CN117467607A - Method, preparation, pharmaceutical composition and reagent for obtaining stable RPE cells - Google Patents

Method, preparation, pharmaceutical composition and reagent for obtaining stable RPE cells Download PDF

Info

Publication number
CN117467607A
CN117467607A CN202311752081.6A CN202311752081A CN117467607A CN 117467607 A CN117467607 A CN 117467607A CN 202311752081 A CN202311752081 A CN 202311752081A CN 117467607 A CN117467607 A CN 117467607A
Authority
CN
China
Prior art keywords
rpe
cells
maturation
irpe
promoting
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
CN202311752081.6A
Other languages
Chinese (zh)
Inventor
王嘉显
潘芷伊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Help Stem Cell Innovations Co ltd
Original Assignee
Help Stem Cell Innovations Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Help Stem Cell Innovations Co ltd filed Critical Help Stem Cell Innovations Co ltd
Priority to CN202311752081.6A priority Critical patent/CN117467607A/en
Publication of CN117467607A publication Critical patent/CN117467607A/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0621—Eye cells, e.g. cornea, iris pigmented cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5014—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing toxicity

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Toxicology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Ophthalmology & Optometry (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The invention belongs to the field of regenerative medicine, and relates to a method, a preparation, a pharmaceutical composition and a reagent for obtaining RPE cells with stable performance, wherein the method comprises the steps of obtaining RPE precursor cells; the RPE precursor cells are RPE-like cells that exhibit compact monolayer paving stones; continuously culturing the RPE precursor cells by adopting a maturation promoting medium until the RPE cells which are cobblestone-like and have even melanin distribution are obtained, and deepening the melanin of the obtained RPE cells relative to the RPE precursor cells; the maturation-promoting medium comprises maturation-promoting small molecules, wherein the maturation-promoting small molecules are selected from one or a plurality of thyroid hormones, EDN1, EDN3 and RA in any molar ratio; the dosage of thyroid hormone ranges from 20 nM to 500nM, EDN1 ranges from 10 nM to 200nM, EDN3 ranges from 10 nM to 200nM, and RA ranges from 0.2. Mu.M to 2. Mu.M. The functional maturity stage is mainly realized by depending on chemical small molecules, and the components in the ripening process are clear and have strong replicability.

