WO2008068621A2 - Produit de combinaison - Google Patents

Produit de combinaison Download PDF

Info

Publication number
WO2008068621A2
WO2008068621A2 PCT/IB2007/004299 IB2007004299W WO2008068621A2 WO 2008068621 A2 WO2008068621 A2 WO 2008068621A2 IB 2007004299 W IB2007004299 W IB 2007004299W WO 2008068621 A2 WO2008068621 A2 WO 2008068621A2
Authority
WO
WIPO (PCT)
Prior art keywords
ifnγ
ido
inhibitor
tumor
ngr
Prior art date
Application number
PCT/IB2007/004299
Other languages
English (en)
Other versions
WO2008068621A3 (fr
Inventor
Angelo Corti
Original Assignee
Molmed Spa
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Molmed Spa filed Critical Molmed Spa
Publication of WO2008068621A2 publication Critical patent/WO2008068621A2/fr
Publication of WO2008068621A3 publication Critical patent/WO2008068621A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404—Indoles, e.g. pindolol
    • A61K31/405—Indole-alkanecarboxylic acids; Derivatives thereof, e.g. tryptophan, indomethacin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/21—Interferons [IFN]
    • A61K38/217—IFN-gamma
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Definitions

  • the present invention relates to a pharmaceutical combination suitable for the treatment of cancer.
  • IFN ⁇ interferon- ⁇
  • IFN ⁇ can also induce antiproliferative and pro-apoptotic effects on many tumor cell types (Ikeda, et al., Cytokine Growth Factor Rev 2002,13:95-109) and can inhibit tumor angiogenesis (Qin et al., Immunity 2000,12:677-86; Hayakawa, et al., Blood 2002,100:1728-33). As a consequence of these effects IFN ⁇ can activate inflammatory/immune responses against tumors and inhibit tumor growth (Blankenstein et al., Curr Opin Immunol 2003,15:148-54).
  • CDl 3 is a trans-membrane glycoprotein of 150 kDa highly conserved in various species. It is expressed on normal cells as well as in myeloid tumor lines, in the angiogenic endothelium and is some epithelia.
  • the CD 13 receptor is usually identified as "NGR" receptor, in that its peptide ligands share the amino acidic "NGR" motif.
  • vascular targeting has been achieved by fusing the C-terminus of murine IFN ⁇ with the N-terminus of an peptide containing the NGR motif, Gly-Cys-Asn-Gly-Arg-Cys (GCNGRC) (Pasqualini et al., Cancer Res 2000,60:722-7; Curnis, et al., Cancer Research 2002;62:867-74).
  • GCNGRC Gly-Cys-Asn-Gly-Arg-Cys
  • IDO catalyzes the first and rate-limiting step in the kinurenine pathway of the tryptophan catabolism (Mellor, Munn et al., 1999, Oct;20(10):469-73). Expression of this enzyme in the placenta plays a critical role in preventing rejection of allogenic foetuses, likely by inhibiting T-cell proliferation, which are extremely sensitive to extracellular tryptophan shortage (Munn et al., Science 1998, 281:1191-1193). Recent findings that IDO is overexpressed in most rumors and that it can play a crucial role in peripheral tolerance suggest that IDO could be actually exploited by tumors to facilitate immune escape.
  • the present invention seeks to provide a new combination of pharmaceutical agents that is particularly suitable for the treatment of cancer. More specifically, the invention centres on the surprising and unexpected effects associated with using certain therapeutic agents in combination.
  • IDO indoleamine 2,3- dioxygenase
  • a pharmaceutical product comprising, in combination, an indoleamine 2,3-dioxygenase (IDO) inhibitor and (ii) a conjugation product of IFN ⁇ and a Targeting Moiety (TM) or a polynucleotide encoding therefor.
  • IDO indoleamine 2,3-dioxygenase
  • TM Targeting Moiety
  • polynucleotide encoding therefor it is meant a polynucleotide encoding for a conjugation product of IFN ⁇ and a TM.
  • the pharmaceutical product comprises, in combination, an indoleamine 2,3-dioxygenase (IDO) inhibitor and (ii) a conjugation product of IFN ⁇ and a Targeting Moiety (TM).
  • IDO indoleamine 2,3-dioxygenase
  • TM Targeting Moiety
  • the combination has a synergistic effect, i. e. the combination is synergistic.
  • the combination of an IDO inhibitor and the IFN ⁇ conjugation product has an enhanced effect as compared to either drug administered alone.
