WO2008129554A1 - Stem cell-derived retinal pigment epithelial cells - Google Patents
Stem cell-derived retinal pigment epithelial cells Download PDFInfo
- Publication number
- WO2008129554A1 WO2008129554A1 PCT/IL2008/000556 IL2008000556W WO2008129554A1 WO 2008129554 A1 WO2008129554 A1 WO 2008129554A1 IL 2008000556 W IL2008000556 W IL 2008000556W WO 2008129554 A1 WO2008129554 A1 WO 2008129554A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- rpe
- rpe cells
- hscs
- differentiation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/30—Nerves; Brain; Eyes; Corneal cells; Cerebrospinal fluid; Neuronal stem cells; Neuronal precursor cells; Glial cells; Oligodendrocytes; Schwann cells; Astroglia; Astrocytes; Choroid plexus; Spinal cord tissue
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/44—Vessels; Vascular smooth muscle cells; Endothelial cells; Endothelial progenitor cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/48—Reproductive organs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0048—Eye, e.g. artificial tears
- A61K9/0051—Ocular inserts or implants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0618—Cells of the nervous system
- C12N5/0621—Eye cells, e.g. cornea, iris pigmented cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/30—Organic components
- C12N2500/38—Vitamins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/90—Serum-free medium, which may still contain naturally-sourced components
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/99—Serum-free medium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/15—Transforming growth factor beta (TGF-β)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/155—Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/16—Activin; Inhibin; Mullerian inhibiting substance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/999—Small molecules not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/02—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2533/00—Supports or coatings for cell culture, characterised by material
- C12N2533/50—Proteins
- C12N2533/52—Fibronectin; Laminin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
Definitions
- This invention relates to methods and systems for producing differentiated retinal pigment epithelial cells (RPE) and to therapeutic uses of RPE cells obtained thereby.
- RPE retinal pigment epithelial cells
- RPE retinal pigment epithelium
- AMD age-related macular degeneration
- Best disease the early onset form of vitelliform macular dystrophy
- RP retinal function
- the macula the central part of the retina, is responsible for fine visual detail and color perception, and is crucial for many of our daily visual tasks such as facial recognition and reading.
- the macula is often affected as part of the disease process in widespread retinal degenerations such as retinitis pigmentosa (RP), as well as in different diseases that more specifically target the macular region such as age-related macular degeneration (AMD) and Best disease.
- RP retinal degeneration
- AMD age-related macular degeneration
- Best disease the primary dysfunction and failure occurs in the retinal pigment epithelium (RPE) cells which underlie the photoreceptors.
- the highly specialized RPE cells play a major role in supporting photoreceptor function: they actively transport nutrients from the choroidal vessels, participate in the recycling of vitamin A, which is necessary for the chromophores in the photoreceptors, and take-up and recycle shed photoreceptor outer segments as part of the normal renewal process of these cells 1 .
- hESCs Human embryonic stem cells
- NPs neural precursor cells
- hESCs may be directed to reproducibly differentiate into RPE cells, in which directed rather than spontaneous differentiation of hESCs towards an RPE fate occurred in the presence of Nicotinamide (NA) 8 .
- NA Nicotinamide
- the present invention provides the use of a member of the transforming growth factor- ⁇ (TGFB) superfamily for the preparation of a culture system for promoting directed and augmented differentiation of human stem cells (hSCs) into retinal pigment epithelial (RPE) cells.
- TGFB transforming growth factor- ⁇
- the present invention provides a method for promoting directed differentiation of hSCs into RPE fate, the method comprising:
- a cell culture comprising RPE cells obtained by directed differentiation of hSCs in the presence of one or more member of TGF ⁇ superfamily.
- the RPE cells are terminally differentiated
- RPE cells obtained by the method disclosed herein.
- such RPE cells exhibit several characteristic traits that are different from those obtained when hSCs are spontaneously differentiated into RPE cells.
- the RPE cells are capable of responding to TGF ⁇ signaling during their differentiation.
- a method of transplanting hSCs-derived RPE cells into a subject's eye, said RPE cells obtained by directed differentiation of said hSCs, the method comprises
- a cell culture system comprising transplantable hSCs-derived RPE cells obtained by directed differentiation of said hSCs.
- the transplanted RPE cells exhibited one or more parameters indicative that said transplanted cells are functional within said subject eye.
- the functionality of the transplanted RPE cells is exhibited by their ability to uptake shed outer segments of photoreceptors in parallel to improving retinal function
- the hSCs in the culture system of the methods disclosed herein are differentiating hSCs, i.e. a population of hSCs essentially in an undifferentiated state, or wherein at least part of said cells have been induced to undergo initial stages of directed differentiation and at times, the majority of said cells have been induced to undergo initial stages of directed differentiation.
- the initial stage of differentiation is achieved by a priori exposing the cells to NA although initial stages of differentiation will occur also when the undifferentiated cells are co-exposed to NA and the one or more member of the TGF ⁇ superfamily.
- the hSCs are human embryonic stem cells (hESCs).
- the culturing of cells in a medium comprising one or more member of TGF ⁇ superfamily is at least two days after the hSCs have initiated differentiation;, directed differentiation, preferably directed by NA.
- a method of treating or preventing in a subject a retinal disease or disorder comprising dysfunction, injury, and/or loss of retinal pigment epithelium comprises intraocular transplantation to said subject of hSC-derived RPE cells, the RPE cells obtained by inducing the hSCs towards directed differentiation.
- the transplantable RPE cells are preferably obtained by the method disclosed herein.
- FIGS 1A-1E Real-Time PCR, analyzing the expression of RPE markers in the presence of NA. Differentiation of hESCs was induced by culturing them as free floating clusters. At 6 weeks of differentiation, the level of expression of the RPE markers MiTF-A (Fig. IA) and RPE65 (Fig. IB) was significantly enhanced in the presence of NA..
- Real-Time PCR analysis at sequential time points demonstrated the progressive increase in the expression levels of MiTF-A (Fig. 1C) and RPE65 (Fig. ID) along time in the presence of NA. Expression of additional transcripts of RPE markers including Bestrophin, CRALBP and Mertk were demonstrated by RT-PCR analysis of plated pigmented clusters (Fig. IE). +/- indicates presence or absence, respectively, of reverse transcriptase.
- Figures 2A-2F The RPE differentiation inductive effect of NA is not dependent on a specific medium composition. Dark field micrographs of hESC clusters differentiating 12 weeks in KO medium (Fig. 2A) or in Neurobasal medium supplemented with N2, which is substituted after 1 week with DMEM/F12 supplemented with B27 (NN medium) (Fig. 2C). In both media NA augmented the differentiation towards pigmented cells (Fig. 2B, D) though the size of the differentiated hESC-clusters and their total number was smaller with NN medium (white arrows mark pigmented areas within differentiating clusters). At the RNA level, in both media, NA supplementation enhanced the level of expression of MiTF-A and RPE65 (Fig. 2E, and F; respectively).
- Figures 3A-3L Melanin-expressing cells within free floating clusters of hESCs are putative RPE cells. Dark field micrograph of free floating clusters of differentiating hESCs with defined areas highly enriched for pigmented cells (Fig. 3A). Fluorescence (Fig. 3B) and phase contrast (Fig. 3C) images of pigmented cells following dissociation and plating that are immunoreactive with anti Otx2 and MiTF. A dark field micrograph of differentiating clusters after plating illustrating confined pigmented areas is shown (Fig. 3D). Phase contrast image of cells within the pigmented areas having morphological characteristics that are typical of RPE cells (Fig. 3E).
- FIGs 4A-4E Activin A induces RPE differentiation.
- Human ESCs were allowed to differentiate as free floating clusters for 6 weeks in the absence or presence of activin A which was supplemented after the first week of differentiation.
- Dark field micrographs of the clusters show that activin A significantly increased the percentage of clusters that included pigmented cells (Fig. 4A, B) (white arrows mark pigmented areas within differentiating clusters and the borders of pigmented areas within some of the clusters are marked by dashed lines).
- the borders of the pigmented areas are more sharply demarcated from surrounding non-pigmented areas within the clusters.
- the pigmented cells are darker in the presence of activin A (Fig. 4B).
- Figure 6A-6J Survival and integration of transplanted hESC-derived RPE cells in rat eyes. Following intraocular transplantation of hESC-derived RPE cells, the pigmented cells could be readily identified in vivo in the eyes of albino rats (Figs. 6A, 6B). Following enucleation of the eye (Fig. 6B) and removal of the cornea and lens, the main graft as well as additional dispersed pigmented spots could be seen (Fig. 6C). In histological sections, grafts that included dark pigmented cells which also co-express GFP could be identified (Fig. 6D-6G), attesting to the fact that the cells were hESC- derived.
- Transplanted cells could be found in the intravitreal area, between the retina and lens (Fig. 6H), in the retina (occasionally protruding into the vitreous along the tract of injection) (Fig. 61), and also in the subretinal space (Figs. 61, 6O, 6P).
- Transplanted hESC-derived RPE cells (pigmented cells marked with arrows) integrated into the RPE layer of albino rats (Fig. 6J). Pigmented cells were not observed in the
- Fig. 6K-6N showed that there were tight junctions between transplanted GFP+ hESC- derived cells. Such junctions are characteristic of RPE cells. Following transplantation into the subretinal space of RCS rats with RPE dysfunction and retinal degeneration, relative preservation of the photoreceptor layer could be seen in proximity to the graft
- Figures 8A-8I Analysis of morphology and marker expression showing the effect of NA in inducing the development of pigmented cells from hESCs.
- Dark field micrographs showing the progressive appearance of pigmented cells during culturing of hESC-derived clusters for 4 weeks (Fig. 8A, 8B), 6 weeks (Figs. 8C, 8D) and 8 weeks (Fig. 8E, 8F) in the presence (Figs. 8A, 8C, and 8E) or absence of NA (Fig. 8B, 8D or 8F) (white arrows mark pigmented areas within differentiating clusters).
- FIG. 8G Histogram presentation of the percentage of clusters containing pigmented areas at different time points during culture in medium supplemented with NA ⁇ bars with bold line) and in control cultures ⁇ bars with fine line) (Fig. 8G). Histogram presentation of the percentage of pigmented cells (Fig. 8BQ. and the cells that are immunoreactive with anti-MiTF (Fig. 81), an early RPE marker, during 8 weeks of culture with NA supplementation Scale bars: (A) 200 ⁇ m; * p ⁇ 0.05; ** pO.OOl .
- FIGS 9A-9S Real-time PCR, immunostaining and flow cytometry analysis showing the progression of RPE development along time in hESC differentiating clusters.
- FIG. 9A-9L Real-time PCR 5 analyzing the timing of the expression of key genes in RPE development in clusters cultured in the presence (bars with bold line) or absence (bars with fine line) of NA. The progressive expression of the following markers was analyzed at sequential time points during 8 weeks differentiation of hESC-derived clusters: the hESC-specific marker, Oct4 (Fig. 9A); the early neural markers, Otx2 (Fig. 9B), Musashi (Fig. 9C) and Pax6 (Fig. 9D); the retinal progenitor markers, Six3 (Fig.
- Figure 10A-10J Analysis of morphology, marker expression and function showing that the pigment-expressing cells within free-floating clusters of hESCs are putative RPE cells. Phalloidine staining showing distribution of F-actin within the hESC-derive pigmented progeny which is characteristic of RPE (Fig. 10A); After dissociation, plating at low density and cultivation, the pigmented cells lost pigmentation and acquired fibroid-like morphology (phase contrast image, 1 week of culture) (Fig. 10B). Following further prolonged cultivation and proliferation into high density cultures the cells reacquired the morphology and pigmentation characteristics of RPE cells (1.5 month of culture) (Fig. 10C).
- Electron microscopic analysis of hESC- derived RPE cells showing features characteristic of RPE: microvilli (Fig. 10D), a basal membrane (Fig. 10E), melanin granules (Fig. 10D), tight junctions (Fig. 10F).
- Phase contrast Fig, 1OG and fluorescent images Fig. 10H-J
- Fig. 10H-J Phase contrast Fig, 1OG and fluorescent images showing phagocytosis of green fluorescent latex beads (Wight arrowheads) by the hESC-derived pigment cells; the cell n ⁇ embranes were stained with red fluorescent die PKH (grey color).
- the three confocal fluorescent images demonstrated serial z axis slices (Fig. 10H- J).
- Figures HA-HP Analysis of morphology and gene expression showing that factors from the TGF ⁇ family promote differentiation towards RPE fate.
- Dark field micrographs of hESC-derived clusters differentiating for 4 weeks showed the appearance of pigmented cells at this early stage in the presence of activin (Fig. HA). as well as the increase in number of pigmented clusters differentiating in the presence of activin A and NA (Fig. HC) as opposed to NA only (Fig. HB).
- activin A Similar to activin A, supplementation with TGF ⁇ l also increases the appearance of pigmented clusters (Fig. HD).
- SB431542 the inhibitor of activin signaling pathway, SB431542 together with activin A and NA reduced the effect of activin A on the appearance of pigmented clusters (Fig. HE).
- Histogram analysis of the percentage of pigmented cells after 4 weeks of culture with NA (bars with bold line) or activin A and NA (bars with diagonal stripes) supplementation (Fig. HI). Histogram analysis of the percentage of pigmented cells (Fig. HJ) and the level of expression of transcripts of the RPE markers, Bestrophin (Fig. HK) and RPE65 (Fig. HL) at different concentrations of activin A, that 140 ng/ml is optimal for RPE induction.
- FIG. 12A-12E RPE cells derived from hESCs treated by NA and Activin A survive following sub-retinal transplantation in dystrophic RCS rat eyes. Clusters of pigmented cells could be readily identified in- vivo in the eyes of RCS rats using fundus imaging systems (Figs. 12A-12C); Fundus photo (Fig. 12A) and red-free photo (Fig. 12B) which showed the subretinal location of the grafts (note retinal vessels coursing over the pigmented areas).
- the hESC-derived, GFP-expressing cells can be seen to emit fluorescence when fluorescein excitation and emission filters were used (Fig. 12C).
- Figs. 12D-12E In eye cup preparations imaged ex-vivo in a fluorescence microscope (Figs. 12D-12E), large clusters of subretinal GFP -positive cells can be seen (Fig. 12D) as well as multiple, dispersed smaller clusters (Fig. 12E).
- FIG. 13A-13F Histologic appearance of sub-retinal hESC-derived, Activin-A-treated RPE cell grafts in RCS rat eyes. Histologic sections stained by hemotoxylin and eosin (Fig. 13A, and IB) showed the subretinal and occasionally intra- retinal location of transplanted hESC-derived pigmented cells, which appeared in clusters or as isolated cells (arrows). Immunostaining with GFP (Figs. 13C-13F) confirmed that the cells are indeed hESC-derived. Grafts were often quite large and dispersed (Figs. 13C, 13E), and pigmented cells co-expressing GFP can be clearly seen (Figs. 13D, 13F). Note GFP-positive pigmented cells integrating within the host RPE layer (Fig. 13D, arrow).