Description

Method, preparation, pharmaceutical composition and reagent for obtaining stable RPE cells
Technical Field
The invention belongs to the field of regenerative medicine, and relates to a method, a preparation, a pharmaceutical composition and a reagent for obtaining stable RPE cells, in particular to a method for inducing pluripotent stem cells to differentiate into RPE cells by using three small molecular compounds singly or in combination.
Background
Human pluripotent stem cells (hpscs) (human embryonic stem cells (hescs)/human induced pluripotent stem cells (hipscs)) have the multipotent ability to self-renew and differentiate into tricermal cells, and thus are an important source of regenerative therapies. Retinal regeneration using hpscs is a new promising therapeutic approach for stem cell regeneration therapies. Retinal pigment epithelial cells (RPE cells) play an important role in vision and maintenance of retinal function. For age-related macular degeneration (AMD) patients, transplantation of RPE cell suspensions or RPE cell sheets prepared from hpscs is considered safe and potentially effective.
When the RPE cell is applied, the function of the RPE cell needs to be judged, and main functional indexes comprise:
secretion function: VEGF is a neuroprotective factor and is also a potent angiogenic factor. VEGF secretion is an important property of healthy RPE cells and is critical to survival and maintenance of the retina and choroid.
Regulating the barrier: the RPE cells have melanosomes or pigment particles, which can absorb stray light, prevent light scattering, and prevent a decrease in spatial resolution. The clear role of melanosomes in RPE cells (and melanocytes of the skin) is to screen light. During daylight hours, when the photoreceptor sensitivity is less important, it is important to limit light scattering within the eye to improve spatial resolution.
Phagocytic function: the RPE cells are positioned between the chorionic vessel and the photosensitive outer segment of the photoreceptor, and the photoreceptor photosensitive outer segment part can be continuously updated by phagocytosis and degradation of the detached rod and cone photoreceptor outer segment so as to maintain visual functions.
The RPE precursor cells are immature RPE cells, have strong proliferation capacity, and can generate safety characteristics such as tumorigenicity and the like in practical application.
Disclosure of Invention
The application provides a method, a preparation, a pharmaceutical composition and a reagent for obtaining stable RPE cells, wherein the functional maturation stage is mainly realized by depending on chemical small molecules, and the components of the maturation promoting process are clear and have strong replicability.
In order to achieve the technical purpose, the technical scheme adopted by the application is that the method for obtaining the RPE cells with stable performance comprises the steps of obtaining RPE precursor cells; the RPE precursor cells are RPE-like cells that exhibit compact monolayer paving stones;
continuously culturing the RPE precursor cells by adopting a maturation promoting medium until the RPE cells which are cobblestone-like and have even melanin distribution are obtained, and deepening the melanin of the obtained RPE cells relative to the RPE precursor cells;
the maturation-promoting medium comprises maturation-promoting small molecules, wherein the maturation-promoting small molecules are selected from one or a plurality of thyroid hormones, EDN1, EDN3 and RA in any molar ratio; the dosage of thyroid hormone ranges from 20 nM to 500nM, EDN1 ranges from 10 nM to 200nM, EDN3 ranges from 10 nM to 200nM, and RA ranges from 0.2. Mu.M to 2. Mu.M.
As an improved technical scheme of the application, the obtained RPE precursor cells are ESCs, iPSCs or universal iPSCs HLA -KO Differentiation is carried out to obtain;
the universal iPSC HLA-KO Ipscs with immune-exemption properties are specifically reduced for HLA expression via gene editing.
As an improved technical scheme of the application, the maturation-promoting medium further comprises an additive; the additive is one or two of CHIR99021 and Nicotinamide in any molar ratio; wherein the dosage of CHIR99021 is 1-10 μm, and the dosage of Nicotinamide is 10-50mM.
As an improved technical scheme of the application, thyroid hormone is one of T3 and T4 or two of any molar ratios.
As an improved technical scheme of the application, the maturation-promoting medium further comprises a basal medium, wherein the basal medium is E5 or E6.
It is another object of the present application to provide an RPE cell preparation comprising RPE cells obtained by the aforementioned method.