  • the surprising nature of this observation is in contrast to that expected on the basis of the prior art.
  • the pharmaceutical product may be in the form of a pharmaceutical composition comprising (i) an indoleamine 2,3-dioxygenase (IDO) inhibitor and (ii) a conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor.
  • IDO indoleamine 2,3-dioxygenase
  • the pharmaceutical product may be in the form of liposomes.
  • the pharmaceutical product further comprises a pharmaceutically acceptable carrier, diluent or excipient.
  • a pharmaceutical product comprising (i) an indoleamine 2,3-dioxygenase (IDO) inhibitor and (ii) a conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor, as a combined preparation for simultaneous, sequential or separate use in therapy.
  • IDO indoleamine 2,3-dioxygenase
  • a conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor as a combined preparation for simultaneous, sequential or separate use in therapy.
  • a pharmaceutical product of the present invention for use in the treatment of cancer.
  • the pharmaceutical product is in the form of a kit of parts.
  • the present invention provides a kit of parts comprising (i) indoleamine 2,3-dioxygenase (IDO) inhibitor and (ii) a conjugation product of IFN ⁇ and a Targeting Moiety (TM) or a polynucleotide encoding therefor.
  • IDO indoleamine 2,3-dioxygenase
  • TM Targeting Moiety
  • a method of treating cancer comprising administering to a subject, simultaneously, sequentially or separately, an indoleamine 2,3-dioxygenase (IDO) inhibitor and a conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor.
  • IDO indoleamine 2,3-dioxygenase
  • the IDO inhibitor may be administered to a subject prior to, sequentially or separately to administering the conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor.
  • the conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor may be administered to a subject prior to the IDO inhibitor.
  • the IDO inhibitor may be administered to a subject prior to the conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor.
  • the IDO inhibitor and the conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor may each be administered in a therapeutically effective amount with respect to the individual components, or a subtherapeutic amount with respect to the individual components.
  • a method of treating a subject with a cancer including administering to the subject an inhibitor of IDO in an amount effective to reverse IDO-mediated immunosuppression, and administering a conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor wherein the administration of the inhibitor of indoleamine-2,3- dioxygenase and the conjugation product demonstrate therapeutic synergy.
  • a conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor in the preparation of a medicament for the treatment of cancer, wherein said treatment comprises administering to a subject simultaneously, sequentially or separately an IDO inhibitor and a conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor.
  • an indoleamine 2,3-dioxygenase (IDO) inhibitor in the preparation of a medicament for the treatment of cancer, wherein said treatment comprises administering to a subject - • simultaneously, sequentially or separately a conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor and an IDO inhibitor.
  • IDO indoleamine 2,3-dioxygenase
  • an indoleamine 2,3-dioxygenase (IDO) inhibitor and a conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor in the preparation of a medicament for treating cancer.
  • an indoleamine 2,3-dioxygenase (IDO) inhibitor in the preparation of a medicament for the treatment of a proliferative disorder, wherein said medicament is for use in combination therapy with a conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor.
  • IDO indoleamine 2,3-dioxygenase
  • a conjugation product of IFN ⁇ and a TM or a polynucleotide encoding therefor in the preparation of a medicament for the treatment of cancer, wherein said medicament is for use in combination therapy with an indoleamine 2,3-dioxygenase (IDO) inhibitor.
  • IDO indoleamine 2,3-dioxygenase
  • the IDO inhibitor and the conjugation product of IFN ⁇ and a TM are administered, in combination, preferably more than once during the treatment of a subject.
  • the number of repeat dosages corresponds to the number required to provide the optimum therapeutic effect for a particular subject.
  • the IDO inhibitor and the conjugation product of IFN ⁇ and a TM may be administered in combination (simultaneously or sequentially) or separately, at least 2, 4, 6, 8, 10 or 20 times over the treatment regimen, preferably until tumor progression.
  • Each repeat dose may be administered at, for example, intervals of between 12 hours to 21 days, 12 hours to 10 days, 12 hours to 7 days, 12 hours to 4 days, 12 hours to 3 days, 1 hour to 96 hours, 1 hour to 72 hours, 1 hour to 48 hours, 1 hour to 24 hours, 1 hour to 12 hours, 12 hours to 96 hours, 12 hours to 72 hours, 12 hours to 48 hours and 12 hours to 24 hours.