- FIG. 14A-14O Transplanted hESC-derived pigmented cells express markers of mature RPE. Immunostaining revealed that large numbers of transplanted cells within grafts express proteins which are characteristic of mature RPE cells, including the RPE-specific markers RPE65 (Figs. 14A-14E) and Bestrophin (Figs. 14F- 14J) as well as the tight-junction marker ZO-I (Figs. 14K-14O). Figs. 14A, 14F and 14K show low-magnification fluorescent image of grafts co-expressing GFP and the relevant marker. High magnification confocal images in each row show pigment (by Nomarski optics) as well as co-expression of GFP and the different markers at the single-cell level.
- FIG. 15A-15C Transplanted hESC-derived, Activin-A treated RPE cells provide functional rescue in the RCS rat retinal degeneration model.
- Full field ERG responses recorded at the age of 8 weeks were higher in RCS rat eyes following transplantation of activin-treated RPE cells derived from hESC as compared to fellow non-transplanted control eyes as well as compared to eyes in which subretinal injection of medium alone was performed.
- Representative ERG responses to a series of white flashes of increasing intensity in the dark-adapted state are shown in a transplanted eye (Fig. 15A) versus its fellow control eye (Fig. 15B).
- Fig. 15A transplanted eye
- FIG. 16A-16D Transplanted hESC-derived, Activin-A treated RPE cells provide structural rescue in the RCS rat retinal degeneration model.
- the effects of transplanted hESC-derived, activin-treated RPE cells on the degenerating host retina were examined and quantified using high resolution microscopic images of hematoxylin and eosin stained sections.
- Relative preservation of the outer nuclear (photoreceptor) layer (ONL) and of the inner and outer photoreceptor segments (IS+OS) was observed in proximity to sub-retinal RPE grafts as compared with areas distant from the grafts (two examples shown in Fig. 16A, 16B). Inserts in Fig.
- FIG. 16A demonstrate this difference (rescued retina with relatively thick ONL shown in right insert in proximity to graft; severe thinning of the ONL is seen in left insert, distant from the graft).
- FIG 17A-17E Transplanted hESC-derived, Activin-A treated RPE cells uptake rhodopsin in-vivo. Confocal images of subretinal transplanted RPE cells show the co- localization of pigment, GFP, RPE65 and rhodopsin within the same single cells.
- the native RPE cells of the RCS rat express RPE65 (Fig 17C 5 arrow) but do not express GFP (Fig 17D, arrow) and contain minimal amounts of rhodopsin (Figs. 17B, 17E).
- the present disclosure provides the use of one or more members of the transforming growth factor- ⁇ (TGFB) superfamily for the preparation of a culture system for promoting differentiation of human stem cells (hSCs), preferably human embryonic stem cells (hESCs) into retinal pigment epithelial (RPE) cells.
- hSCs human stem cells
- hESCs human embryonic stem cells
- RPE retinal pigment epithelial
- RPE cells obtained by directed differentiation of hSCs in the presence of one or more the TGFB superfamily as well as a method for promoting directed differentiation of hSCs into RPE fate, as well as methods for growing and maintaining such hSCs-derived RPE cells and methods making use of such hSCs-derived RPE cells.
- the RPE cells obtained according to the teaching herein are mature (in other words, terminally differentiated) and functional RPE cells, as will be further discussed and explained below.
- the present disclosure broadly concerns the use of one or more members of the
- TGFB superfamily of growth factors in promoting/inducing/augmenting the directed differentiation of hSCs into RPE cells, preferably mature RPE cells.
- Transforming growth factor- ⁇ (TGF ⁇ ) superfamily growth factor denotes any member of the TGFB superfamily of growth factors, such as transforming growth factor- ⁇ proteins, including the TGF ⁇ l, TGF ⁇ 2, and TGF ⁇ 3 subtypes, as well as homologous ligands including activin (e.g., activin A, activin B, and activin AB), nodal, anti-muUerian hormone (AMH), some bone morphogenetic proteins (BMP), e.g. BMP2, BMP3, BMP4, BMP5, BMP6, and BMP7, and growth and differentiation factors (GDF).
- activin e.g., activin A, activin B, and activin AB
- AMH anti-muUerian hormone
- BMP bone morphogenetic proteins
- BMP2 bone morphogenetic proteins
- BMP5 BMP5, BMP6, and BMP7
- GDF growth and differentiation factors
- Human stem cells or “hSCs”, as used herein, refers to cells of human origin which under suitable conditions are capable of differentiating into other cell types having a particular, specialized function while under other suitable conditions are capable of self renewing and remaining in an undifferentiated pluripotential state as detailed below.
- a "cell” as used herein refers to a single cell as well as to a population of (i.e. more than one) cells. The population may be a pure population comprising one cell type. Alternatively, the population may comprise more than one cell type.
- the hSCs cells are preferably hematopoietic or mesenchymal stem cells obtained from bone marrow tissue of an individual at any age or from cord blood or tissue of a newborn individual, neural stem cells obtained from fetal, any age post birth, or cadaver brain, embryonic stem (ES) cells obtained from the embryonic tissue formed after fertilization (e.g., blastomere, blastocyst), or embryonic germ (EG) cells obtained from the genital tissue of a fetus any time during gestation, preferably before 10 weeks of gestation.
- the term cell may denote a single cell or a cluster of cells.
- Embryonic stem cell and "Pluripotent embi ⁇ onic stem cell”, as used herein, refer to a cell which can give rise to any differentiated cell types in an embryo or an adult, including the germ cells (sperm and eggs).
- Cell culture or “Cultured cell”, as used herein, refer to cells or tissues that are cultured, cultivated or grown in an artificial, in vitro environment.
- Undifferentiated pluripotential hSCs “Pluripotent hSCs” as used herein, refer to precursor cells of human source that have the ability to form any adult cell. Such cells are true cell lines in that they: (i) are capable of extensive proliferation in vitro in an undifferentiated state; and (ii) are capable of differentiation to derivatives of all three embryonic germ layers (endoderm, mesoderm, and ectoderm) even after prolonged culture.
- hESCs are derived from fertilized embryos that are less than one week old (in the cleavage or blastocyte stage) or produced by artificial means (such as by nuclear transfer) that have equivalent characteristics.
- Other pluripotent hSCs include, without being limited thereto, multipotent adult progenitor cells (MAPs), induced pluripotent stem cells (iPS cells) and amniotic fluid stem cells.
- MAPs multipotent adult progenitor cells
- iPS cells induced pluripotent stem cells
- amniotic fluid stem cells amniotic fluid stem cells.
- Undifferentiated refers to cultured cells when a substantial proportion (at least 20%, and possibly over 50% or 80%) of the cells and their derivatives in the population display characteristic markers and morphological characteristics of undifferentiated cells, distinguishing them from differentiated cells of embryo or adult origin. Cells are recognized as proliferating in an undifferentiated state when they go through at least 1 population doubling during a cultivation period of at least 3 weeks, while retaining at least about 50%, or the same proportion of cells bearing characteristic markers or morphological characteristics of undifferentiated cells after said cultivation period.
- Cell suspension or “freely floating cells” as used herein, refers to a culture of cells in which the majority of the cells freely float in the medium, typically a culture medium (system), and the cells floating as single cells, as cell clusters and/or as cell aggregates. In other words, the cells survive and propagate in the medium without being attached to a substrate.
- medium typically a culture medium (system)
- system typically a culture medium
- Culture system refers to a culture system suitable for the propagation of SCs.
- the term denotes a combination of elements, at minimum including a basic medium (a cell culture medium usually comprising a defined base solution, which includes salts, sugars and amino acids) and the one or more member of a the transforming growth factor- ⁇ (TGF ⁇ ) superfamily of growth factors.
- the culture system in accordance with the invention may further comprise other elements such as, without being limited thereto, a serum or serum replacement, a culture (nutrient) medium and other exogenously added factors, which together provide suitable conditions that support SC growth as well as other components typically used in cell culture systems.
- the above elements may be collectively classified as soluble elements.
- the elements may also be associated to a carrier, i.e. non-soluble elements.
- the association may be by chemical or physical attachment/binding.
- the element may be immobilized onto a matrix (e.g. extracellular matrix), presented by cells added to the system or bound to biodegradable material.
- the element may be released from a carrier, the carrier may be a cell or a vesicle encapsulating or embedding the element.
- elements supplementing the basic media to form the culture system comprise both soluble and non-soluble elements.
- “Differentiation”, as used herein, refers to the process of switching the state of a cell from one cell type to another, and more specifically in the context of the present disclosure indicates the process of a human stem cell acquiring the cell type of a retinal pigment epithelial (RPE) cell with at least one characteristic feature indicative that said RPE cell is a mature (terminally differentiated) cell.
- RPE retinal pigment epithelial
- the term "cell type” refers to a distinct morphological or functional form of a cell.
- “Differentiating hSCs” as used herein, refer to undifferentiated hSCs which under suitable conditions are capable of differentiating in an augmented, directed fashion into a predetermined fate; the term also referring to a population of hSCs in which at least part thereof has already been induced to undergo at least initial differentiation, namely directed differentiation or combination of same.
- Retinal pigment epithelial cells mean cells of a cell type functionally similar to that of native RPE cells which form the pigmented cell layer of the retina (e.g. upon transplantation within an eye, they exhibit functional activities similar to those of native RPE cells).
- the terms “retinal pigment epithelial cells”, U RPE cells”, or “RPEs” may be used to refer to both native RPE cells of the pigmented layer of the retina and RPE cells directly differentiated from hSCs, in accordance with the present disclosure.
- hSC-derived KPE cells is used herein to denote RPE cells that are obtained by directed differentiation from hSCs.
- the hSC-derived RPE cells are mature (terminally differentiated) and functional RPE cells as exhibited by parameters defined hereinbelow.
- the term "directed differentiation” is used interchangeably with the term “KPE induced differentiation” and is to be understood as meaning the process of manipulating hSCs under culture conditions which induce/promote differentiation into RPE cell type only.
- “Functional RPE cells” is used herein to denote cells obtained by directed differentiation of hSCs in the presence of one or more members of the TGF ⁇ superfamily, the RPE cells exhibiting at least one of the following characteristics: during differentiation, the cultured cells respond to TGF ⁇ signaling; the RPE cells are mature, terminally differentiated cells as exhibited by the expression of markers indicative of terminal differentiation, e.g. bestrophin or RPE65 as well or alternatively, by their lack of potency to proliferate in vivo. - following transplantation (i.e.
- the RPE cells exhibit trophic effect supporting photoreceptors adjacent to RPE cells; further, in situ the RPE cells are capable of functioning with phagocytosis of shed photoreceptor outer segments as part of the normal renewal process of these photoreceptors.
- the RPE cells in accordance with the present invention are especially suitable for regeneration of host RPE thereby providing improved vision following transplantation therewith into a subject's eye.
- Similar when used in the context of differentiated RPE cells, means that the differentiated RPE cells share one or more distinct morphological or functional features with native RPE cells. For example, sufficient similarity might be indicated by, for example, determining that the differentiated cell expresses one or more markers of naturally occurring RPE cells, such as MiTF, ZO-I, Bestrophin, RPE65, Otx2, Mertk, and CRALBP; or that the cell manifests one or more physical morphological features of RPE cells, such as typical F-actin distribution within the cells, pigmentation by pigmented granules, polygonal (e.g., hexagonal) shape, a cobblestone-like appearance and ultrastructural features of RPE as demonstrated by electron microscopy.
- markers of naturally occurring RPE cells such as MiTF, ZO-I, Bestrophin, RPE65, Otx2, Mertk, and CRALBP
- the cell manifests one or more physical morphological features of RPE cells such as typical F-actin distribution within the
- trophic effect supporting photoreceptors adjacent to RPE cells may include any one of the functions listed above, e.g., trophic effect supporting photoreceptors adjacent to RPE cells; functionality with phagocytosis of shed photoreceptor outer segments that harbor rhodopsin or lack of potency to proliferate in vivo.
- “Large scale”, as used herein with regard to cell cultivation and expansion, refers to the production of RPE cells under conditions which permit at least the doubling of cells in the cell culture after 4 weeks, the cell population after the 4 weeks consisting essentially of RPE cells.
- Cell marker refers to any phenotypic feature of a cell that can be used to characterize it or discriminate it from other cell types.
- a marker may be a protein (including secreted, cell surface, or internal proteins; either synthesized or taken up by the cell); a nucleic acid (such as an mRNA, or enzymatically active nucleic acid molecule) or a polysaccharide. Included are determinants of any such cell components that are detectable by antibody, lectin, probe or nucleic acid amplification reaction that are specific for the marker of the cell type of interest.
- the markers can also be identified by a biochemical or enzyme assay or biological response that depends on the function of the gene product.
- each marker is said to be preferentially expressed in an undifferentiated or differentiated cell population, if it is expressed at a level that is at least 50% higher (in terms of total gene product measured in an antibody or PCR assay) or 30% more frequently (in terms of positive cells in the population) than an acceptable control such as actin or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Markers that are expressed 2 5 10, 100, or 10,000 times higher or more frequently are increasingly more preferred.
- the present disclosure makes use of hSCs from which RPE are derived, due to inductive and directed differentiation of the hSCs in the presence of a unique culture system applied to the.hSCs in suspension.
- Non-limiting examples of hSCs are neural stem cells obtained from the fetus, or at any age post birth or from cadaver, hematopoietic stem cells obtained from bone marrow tissue of a human individual at any age or from cord blood of a newborn individual, mesenchymal stem cells, amniotic fluid stem cells, embryonic stem (ES) cells obtained from the embryonic tissue formed after fertilization (e.g., from a single blastomere, or from blastocyst), embryonic germ (EG) cells obtained from the genital tissue of a fetus any time during gestation, preferably before 10 weeks of gestation, induced pluripote ⁇ t stem cells, or stem cells obtained from the gonads of human individual at any age.
- ES embryonic stem
- EG embryonic germ
- hSCs can be obtained using well-known cell-culture methods.
- hESC can be isolated from single blastomeres of the cleavage or morula stage human embryo, from cleavage stage and morula human embryos and human blastocysts.
- Human embryos may be obtained from in vivo preimplantation embryos or more typically from in vitro fertilized (IVF) embryos.
- IVF in vitro fertilized
- non-fertilized human oocyte can be parthenogenetically activated to cleave and develop to the blastocyst stage.
- a single cell human embryo can be expanded to the blastocyst stage.
- the zona pellucida is removed and the inner cell mass (ICM) is isolated by immunosurgery, in which the trophectoderm cells are lysed and removed from the intact ICM by gentle pipetting.
- the ICM is then plated in a tissue culture flask containing the appropriate medium which enables its outgrowth. Following 9 to 15 days, the ICM derived outgrowth is dissociated into clumps either by mechanical dissociation or by enzymatic digestion and the cells are then re-plated on a fresh tissue culture medium. Colonies demonstrating undifferentiated morphology are individually selected by micropipette, mechanically dissociated into clumps, and re- plated.
- HSCs can be also used in accordance with the invention.
- HSCs can be purchased from the NIH human embryonic stem cells registry.
- Non- limiting examples of commercially available embryonic stem cell lines are BGOl, BG02, BG03, BG04, CY12, CY30, CY92, CYlO, TE03 and TE32.
- Potential applications of hESC and cells derived from them are far ranging and include drug discovery and testing, generation of cells, tissues and organs for use in transplantation, production of biomolecules, testing the toxicity and/or teratogenicity of compounds, high through put screening of molecules for their toxic, regenerative, protective or any other effect, and facilitating the study of developmental and other biological processes.