It is another object of the present application to provide a pharmaceutical composition suitable for ophthalmic use comprising as an active ingredient RPE cells obtained by the aforementioned method.
It is another object of the present application to provide an agent for evaluating toxicity or efficacy of a test substance, comprising RPE cells obtained by the foregoing method.
It is another object of the present application to provide a method for evaluating the toxicity or efficacy of a test substance comprising contacting RPE cells obtained using the aforementioned method with said substance and determining the effect of said substance on said cells.
The beneficial effects are that: the RPE cell with short period and stronger functionality is obtained, the cost and the efficiency of the RPE cell are reduced for industrial production, and more suitable raw materials are provided for RPE cell preparations, pharmaceutical compositions and related reagents.
The differentiation process does not introduce any animal-derived component, avoids the risk of exogenous virus pollution, and improves the safety of future clinical application.
The applicant has obtained RPE cells with stable properties based on extensive experimental studies in ESCs, iPSCs or universal iPSCs HLA-KO Has universality in the differentiation direction of RPE cells.
Drawings
FIG. 1 is a diagram of the morphology of iRPE precursor cells on which the present application is based.
FIG. 2 is a diagram of the morphology of iRPE cells obtained based on the method of the present application: (a) iRPE-1 (immature RPE cells), without a forcing agent; (b) iRPE-T3, employing T3 as a maturation-promoting agent; (c) iRPE-EDN3, employing EDN3 as a maturation-promoting agent; (d) iRPE-RA, employing RA as a maturation-promoting agent; (e) iRPE-ALL-1 adopts the mixed use of T3, EDN3 and RA as maturation-promoting agent.
FIG. 3 is a flow chart of iRPE cells obtained based on the method of the present application: (a) fRPE (99.44%); (b) iRPE-1, without a ripening agent (99.59%); (c) iRPE-T3, employing T3 as a maturation-promoting agent (99.29%); (d) iRPE-EDN3, EDN3 was used as a maturation-promoting agent (99.53%); (e) iRPE-RA, using RA as a maturation-promoting agent (99.58%); (f) iRPE-ALL-1, a mixture of T3, EDN3, RA was used as maturation-promoting agent (99.63%).
FIG. 4 marker MITF quantitative qPCR assay: iPSC, fRPE, iRPE-1, iRPE-T3-min (T3 dose 20 nM), iRPE-T3-mid (T3 dose 300 nM), iRPE-T3-max (T3 dose 500 nM), iRPE-EDN3-min (EDN 3 dose 10 nM), iRPE-EDN3-mid (EDN 3 dose 100 nM), iRPE-EDN3-max (EDN 3 dose 200 nM), iRPE-RA-min (RA dose 0.2. Mu.M), iRPE-RA-mid (RA dose 1. Mu.M), iRPE-RA-max (RA dose 2. Mu.M), iRPE-ALL-1 (T3 dose 300 nM, RA dose 1. Mu.M, EDN3 dose 100 nM), iRPE-ALL-2 (T3 dose 300 nM, RA dose 1. Mu.M, EDN3 dose 100 nM), iRPE-ALL-3 (T3 nM, RA 1. Mu.M, RA 1 nM), iRPE-RA-3 (RA dose 100 nM) and iRPE-ALL-3 nM (RA dose 100 nM).
FIG. 5 marker RPE65 quantitative qPCR detection: iPSC, fRPE, iRPE-1, iRPE-T3-min (T3 dose 20 nM), iRPE-T3-mid (T3 dose 300 nM), iRPE-T3-max (T3 dose 500 nM), iRPE-EDN3-min (EDN 3 dose 10 nM), iRPE-EDN3-mid (EDN 3 dose 100 nM), iRPE-EDN3-max (EDN 3 dose 200 nM), iRPE-RA-min (RA dose 0.2. Mu.M), iRPE-RA-mid (RA dose 1. Mu.M), iRPE-RA-max (RA dose 2. Mu.M), iRPE-ALL-1 (T3 dose 300 nM, RA dose 1. Mu.M, EDN3 dose 100 nM), iRPE-ALL-2 (T3 dose 300 nM, RA dose 1. Mu.M, EDN3 dose 100 nM), iRPE-ALL-3 (T3 nM, RA 1. Mu.M, RA 1 nM), iRPE-RA-3 (RA dose 100 nM) and iRPE-ALL-3 nM (RA dose 100 nM).
Fig. 6 phagocytic-flow assay: (a) fRPE (95.67%), (b) iRPE-1 (76.66%), (c) iRPE-EDN3 (97.55%), (d) iRPE-T3 (98.51%), (e) iRPE-RA (97.75%), (f) iRPE-ALL-1 (98.35%).
FIG. 7 VEGF secretion assay: iPSC, fRPE, iRPE-1, iRPE-T3-min (T3 dose 20 nM), iRPE-T3-mid (T3 dose 300 nM), iRPE-T3-max (T3 dose 500 nM), iRPE-EDN3-min (EDN 3 dose 10 nM), iRPE-EDN3-mid (EDN 3 dose 100 nM), iRPE-EDN3-max (EDN 3 dose 200 nM), iRPE-RA-min (RA dose 0.2. Mu.M), iRPE-RA-mid (RA dose 1. Mu.M), iRPE-RA-max (RA dose 2. Mu.M), iRPE-ALL-1 (T3 dose 300 nM, RA dose 1. Mu.M, EDN3 dose 100 nM), iRPE-ALL-2 (T3 dose 300 nM, RA dose 1. Mu.M, EDN3 dose 100 nM), iRPE-ALL-3 (T3 nM, RA 1. Mu.M, RA 1 nM), iRPE-RA-3 (RA dose 100 nM) and iRPE-ALL-3 nM (RA dose 100 nM).
Description of the embodiments
Definition of noun
iPSC, i.e. induced pluripotent stem cells. hiPSC, a human induced pluripotent stem cell, is a stem cell that is reprogrammed from human peripheral blood mononuclear cells, has self-renewal capacity and differentiates into tricodermic cells. Tricodermic differentiation refers to differentiation into ectodermal, mesodermal and endodermal cell lineage cells. Derived from: T/CSCB0005-2021, published by the society of cell biology, china, standards for human induced pluripotent Stem cells. The iRPE is an RPE precursor cell obtained by iPSC differentiation and a mature RPE cell.