  • IDO inhibitors include without limitation 1-methyl-trypto ⁇ han (IMT), ⁇ - (3-benzofuranyl)-alanine, ⁇ -(3-benzo(b)thienyl)-alanine), 6-nitro-tryptophan, 6- fluoro-tryptophan, 4-methyl-tryptophan, 5 -methyl tryptophan, 6-methyl-tryptophan,
  • the IDO inhibitor is selected from 1-methyl-tryptophan, ⁇ -(3- benzofuranyl)-alanine, 6-nitro-L-tryptophan, 3-Amino-naphtoic acid and ⁇ -[3- benzo(b)thienyl] -alanine or a derivative or prodrug thereof.
  • the IDO inhibitor is selected from L- 1-methyl-tryptophan, L - ⁇ - (3-benzofuranyl)-alanine, L -6-nitro-L-tryptophan, L -3-Amino-naphtoic acid and L - ⁇ - [3-benzo(b)thienyl]-alanine, D- 1-methyl-tryptophan, o- ⁇ -(3-benzoruranyl)-alanine, D- 6-nitro-L-tryptophan, o-3-Amino-naphtoic acid and o- ⁇ - [3 -benzo(b)thienyl] -alanine or a derivative or prodrug thereof.
  • the TM is a tumor targeting moiety (TTM).
  • the TM is a tumor vasculature targeting moiety (TVTM).
  • TVTM tumor vasculature targeting moiety
  • the target of the TM can be expressed either on the endothelial cells surface of tumor vessels or in the extracellular matrix in close contact with or in the vicinity of endothelial cells.
  • the TVTM is a binding partner of a tumor vasculature receptor, marker or other extracellular component.
  • the TTM is a binding partner of a tumor receptor, marker or other extracellular component.
  • the TM is an antibody or ligand, or a fragment thereof.
  • the TM is targeted to VEGFR, ICAM 1, 2 or 3, PECAM-I,
  • the TM is a peptide containing NGR or DGR or isoDGR or RGD motif.
  • the TM is a peptide containing the NGR motif.
  • the pharmaceutical product and methods and uses described herein preferably comprise/use the combination of (i) an IDO inhibitor and (ii) a conjugation product of IFN ⁇ and a peptide containing the NGR motif.
  • the peptide containing the NGR motif comprises the sequence XNGRX' wherein X is selected form the group consisting of L, V, A, C, G, Y, P, H, K, Q and I and X' is selected from the group consisting of C, G, H, L, E, T, Q, R, S and P.
  • the peptide containing the NGR motif may comprise, for example, up to 350, up to 100, up to 50, up to 25 or up to 15 amino acids.
  • the peptide containing the NGR motif comprises a sequence selected from CNGRCVSGCAGRC, NGRAHA, GNGRG, CVLNGRMEC, CNGRC, CNGRCG GCNGRC, LNGRE, YNGRT, LQCICTGNGRGEWKCE,
  • LQCISTGNGRGEWKCE LQCISTGNGRGEWKCE, CICTGNGRGEWKC, CISTGNGRGEWKC, MRCTCVGNGRGEWTCY, MRCTSVGNGRGEWTCY CTCVGNGRGEWTC and CTSVGNGRGEWTC.
  • the peptide containing the NGR motif consists of a sequence selected from CNGRCVSGCAGRC, NGRAHA, GNGRG, CVLNGRMEC, CNGRC, CNGRCG GCNGRC, LNGRE, YNGRT, LQCICTGNGRGEWKCE, LQCISTGNGRGEWKCE, CICTGNGRGEWKC, CISTGNGRGEWKC, MRCTCVGNGRGEWTCY, MRCTSVGNGRGEWTCY CTCVGNGRGEWTC and CTSVGNGRGEWTC.
  • the peptide containing the NGR motif comprises a sequence selected from cycloCVLNGRMEC, linear CNGRC, cyclic CNGRC, linear GCNGRC, linear CNGRCG, cyclic GCNGRC and cyclic CNGRCG.
  • the peptide containing the NGR motif consists of a sequence selected from cycloCVLNGRMEC, linear CNGRC, cyclic CNGRC, linear GCNGRC, linear CNGRCG, cyclic GCNGRC and cyclic CNGRCG.
  • the conjugation product is a conjugation product of IFN ⁇ and a CNGRCG peptide wherein the N-terminus of IFN ⁇ is linked to the C -terminus domain of CNGRCG.
  • the conjugation product is a conjugation product of IFN ⁇ and a GCNGRC peptide wherein the C-terminus of IFN ⁇ is linked to the N-terminus domain of GCNGRC .