- hESC diseases presently expected to be treatable by therapeutic transplantation of hESC or hESC-derived cells include Parkinson's disease, cardiac infarcts, juvenile-onset diabetes mellitus, and leukemia [Gearhart J. Science 282: 1061-1062, 1998; Rossant andNagy, Nature Biotech. 17: 23-24, 1999].
- Parkinson's disease cardiac infarcts
- juvenile-onset diabetes mellitus juvenile-onset diabetes mellitus
- Two such hurdles include: maintaining hESC in an undifferentiated, pluripotential state without spontaneous differentiation; and directing the differentiation of hESC into specific types of somatic cells.
- Several culture systems have been described for maintaining and propagating stem cells, and particularly hESC, in an undifferentiated state 8 .
- hSCs thus may serve as a potential unlimited donor source for RPE cells, if the means to direct their differentiation into functional RPE cells can be elucidated. It has now been surprisingly found that contacting hSCs with a member of the
- TGF ⁇ superfamily of growth factors strongly promotes differentiation of hSCs towards an RPE fate. In other words, these growth factors have an inducting effect on the hSCs.
- TGFB transforming growth factor- ⁇
- RPE retinal pigment epithelial
- the member of the TGFB superfamily is preferably the TGF ⁇ l, TGF ⁇ 3 growth factors or activin A or a combination of same.
- NA nicotinamide
- niacinamide is the amide derivative form of Vitamin B3 (niacin) which is thought to preserve and improve beta cell function.
- NA has the chemical formula C 6 H 6 N 2 O. NA is essential for growth and the conversion of foods to energy, and it has been used hi arthritis treatment and diabetes treatment and prevention.
- NA also denotes derivatives of
- nicotinamide denotes a compound which is a chemically modified derivative of the natural NA.
- the chemical modification may include, for example, a substitution on the pyridine ring of the basic NA structure (via the carbon or nitrogen member of the ring), via the nitrogen or the oxygen atoms of the amide moiety, as well as deletion or replacement of a group, e.g. to form a thiobenzamide analog of NA 5 all of which being as appreciated by those versed in organic chemistry.
- the derivative in the context of the invention also includes the nucleoside derivative of NA (e.g. nicotinamide adenine).
- a variety of derivatives of NA are described, some also in connection with an inhibitory activity of the PDE4 enzyme (WO03/068233; WO02/060875; GB2327675A), or as VEGF-receptor tyrosine kinase inhibitors (WO01/55114).
- PDE4 enzyme WO03/068233; WO02/060875; GB2327675A
- VEGF-receptor tyrosine kinase inhibitors WO01/55114.
- the process of preparing 4-aryl-nicotinamide derivatives WO05/014549.
- hSCs when hSCs are differentiating in the presence of NA, their properties are altered and accordingly they gain the capability to respond to an inductive effect of one or more members of the TGF ⁇ superfamily which directs their differentiation towards RPE fate, preferably mature and functional RPE cells.
- the RPE differentiation-inductive effect of NA may be significantly enhanced when thereafter exposing the hSCs to the one or more member of the TGFB superfamily of growth factors in combination with the preexposure of the cells in the culture to NA.
- the method comprises treating the cells with the one or more member of the TGFB superfamily of growth factors is used in combination with prior exposure to NA.
- Combination may be for the preparation of a culture system comprising both TGFB and NA; as well as for the preparation of a culture system comprising only the one or more member of the TGFB superfamily, to be used for inducing/promoting differentiation and/or further differentiation of hSCs which have already been exposed to NA.
- NA acts as a differentiation inducer/promoter and that similarly, the one or more members of the TGFB superfamily act as an RPE differentiation promoting factor.
- the prior exposure of the hSCs to NA provides the cells with properties that enable their response to the RPE differentiation promoting effect of the one or more members of the, TGFB superfamily.
- the hSCs are first cultured in a culture system comprising a basic medium supplemented with NA for at least several hours, preferably at least a day and more preferably, at least two days prior to culturing the cells in that cell culture in a basic medium (the same or different) supplemented with the one or more member of TGF ⁇ superfamily.
- the undifferentitated hSCs are cultured in a culture system comprising a basic medium supplemented with NA and the one or more member of TGF ⁇ superfamily. It is noted that various basic mediums are known in the art for use in cell cultures and preferably for use in SC cultures.
- a non-limiting list of basic mediums which can be used in accordance with the present disclosure comprises NeurobasalTM (CAT# 21103-049, Gibco 1998/1999), KO-DMEM (CAT# 10829-018, Gibco 1998/1999), DMEM (CAT# 41965-039, Gibco 2004), DMEM/F12 (CAT# 21331-020, Gibco 2004), CellgroTM Stem Cell Growth Medium (CAT# 2001, CellGenix 2005), or X- VivoTM (CAT# 04-380Q, LONZA 2007).
- the present disclosure also provides a method for inducing directed differentiation of hSCs into RPE fate, the method comprising: (a) providing cell culture comprising hSCs;
- the cells in the cell culture may be a population of undifferentiated hSCs or a population of cells in which at least part of the hSCs have initiated differentiation.
- the initial differentiation is a directed differentiation.
- the cells provided in the method are at times referred to as differentiating cells.
- the basic medium may be supplemented by the introduction thereto of soluble elements as well as by non-souble elements.
- the member With repsect to the supplementation with one or more members of the TGFB superfamily of growth factors, the member may be presented in soluble form or affixed or associated to a matrix or cell added to the culture system or the element may be bound or complexed to other substances.
- the member may also be secreted to the culture system from cells present in the latter.
- the hSCs may be provided in undifferentiated state as well as after being exposed to a differentiation promoting factor (differentiation priming agent), such as NA. Undifferentiated hSCs may be obtained from various culture systems in which hSCs may be maintained in an undifferentiated pluripotent state.
- the cells may be cultivated in a feeder-free adherent or suspension system (WO06/070370) or on feeder cells.
- feeder cells include a primary mouse embryonic fibroblast (PMEF), a mouse embryonic fibroblast (MEF), a murine fetal fibroblast (MFF) 5 a human embryonic fibroblast (HEF), a human fibroblast obtained from the differentiation of human embryonic stem cells, a human fetal muscle cell (HFM), a human fetal skin cell (HFS), a human adult skin cell, a human foreskin fibroblast (HFF), a human cell obtained from the umbilical cord or placenta, a human adult fallopian tubal epithelial cell (HAFT) and human marrow stromal cells (hMSCs).
- PMEF primary mouse embryonic fibroblast
- MFF murine fetal fibroblast
- HEF human embryonic fibroblast
- HFF human fibroblast obtained from the differentiation of human embryonic stem cells
- the clusters of hSCs may be obtained from an adherent cell culture by dissociation of the cells from the feeder layer or extracellular matrix to form a suspension of cells.
- the suspension of cells may comprise the free floating clusters or an essentially single cell suspension from which clusters of cells are outgrown to form the cell clusters.
- the cell culture comprises cell suspension, preferably free floating clusters in a suspension culture, i.e. aggregates of cells derived from human embryonic stem cells (hESCs). Sources of free floating stem cells were previously described in WO 06/070370, which is herein incorporated by reference in its entirety.
- the culturing step in accordance with the present disclosure may comprise cultivation of the cells in the cell culture with one or more different culture systems, at least one of the culture systems comprising the one or more member of the TGF ⁇ superfamily.
- the cells in the culture are cultivated in a culture system comprising a basic medium supplemented with NA, in addition to said one or more member of TGF ⁇ superfamily of growth factors.
- the cells are firstly cultured in a culture sytsem comprising a basic medium and NA, the cells being undifferentiated hSCs, and prefearbly after hSCs differentiation is induced (i.e. after a predetermined time period or after confirming cell differentiation by techniques available in the art) the cells in the cell culture are cultured in a cultrue system comprising the one or more member of TGF ⁇ superfamily of growth factors.
- the second cluture system may also comprise NA, i.e. may be the same as the initial culture system, into which the member of the TGF ⁇ superfamily is added. As a result, directed differetation into RPE cells is induced.
- the hSCs in the initial cell culture are cultured in the NA comprising culture system for at least the time period required for hSCs differentiation to initiate.
- the cell culture system is cultivated in the NA comprising culture system for several days, prefearbly at least two days and preferably for at least one week, more preferably, at least two weeks.
- NA induces the directed differentiation process which is also accelerated in its progression as compared to spontaneous differentiation (namely, that occurring in the absence of NA exposure or exposure to NA in combination with TGF ⁇ member). It has been shown herein that in the directed differentiation, undifferentiated stem cells are more rapidly eliminated from the culture system.
- NA is used in a culture system of differentiating hSCs as a mean to promote and accelerate the directed differentiation process, and for the complete elimination of undifferentiated stem cells by thus preventing potential complications such as teratoma tumor formation from the presence of undifferentiated cells after transplantation.
- NA induces differentiation into cells that express receptors to one or more member of the
- TGF ⁇ superfamily (which are not expressed by spontaneously differentiating stem cells), thereby allowing directed differentiation into mature and functional RPE cells.
- Such receptor expression allows the inductive effect of the TGF ⁇ superfamily member on directed differentiation of the differentiating cells in the culture towards RPE fate, namely, towards mature and functional RPE cells.
- the growth factor in accordance with the invention may be one or more of the following TGF ⁇ l, TGF ⁇ 2, TGF ⁇ 3, activin A, activin B, activin AB, nodal, anti-mullerian hormone (AMH) 5 BMP3, BMP4, BMP5, BMP6, BMP7 or growth and differentiation factor (GDF).
- the growth factor of the TGF ⁇ superfamily is TGF ⁇ 3 or TGF ⁇ l or activin A or the combination of same.
- the basic medium in accordance with the invention is any known cell culture medium known in the art for supporting cells growth in vitro, typically, a medium comprising a defined base solution, which includes salts, sugars, amino acids and any other nutrients required for the maintenance of the cells in the culture in a viable state.
- Non-limiting examples of commercially available basic media that may be utilized in accordance with the invention comprise NeurobasalTM, KO-DMEM, DMEM, DMEM/F12, CellgroTM Stem Cell Growth Medium, or X-VivoTM.
- the basic medium may be supplemented with a variety of agents as known in the art dealing with cell cultures.
- the following is a non-limiting reference to various supplements that may be included in the culture system to be used in accordance with the present disclosure: serum or with a serum replacement containing medium, such as, without being limited thereto, knock out serum replacement (KOSR), Nutridoma-CS,
- TCHTM, N2, N2 derivative, or B27 or a combination an extracellular matrix (ECM) component, such as, without being limited thereto, fibronectin, laminin and gelatin.
- ECM extracellular matrix
- the ECM may them be used to carry the one or more members of the TGF ⁇ superfamily of growth factors; - an antibacterial agent, such as, without being limited thereto, penicillin and streptomycin; non-essential amino acids (NEAA), neuortrophins which are known to play a role in promoting the survival of SCs in culture, such as, without being limited thereto, BDNF, NT3, NT4.
- NEAA non-essential amino acids
- neuortrophins which are known to play a role in promoting the survival of SCs in culture, such as, without being limited thereto, BDNF, NT3, NT4.
- the present disclosure also provides RPE cells obtained by directed differentiation of hSC in the presence of one or more members of the TGF ⁇ superfamily.
- the RPE cells are obtained by the method of the invention.
- the RPE cells produced by the directed differentiation according to the present disclosure have specific properties in comparison to RPE cells that develop during spontaneous differentiation.
- the differentiating cells have the potential to respond to TGF ⁇ signaling in their development and differentiation.
- the resulting RPE cells are mature cells (terminally differentiated).
- the mature RPE cells display darker pigmentation in comparison to RPE cells formed during spontaneous differentiation.
- the mature RPE cells express significantly higher levels of transcripts of markers of mature RPE cells such as bestrophin, and RPE65 as compared to their expression in RPE cells produced by spontaneous differentiation.
- markers of mature RPE cells such as bestrophin, and RPE65
- Figs. 93, HM and HK showing the expression of bestrophin in spontaneous differentiation (no NA) as compared to differentiation in the presence of NA (Fig. 9J) and the augmenting effect of activin A on directed differentiation (Fig. HK, HM and 4E).
- Figs. IB and 91 showing the expression of RPE65 in spontaneous differentiation (no NA) as compared to differentiation in the presence of NA and further as compared to the augmenting effect of activin A in Fig. 4D.
- the RPE cells display morphological characteristics of mature authentic RPE cells that are not demonstrated within RPE-like cells that were derived from spontaneously differentiating hSC such as apical villi, tight junctions, and basal membrane.
- the RPE cells produced by the method of the present disclosure may be used for large scale and/or long term cultivation of such cells.
- the method of the invention is to be performed in bioreactors suitable for large scale production of cells, and in which undifferentiated hSCs are to be cultivated in accordance with the invention. General requirements for cultivation of cells in bioreactors are well known to those versed in the art.
- the RPE cells produced by the method of the present disclosure may be expanded after their derivation.
- they are dissociated, plated at low density on an extra cellular matrix, preferably poly-D-lysine and laniinin, and cultured in serum-free KOM with NA.
- the pigmented cells loose pigmentation and acquired a fibroid-like morphology.
- the cells re-acquired the characteristic polygonal shape morphology and pigmentation of RPE cells.
- the RPE cells may be expanded in suspension or in a monolayer.
- the expansion of the RPE cells in monolayer cultures may be modified to large scale expansion in bioreactors by methods well known to those versed in the art.
- hSC-derived RPE cells may serve for high throughput screening for compounds that have a toxic or regenerative effect on RPE cells. They may be used to uncover mechanisms, new genes, soluble or membrane-bound factors that are important for the development, differentiation, maintenance, survival and function of photoreceptor cells.
- the RPE cells may also serve as an unlimited source of RPE cells for transplantation, replenishment and support of malfunctioning or degenerated RPE cells in retinal degenerations. Furthermore, genetically modified RPE cells may serve as a vector to carry and express genes in the eye and retina after transplantation.
- a method of transplanting RPE cells into a subject's eye comprises: (a) providing a cell culture comprising hSCs;
- the hSCs-derived RPE cells may be transplanted to various target sites within a subject's eye.
- the transplantation of the RPE cells is to the subretinal space of the eye, which is the normal anatomical location of the RPE (between the photoreceptor outer segments and the choroids).
- transplantation into additional ocular compartments can be considered including the vitreal space, the inner or outer retina, the retinal periphery and within the choroids.
- transplantation may be performed by various techniques known in the art.
- Methods for performing RPE transplants are described in, for example, U.S. Pat. Nos. 5,962,027, 6,045,791, and 5,941,250 and in Eye Graefes Arch Clin Exp Opthalmol March 1997; 235(3): 149-58; Biochem Biophys Res Commun Feb. 24, 2000; 268(3): 842-6; Opthalrnic Surg February 1991; 22(2): 102-8.
- Methods for performing corneal transplants are described in, for example, U.S. Pat. No.
- cells may also be delivered and maintained in the eye encapsulated within a semi-permeable container, which will also decrease exposure of the cells to the host immune system (Neurotech USA CNTF delivery system; PNAS March 7, 2006 vol. 103(10) 3896-3901).