The universal iPSC HLA-KO Ipscs with immune-exemption properties are specifically reduced for HLA expression via gene editing. The method specifically comprises the following steps: universal iPSC HLA-KO Refers to knocking out class I (e.g., B2M) and/or class II (e.g., CIITA) genes of HLA gene groups by CRISPR/Cas9 technology to ipscs. The procedure for obtaining was as exemplified in the description of chinese patent CN114686440B, "a method for preparing low-immunogenicity iPSC cells, low-immunogenicity iPSC cells and compositions", except that ipscs herein were not dependent on CD47 editing. iKO-RPE is iPSC HLA-KO Differentiation to obtain RPE precursor cells and mature RPE cells.
ESCs are derived from embryonic stem cell lines H1 or H9.
RPE cells, retinal Pigment Epithelium, RPE cells are short for retinal pigment epithelial cells, located outside the retina, a dense pigmented epithelial monolayer between the choroid and the neural retina that provides support, nutrition and circulation for photoreceptor cells. The confirmation of RPE cells in this application is: first, the expression of RPE cell-specific marker proteins: TYR, RPE65, MITF, PAX6 and BEST1 were expressed positively; secondly, the presence of melanin granules (brown-black); thirdly, the cell-cell tight junctions, typical polygonal shapes, cobblestone-like cell morphologies, and the like are easily confirmed. Whether a cell has the function of a retinal pigment epithelial cell is verified herein by the in vitro phagocytic function of RPE cells.
Thyroid hormone, specifically: one or two of T3 and T4 in any molar ratio; the dosage of T3 and T4 ranges from 20 to 500 and nM. T3 is called triiodothyronine, T4 is called tetraiodothyronine, and the T3 shows high affinity in combination with RPE cells and participates in the regulation of the functions of mature RPE cells such as choroidal vascular permeability, antioxidant enzyme activity, photosensitivity and the like.
EDN1 is used in an amount ranging from 10-200nM, and EDN1 is endothelin 1.
EDN3 is used in an amount ranging from 10 nM to 200nM, EDN3 (Endothelin-3) is an endothelial-derived vasoactive peptide that participates in multiple biological functions, and EDN3 regulates the expression of melanin-producing markers, such as MITF, during the maturation of RPE cells, promoting the deposition of melanin.
RA amounts ranging from 0.2 to 2 μm, retinoic Acid (RA) is a regulator of eye growth, modulating neural retina, RPE cells, periocular mesenchyme, crystalline lens, cornea, iris/ciliary body, choroid, sclera and non-steroid hormone receptors in conjunctiva such as rarα/β/γ and rxrα/β/γ, beneficial for Tight Junction (TJ) related proteins in RPE cell-choroidal complex.
iRPE cells are mature RPE cells obtained by adopting different maturation promoting modes after iRPSC is induced and differentiated into RPE precursor cells.
fRPE cells, english are all: human Fetal Retinal Pigment Epithelium Cells, literal name: human fetal retinal pigment epithelial cells were used as positive controls for iRPE cells. The source is eyeball separation and culture of aborted fetus, and the specific method is available in the prior art and includes, but is not limited to, chinese patent CN103602631A 'separation culture method of human fetal retinal pigment epithelial cells'.
Example 1, RPE precursor cells (native RPE) were obtained. Methods for obtaining RPE precursor cells may employ any of the methods known in the art, such as iPSC induced differentiation of RPE precursor cells (shreatha R, wen YT, tsai RK. Effective Differentiation and Biological Characterization of Retinal Pigment Epithelium Derived from Human Induced Pluripotent Stem cells, curr Eye res.2020 sep;45 (9): 1155-1167. Doi: 10.1080/02713683.2020.1722180. Epub 2020 Feb 3. PMID: 31984806.), the purpose of the present application is to use RPE precursor cells obtained by the prior art, rather than to obtain RPE precursor cells themselves.
Example 2, stable RPE cells were obtained. The method for obtaining the stable performance RPE cell comprises the following steps of
(1) Obtaining an RPE precursor cell; the RPE precursor cells are RPE-like cells that exhibit compact monolayer paving stones; as shown in fig. 1.
(2) And (3) continuing to culture the RPE precursor cells by adopting a maturation promoting medium until the RPE cells which are cobblestone-like and have uniform melanin distribution are obtained, and deepening the melanin of the obtained RPE cells relative to the RPE precursor cells. As shown in fig. 2
