shows the production amount of indole pyruvic acid by a relative value. The graph shows the average value of three repetitions.

  Next, the reaction was performed by adding no inhibitor (complete) and AOIBA (1, 3, 10, 30 μM) or AOA (0.1, 0.3, 1, 3 μM).

  Both AOIBA and AOA inhibited the IPyA synthase activity of Arabidopsis thaliana. Based on the results, IC50 was calculated to be 0.4 μM for AOA and 1.26 μM for AOIBA, both of which were more active than AVG.

[Example 10]
Effects of L-AOPP and D-AOPP on the expression of auxin-responsive genes
In order to elucidate the specificity of the three-dimensional structure when AOPP inhibits indole pyruvate synthase, we investigated the effects of L-AOPP and D-AOPP on auxin-responsive gene expression.
Arabidopsis thaliana was grown in a liquid medium containing 1 / 2MS and 1% sucrose for 7 days and treated with L-AOPP (1, 3, 10, 30 μM) and D-AOPP (1, 3, 10, 30 μM) for 3 h. The plant body was sampled and RNA was purified. According to the method of Example 3, the expression levels of the IAA19 / At3g15540 and IAA1 / At4g14560 genes were measured using quantitative PCR. The results are shown in FIG. D-AOPP suppressed IAA gene expression from 3 μM. On the other hand, D-AOPP inhibited IAA1 gene expression at 30 μM, but did not inhibit IAA19 gene expression. From this, it can be said that S body is more effective than R body by inhibiting IAA gene expression. The three-dimensional structure of S-form has a homologous relationship with the three-dimensional structure of L-tryptophan, and that these compounds work as analogs of L-tryptophan, that is, S-form is more effective in inhibiting auxin biosynthesis. (The experiment is an average of two replicates.)

[Example 11]
Effect of L-AOPP on Arabidopsis thaliana growth Arabidopsis thaliana was grown in 1% sucrose 1 / 2MS medium containing L-AOPP, but no growth inhibition was observed. This was because L-AOPP was unstable in MS medium. Therefore, the influence of L-AOPP on the growth of Arabidopsis thaliana in sugar agar without MS medium components was examined. Arabidopsis seedlings were grown for 4 days in 1 / 2MS medium containing 1% sucrose to a main root length of about 1 cm. These seedlings were transplanted to 1% sucrose agar supplemented with drugs and cultured at 21 ° C. for 4 days. The results are shown in FIG. 13 and FIG.

  In the presence of 30 μM L-AOPP, Arabidopsis roots slanted to the left and wavyly elongated. This is said to indicate that the gravitropism of the root is not working properly. In contrast, the addition of indole, L-tryptophan, and indolepyruvic acid restored the root gravitropism. In addition, when 1 nM IAA was added, the gravitropism almost recovered, but when 10 nM IAA was added, the root elongation was slightly inhibited, but the root gravitropism was completely Recovered. This indicates that L-AOPP inhibits the biosynthesis of auxin that regulates gravitropism, and this inhibition is restored by an IAA intermediate via tryptophan and IAA. In addition, when L-AOPP was treated at a concentration of 50 μM or more, the elongation of the main root was inhibited, and this inhibition was recovered by IAA and IPyA.

[Example 12]
Effect on Arabidopsis IAA Endogenous Growth Arabidopsis seedlings were cultured in 1/2 MS agar medium at 22 ° C. under continuous light for 6 days. Seedlings with sufficient growth were transplanted 20 strains into 1 / 2MS liquid medium (5 ml), cultured for 24 hours, and treated with 30 μM AVG or L-AOPP for 1 hour. D5-IAA was added as an internal standard, extracted with MeOH, purified with an oasis HLB, MCX column, and the amount of IAA was quantified by LC-MS / MS. The quantitative analysis by LC-MS / MS was performed according to the method described in Example 6. The results are shown in FIG. 15, and are the average and standard error of the results of three independent experiments, and the vertical axis indicates the amount of IAA. The left shows the amount of IAA per gram of fresh weight, and the right shows the amount of IAA per seedling. As a result, both AVG and L-AOPP significantly reduced the endogenous amount of IAA.