- transplantation is performed via pars pana vitrectomy surgery followed by delivery of the cells through a small retinal opening into the sub-retinal space or by direct injection.
- cells may be delivered into the subretinal space via a trans-scleral, trans-choroidal approach.
- direct trans- scleral injection into the vitreal space or delivery to the anterior retinal periphery in proximity to the ciliary body can be performed.
- the RPE cells may be transplanted in various forms.
- the RPE cells may be introduced into the target site in the form of cell suspension, or adhered onto a matrix, extracellular matrix or substrate such as a biodegradable polymer or a combination.
- the RPE cells may also be transplanted together (co-transplantation) with other retinal cells, such as with photoreceptors.
- the invention also pertains to a composition comprising hSCs-derived RPE cells obtained by the method of the invention.
- the composition is preferably such suitable for transplantation into the eye.
- Various eye conditions may be treated or prevented by the introduction of the
- RPE cells obtained by the method of the invention to a subject's eye may include retinal diseases or disorders generally associated with retinal dysfunction, retinal injury, and/or loss of retinal pigment epithelium.
- a non-limiting list of conditions which may be treated in accordance with the invention comprises retinitis pigmentosa, lebers congenital amaurosis, hereditary or acquired macular degeneration, age related macular degeneration (AMD), Best disease, retinal detachment, gyrate atrophy, choroideremia, pattern dystrophy as well as other dystrophies of the RPE, Stargardt disease, RPE and retinal damage due to damage caused by any one of photic, laser, inflammatory, infectious, radiation, neo vascular or traumatic injury.
- the transplanted RPE cells may exert their therapeutic effect through multiple mechanisms.
- One mechanism is trophic supportive effect promoting the survival of degenerating photoreceptors or other cells within the retina.
- RPE cells derived from hSCs by the methods of this disclosure and in the presence of a member of the TGF ⁇ super family are capable of preserving the photoreceptors adjacent to them potentially by a trophic effect.
- the transplanted RPE cells may also exert their effect through a regeneration mechanism replenishing mal functioning and/or degenerating host RPE cells.
- RPE cells derived from hSCs by the methods of this disclosure and in the presence of a member of the TGF ⁇ super family can replenish mal functioning host RPE.
- the transplanted cells are mature and have the functional capability of phagocytosis of shed outer segments of photoreceptors which include rhodopsin.
- RPE cells derived from hSCs by the methods of this disclosure and in the presence of a member of the TGF ⁇ super family are mature and as such they do not proliferate in vivo after transplantation. Therefore, RPE cells derived from hSCs by the methods of this disclosure are safer for transplantation therapy and carry a reduced risk for development into teratoma tumors or tumors of proliferating precursor cells.
- the term "treating" or “treatment” refers to the therapeutic as well as the prophylactic effect of the hSC-derived RPE cells of the invention on a subject's eye condition
- the effect may generally include, amelioration of symptoms associated with the conditions, lessening of the severity or curing the condition, more specifically, the effect may include reversal of damage caused to the treated subject's retina and RPE, improved function of the subject's retina, rebuilding of the subject's retina and RPE by replacement and/or support of failing host retinal and RPE cells, directly or by paracrine effect as well as to the prophylactic effect which may be exhibited by the attenuation, inhibition or cessation in damage caused to the subject's retina as a result of the condition.
- a growth factor includes one or more growth factors
- growth factors includes one growth factor as well as more than one growth factor
- the term “or” means one or a combination of two or more of the listed choices. Furthermore, the use of the phrase “selected from" followed by a list of choices separated by the term “and” includes one or a combination of two or more of the listed choices. Further, as used herein, the term “comprising” is intended to mean that the methods or composition includes the recited elements, but does not exclude others. Similarly, “consisting essentially of x is used to define methods and systems that include the recited elements but exclude other elements that may have an essential significance on the functionality of the culture systems of the inventions.
- a culture system consisting essentially of a basic medium, medium supplements and feeder cells will not include or will include only insignificant amounts (amounts that will have an insignificant effect on the propagation and differentiation of cells in the culture system) of other substances that have an effect on cells in a culture.
- a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method. "Consisting of shall mean excluding more than trace amounts of other elements. Embodiments defined by each of these transition terms are within the scope of this invention.
- Human ESC HESl cell line
- hESCs engineered by lentiviral vector to constitutively express eGFP [Gropp M, Itsykson P, Singer O, Ben-Hur T, Reinhartz E, Galun E, and Reubinoff BE. Stable genetic modification of human embryonic stem cells by lentiviral vectors.
- KO medium consisting of 86% KO-DMEM (Gibco, Invitrogen, Gaithersburg, MD), 14% KOSR (Gibco), 1 mM glutamine, 1% nonessential amino acids, 50 units/ml penicillin (Gibco), 50 ⁇ g/ml streptomycin, (Gibco) and 4 ng/ml bFGF (R&D Systems, Inc., Minneapolis, MN).
- hES cells were weekly passaged with type IV collagenase (1 mg/ml; Gibco) and plated onto a fresh feeder layer.
- the cells were passaged by dissociation into nearly a single-cell suspension with Ca/Mg ⁇ -free PBS supplemented with 0.05% EDTA (Biological Industries, Beit Haemek, Israel) and were re-plated on the feeders.
- Ca/Mg ⁇ -free PBS supplemented with 0.05% EDTA (Biological Industries, Beit Haemek, Israel)
- hES cells Six-eight days after plating the hES cells that were dissociated into single cells as above; they were removed from the feeders by treatment with type IV collagenase.
- the clumps were cultured for various periods up to 12 weeks in suspension within bacteriological dishes precoated with 0.1% low melting temperature agarose in KO medium (KOM) consisting of 86% KO-DMEM, 14% KOSR, 1 mM glutamine, 1% nonessential amino acids, 50 units/ml penicillin, and 50 ⁇ g/ml streptomycin, in the presence or absence of 10 mM nicotinamide (NA) (Sigma, St. Louis, MO, USA).
- KOM KO medium
- NA nicotinamide
- the medium used was NeurobasalTM medium (Gibco) supplemented with N2 supplement (1:100) (Gibco) (NN medium), which was substituted after 1 week with DMEM/F12 (Gibco) supplemented with B27 (1 :50) (Gibco).
- ESCs Human ESCs were allowed to differentiate as free-floating clusters in KOM as above for up to six weeks in the presence of nicotinamide (NA) 1OmM. After the first week or 2 weeks of differentiation, cultures were supplemented with activin A 20- 180ng/ml (PeproTech Inc, Rocky Hill, NJ) 5 with TGF ⁇ 3 (lng/ml; R&D Systems Inc, Minneapolis, MN) with TGF ⁇ l (lng/ml-20ng/ml; R&D Systems Inc) or with SB431542 (5 ⁇ M-50 ⁇ M, Sigma). Control cultures were supplemented with NA alone.
- activin A 20- 180ng/ml PeproTech Inc, Rocky Hill, NJ
- TGF ⁇ 3 lng/ml
- R&D Systems Inc Minneapolis, MN
- SB431542 5 ⁇ M-50 ⁇ M, Sigma
- the pigmented clusters were gently mechanically dissociated into small clamps and plated at low density on poly-D-lysine ((30-70 kDa, 10 ⁇ g/ml) and laminin (4 u_g/ml), and cultured in KOM with NA. Under these culture conditions, the pigmented cells lost pigmentation and acquired a fibroid-like morphology. Following further culture for 1.5 month and proliferation into high-density cultures, the cells re-acquired the characteristic polygonal shape morphology and pigmentation of RPE cells.
- the clusters cultivated for 2, 4, 6 or 8 weeks were gently dissociated either with 0.04% trypsin/ 0.04% EDTA or with Papain Dissociation System (Worthington Biochemical, Lakewood, NJ), and the resulting small clumps and single cells were plated in KO medium supplemented with NA on poly-D-lysine (30-70 kDa, 10-20 ⁇ g/ml) alone or supplemented with either laminin (4 ⁇ g/ml) or fibronectin (10-20 ⁇ g/ml; all from Sigma, St. Louis, http ://www. sigmaaldrich. com) .
- the cells were fixed with 4% paraformaldehyde after 2 hours and examined for the expression of nestin (1:200), polysialic acid NCAM (PSA-NCAM) (1:100), Musashi (1:200; all from Chemicon, Temecula, from CA), Pax6 (DSHB, 1:100 or Chemicon, 1:250), Otx2 (Chemicon, 1:200), MiTF (Lab Vision Corporation, Fremont, CA; mouse IgG 1 , 1:50).
- PSA-NCAM polysialic acid NCAM
- the isolated clusters that were enriched for pigmented cells were further dissociated into smaller clumps mechanically by trituration with/without the aid of trypsin (0.025%, 3 mM EDTA in PBS) digestion or papain dissociation (Papain Dissociation System; Worthington Biochemical Corporation, Lakewood, New Jersey).
- the small clusters of cells were plated on poly-D-lysine-coated (30-70 kDa, 10 ⁇ g/ml; Sigma) and laminin-coated (4 ⁇ g/ml; Sigma) glass coverslips and cultured for an additional 3-5 weeks in the culture medium used for suspension culture of the hESC clusters.
- Differentiated cells within the outgrowth were fixed with 4% paraformaldehyde for 30 minutes at room temperature.
- cell membranes were permeabilized with 0.2% Triton XlOO (Sigma) in PBS for 30 minutes, supplemented with normal goat serum (5%, Biological Industries) for blocking.
- the cells were incubated with the following primary antibodies: anti-MiTF (Lab Vision Corporation, Fremont, CA; mouse IgG 1 , 1:50); anti- RPE65 (Novus Biologicals, Littleton, CO; mouse IgG 1 , 1:300); anti-Bestrophin (Novus Biologicals; mouse IgG 1 , 1:150); anti-ZO-1 (Zymed Laboratories Inc., San Francisco, CA; rabbit polyclonal, 1:10); anti-Ki67 (Dako Denemark A/S;,l:50) and anti-CRALBP (kindly provided by John C. Saari, University of Washington, Seattle; rabbit polyclonal, 1:100).
- the cells were also incubated with Phalloidine (1:200 Sigma) Primary antibody localization was performed by using fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse immunoglobulins (Dako Denmark A/S; 1:20-1:50), goat anti-mouse IgG conjugated to Cy TH 3 (1:500) (Jackson ImmunoResearch Laboratories Inc, West Grove, PA), rabbit anti-goat igG conjugated to Cy2 (1:200; Jackson ImmunoResearch Laboratories Inc) and swine anti-rabbit Ig conjugated to fluorescein isothiocyanate (FITC) (Dako; 1 :50).
- FITC fluorescein isothiocyanate
- the RNA was isolated using TRIzol reagent (Invitrogen,http://www.invitrogen.com) or TRI-Reagent (Sigma).
- cDNA synthesis was carried out using Moloney murine leukemia virus reverse transcriptase (M-MLV RT) and random primers, according to the manufacturer's instructions (Promega Corporation, Madison, WI, http://www. promega.com).
- PCR Polymerase chain reaction
- Gabco-BRL Taq DNA Polymerase
- Amplification conditions were as follows: denaturation at 94°C for 15 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 45 seconds. The number of cycles varied between 18 and 40, depending on particular mRNA abundance.
- Primer human sequences for identifying human gene transcripts forward and reverse 5'— 3'
- the length of the amplified products were as follows (SEQ ID NOs. 1-12):
- MiTF-A (GAGCCATGCAGTCCGAAT, GACATGGCAAGCTCAGGACT; 486 bp);
- RPE65 GCTGCTGGAAAGGATTTGAG, CAGGCTCCAGCCAGATAGTC; 231 bp;
- Bestrophin GAATTTGCAGGTGTCCCTGT, ATCCTCCTCGTCCTCCTGAT; 214 bp
- CRALBP AGCTGCTGGAGAATGAGGAA, CAAGAAGGGCTTGACCACAT; 218 bp
- MERTK (AAGTGATGTGTGGGCATTTG, TCTAAGGGATCGGTTCTCCA, 189bp);
- ACTRIB CACGTGTGAGACAGATGGG, GGCGGTTGTGATAGACACG; 346 bp;
- ACTRIIA AACCATGGCTAGAGGATTGGC, CTTTCACCTACACATCCAGCTG; 551 bp);
- ACTRBB CACCATCGAGCTCGTGAAG, GAGCCCTTGTCATGGAAGG; 611 bp;
- GAPDH AGCCACATCGCTCAGACACC; GTACTCAGCGCCAGCATCG; 301 bp.
- transcripts were monitored using TaqMan primers and probes that were derived from the commercially available TaqMan R
- Human ESC-derived clusters were cultured in suspension in KOM. The pigmented areas were then separated mechanically and were processed for transmission electron microscopy. The cells were fixed with 2% glutaraldehyde and 4% formaldehyde in 0.1M cacodylate buffer, pH 7.4. After three washes in 0.1M cacodylate buffer the tissue was post-fixed with 1% osmium tetroxide and 1.5% potassium fericyanide, dehydrated with increasing concentrations of ethanol and embedded in Agar 100 resin. Ultra-thin sections cut by an LKB ultrotome 3 were stained with uranyl acetate and lead citrate.
- Micrographs were taken with Tecnai 12 electron microscope (Phillips, Eindhoven the Netherlands http://www.philips.com) equipped with a Megaview II CCD camera and an Analysis version 3.0 software (Soft Imaging System, http://www.soft-imaging.net).
- the pigmented clusters were incubated with 1- ⁇ m latex beads (Polysciences Inc., Warrington, PA) at a concentration of 1.0 x 10 9 beads/mL for 18 hours at 37°C.
- the pigmented clusters were then washed with PBS+, dissociated into single cells or small clumps using Papain Dissotiation System and plated on poly-D-lysine.
- the membranes of the cells were stained with red fluorescent die, PKH (Sigma).
- the phagocytosis was analyzed using confocal microscope (Olympus Fluoview FVlOOO)
- Flow cytometric analysis was performed to determine the number of PSA- NCAM and TRA-I -60 positive cells at different time points within the hESC-derived clusters differentiating with or without nicotinamide supplementation.
- the clusters were dissociated with 0.04% Trypsin/ 0.04%EDTA.
- the single cells were then stained with anti-PS A-NC AM or anti-Tra-1-60 antibodies (both from Chemicon; 1:100), detected with goat anti-mouse immunoglobulins conjugated to FITC (Dako; 1:100), and counterstained with the cell viability dye Propidium iodide (0.005mg/ml; Sigma) Control cells were incubated only with a secondary antibody.
- the cell-associated immunoreactivity was analyzed with FACScalibur (Becton Dickinson Immunocytometry Systems), using CellQuest software. Intravitreal and subretinal transplantation ofhESC-derived differentiated RPE cells
- hESCs engineered to express eGFP [as previously described in Gropp et al., Stable genetic modification of human embryonic stem cells by lentiviral vectors. Molecular Therapy 2003; 7: 281-7.) were used to generate RPE cells in culture as described above. Briefly, clusters enriched with pigmented cells were mechanically isolated by dissection following differentiation for 6-8 weeks in the presence of NA alone or in the presence of NA supplemented with activin A. To allow injection through a small bore glass capillary, the clumps were further dissociated into smaller clusters of cells by digestion with Papain (Papain Dissociation System; Worthington Biochemical Corporation, Lakewood,
- RCS rats Fifteen adult albino rats (body weight 230-250 g) and over 100 l-3weeks outbred dystrophic RCS rats were used for intraocular transplantation. In RCS rats, a mutation in the Mertk gene causes RPE dysfunction which leads to retinal degeneration over the first few months of life. All animal experiments were conducted according to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, and approved by the Institutional Committee for Animal Research of the Hebrew University-Hadassah Medical School.