  • the IFN ⁇ used in the present invention may be derivatized with polyethylene glycol or an acyl residue. Furthermore, the IFN ⁇ may be further conjugated with a compound selected from the group consisting of an antibody, an antibody fragment, and biotin, wherein said antibody or fragment thereof is directed to a compound selected from the group consisting of a tumoral antigen, a tumoral angiogenic marker or a component of the extracellular matrix.
  • the IFN ⁇ used in the present invention may be, but not limited to, murine or human IFN ⁇ .
  • the IFN ⁇ is human IFN ⁇ .
  • Figure 1 shows the effect of 1-methyl-tryptophan (IMT) on the anti-tumor activity of melphalan in the RMA lymphoma model.
  • Animals (5 mice/group) bearing RMA- tumors were treated at the indicated day (arrows) with melphalan (50 ⁇ g) in physiological solution or with physiological solution alone (control) (i.p.).
  • One group of mice were given IMT (5 mg/ml in the drinking water) as indicated.
  • Figure 2 shows the effect of IMT on single and repeated treatments with IFN ⁇ -NGR of RMA lymphoma bearing mice.
  • Animals (5 mice/group) bearing RMA-tumors were treated at the indicated days (arrows) with IFN ⁇ -NGR (0.1 ng) in physiological solution containing 0.1 mg/ml human serum albumin (HAS) or with HSA solution alone (control) (i.p.).
  • HAS human serum albumin
  • mice were given IMT (5 mg/ml in the drinking water), as indicated in the legend, starting from day 10 to the end of the experiment. Tumor volume after treatment are reported. While one treatment with IFN ⁇ -NGR (0.1 ng) induces a delay in tumor growth (Fig.2 panel A) repeated treatments induced no antitumor effects (panel B).
  • Figure 3 shows the effect of IMT on repeated treatments with IFN ⁇ -NGR of B 16Fl melanoma bearing mice.
  • Animals (5 mice/group) bearing B 16Fl -tumors were treated at the indicated days (arrows) with IFN ⁇ -NGR (1 ng) in physiological solution containing 0.1 mg/ml HSA or with HSA solution alone (control) (i.p.).
  • Mice were given IMT (5 mg/ml in the drinking water), as indicated in the legend, starting from day 6 to the end of the experiment. Tumor volume after treatment are reported. While repeated treatments with IFN ⁇ -NGR induced no anti-tumor effects or even promoted tumor growth (Fig.
  • Figure 4 shows the effect of IMT on repeated treatments with NGR-TNF of RMA lymphoma bearing mice.
  • Animals (5 mice/group) bearing RMA-tumors were treated at the indicated days (arrows) with NGR-TNF (0.1 ng) in physiological solution containing 0.1 mg/ml HSA or with HSA solution alone (control) (i.p.).
  • Mice were given IMT (5 mg/ml in the drinking water), as indicated in the legend, starting from day 10 to the end of the experiment. Tumor volume after treatment are reported. As shown, IMT could not significantly modify the anti-tumor activity of NGR-TNF.
  • Figure 5 shows the effect of repeated treatments with IFN ⁇ -NGR on IDO activity in RMA lymphoma tumors.
  • Tumor-bearing mice were treated with 100 pg of IFN ⁇ -NGR for five times, every day, and IDO activity was analysed in tumors 2 h after the last treatment.
  • IDO activity was analysed in tumors 2 h after the last treatment.
  • a significant increase of IDO activity was observed supporting the hypothesis that IDO activity is increased after repeated IFN ⁇ -NGR administrations.
  • Figure 6 shows the effect of IFN ⁇ -NGR and IMT, in combination, in nu/nu RMA- tumor bearing mice. Since tumors grow faster in nu/nu mice compared to immunocompetent C57BL6 mice, treatment was started at day 8 instead of day 10. No significant response was observed even after repeated treatment with IFN ⁇ -NGR and IMT, either alone or in combination. This supports the concept that T cells play a major role in the anti-tumor activity observed in immunocompetent mice with this drug combination.
  • Figure 7 shows representative examples of murine and human IFN ⁇ sequences.
  • Figure 8 shows a IFN ⁇ (human)-NGR conjugate sequence.
  • Figure 9 shows an IFN ⁇ (murine)-NGR conjugate sequence.
  • Figure 10 shows a NGR-IFN ⁇ (human) conjugate sequence.