The maturation-promoting medium comprises maturation-promoting small molecules selected from one or more of T3 or T4, EDN1 or EDN3 and RA in any molar ratio;
the dosage of T3 or T4 ranges from 20 to 500 nM;
EDN1 or EDN3 is used in an amount ranging from 10 to 200 and nM;
RA was used in an amount ranging from 0.2 to 2. Mu.M.
TABLE 1 selection of maturation-promoting Medium in this example
Basal medium and dosage Small molecule and dosage
iRPE-1 E6 Nicotinamide 25mM CHIR99021 5μM N/A (not added)
iRPE-T3-mid（iRPE-T3） E6；Nicotinamide 25mM CHIR99021 5μM T3 300 nM
iRPE-T3-min E6Nicotinamide 25mMCHIR99021 5μM T3 20 nM
iRPE-T3-max E6Nicotinamide 25mMCHIR99021 5μM T3 500 nM
iRPE-EDN3-mid（iRPE-EDN3） E6Nicotinamide 25mMCHIR99021 5μM EDN3 100 nM
iRPE-EDN3-min E6Nicotinamide 25mMCHIR99021 5μM EDN3 10 nM
iRPE-EDN3-max E6Nicotinamide 25mMCHIR99021 5μM EDN3 200 nM
iRPE-RA-mid（iRPE-RA） E6Nicotinamide 25mMCHIR99021 5μM RA 1 μM
iRPE-RA-min E6Nicotinamide 25mMCHIR99021 5μM RA 0.2 μM
iRPE-RA-max E6Nicotinamide 25mMCHIR99021 5μM RA 2 μM
iRPE-ALL-1 E6Nicotinamide 25mMCHIR99021 5μM T3 300 nMRA 1 μMEDN3 100nM
iRPE-ALL-2 E6Nicotinamide 50mMCHIR99021 1μM T3 300 nMRA 1 μMEDN3 100nM
iRPE-ALL-3 E6Nicotinamide 10mMCHIR99021 10μM T3 300 nMRA 1 μMEDN3 100nM
iKO-iRPE-ALL E6Nicotinamide 25mMCHIR99021 5μM T3 300 nMRA 1 μMEDN3 100nM
Among them, E5 (less insulin than E6) and E6 (medium in which FGF2 and TGF-. Beta.are reduced relative to E8) can be used as the basal medium E6. The two can be replaced with each other, and the obtained RPE cells have little influence.
Wherein, T3 and T4 can be interchanged, EDN3 and EDN1 can be interchanged, and the obtained RPE cells have little influence.
Example 3, flow cytometry detection. After RPE cells which are cobblestone-like and have even melanin distribution are obtained, cell digestion is carried out, cell suspension which is digested into single cells is washed for 1 time by DPBS, and 4 percent by volume of paraformaldehyde is respectively added for incubation for 10 minutes at room temperature; then DPBS is washed for 1 time, supernatant after centrifugation is added with Triton-X100 permeabilization containing 0.2% of mass-volume ratio for 10 minutes; then, DPBS was washed 1 time, and the supernatant after centrifugation was subjected to blocking treatment at room temperature for 30 minutes by adding DPBS to Bovine Serum Albumin (BSA) in a mass-volume ratio of 1%. After BSA was then centrifuged, and the MITF was blotted with BSA, the primary antibody was directly added without washing: murine monoclonal MITF antibody (diluted 1:100 with dilution) was incubated overnight at 4 ℃. Then PBS was washed 1 time, followed by addition of secondary antibody: FITC-labeled goat anti-mouse IgG antibody (diluted 1:1000 with diluent) was incubated for 1 hour at room temperature. After that, PBS was washed 1 time, and the supernatant was discarded and DPBS was added to perform loading analysis under a flow cytometer system.
As described, fRPE cells were used as a control (99.44%), and iRPE-1 was compared (no maturation-promoting agent, 99.59% results); iRPE-T3 (using T3 as maturation-promoting agent, result value 99.29%); iRPE-EDN3 (with EDN3 as maturation-promoting agent, result 99.53%); iRPE-RA (with RA as maturation-promoting agent, outcome value 99.58%); iRPE-ALL (using a mix of T3, EDN3, RA as maturation-promoting agent, result in a value of 99.63%).
Flow results show that the iRPE cells which promote maturation of the maturation agents are added to positively express the RPE cell specific marker protein; the MITF positive cell rate is greater than 99%, the purity of the mature iRPE cells added with the maturation-promoting agent is consistent with that of the fRPE cells and the mature iRPE cells without the maturation-promoting agent, and the purity of the RPE cells is not reduced by adding the maturation-promoting agent.
Example 4 reverse transcription qPCR assay. And extracting total RNA of each group of cells by using an RNA extraction kit (Nuo-uzan, china) and measuring OD, so that the OD 260/OD280 value of the extracted RNA of each group is ensured to be between 1.8 and 2.1, and the purity of the extracted RNA is ensured. The RNA was then used to reverse transcribe cDNA using reverse transcription kit (Northenzan, china), and the reaction system and reaction procedure were as described in the product instructions. The cDNA was used for RT-PCR, and the primer sequences are shown in Table 1. The reaction system was referred to SYBR kit (Bio, USA) instructions. The reaction was carried out for 5 minutes at 95℃after the instantaneous separation and was carried out for 40 cycles (94℃for 30 seconds; 59℃for 30 seconds; 72℃for 30 seconds). The reaction product was pipetted into 2. Mu.L and added to 3. Mu.L of SYBRGREEN MIX and mixed.