- Ketamine HCl Ketalar, Parke Davis, UK; 100 mg/kg
- Xylazine the relaxing agent Xylazine
- Local anaesthetic drops Benoxinate HCl 0.4%; Fischer Pharmaceuticals, Israel
- the pupils were dilated with Tropicamide 0.5% (Mydramide, Fisher
- anesthetized animals were imaged using a color fundus camera (Zeiss, Germany) and fluorescence of the GFP-expressing cells was detected using fluorescein filters on a scanning laser ophthalmoscope (Heidelberg HRA, Germany).
- fluorescein filters on a scanning laser ophthalmoscope (Heidelberg HRA, Germany).
- location of the GFP- positive grafts was also determined ex-vivo in eye-cup preparations using a fluorescent microscope (Canon, Japan).
- a commercial computerized ERG system (LKC technologies, UTAS 3000) was used to record retinal responses to full field stimuli generated using a Xenon photostrobe flash (Grass, PS-22) mounted on a Ganzfeld bowl. Dim blue flashes under scotopic conditions were used to elicit a largely rod-driven response. At stronger stimulus intensities of blue, and with white flashes in the dark-adapted state, mixed cone-rod responses were recorded. Under light-adapted (photopic) conditions, with white flashes on a rod-suppressing 34 cd/m 2 white background, IHz and 16Hz cone responses were generated. Signals were filtered between 0.3-500Hz 5 and signal averaging was used. Histological and immunohistochemical evaluation of transplanted eyes
- Nuclei were counterstained with 4, 6-diamidino-2-phenylindole (DAPI)-containing mounting medium (Vector Laboratories, Burlingame, CA) or with propidium iodide l ⁇ g/ml (BioLegend, San Diego, CA). To determine the specificity of the antigen-antibody reaction, corresponding negative controls with an irrelevant isotype-matched antibody were performed.
- An Olympus BX41 microscope equipped with a DP70 digital camera (Olympus, Japan) was used for fluorescent and light microscopy imaging. Confocal images were collected on an Olympus Fluoview 300 (FV300) confocal microscope (Olympus, Japan) built around an 1X70 inverted microscope. 488-nm Ar, 543 HeNe- Green, and 633 HeNe Red lasers were used in combination with Nomarski optics.
- hESCs Differentiation of hESCs was induced by culruring them as free-floating clusters in KO medium supplemented with NA. Under these culture conditions defined areas highly enriched for pigmented cells developed within the differentiating clusters, as shown in Fig. 3A. These pigmented areas appeared after 4 weeks of differentiation and after 8 weeks 72.9+2.5% of the clusters had pigmented areas. Pigmented areas were not observed after 4 weeks of differentiation in the absence of NA supplementation, and in these conditions only 13.1+4.8% developed pigmented areas after 8 weeks (Figs. 8 A, and 8B). Thus, NA treatment augmented/promoted differentiation within hESC clusters into pigmented cells as compared to spontaneously differentiating hESC clusters.
- Fig. 8C Partially dissociated and plated clusters of differentiated hESCs developed, among other types of differentiated cells, into colonies composed of monolayers of pigmented cells , as shown by a dark field micrograph (Fig. 3D) and a phase contrast image (Fig. 3E). The cells within these colonies assumed a polygonal shape and formed "cobble stone" -like sheets of cells with tight junctions between them (Fig. 3E), features that are highly characteristic of native RPE cells.
- the F-actin distribution within the cells was adjacent to their membranes, like authentic RPE cells as demonstrated by staining with Phalloidin ( Figure 10A).
- the pigmented, RPE cells co-expressed the RPE markers Otx2 (Fig. 3B) and MiTF-A (Fig. 3B and Fig. 3F), as well as ZO-l(Fig. 3G), Bestrophin (Fig. 3H), RPE65 (Fig.31), and CRALBP (Fig. 3J).
- the pigmented cells After dissociation, plating at low density and cultivation, the pigmented cells lost pigmentation and acquired a fibroid-like morphology, as shown by phase contrast imaging (Figs. 3K, and 10B). Following further prolonged cultivation and proliferation into high-density cultures, the cells re-acquired the polygonal shape morphology and pigmentation of RPE cells (Figs. 3L, and 10C).
- Electron microscopy (EM) analysis demonstrated that the hESC-derived pigmented cells had morphologic characteristics of native RPE cells including microvilli on their apical side (Fig. 10D), and basal membrane on their basal side
- FIG. 10E The cells contained melanin granules (Fig. 10D) and were attached by tight junctions (Fig. 10F).
- RPE cells One of the most important functions of RPE cells is phagocytosis of photoreceptors shed outer segments. To examine whether the hESC-derived pigmented cells had phagocytic capability, they were incubated with 1- ⁇ m fluorescent latex beads. The three confocal fluorescent images demonstrate serial z axis slices (Figs. 1 OH-I OJ). Confocal microscope analysis showed that the putative RPE cells were capable of phagocytosis of the fluorescent beads (Figs. lOG-lOJ).
- hESCs toward an RPE fate was examined by culturuig them as free-floating clusters in KOM with or without NA (without providing spontaneously differentiating clusters as controls).
- the level of expression of markers of RPE cells, MiTF-A and RPE65 was significantly enhanced in the presence of NA 5 as determined by Real-time RT-PCR (Figs. IA, and IB; respectively).
- the expression of MiTF-A increased nearly two-fold in the presence of NA, while the expression of RPE65 increased nearly 30-fold. Since most pigmented cells co-expressed MITF-A (Fig. 8C), it appeared that in the presence of NA there was a significant and prominent increase in the level of expression of RPE65 per pigmented cell.
- differentiation in the presence of NA may be used to eliminate undifferentiated cells from the culture and may aid in avoiding teratoma tumor formation after transplantation.
- NA treatment enhanced the process of early neural differentiation.
- the expression of transcripts of the early neural markers Otx2 (Fig. 9B), Pax6 (Fig. 9D) and Musashi (Fig. 9C) was significantly increased after 2, 2-6 and 4-6 weeks of differentiation, respectively.
- Similar results were demonstrated at the protein level by FACS analysis of the expression of PSA-NCAM 5 a marker of neural precursors (Fig. 9O). After 4 weeks of differentiation with NA, 81.4+6.3% of the cells expressed PSA-NCAM as compared to 14.4+5.9 in control clusters.
- NA treatment also increased the expression of ChxlO which regulates the proliferation of neural retina retinal progenitors and of Crx, the marker of photoreceptor progenitors (Fig. 9K).
- the RPE differentiation process within the hESC clusters went through steps similar to authentic RPE development in vivo and was augmented by NA.
- NA had an effect on the phenotype of the RPE cells that were obtained. These cells were different from RPE cells that are obtained after spontaneous differentiation and expressed markers of mature RPE cells at significant higher levels. NA shows an inductive effect regardless of culture medium
- NA supplementation increased pigmentation in differentiated cells cultured in both KO medium and NN/DMEM medium for 12 weeks, as shown in dark field micrographs of clusters of differentiating hESCs (Figs 2A-2D).
- NN medium that was further replaced after a week by DMEM/F12-B27 (NN/DMEM), as compared to KO medium, in the presence of NA, the percentage of pigmented hESC clusters from the total number of clusters was higher, although their size and total population numbers relative to clusters cultured in KO medium were smaller.
- RT-PCR analysis showed that NA supplementation enhanced the expression of MiTF-A approximately 3 -fold in KOM and approximately 2.5-fold in NN/DMEM medium (Fig. 2E).
- Activin A was found to augment differentiation towards RPE fate. Dark field micrographs of hESC-derived clusters differentiating for 4 weeks showed the appearance of pigmented cells at this early stage in the presence of activin (Fig. HA) It was further shown that in the presence of NA, activin A significantly augmented the differentiation of hESCs towards RPE cells (Figs. 4A-4B, and 11B-11C). The percentage of clusters that included pigmented cells (50.7+6.5_vs 17.7+3.2), as well as the percentage of pigmented cells from the total number of cells (9.9+1.4 vs 2.4+1.2), was significantly higher when differentiation was induced in the presence of activin A as compared to the control cultures supplemented with NA without activin A ( Figures HH and 111).
- activin A was supplemented for two weeks (weeks 3-4) after the clusters have already differentiated for 2 weeks, since we found that application at this time period was optimal for enhancing RPE differentiation.
- BMPs bone morphogenetic proteins
- Fig. 5D differentiation of hESC clusters into pigmented RPE cells was blocked.
- Fig. 5C Differentiation into pigmented cells was blocked with supplementation of noggin even when the medium was also supplemented with NA.
- Fig. 5E Real-T ⁇ me RT-PCR demonstrated that noggin significantly reduced the expression of MiTF-A in both the presence and absence of NA in the culture medium (Fig. 5E).
- BMPs play a role in inducing differentiation of hESCs to RPE cells.
- Differentiated RPE cells derived from hESCs may be used for intraocular transplantation
- Enriched populations of hESC-derived RPE cells engineered to express eGFP were initially transplanted into the vitreous and subretinal spaces of albino rats, to facilitate localization of the pigmented cells. Following intraocular transplantation, the transplanted pigmented cells could be readily identified in vivo (Figs. 6 A and 6B).
- Fig. 6C Following enucleation of the eye shown in Fig. 6B, removal of the cornea and lens and isolation of the retina, the retina showed the main graft as well as additional dispersed pigmented cells (Fig. 6C).
- Fig. 6C grafts that included viable pigmented transplanted cells which also expressed GFP were present (Figs. 6D - 6G).
- Transplanted cells could be found in the vitreal space, in the retina, along the tract of injection, and also in the subretinal space (Figs. 6H, 61, 6O, 6P).
- Transplanted RPE cells also migrated from subretinal grafts and integrated within the RPE layer of host rats (Fig. 6J).
- the main body of transplantation experiments were performed in RCS rats which manifest an RPE and retinal degeneration caused by a mutation in the mertk gene, in an attempt to examine whether delivery of hESC-derived RPE cells can modulate the course of disease.
- the transplanted pigmented cells could be readily identified in- vivo in the eyes of RCS rats using standard fundus imaging systems (Figs. 12A-12C).
- the hESC- derived, GFP -expressing cells can be seen to emit fluorescence when fluorescein excitation and emission filters are used (Fig. 12C).
- Figs. 12D-12E In eye cup preparations imaged ex- vivo in a fluorescence microscope (Figs. 12D-12E), large clusters of subretinal GFP- positive cells can be seen (Fig. 12D) as well as multiple, dispersed smaller clusters (Fig. 12E).
- Fig. 14 Immunostaining revealed that large numbers of transplanted cells within grafts express proteins which characterize mature, differentiated RPE cells (Fig. 14). This included expression of the RPE-specific markers RPE65 (Figs. 14A-14E) and Bestrophin (Figs. 14F-14J). The cells were also capable of forming tight junctions (Figs. 14K-14O), which is an important function of RPE cells and essential for maintaining the blood-retinal barrier. Left-most panel in each row shows low- magnification fluorescent image of grafts co-expressing GFP and the relevant marker. High magnification confocal images in each row show pigment (by Nomarski optics) as well as co-expression of GFP and the different markers at the single-cell level.
- hESC-derived RPE cells provide functional and structural retinal rescue in dystrophic RCS rats
- Fig. 16 Qualitative as well as quantitative assessment of retinal structure corroborated the functional findings (Fig. 16).
- Relative preservation of the photoreceptor (ONL) layer and of the inner and outer photoreceptor segments (IS+OS) was observed in proximity to sub- retinal RPE grafts as compared with areas distant from the grafts (two examples shown in Fig. 16A, 16B).