  • Figure 11 shows a murine NGR-IFN ⁇ (murine) conjugate sequence.
  • the pharmaceutical product of the present invention may, for example, be a pharmaceutical composition comprising an IDO inhibitor, and a conjugate product of
  • IFN ⁇ and a targeting moiety, or polynucleotide encoding therefor, in admixture.
  • the pharmaceutical product may, for example, be a kit comprising a preparation of an IDO inhibitor, and an IFN ⁇ conjugate, or polynucleotide encoding therefor, and, optionally, instructions for the simultaneous, sequential or separate administration of the preparations to a patient in need thereof.
  • the term "combination therapy” refers to therapy in which the IDO inhibitor, and the IFN ⁇ conjugate, or polynucleotide encoding therefor, are administered, if not simultaneously, then sequentially within a timeframe that they both are available to act therapeutically within the same time-frame.
  • one aspect of the invention relates to a pharmaceutical product comprising an IDO inhibitor and an IFN ⁇ conjugate as a combined preparation for simultaneous, sequential or separate use in therapy.
  • the IDO inhibitor and the IFN ⁇ conjugate may be administered simultaneously, in combination, sequentially or separately (as part of a dosing regime).
  • “simultaneously” is used to mean that the two agents are administered concurrently, whereas the term “in combination” is used to mean they are administered, if not simultaneously, then “sequentially” within a time-frame that they both are available to act therapeutically within the same time-frame.
  • administration “sequentially” may permit one agent to be administered within 5 minutes, 10 minutes or a matter of hours after the other provided the circulatory half- life of the first administered agent is such that they are both concurrently present in therapeutically effective amounts.
  • the time delay between administration of the components will vary depending on the exact nature of the components, the interaction therebetween, and their respective half-lives.
  • IFN ⁇ interferon- ⁇
  • T-lymphocytes and natural killer cells can promote anti-tumor responses (Curnis et al., Cancer Res. 2005, 65: (7) 2906-13).
  • IFN ⁇ can induce antiproliferative and pro-apoptotic effects on many tumor cell types, can inhibit tumor angiogenesis and activate natural killer cells and macrophages to kill a variety of tumor cell targets.
  • IFN ⁇ is also an important regulator of CD4 + T helper cells, is the major physiological macrophage-activating factor and can augment the expression of MHC-I and II on cancer and endothelial cells.
  • IFN ⁇ can induce cytokine and chemokine secretion, including IP-IO (IFN-inducible Protein 10), an angiostatic protein and a chemoattractant factor for lymphocytes and monocytes.
  • IP-IO IFN-inducible Protein 10
  • angiostatic protein angiostatic protein
  • monocytes chemoattractant factor for lymphocytes and monocytes.
  • IFN ⁇ tumor necrosis factor- ⁇
  • TNF tumor necrosis factor- ⁇
  • IFN ⁇ exists as a homodimer of two noncovalently bound polypeptide subunits.
  • the primary sequence of wildtype human IFN ⁇ was reported by Gray et al. Nature 298:859-863, 1982; Taya et al., (1982) EMBO J. 1:953-958; Devos et al., (1982) Nucleic Acids Res. 10:2487-2501; and Rinderknecht et al., J. Biol. Chem. 259:6790-6797, 1984 and in EP 77670, EP 89676 and EP 110044.
  • the 3D structure of huIFNG was reported by Ealick et al., (1991) Science 252:698-702.
  • Figure 7 shows representative examples of murine and human IFN ⁇ sequences.
  • the IFN ⁇ used in the present invention includes fragments, variants and derivatives of the full length IFN ⁇ cytokine, which retains IFN ⁇ function, preferably having at least 25 to 50 % of wild type IFN ⁇ function.
  • the pharmaceutical product of the present invention comprises, in addition to an IDO inhibitor, a targeting moiety (TM) linked to IFN ⁇ .
  • the conjugate may be a molecule comprising at least one targeting moiety linked to IFN ⁇ formed through genetic fusion or chemical coupling.
  • the targeting moiety is a polypeptide.
  • conjugates include fusion proteins in which the targeting moiety is linked to IFN ⁇ via their polypeptide backbones through genetic expression of a DNA molecule encoding these proteins, directly synthesised proteins and coupled proteins in which pre-formed sequences are associated by a cross-linking agent.
  • the term is also used herein to include associations, such as aggregates, of the cytokine with the targeting moiety.