TABLE 2 primer sequences (F: left arm; R: right arm)
Primer(s) Sequence (5 'to 3')
GAPDH-F SEQ ID No.1：GGAGCGAGATCCCTCCAAAAT
GAPDH-R SEQ ID No.2：GGCTGTTGTCATACTTCTCATGG
RPE65-F SEQ ID No.3：TTGGATCTGAGCCATTTTACCAC
RPE65-R SEQ ID No.4：GTCAGTAACCTCTACTCCTCGAA
MITF-F SEQ ID No.5：TGCCCAGGCATGAACACAC
MITF-R SEQ ID No.6：TGGGAAAAATACACGCTGTGAG
RPE65, MITF detected the expression level of RPE cells, GAPDH as an internal reference gene (Normalized to GAPDH) to correct and normalize the expression of the gene of interest. The length of the product sequence corresponding to the primer of the GAPDH gene is 197bp; the length of the product sequence corresponding to the primer of the RPE65 gene is 236bp; the length of the product sequence corresponding to the primer of the MITF gene is 276bp.
RT-PCR results showed that addition of irPE cells promoting maturation of maturation agents up-regulated specific RPE cell marker genes compared to irPE cells not promoting maturation of maturation agents: RPE65 (shown in fig. 5), MITF (fig. 4); at the same time, the specific RPE cell marker gene is also up-regulated relative to an fRPE cell: RPE65 (shown in fig. 5), MITF (fig. 4). Wherein RPE65 expression plays a key role in the visual cycle in the late stages of RPE cell development, and MITF is an important regulator of melanogenesis in RPE cells.
The conclusion shows that the addition of small molecules is more beneficial to the maturation of the iRPE cells and also further promotes the clinical transformation application of the iRPE cells.
Example 5: phagocytosis assay. Each experimental group was carried out according to the method of the prior art, according to 1×10 6 Individual cells/well were seeded into 12-well plates and incubated at 37 ℃ for 2 days. After 2 days Fluorescent Particles (fluorescent particles) were added and incubated for 8 hours at 4 ℃/37 ℃. The Trypan Blue was added for fluorescence quenching. The cells were then washed 3 times with DPBS, resuspended with DPBS, and analyzed under a flow cytometer system (Parinot C, rieu Q, chatagon J, finnesmann SC, nandrot EF. Larges-scale purification of porcine or bovine photoreceptor outer segments for phagocytosis assays on retinal pigment epithelial cells, J Vis exp.2014 Dec 12; (94): 52100. Doi: 10.3791/52100. PMID: 25548986; PMCID: PMC 4396958.).
Another important function for RPE cells is phagocytizing the outer segment of photoreceptor cell shedding. To examine phagocytic function of the differentiated RPE cells, fluorescent Particles (fluorescent particles) were used together for post-cell incubation tracking.
The results show that Fluorescent Particles is more intuitively seen by the flow to be engulfed into cells by the iRPE cells and the fRPE cells (fig. 6), and that the engulfing capacity of the iRPE cells, which add maturation promoting agents to mature, is substantially consistent, even slightly higher than the engulfing capacity of the fRPE cells, in particular: fRPE cells, 95.67%; iRPE-EDN3, 97.55%; iRPE-T3, 98.51%; iRPE-RA,97.75%; iRPE-ALL,98.35%.
The small molecule-free iRPE cells have less phagocytic capacity than fRPE cells, and are specifically: fRPE cells, 95.67%; iRPE-1, 76.66%.
Example 6: ELISA assay measures VEGF secretion. As shown in fig. 7, the results show that the mature promoting iRPE cells have similar VEGF secretion compared to the fRPE cells, but the iRPE cells without added maturation promoting agent have significantly weaker VEGF secretion than the iRPE cells obtained with the fRPE cells and maturation promoting agent.
Based on the above results, and in the prior art, it is another object of the present application to provide an RPE cell preparation comprising one of the aforementioned pluripotent stem cell-derived RPE cells.
It is another object of the present application to provide a pharmaceutical composition for ophthalmic use comprising one of the aforementioned pluripotent stem cell-derived RPE cells as an active ingredient.
It is another object of the present application to provide an agent for evaluating toxicity or efficacy of a test substance, comprising one of the aforementioned pluripotent stem cell-derived RPE cells.
It is another object of the present application to provide a method for evaluating the toxicity or efficacy of a test substance comprising contacting said substance with one of the aforementioned pluripotent stem cell-derived RPE cells and determining the effect of said substance on said cells.