- Transplanted hESC-derived, Activin-A treated RPE cells uptake rhodopsin in-vivo
- hSCs derived RPE cells obtained by culturing in a culture system comprising a member of the TGF ⁇ superfamily and preferably in the presence of NA can be utilized in vivo for transplantation to provide essentially fully functional RPE cells in the eye.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Cell Biology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Developmental Biology & Embryology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Epidemiology (AREA)
- Genetics & Genomics (AREA)
- Ophthalmology & Optometry (AREA)
- Wood Science & Technology (AREA)
- Virology (AREA)
- Immunology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Vascular Medicine (AREA)
- Reproductive Health (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Urology & Nephrology (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Transplantation (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Materials For Medical Uses (AREA)
Abstract
Description
Claims
Priority Applications (15)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008800207480A CN101688178B (en) | 2007-04-18 | 2008-04-27 | Stem cell-derived retinal pigment epithelial cells |
| EP19191405.0A EP3640326A1 (en) | 2007-04-18 | 2008-04-27 | Stem cell-derived retinal pigment epithelial cells |
| EP14193621.1A EP2886646B1 (en) | 2007-04-18 | 2008-04-27 | Stem cell-derived retinal pigment epithelial cells |
| EP08738258.6A EP2147094B2 (en) | 2007-04-18 | 2008-04-27 | Stem cell-derived retinal pigment epithelial cells |
| ES08738258.6T ES2527444T5 (en) | 2007-04-18 | 2008-04-27 | Retinal pigment epithelial cells derived from stem cells |
| AU2008242106A AU2008242106B2 (en) | 2007-04-18 | 2008-04-27 | Stem cell-derived retinal pigment epithelial cells |
| JP2010503665A JP5395058B2 (en) | 2007-04-18 | 2008-04-27 | Retinal pigment epithelial cells derived from stem cells |
| US12/450,943 US8956866B2 (en) | 2007-04-18 | 2008-04-27 | Retinal pigment epithelial cells differentiated from embryonic stem cells with nicotinamide and activin A |
| CA2684460A CA2684460C (en) | 2007-04-18 | 2008-04-27 | Stem cell-derived retinal pigment epithelial cells |
| HK10107017.2A HK1140791B (en) | 2007-04-18 | 2008-04-27 | Stem cell-derived retinal pigment epithelial cells |
| IL201600A IL201600A (en) | 2007-04-18 | 2009-10-18 | Method of generating pluripotent stem cell derived retinal pigment epithelial cells |
| IL225163A IL225163B (en) | 2007-04-18 | 2013-03-11 | Methods of generating pluripotent stem cell-derived retinal pigment epithelium cells |
| US14/583,838 US20150125506A1 (en) | 2007-04-18 | 2014-12-29 | Retinal pigment epithelial cells differentiated from embryonic stem cells with nicotinamide and activin a |
| US14/583,848 US20150118749A1 (en) | 2007-04-18 | 2014-12-29 | Retinal pigment epithelial cells differentiated from embryonic stem cells with nicotinamide and activin a |
| IL256587A IL256587B (en) | 2007-04-18 | 2017-12-26 | Methods of generating pluripotent stem cell-derived retinal pigment epithelium cells |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US90781807P | 2007-04-18 | 2007-04-18 | |
| US60/907,818 | 2007-04-18 |
Related Child Applications (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/450,943 A-371-Of-International US8956866B2 (en) | 2007-04-18 | 2008-04-27 | Retinal pigment epithelial cells differentiated from embryonic stem cells with nicotinamide and activin A |
| EP12181140.0A Previously-Filed-Application EP2554661B2 (en) | 2007-04-18 | 2008-04-27 | Stem cell-derived retinal pigment epithelial cells |
| US14/583,838 Division US20150125506A1 (en) | 2007-04-18 | 2014-12-29 | Retinal pigment epithelial cells differentiated from embryonic stem cells with nicotinamide and activin a |
| US14/583,848 Division US20150118749A1 (en) | 2007-04-18 | 2014-12-29 | Retinal pigment epithelial cells differentiated from embryonic stem cells with nicotinamide and activin a |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2008129554A1 true WO2008129554A1 (en) | 2008-10-30 |
Family
ID=39666210
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2008/000556 Ceased WO2008129554A1 (en) | 2007-04-18 | 2008-04-27 | Stem cell-derived retinal pigment epithelial cells |
Country Status (9)
| Country | Link |
|---|---|
| US (3) | US8956866B2 (en) |
| EP (4) | EP2147094B2 (en) |
| JP (1) | JP5395058B2 (en) |
| CN (2) | CN101688178B (en) |
| AU (1) | AU2008242106B2 (en) |
| CA (1) | CA2684460C (en) |
| ES (2) | ES2530370T5 (en) |
| IL (2) | IL225163B (en) |
| WO (1) | WO2008129554A1 (en) |
Cited By (54)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2409663C1 (en) * | 2009-10-14 | 2011-01-20 | Российская Федерация, от имени которой выступает Федеральное Агентство по науке и инновациям | Method for producing dedifferentiated cells of adult retinal pigment eye epithelium |
| WO2011025852A1 (en) | 2009-08-28 | 2011-03-03 | Cellular Dynamics International, Inc. | Identifying genetic variation in affected tissues |
| WO2011055855A1 (en) * | 2009-11-05 | 2011-05-12 | Riken | A method for differentiation induction in cultured stem cells |
| WO2011063005A3 (en) * | 2009-11-17 | 2011-10-06 | Advanced Cell Technology, Inc. | Methods of producing human rpe cells and pharmaceutical preparations of human rpe cells |
| WO2012085348A1 (en) * | 2010-12-20 | 2012-06-28 | Suomen Punainen Risti, Veripalvelu | Method of producing human retinal pigmented epithelial cells |
| US8268303B2 (en) | 2004-01-23 | 2012-09-18 | Advanced Cell Technology, Inc. | Methods for producing enriched populations of human retinal pigment epithelium cells for treatment of retinal degeneration |
| JP2012524525A (en) * | 2009-04-23 | 2012-10-18 | 中国科学院広州生物医藥与健康研究院 | Novel serum-free medium for rapidly and efficiently inducing pluripotent stem cells and method of use thereof |
| US8349005B2 (en) | 2011-01-03 | 2013-01-08 | Masatoshi Murata | Method for burying implant to choroid |
| WO2013077425A1 (en) * | 2011-11-25 | 2013-05-30 | 住友化学株式会社 | Methods for producing retinal tissue and retina-related cell |
| RU2486603C1 (en) * | 2012-04-11 | 2013-06-27 | Федеральное государственное бюджетное учреждение науки Институт биологии развития им. Н.К. Кольцова РАН (ИБР РАН) | Method for simulating tissue structure of human retina |
| JP2013128477A (en) * | 2011-11-25 | 2013-07-04 | Sumitomo Chemical Co Ltd | Method for producing retinal-layer-specific nerve cell |
| JP2013128476A (en) * | 2011-11-25 | 2013-07-04 | Sumitomo Chemical Co Ltd | Method for producing optic-cup-like structure |
| JP2013128475A (en) * | 2011-11-25 | 2013-07-04 | Sumitomo Chemical Co Ltd | Method for producing retinal tissue |
| JP2013128474A (en) * | 2011-11-25 | 2013-07-04 | Sumitomo Chemical Co Ltd | Method for producing retinal pigment epithelial cell |
| WO2014162040A1 (en) * | 2013-04-03 | 2014-10-09 | Tampereen Yliopisto | Methods and media for differentiating eye cells |
| US8877489B2 (en) | 2011-12-05 | 2014-11-04 | California Institute Of Technology | Ultrathin parylene-C semipermeable membranes for biomedical applications |
| US20150010922A1 (en) * | 2012-01-31 | 2015-01-08 | Cell Cure Neurosciences Ltd. | Methods of selecting retinal pigmented epithelial cells |
| US8956866B2 (en) | 2007-04-18 | 2015-02-17 | Hadasit Medical Research Services And Development Ltd. | Retinal pigment epithelial cells differentiated from embryonic stem cells with nicotinamide and activin A |
| WO2015053375A1 (en) * | 2013-10-09 | 2015-04-16 | 株式会社ヘリオス | Method of producing retinal pigment epithelial cell |
| US9040770B2 (en) | 2004-01-23 | 2015-05-26 | Ocata Therapeutics, Inc. | Modalities for the treatment of degenerative diseases of the retina |
| CN104694570A (en) * | 2008-03-17 | 2015-06-10 | 斯克里普斯研究所 | Combined chemical and genetic approaches for generation of induced pluripotent stem cells |
| WO2015087231A1 (en) | 2013-12-11 | 2015-06-18 | Pfizer Limited | Method for producing retinal pigment epithelial cells |
| US9248013B2 (en) | 2011-12-05 | 2016-02-02 | California Institute Of Technology | 3-Dimensional parylene scaffold cage |
| JP2016082983A (en) * | 2009-08-24 | 2016-05-19 | ウイスコンシン アラムナイ リサーチ ファウンデーシヨンWisconsin Alumni Research Foundation | Substantially pure human retinal progenitor cell culture, forebrain progenitor cell culture, retinal pigment epithelial cell culture, and methods for their production |
| WO2016108240A1 (en) | 2014-12-30 | 2016-07-07 | Cell Cure Neurosciences Ltd. | Assessing retinal pigment epithelial cell populations |
| WO2016108239A1 (en) | 2014-12-30 | 2016-07-07 | Cell Cure Neurosciences Ltd. | Rpe cell populations and methods of generating same |
| WO2017017686A1 (en) | 2015-07-29 | 2017-02-02 | Hadasit Medical Research Services And Development Ltd. | Large scale production of retinal pigment epithelial cells |
| WO2017021973A1 (en) | 2015-08-05 | 2017-02-09 | Cell Cure Neurosciences Ltd. | Preparation of retinal pigment epithelium cells |
| WO2017021972A1 (en) | 2015-08-05 | 2017-02-09 | Cell Cure Neurosciences Ltd. | Preparation of photoreceptors for the treatment of retinal diseases |
| US20170080030A1 (en) * | 2014-03-17 | 2017-03-23 | University Of Virginia Patent Foundation | Compositions and methods for treating retinopathy |
| WO2017072763A1 (en) | 2015-10-26 | 2017-05-04 | Cell Cure Neurosciences Ltd. | Preparation of retinal pigment epithelium cells |
| EP3070162A4 (en) * | 2013-11-11 | 2017-05-31 | Sumitomo Chemical Company Limited | Method for producing retinal pigment epithelial cells |
| US10077424B2 (en) | 2007-10-12 | 2018-09-18 | Astellas Institute For Regenerative Medicine | Methods of producing RPE cells and compositions of RPE cells |
| WO2018170494A1 (en) | 2017-03-16 | 2018-09-20 | Bio Time, Inc. | Methods for measuring therapeutic effects of retinal disease therapies |
| US10188769B2 (en) | 2010-07-12 | 2019-01-29 | University Of Southern California | Biocompatible substrate for facilitating interconnections between stem cells and target tissues and methods for implanting same |
| EP3348631A4 (en) * | 2015-09-08 | 2019-03-06 | Sumitomo Dainippon Pharma Co., Ltd. | PROCESS FOR PRODUCING RETINAL TISSUE |
| US10227563B2 (en) | 2008-06-06 | 2019-03-12 | Riken | Method for culture of stem cell |
| US10480031B2 (en) | 2013-02-01 | 2019-11-19 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Method for generating Retinal Pigment Epithelium (RPE) cells from Induced Pluripotent Stem Cells (IPSCs) |
| US10478206B2 (en) | 2011-04-29 | 2019-11-19 | University Of Southern California | Instruments and methods for the implantation of cell-seeded substrates |
| US10501724B2 (en) | 2013-08-23 | 2019-12-10 | Sumitomo Chemical Company, Limited | Method for producing retinal tissue and retina-related cells |
| US10844356B2 (en) | 2010-12-22 | 2020-11-24 | Fate Therapeutics, Inc. | Cell culture platform for single cell sorting and enhanced reprogramming of iPSCs |
| EP3754014A1 (en) | 2019-06-21 | 2020-12-23 | Centre d'Etude des Cellules Souches (CECS) | Automated method for preparing retinal pigment epithelium cells |
| WO2021242788A1 (en) * | 2020-05-25 | 2021-12-02 | Lineage Cell Therapeutics, Inc. | Methods and compositions for treating retinal diseases and conditions |
| US11268069B2 (en) | 2014-03-04 | 2022-03-08 | Fate Therapeutics, Inc. | Reprogramming methods and cell culture platforms |
| US11441126B2 (en) | 2015-10-16 | 2022-09-13 | Fate Therapeutics, Inc. | Platform for the induction and maintenance of ground state pluripotency |
| WO2022261320A1 (en) | 2021-06-09 | 2022-12-15 | Lineage Cell Therapeutics, Inc. | Methods and compositions for treating retinal diseases and conditions |
| WO2023009676A1 (en) | 2021-07-28 | 2023-02-02 | Lineage Cell Therapeutics, Inc. | Expansion of retinal pigment epithelium cells |
| US11739366B2 (en) | 2010-07-23 | 2023-08-29 | Astellas Institute For Regenerative Medicine | Methods for detection of rare subpopulations of cells and highly purified compositions of cells |
| WO2023201361A1 (en) | 2022-04-15 | 2023-10-19 | Aspen Neuroscience, Inc. | Methods of classifying the differentiation state of cells and related compositions of differentiated cells |
| US11814652B2 (en) | 2018-03-22 | 2023-11-14 | Oriental Yeast Co., Ltd. | Pluripotent stem cell differentiation-promoting agent |
| US11865189B2 (en) | 2014-12-18 | 2024-01-09 | Sorbonne Universite | Transgenic RPE cells overexpressing OTX2 for the treatment of retinal degeneration |
| US12110503B2 (en) | 2018-04-20 | 2024-10-08 | FUJIFILM Cellular Dynamics, Inc. | Method for differentiation of ocular cells and use thereof |
| US12593837B2 (en) | 2017-12-29 | 2026-04-07 | Cell Cure Neurosciences Ltd. | Retinal pigment epithelium cell compositions |
| US12618049B2 (en) | 2022-01-19 | 2026-05-05 | Fate Therapeutics, Inc. | Reprogramming methods and cell culture platforms |
Families Citing this family (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1844136B1 (en) * | 2004-12-29 | 2014-08-27 | Hadasit Medical Research Services And Development Ltd. | Stem cells culture systems |
| US8597947B2 (en) * | 2004-12-29 | 2013-12-03 | Hadasit Medical Research Services & Development Limited | Undifferentiated stem cell culture systems |
| WO2012149480A2 (en) * | 2011-04-29 | 2012-11-01 | University Of Southern California | Systems and methods for in vitro and in vivo imaging of cells on a substrate |
| CN103627669A (en) * | 2012-08-22 | 2014-03-12 | 复旦大学 | Method used for inducing differentiation of human multipotential stem cells into retinal progenitor cells |
| US9265458B2 (en) | 2012-12-04 | 2016-02-23 | Sync-Think, Inc. | Application of smooth pursuit cognitive testing paradigms to clinical drug development |
| US9380976B2 (en) | 2013-03-11 | 2016-07-05 | Sync-Think, Inc. | Optical neuroinformatics |
| KR102297580B1 (en) * | 2013-08-06 | 2021-09-03 | 고쿠리쓰 겐큐 가이하쓰 호징 리가가쿠 겐큐소 | Method for producing anterior eye segment tissue |
| US20150148383A1 (en) * | 2013-11-22 | 2015-05-28 | Regenerative Research Foundation | Methods for Inhibiting or Reversing Epiretinal Membrane Formation |
| WO2015175504A1 (en) * | 2014-05-12 | 2015-11-19 | The Johns Hopkins University | Differentiation of human pluripotent stem cells into retinal pigment epithelium using hif1 inhibitors |