[Example 13]
Effect on IAA Endogenous Rice Rice (Koshihikari) seeds were sterilized and allowed to germinate by water absorption at 25 ° C. for 3 days. This was seeded on agar and cultured at 28 ° C. for 2 days.

  The seedlings with the same growth were transferred to 10 ml of water, and cultured with shaking at 28 ° C. for 3 hours in the presence of 30 μM inhibitors Met-Trp, AVG, AOA and L-AOPP. After cultivation, the seedlings are divided into the above-ground part, roots and seeds, and d5-IAA is used as an internal standard so that the above-ground part and the below-ground part are 100 pg / mg FW (Fresh Weight, FW in other drawings is the same). In addition to the substance, the amount of IAA was quantified using LC-MS / MS according to Example 12. The results are shown in FIG. The vertical axis of the graph indicates the amount of IAA per 1 mg of fresh weight. Average values and standard errors obtained by repeating this experiment three times are shown. Met-Trp, which inhibits tryptophan biosynthesis, did not affect the endogenous amount of IAA. On the other hand, AVG, AOA, L-AOPP decreased the endogenous amount of IAA.

  The invention of the present application has an extremely excellent effect of providing an auxin biosynthesis inhibitor and a screening method thereof for the first time. This makes it possible to control the amount of auxin in the plant, which was impossible before, and it will be possible to develop completely new plant growth regulators and herbicides in the future.

The present invention can be used in plant growth regulators, herbicides and their production fields.
All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety.

Claims (10)

  Auxin responsiveness in a method in which a plant is treated with a test compound and a control compound, the expression level of the auxin responsive gene is measured, and a candidate for an auxin biosynthesis inhibitor is screened from compounds that suppress the expression of the auxin responsive gene. Using a microarray carrying a probe for a gene, treating a plant with a test compound or a control compound, measuring the gene expression, and selecting a compound that suppresses the expression of the auxin-responsive gene group as an auxin biosynthesis inhibitor candidate A method for screening a synthetic inhibitor candidate.   2. The method for screening a candidate for an auxin biosynthesis inhibitor according to claim 1, wherein an inhibitor of pyridoxal phosphate-requiring enzyme or aminotransferase is used as a test compound.   An auxin biosynthesis inhibitor, wherein a plant is treated with a test compound and a control compound, endogenous auxin is extracted from the treated plant, the amount thereof is measured, and an inhibitor of auxin synthesis is selected as an auxin biosynthesis inhibitor How to screen.   The method for screening an auxin biosynthesis inhibitor according to claim 3, wherein an inhibitor of pyridoxal phosphate-requiring enzyme or aminotransferase is used as the test compound.   Treat a tryptophan deaminase extract containing tryptophan with a test compound and a control compound, measure the amount of indole pyruvate in the treated extract, and select one that inhibits the production of indole pyruvate as an auxin biosynthesis inhibitor A method for screening an auxin biosynthesis inhibitor.   The method for screening for an auxin biosynthesis inhibitor according to claim 5, wherein an inhibitor of pyridoxal phosphate-requiring enzyme or aminotransferase is used as the test compound. An auxin biosynthesis inhibitor containing a compound selected from the following formula (I) or formula (II) as an active ingredient.

However, R ₁ is meant a carboxyl group, or a phosphonic group. R ₂ represents a hydrogen atom or a methyl group. R ₃ represents an amino group or an aminooxy group (—O—NH ₂ ). R ₄ is hydrogen or R ₅ —CH ₂ —, wherein R ₅ is an indole ring, naphthalene ring, benzene ring, pyridine ring, pyrrole, the carbon atom of which may be modified with a chlorine or methyl group Indicates a ring.

R ₆ represents alkyl having 1 to 4 carbon atoms which may have an amino group.   An auxin biosynthesis inhibitor containing AVG, AOA, AOIBA, AOPP or an analog thereof as an active ingredient.   An auxin biosynthesis inhibitor comprising an inhibitor of pyridoxalphosphate-requiring enzyme or a tryptophan aminotransferase inhibitor.   A plant growth regulator or herbicide containing an auxin biosynthesis inhibitor as an active ingredient.

Images