Claims (9)

1. A method for obtaining stable RPE cells is characterized by comprising the following steps
Obtaining an RPE precursor cell; the RPE precursor cells are RPE-like cells that exhibit compact monolayer paving stones;
continuously culturing the RPE precursor cells by adopting a maturation promoting medium until the RPE cells which are cobblestone-like and have even melanin distribution are obtained, and deepening the melanin of the obtained RPE cells relative to the RPE precursor cells;
the maturation-promoting medium comprises maturation-promoting small molecules, wherein the maturation-promoting small molecules are selected from one or a plurality of thyroid hormones, EDN1, EDN3 and RA in any molar ratio; the dosage of thyroid hormone ranges from 20 nM to 500nM, EDN1 ranges from 10 nM to 200nM, EDN3 ranges from 10 nM to 200nM, and RA ranges from 0.2. Mu.M to 2. Mu.M.
2. The method of claim 1, wherein the RPE precursor cells are ESC, iPSC or universal iPSC HLA-KO Differentiation is carried out to obtain;
the universal iPSC HLA-KO Is meridian passageiPSC with immune-immune characteristics, which specifically reduces HLA expression by the transgenic editing.
3. The method of claim 1, wherein the maturation-promoting medium further comprises an additive; the additive is one or two of CHIR99021 and Nicotinamide in any molar ratio; wherein the dosage of CHIR99021 is 1-10 μm, and the dosage of Nicotinamide is 10-50mM.
4. The method of claim 1, wherein the thyroid hormone is one of T3 and T4 or two of them in any molar ratio.
5. The method of claim 1, wherein the maturation-promoting medium further comprises a basal medium, wherein the basal medium is E5 or E6.
6. An RPE cell preparation comprising an RPE cell obtained by the method of any one of claims 1-5.
7. A pharmaceutical composition suitable for ophthalmic use, characterized in that it comprises as active ingredient RPE cells obtained by the method according to any one of claims 1 to 5.
8. An agent for evaluating toxicity or efficacy of a test substance, comprising RPE cells obtained by the method of any one of claims 1-5.
9. A method for evaluating the toxicity or efficacy of a test substance, comprising contacting an RPE cell obtained using the method of any one of claims 1-5 with said substance and determining the effect of said substance on said cell.
CN202311752081.6A 2023-12-19 2023-12-19 Method, preparation, pharmaceutical composition and reagent for obtaining stable RPE cells Withdrawn CN117467607A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311752081.6A CN117467607A (en) 2023-12-19 2023-12-19 Method, preparation, pharmaceutical composition and reagent for obtaining stable RPE cells