| EP3211071B1 (en) | 2014-10-24 | 2021-05-05 | Sumitomo Dainippon Pharma Co., Ltd. | Production method for retinal tissue |
| TWI810142B (en) | 2014-10-24 | 2023-08-01 | 日商住友製藥股份有限公司 | Nervous tissue manufacturing method |
| EP3240612B1 (en) | 2014-12-30 | 2020-12-23 | Cell Cure Neurosciences Ltd. | Methods of treating retinal diseases |
| CN105112368B (en) * | 2015-09-30 | 2018-09-21 | 奥思达干细胞有限公司 | A kind of stem cell medicine and its application method for treating retinosis |
| CH711966A2 (en) * | 2015-12-23 | 2017-06-30 | Pinelli Roberto | Retinal stem cells. |
| SG11201809201UA (en) | 2016-04-22 | 2018-11-29 | Sumitomo Dainippon Pharma Co Ltd | Method for producing retinal tissue |
| JP2020501543A (en) | 2016-12-07 | 2020-01-23 | メイヨ・ファウンデーション・フォー・メディカル・エデュケーション・アンド・リサーチ | Methods and materials using fibrin support for retinal pigment epithelium transplantation |
| CN106754718A (en) * | 2016-12-19 | 2017-05-31 | 胡其锐 | A kind of human embryo stem cell slewing is broken up to the method for retinal pigment epithelium |
| CN110520139A (en) | 2017-02-08 | 2019-11-29 | 哈达西特医疗研究服务和开发有限公司 | For treating the photosensory cell of retinal disease |
| CN108728413A (en) * | 2017-06-13 | 2018-11-02 | 中山大学中山眼科中心 | A kind of preparation of human pluripotent stem cells source Human RPE Cells in Vitro and amplification cultivation method |
| WO2019069327A1 (en) | 2017-10-05 | 2019-04-11 | Eyestem Research Private Limited | Unified cell differentiation protocol |
| CN108531443A (en) * | 2018-04-04 | 2018-09-14 | 温州医科大学附属第二医院、温州医科大学附属育英儿童医院 | The method that small molecule inducing pluripotent stem cells are divided into retinal pigment epithelium |
| CN110205283B (en) * | 2018-04-18 | 2021-04-23 | 浙江大学 | A method for inducing human amniotic epithelial cells to differentiate into retinal pigment epithelial cells and its application |
| EP3969570A1 (en) * | 2019-05-15 | 2022-03-23 | Novo Nordisk A/S | Methods for obtaining eye field progenitor cells from human pluripotent stem cells |
| US20230201267A1 (en) * | 2020-05-29 | 2023-06-29 | FUJIFILM Cellular Dynamics, Inc. | Retinal pigmented epithelium and photoreceptor dual cell aggregates and methods of use thereof |
| CN115840045B (en) * | 2023-02-23 | 2023-04-28 | 中国农业大学 | An identification method and application of porcine embryonic hair follicle placode precursor cells |
| WO2025083169A1 (en) | 2023-10-17 | 2025-04-24 | Tenpoint Therapeutics Limited | Combination of a vegf inhibitor and a complement pathway inhibitor for treating ocular disorders |
| WO2025096328A1 (en) * | 2023-10-30 | 2025-05-08 | The Jackson Laboratory | Cell therapies for retinal diseases |
| CN117467607A (en) * | 2023-12-19 | 2024-01-30 | 南京艾尔普再生医学科技有限公司 | Method, preparation, pharmaceutical composition and reagent for obtaining stable RPE cells |
| CN119709618B (en) * | 2024-12-25 | 2025-10-28 | 电子科技大学附属医院·四川省人民医院 | A method for sorting mature RPE cells from iPSC-differentiated cells and its application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1994025569A1 (en) * | 1993-04-30 | 1994-11-10 | Photogenesis, Incorporated | Retinal pigment epithelium transplantation |
| US6045791A (en) * | 1992-03-06 | 2000-04-04 | Photogenesis, Inc. | Retinal pigment epithelium transplantation |
| WO2006070370A2 (en) | 2004-12-29 | 2006-07-06 | Hadasit Medical Research Services & Development Limited | Stem cells culture systems |
| WO2006080952A2 (en) * | 2005-01-24 | 2006-08-03 | Advanced Cell Technology, Inc. | Improved modalities for the treatment of degenerative diseases of the retina |
Family Cites Families (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SG49267A1 (en) | 1989-08-14 | 1998-05-18 | Photogenesis Inc | Surgical instrument and cell isolation and transplantation |
| US5750342A (en) * | 1990-06-11 | 1998-05-12 | Nexstar Pharmaceuticals, Inc. | Nucleic acid ligands of tissue target |
| TW209224B (en) * | 1991-05-27 | 1993-07-11 | Yoshitomi Pharmaceutical | |
| DE4219250A1 (en) * | 1992-06-12 | 1993-12-16 | Behringwerke Ag | Serum-free cell culture medium |
| US5755785A (en) | 1994-08-12 | 1998-05-26 | The University Of South Florida | Sutureless corneal transplantation method |
| US5843780A (en) | 1995-01-20 | 1998-12-01 | Wisconsin Alumni Research Foundation | Primate embryonic stem cells |
| US5941250A (en) | 1996-11-21 | 1999-08-24 | University Of Louisville Research Foundation Inc. | Retinal tissue implantation method |
| GB9715584D0 (en) | 1997-07-23 | 1997-10-01 | Eisai Co Ltd | Compounds |
| JP3663990B2 (en) | 1999-08-31 | 2005-06-22 | 不二製油株式会社 | Aerated chocolate and method for producing the same |
| GB0001930D0 (en) | 2000-01-27 | 2000-03-22 | Novartis Ag | Organic compounds |
| EP2298867A3 (en) | 2000-06-20 | 2013-01-16 | ES Cell International Pte Ltd. | Method of controlling differentiation of embryonic stem (ES) cells by culturing ES cells in the presence of bmp-2 pathway antagonists |
| EE200300360A (en) | 2001-01-31 | 2003-12-15 | Pfizer Products Inc. | Biaryl derivatives of nicotinamide used as inhibitors of PDE4 isozymes |
| AU2003202988A1 (en) * | 2002-01-14 | 2003-07-30 | The Board Of Trustees Of The University Of Illinois | Use of modified pyrimidine compounds to promote stem cell migration and proliferation |
| AU2003201745A1 (en) | 2002-02-11 | 2003-09-04 | Pfizer Limited | Nicotinamide derivatives and a tiotropium salt in combination for the treatment of e.g. inflammatory, allergic and respiratory diseases |
| US7288658B2 (en) | 2003-07-15 | 2007-10-30 | Hoffmann-La Roche Inc. | Process for preparation of pyridine derivatives |
| US20050019718A1 (en) | 2003-07-22 | 2005-01-27 | Hanson G. Herbert | Orthodontic devices for use with arch wires |
| EP2929782A1 (en) * | 2004-01-23 | 2015-10-14 | Ocata Therapeutics, Inc. | Improved modalities for the treatment of degenerative diseases of the retina |
| DE102004048640A1 (en) * | 2004-10-04 | 2006-04-06 | Otmar Fahrion | Chain |
| JP2006113175A (en) * | 2004-10-13 | 2006-04-27 | Konica Minolta Opto Inc | Optical film, polarizing plate and display apparatus |
| EP2147094B2 (en) | 2007-04-18 | 2018-02-21 | Hadasit Medical Research Services & Development Limited | Stem cell-derived retinal pigment epithelial cells |
| EP2401794B1 (en) | 2009-02-25 | 2012-09-05 | Philips Intellectual Property & Standards GmbH | Output power stabilization for laser diodes using the photon-cooling dependent laser voltage |
| EP3047017B1 (en) * | 2013-10-09 | 2025-09-10 | The Regents of the University of California | Methods of mammalian retinal stem cell production and applications |
-
2008
- 2008-04-27 EP EP08738258.6A patent/EP2147094B2/en active Active
- 2008-04-27 AU AU2008242106A patent/AU2008242106B2/en active Active
- 2008-04-27 ES ES12181140.0T patent/ES2530370T5/en active Active
- 2008-04-27 CA CA2684460A patent/CA2684460C/en active Active
- 2008-04-27 ES ES08738258.6T patent/ES2527444T5/en active Active
- 2008-04-27 CN CN2008800207480A patent/CN101688178B/en active Active
- 2008-04-27 WO PCT/IL2008/000556 patent/WO2008129554A1/en not_active Ceased
- 2008-04-27 US US12/450,943 patent/US8956866B2/en active Active
- 2008-04-27 JP JP2010503665A patent/JP5395058B2/en active Active
- 2008-04-27 EP EP19191405.0A patent/EP3640326A1/en not_active Withdrawn
- 2008-04-27 CN CN201310484803.4A patent/CN103555654B/en active Active
- 2008-04-27 EP EP12181140.0A patent/EP2554661B2/en active Active
- 2008-04-27 EP EP14193621.1A patent/EP2886646B1/en active Active
-
2013
- 2013-03-11 IL IL225163A patent/IL225163B/en active IP Right Grant
-
2014
- 2014-12-29 US US14/583,838 patent/US20150125506A1/en not_active Abandoned
- 2014-12-29 US US14/583,848 patent/US20150118749A1/en not_active Abandoned
-
2017
- 2017-12-26 IL IL256587A patent/IL256587B/en active IP Right Grant
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6045791A (en) * | 1992-03-06 | 2000-04-04 | Photogenesis, Inc. | Retinal pigment epithelium transplantation |
| WO1994025569A1 (en) * | 1993-04-30 | 1994-11-10 | Photogenesis, Incorporated | Retinal pigment epithelium transplantation |
| WO2006070370A2 (en) | 2004-12-29 | 2006-07-06 | Hadasit Medical Research Services & Development Limited | Stem cells culture systems |
| WO2006080952A2 (en) * | 2005-01-24 | 2006-08-03 | Advanced Cell Technology, Inc. | Improved modalities for the treatment of degenerative diseases of the retina |
Non-Patent Citations (6)
| Title |
|---|
| DAS A M ET AL: "Stem cell therapy for retinal degeneration: retinal neurons from heterologous sources", SEMINARS IN OPHTHALMOLOGY, SAUNDERS, US, vol. 20, no. 1, 1 January 2005 (2005-01-01), pages 3 - 10, XP002991776, ISSN: 0882-0538 * |
| GROPP M; ITSYKSON P; SINGER O; BEN-HUR T; REINHARTZ E; GALUN E; REUBINOFF BE: "Stable genetic modification of human embryonic stem cells by lentiviral vectors", MOLECULAR THERAPY, vol. 7, 2003, pages 281 - 7 |
| HARUTA MASATOSHI ET AL: "In vitro and in vivo characterization of pigment epithelial cells differentiated from primate embryonic stem cells", INVESTIGATIVE OPHTHALMOLOGY & VISUAL SCIENCE MAR 2004,, vol. 45, no. 3, 1 March 2004 (2004-03-01), pages 1020 - 1025, XP002487262 * |
| KAWASAKI H ET AL: "Generation of dopaminergic neurons and pigmented epithelia from primate ES cells by stromal cell-derived inducing activity", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC, vol. 99, no. 3, 5 February 2002 (2002-02-05), pages 1580 - 1585, XP002971360, ISSN: 0027-8424 * |
| KUBOTA ET AL: "Transplantable retinal pigment epithelial cell sheets for tissue engineering", BIOMATERIALS, ELSEVIER SCIENCE PUBLISHERS BV., BARKING, GB, vol. 27, no. 19, 1 July 2006 (2006-07-01), pages 3639 - 3644, XP005365321, ISSN: 0142-9612 * |
| See also references of EP2147094A1 |
Cited By (119)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9045732B2 (en) | 2004-01-23 | 2015-06-02 | Ocata Therapeutics, Inc. | Modalities for the treatment of degenerative diseases of the retina |
| US9649340B2 (en) | 2004-01-23 | 2017-05-16 | Astellas Institute For Regenerative Medicine | Methods for producing enriched populations of human retinal pigment epithelium cells |
| US9181524B2 (en) | 2004-01-23 | 2015-11-10 | Ocata Therapeutics, Inc. | Modalities for the treatment of degenerative diseases of the retina |
| US9080150B2 (en) | 2004-01-23 | 2015-07-14 | Ocata Therapeutics, Inc. | Modalities for the treatment of degenerative diseases of the retina |
| US9562217B2 (en) | 2004-01-23 | 2017-02-07 | Astellas Institute For Regenerative Medicine | Modalities for the treatment of degenerative diseases of the retina |
| US8268303B2 (en) | 2004-01-23 | 2012-09-18 | Advanced Cell Technology, Inc. | Methods for producing enriched populations of human retinal pigment epithelium cells for treatment of retinal degeneration |
| US9040038B2 (en) | 2004-01-23 | 2015-05-26 | Ocata Therapeutics, Inc. | Modalities for the treatment of degenerative diseases of the retina |
| US9730962B2 (en) | 2004-01-23 | 2017-08-15 | Astellas Institute For Regenerative Medicine | Modalities for the treatment of degenerative diseases of the retina |
| US9193950B2 (en) | 2004-01-23 | 2015-11-24 | Ocata Therapeutics, Inc. | Modalities for the treatment of degenerative diseases of the retina |
| US9040770B2 (en) | 2004-01-23 | 2015-05-26 | Ocata Therapeutics, Inc. | Modalities for the treatment of degenerative diseases of the retina |
| US9040039B2 (en) | 2004-01-23 | 2015-05-26 | Ocata Therapeutics, Inc. | Modalities for the treatment of degenerative diseases of the retina |
| US9650607B2 (en) | 2004-01-23 | 2017-05-16 | Astellas Institute For Regenerative Medicine | Modalities for the treatment of degenerative diseases of the retina |
| US8956866B2 (en) | 2007-04-18 | 2015-02-17 | Hadasit Medical Research Services And Development Ltd. | Retinal pigment epithelial cells differentiated from embryonic stem cells with nicotinamide and activin A |
| US10077424B2 (en) | 2007-10-12 | 2018-09-18 | Astellas Institute For Regenerative Medicine | Methods of producing RPE cells and compositions of RPE cells |
| US9926533B2 (en) | 2008-03-17 | 2018-03-27 | The Scripps Research Institute | Combined chemical and genetic approaches for generation of induced pluripotent stem cells |
| CN104694570B (en) * | 2008-03-17 | 2019-07-16 | 斯克里普斯研究所 | A combinatorial chemical genetic approach for the generation of induced pluripotent stem cells |
| CN104694570A (en) * | 2008-03-17 | 2015-06-10 | 斯克里普斯研究所 | Combined chemical and genetic approaches for generation of induced pluripotent stem cells |
| US10227563B2 (en) | 2008-06-06 | 2019-03-12 | Riken | Method for culture of stem cell |
| US10934523B2 (en) | 2008-06-06 | 2021-03-02 | Riken | Method for culture of stem cell |
| JP2012524525A (en) * | 2009-04-23 | 2012-10-18 | 中国科学院広州生物医藥与健康研究院 | Novel serum-free medium for rapidly and efficiently inducing pluripotent stem cells and method of use thereof |
| JP2016082983A (en) * | 2009-08-24 | 2016-05-19 | ウイスコンシン アラムナイ リサーチ ファウンデーシヨンWisconsin Alumni Research Foundation | Substantially pure human retinal progenitor cell culture, forebrain progenitor cell culture, retinal pigment epithelial cell culture, and methods for their production |
| WO2011025852A1 (en) | 2009-08-28 | 2011-03-03 | Cellular Dynamics International, Inc. | Identifying genetic variation in affected tissues |
| RU2409663C1 (en) * | 2009-10-14 | 2011-01-20 | Российская Федерация, от имени которой выступает Федеральное Агентство по науке и инновациям | Method for producing dedifferentiated cells of adult retinal pigment eye epithelium |
| JP2013509859A (en) * | 2009-11-05 | 2013-03-21 | 独立行政法人理化学研究所 | Stem cell differentiation induction method |
| US20130040330A1 (en) * | 2009-11-05 | 2013-02-14 | Riken | Method for differentiation induction in cultured stem cells |
| US12091680B2 (en) | 2009-11-05 | 2024-09-17 | Riken | Method for differentiation induction in cultured stem cells |
| US10793830B2 (en) | 2009-11-05 | 2020-10-06 | Riken | Method for producing retinal tissue in vitro |
| WO2011055855A1 (en) * | 2009-11-05 | 2011-05-12 | Riken | A method for differentiation induction in cultured stem cells |
| US11850261B2 (en) | 2009-11-17 | 2023-12-26 | Astellas Institute For Regenerative Medicine | Methods of producing human RPE cells and pharmaceutical preparations of human RPE cells |
| WO2011063005A3 (en) * | 2009-11-17 | 2011-10-06 | Advanced Cell Technology, Inc. | Methods of producing human rpe cells and pharmaceutical preparations of human rpe cells |
| US10485829B2 (en) | 2009-11-17 | 2019-11-26 | Astellas Institute For Regenerative Medicine | Methods of producing human RPE cells and pharmaceutical preparations of human RPE cells |
| US10188769B2 (en) | 2010-07-12 | 2019-01-29 | University Of Southern California | Biocompatible substrate for facilitating interconnections between stem cells and target tissues and methods for implanting same |
| US11154639B2 (en) | 2010-07-12 | 2021-10-26 | University Of Southern California | Biocompatible substrate for facilitating interconnections between stem cells and target tissues and methods for implanting same |
| US12545945B2 (en) | 2010-07-23 | 2026-02-10 | Astellas Institute For Regenerative Medicine | Methods for detection of rare subpopulations of cells and highly purified composition of cells |
| US11739366B2 (en) | 2010-07-23 | 2023-08-29 | Astellas Institute For Regenerative Medicine | Methods for detection of rare subpopulations of cells and highly purified compositions of cells |
| WO2012085348A1 (en) * | 2010-12-20 | 2012-06-28 | Suomen Punainen Risti, Veripalvelu | Method of producing human retinal pigmented epithelial cells |
| US10844356B2 (en) | 2010-12-22 | 2020-11-24 | Fate Therapeutics, Inc. | Cell culture platform for single cell sorting and enhanced reprogramming of iPSCs |
| US12415989B2 (en) | 2010-12-22 | 2025-09-16 | Fate Therapeutics, Inc. | Cell culture platform for single cell sorting and enhanced reprogramming of iPSCs |
| US8349005B2 (en) | 2011-01-03 | 2013-01-08 | Masatoshi Murata | Method for burying implant to choroid |
| US10478206B2 (en) | 2011-04-29 | 2019-11-19 | University Of Southern California | Instruments and methods for the implantation of cell-seeded substrates |
| US12582677B2 (en) | 2011-11-25 | 2026-03-24 | Sumitomo Chemical Company, Limited | Methods for producing retinal tissue and retina-related cell |
| JP2013128477A (en) * | 2011-11-25 | 2013-07-04 | Sumitomo Chemical Co Ltd | Method for producing retinal-layer-specific nerve cell |
| JP2013128474A (en) * | 2011-11-25 | 2013-07-04 | Sumitomo Chemical Co Ltd | Method for producing retinal pigment epithelial cell |
| KR20140097442A (en) * | 2011-11-25 | 2014-08-06 | 스미또모 가가꾸 가부시끼가이샤 | Methods for producing retinal tissue and retina-related cell |
| WO2013077425A1 (en) * | 2011-11-25 | 2013-05-30 | 住友化学株式会社 | Methods for producing retinal tissue and retina-related cell |
| JP2013128475A (en) * | 2011-11-25 | 2013-07-04 | Sumitomo Chemical Co Ltd | Method for producing retinal tissue |
| KR102111936B1 (en) | 2011-11-25 | 2020-05-18 | 스미또모 가가꾸 가부시끼가이샤 | Methods for producing retinal tissue and retina-related cell |
| JP2013128476A (en) * | 2011-11-25 | 2013-07-04 | Sumitomo Chemical Co Ltd | Method for producing optic-cup-like structure |
| US10973854B2 (en) | 2011-11-25 | 2021-04-13 | Sumitomo Chemical Company, Limited | Methods for producing retinal tissue and retina-related cell |
| US9642940B2 (en) | 2011-12-05 | 2017-05-09 | California Institute Of Technology | 3-dimensional parylene scaffold cage |
| US8877489B2 (en) | 2011-12-05 | 2014-11-04 | California Institute Of Technology | Ultrathin parylene-C semipermeable membranes for biomedical applications |
| US9248013B2 (en) | 2011-12-05 | 2016-02-02 | California Institute Of Technology | 3-Dimensional parylene scaffold cage |
| US11318225B2 (en) | 2011-12-05 | 2022-05-03 | California Institute Of Technology | Ultrathin parylene-C semipermeable membranes for biomedical applications |
| US9658216B2 (en) * | 2012-01-31 | 2017-05-23 | Cell Cure Neurosciences Ltd. | Methods of selecting retinal pigmented epithelial cells |
| US20150010922A1 (en) * | 2012-01-31 | 2015-01-08 | Cell Cure Neurosciences Ltd. | Methods of selecting retinal pigmented epithelial cells |
| US11035857B2 (en) | 2012-01-31 | 2021-06-15 | Hadasit Medical Research Services And Development Ltd. | Methods of selecting retinal pigmented epithelial cells |
| RU2486603C1 (en) * | 2012-04-11 | 2013-06-27 | Федеральное государственное бюджетное учреждение науки Институт биологии развития им. Н.К. Кольцова РАН (ИБР РАН) | Method for simulating tissue structure of human retina |
| US11441184B2 (en) | 2013-02-01 | 2022-09-13 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Method for generating retinal pigment epithelium (RPE) cells from induced pluripotent stem cells (IPSCs) |
| US10480031B2 (en) | 2013-02-01 | 2019-11-19 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Method for generating Retinal Pigment Epithelium (RPE) cells from Induced Pluripotent Stem Cells (IPSCs) |
| WO2014162040A1 (en) * | 2013-04-03 | 2014-10-09 | Tampereen Yliopisto | Methods and media for differentiating eye cells |
| US10501724B2 (en) | 2013-08-23 | 2019-12-10 | Sumitomo Chemical Company, Limited | Method for producing retinal tissue and retina-related cells |
| US11473056B2 (en) | 2013-08-23 | 2022-10-18 | Sumitomo Chemical Company, Limited | Method for producing retinal tissue and retina-related cells |
| US12378520B2 (en) | 2013-08-23 | 2025-08-05 | Sumitomo Chemical Company, Limited | Method for producing retinal tissue and retina-related cells |
| JPWO2015053376A1 (en) * | 2013-10-09 | 2017-03-09 | 株式会社ヘリオス | Retinal pigment epithelial cell purification method |
| WO2015053375A1 (en) * | 2013-10-09 | 2015-04-16 | 株式会社ヘリオス | Method of producing retinal pigment epithelial cell |
| EP3056564A4 (en) * | 2013-10-09 | 2017-06-14 | Healios K.K. | Method for purification of retinal pigment epithelial cells |
| EP3056563A4 (en) * | 2013-10-09 | 2017-06-07 | Healios K.K. | Method of producing retinal pigment epithelial cell |
| US12595464B1 (en) | 2013-10-09 | 2026-04-07 | Helios K.K. | Method of producing retinal pigment epithelial cell |
| AU2014332856B2 (en) * | 2013-10-09 | 2020-03-05 | Healios K.K. | Method of producing retinal pigment epithelial cell |
| CN105829526A (en) * | 2013-10-09 | 2016-08-03 | 希里欧斯株式会社 | Method for purifying retinal pigment epithelial cells |
| US11492593B2 (en) | 2013-10-09 | 2022-11-08 | Healios K.K. | Method for purification of retinal pigment epithelial cells |
| WO2015053376A1 (en) * | 2013-10-09 | 2015-04-16 | 株式会社ヘリオス | Method for purification of retinal pigment epithelial cells |
| JPWO2015053375A1 (en) * | 2013-10-09 | 2017-03-09 | 株式会社ヘリオス | Method for producing retinal pigment epithelial cells |
| JP2019107024A (en) * | 2013-10-09 | 2019-07-04 | 株式会社ヘリオス | Production method of retinal pigment epithelial cell |
| JP2019107025A (en) * | 2013-10-09 | 2019-07-04 | 株式会社ヘリオス | Purification method of retinal pigment epithelial cell |
| CN105849254A (en) * | 2013-10-09 | 2016-08-10 | 希里欧斯株式会社 | Method for purifying retinal pigment epithelial cells |
| EP3070162A4 (en) * | 2013-11-11 | 2017-05-31 | Sumitomo Chemical Company Limited | Method for producing retinal pigment epithelial cells |
| WO2015087231A1 (en) | 2013-12-11 | 2015-06-18 | Pfizer Limited | Method for producing retinal pigment epithelial cells |
| US11268069B2 (en) | 2014-03-04 | 2022-03-08 | Fate Therapeutics, Inc. | Reprogramming methods and cell culture platforms |
| US20170080030A1 (en) * | 2014-03-17 | 2017-03-23 | University Of Virginia Patent Foundation | Compositions and methods for treating retinopathy |
| US11865189B2 (en) | 2014-12-18 | 2024-01-09 | Sorbonne Universite | Transgenic RPE cells overexpressing OTX2 for the treatment of retinal degeneration |
| EP3916085A1 (en) | 2014-12-30 | 2021-12-01 | Cell Cure Neurosciences Ltd. | Assessing retinal pigment epithelial cell populations |
| US11891622B2 (en) | 2014-12-30 | 2024-02-06 | Cell Cure Neurosciences Ltd. | RPE cell populations and methods of generating same |
| WO2016108240A1 (en) | 2014-12-30 | 2016-07-07 | Cell Cure Neurosciences Ltd. | Assessing retinal pigment epithelial cell populations |
| US11987810B2 (en) | 2014-12-30 | 2024-05-21 | Cell Cure Neurosciences Ltd. | RPE cell populations and methods of generating same |
| WO2016108239A1 (en) | 2014-12-30 | 2016-07-07 | Cell Cure Neurosciences Ltd. | Rpe cell populations and methods of generating same |
| EP3240890B1 (en) | 2014-12-30 | 2021-06-16 | Cell Cure Neurosciences Ltd. | Assessing retinal pigment epithelial cell populations |
| EP3674397A1 (en) | 2014-12-30 | 2020-07-01 | Cell Cure Neurosciences Ltd. | Rpe cell populations and methods of generating same |
| US11230696B2 (en) | 2015-07-29 | 2022-01-25 | Hadasit Medical Research Services And Development Ltd. | Large scale production of retinal pigment epithelial cells |
| WO2017017686A1 (en) | 2015-07-29 | 2017-02-02 | Hadasit Medical Research Services And Development Ltd. | Large scale production of retinal pigment epithelial cells |
| EP3862425A1 (en) | 2015-07-29 | 2021-08-11 | Hadasit Medical Research Services and Development Ltd. | Large scale production of retinal pigment epithelial cells |
| WO2017021973A1 (en) | 2015-08-05 | 2017-02-09 | Cell Cure Neurosciences Ltd. | Preparation of retinal pigment epithelium cells |
| WO2017021972A1 (en) | 2015-08-05 | 2017-02-09 | Cell Cure Neurosciences Ltd. | Preparation of photoreceptors for the treatment of retinal diseases |
| US11090337B2 (en) | 2015-08-05 | 2021-08-17 | Cell Cure Neurosciences Ltd | Preparation of photoreceptors for the treatment of retinal diseases |
| EP4155391A1 (en) | 2015-08-05 | 2023-03-29 | Cell Cure Neurosciences Ltd. | Preparation of retinal pigment epithelium cells |
| US12203097B2 (en) | 2015-08-05 | 2025-01-21 | Cell Cure Neurosciences Ltd. | Preparation of retinal pigment epithelium cells |
| US11066642B2 (en) | 2015-08-05 | 2021-07-20 | Cell Cure Neurosciences Ltd | Preparation of retinal pigment epithelium cells |
| EP3348631A4 (en) * | 2015-09-08 | 2019-03-06 | Sumitomo Dainippon Pharma Co., Ltd. | PROCESS FOR PRODUCING RETINAL TISSUE |
| US12385008B2 (en) | 2015-09-08 | 2025-08-12 | Sumitomo Pharma Co., Ltd. | Method for producing retinal tissue |
| US11441126B2 (en) | 2015-10-16 | 2022-09-13 | Fate Therapeutics, Inc. | Platform for the induction and maintenance of ground state pluripotency |
| US12351831B2 (en) | 2015-10-16 | 2025-07-08 | Fate Therapeutics, Inc. | Platform for the induction and maintenance of ground state pluripotency |
| WO2017072763A1 (en) | 2015-10-26 | 2017-05-04 | Cell Cure Neurosciences Ltd. | Preparation of retinal pigment epithelium cells |
| AU2025205526B2 (en) * | 2015-10-26 | 2025-09-11 | Cell Cure Neurosciences Ltd. | Preparation of retinal pigment epithelium cells |
| US12188047B2 (en) | 2015-10-26 | 2025-01-07 | Hadasit Medical Research Services And Development Ltd. | Preparation of retinal pigment epithelium cells |
| IL258824A (en) * | 2015-10-26 | 2018-06-28 | Cell Cure Neurosciences Ltd | Preparation of retinal pigment epithelium cells |
| EP4545633A2 (en) | 2015-10-26 | 2025-04-30 | Cell Cure Neurosciences Ltd. | PRODUCTION OF RETINAL PIGMENT EPITHELIAL CELLS |
| IL258824B (en) * | 2015-10-26 | 2021-12-01 | Cell Cure Neurosciences Ltd | Preparation of retinal pigment epithelium cells |
| EP4545633A3 (en) * | 2015-10-26 | 2025-07-09 | Cell Cure Neurosciences Ltd. | Preparation of retinal pigment epithelium cells |
| WO2018170494A1 (en) | 2017-03-16 | 2018-09-20 | Bio Time, Inc. | Methods for measuring therapeutic effects of retinal disease therapies |
| US12593837B2 (en) | 2017-12-29 | 2026-04-07 | Cell Cure Neurosciences Ltd. | Retinal pigment epithelium cell compositions |
| US11814652B2 (en) | 2018-03-22 | 2023-11-14 | Oriental Yeast Co., Ltd. | Pluripotent stem cell differentiation-promoting agent |
| US12110503B2 (en) | 2018-04-20 | 2024-10-08 | FUJIFILM Cellular Dynamics, Inc. | Method for differentiation of ocular cells and use thereof |
| WO2020254623A1 (en) | 2019-06-21 | 2020-12-24 | Centre D'etude Des Cellules Souches (Cecs) | Automated method for preparing retinal pigment epithelium cells |
| EP3754014A1 (en) | 2019-06-21 | 2020-12-23 | Centre d'Etude des Cellules Souches (CECS) | Automated method for preparing retinal pigment epithelium cells |
| WO2021242788A1 (en) * | 2020-05-25 | 2021-12-02 | Lineage Cell Therapeutics, Inc. | Methods and compositions for treating retinal diseases and conditions |
| WO2022261320A1 (en) | 2021-06-09 | 2022-12-15 | Lineage Cell Therapeutics, Inc. | Methods and compositions for treating retinal diseases and conditions |
| WO2023009676A1 (en) | 2021-07-28 | 2023-02-02 | Lineage Cell Therapeutics, Inc. | Expansion of retinal pigment epithelium cells |
| US12618049B2 (en) | 2022-01-19 | 2026-05-05 | Fate Therapeutics, Inc. | Reprogramming methods and cell culture platforms |
| WO2023201361A1 (en) | 2022-04-15 | 2023-10-19 | Aspen Neuroscience, Inc. | Methods of classifying the differentiation state of cells and related compositions of differentiated cells |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2008242106B2 (en) | Stem cell-derived retinal pigment epithelial cells | |
| KR102514912B1 (en) | Methods of treating retinal diseases | |
| KR20160002779A (en) | Photoreceptors and photoreceptor progenitors produced from pluripotent stem cells | |
| US12281328B2 (en) | Photoreceptor cells for the treatment of retinal diseases | |
| IL201600A (en) | Method of generating pluripotent stem cell derived retinal pigment epithelial cells | |
| HK1211619B (en) | Stem cell-derived retinal pigment epithelial cells | |
| HK1179647B (en) | Stem cell-derived retinal pigment epithelial cells | |
| HK1140791B (en) | Stem cell-derived retinal pigment epithelial cells | |
| HK1191377B (en) | Stem cell-derived retinal pigment epithelial cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200880020748.0 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08738258 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2684460 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201600 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2010503665 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12450943 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008242106 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 6790/CHENP/2009 Country of ref document: IN Ref document number: 2008738258 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2008242106 Country of ref document: AU Date of ref document: 20080427 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 225163 Country of ref document: IL |