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311752081.6A CN117467607A (en) 2023-12-19 2023-12-19 Method, preparation, pharmaceutical composition and reagent for obtaining stable RPE cells

Publications (1)

Publication Number Publication Date
CN117467607A true CN117467607A (en) 2024-01-30

Family

ID=89634997

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311752081.6A Withdrawn CN117467607A (en) 2023-12-19 2023-12-19 Method, preparation, pharmaceutical composition and reagent for obtaining stable RPE cells

Country Status (1)

Country Link
CN (1) CN117467607A (en)

Similar Documents

Publication Publication Date Title
JP6923134B2 (en) Mesenchymal stem cell-derived exosomes
KR101849329B1 (en) Improved methods of producing rpe cells and compositions of rpe cells
Homma et al. Induction of epithelial progenitors in vitro from mouse embryonic stem cells and application for reconstruction of damaged cornea in mice
US20180231526A1 (en) Human Trophoblast Stem Cells and Uses Thereof
JP2022125160A (en) Methods of treating retinal diseases
AU2021204404B2 (en) Phenotype profile of human retinal progenitor cells
JP2007528703A (en) Repair and regeneration of ocular tissue using postpartum-derived cells
JP2009500297A (en) Cell therapy for ocular degeneration
US20030125293A1 (en) Adipose tissue-derived stromal cells for the repair of corneal and intra-orbital defects and uses thereof
US8323966B2 (en) Differentiated pluripotent stem cell progeny depleted of extraneous phenotypes
Gamm et al. The role of FGF9 in the production of neural retina and RPE in a pluripotent stem cell model of early human retinal development
WO2018220489A2 (en) Methods of obtaining cells from human postpartum umbilical cord arterial tissue
WO2020223226A1 (en) Compositions and methods for the treatment of retinal degeneration
US20230042830A1 (en) Compositions and methods for generation of retinal ganglion cells from inducible pluripotent stem cells for the treatment of progressive optic neuropathies, including glaucoma
AU2022201847A1 (en) Improved methods of producing RPE cells and compositions of RPE cells
KR20130048468A (en) The method for inducing differentiation from cystic structure to retinal pigment epithelial cells
WO2012009830A1 (en) Methods for producing nerve cells from stem cells, nerve cells and uses thereof
Akrami et al. Retinal pigment epithelium culture; a potential source of retinal stem cells
CN117467607A (en) Method, preparation, pharmaceutical composition and reagent for obtaining stable RPE cells
CN113015537A (en) Compositions and methods for proliferating insulin-producing islet cells and therapeutic uses thereof
CN117384846B (en) RPE cells derived from pluripotent stem cells, preparation, pharmaceutical composition, reagent, method and kit
KR102038503B1 (en) Method for differentiation of hepatocyte
Liu et al. All-trans retinoic acid in combination with collagen IV induces the differentiation of mouse embryonic stem cells into smooth muscle cells
CN117417891A (en) Spherical preparation of retinal pigment epithelial cells
Katayama et al. PAX6-positive microglia evolve locally in hiPSC-derived ocular organoids

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
WW01 Invention patent application withdrawn after publication
WW01 Invention patent application withdrawn after publication

Application publication date: 20240130