  • the targeting moiety can be coupled directly to the IFN ⁇ or indirectly through a spacer, which can be a single amino acid (e.g., G (glycine)), an amino acid sequence or an organic residue, such as 6-aminocapryl-N-hydroxysuccinimide.
  • a spacer which can be a single amino acid (e.g., G (glycine)), an amino acid sequence or an organic residue, such as 6-aminocapryl-N-hydroxysuccinimide.
  • the targeting moiety is linked to the IFN ⁇ N-terminus or C- terminus.
  • the peptide targeting moiety can be linked to amino acid residues which are amido- or carboxylic-bond acceptors, which may be naturally occurring on the molecule or artificially inserted using genetic engineering techniques.
  • targeted delivery of IFN ⁇ can be achieved with a targeting moiety comprising a peptide containing the NGR motif such as a modified ligand of aminopeptidase-N receptor (CD 13).
  • a targeting moiety comprising a peptide containing the NGR motif
  • CD 13 modified ligand of aminopeptidase-N receptor
  • CD 13 is a trans-membrane glycoprotein of 150 kDa highly conserved in various species. It is expressed on normal cells as well as in myeloid tumor lines, in the angiogenic endothelium and is some epithelia. CD 13 receptor is usually identified as "NGR” receptor, in that its peptide ligands share the amino acidic "NGR" motif.
  • a pharmaceutical product comprising, in combination, (i) an indoleamine 2,3-dioxygenase (IDO) inhibitor and (ii) a conjugation product of IFN ⁇ and a peptide containing the NGR motif.
  • IDO indoleamine 2,3-dioxygenase
  • the pharmacokinetic of the conjugates used in the invention can be improved by preparing polyethylene glycol derivatives, which extend the plasmatic half-life of the cytokines themselves.
  • FIG. 8 to 11 shows representative examples of murine and human IFN ⁇ conjugate sequences.
  • the therapeutic index of IFN ⁇ can be increased by homing or targeting the cytokine, in particular by homing or targeting the cytokine to tumor vessels.
  • the present invention encompasses targeting to tumor cells directly as well as to its vasculature. Any convenient tumor or tumor vasculature, particular endothelial cell, targeting moiety may be used in the conjugate of the present invention. Many such targeting moieties are known and these and any which subsequently become available are encompassed within the scope of the present invention.
  • the targeting moiety is a binding partner, such as a ligand, of a receptor expressed by a tumor cell, or a binding partner, such as an antibody, to a marker or a component of the extracellular matrix associated with tumor cells. More particularly the targeting moiety is binding partner, such as a ligand of, a receptor expressed by tumor-associated vessels, or a binding partner, such as an antibody, to an endothelial marker or a component of the extracellular matrix associated with angiogenic vessels.
  • binding partner is used here in its broadest sense and includes both natural and synthetic binding domains, including ligand and antibodies or binding fragments thereof.
  • said binding partner can be an antibody or a fragment thereof such as Fab, Fv, single-chain Fv, a peptide or a peptido-mimetic, namely a peptido-like molecule capable of binding to the receptor, marker of extracellular component of the cell.
  • CD 13 aminopeptidase-N receptor
  • targeted delivery of IFN ⁇ can be achieved with a targeting moiety comprising a peptide containing the NGR motif.
  • a targeting moiety comprising a peptide containing the NGR motif.
  • the NGR motif comprises a turn involving the G and R residues.
  • the structure- activity relationship of linear and cyclic peptides containing the NGR motif and their ability to target tumors is discussed in Colombo et al., J. Biol. Chem., 2002, 49, 47891-47897.
  • the Experiments carried out in animal models showed that both GNGRG and CNGRC can target cytokines to tumors.
  • Molecular dynamic simulation of cyclic CNGRC showed the presence of a bend geometry involving residues GIy 3 - Arg 4 , stabilised by the formation of a disulphide bridge.
  • TNFRSF TNF Receptor Superfamily
  • molecules in the TNFRSF are all type I (N-terminus extracellular) transmembrane glycoproteins that contain one to six ligand-binding, 40 aa residue cysteine-rich motifs in their extracellular domain.
  • functional TNFRSF members are usually trimeric or multimeric complexes that are stabilised by intracysteine disulfide bonds.
  • TNFRSF members exist in both membrane-bound and soluble forms.
  • CD40 is a 50 kDa, 277 aa residue transmembrane glycoprotein most often associated with B cell proliferation and differentiation. Expressed on a variety of cell types, human CD40 cDNA encodes a 20 aa residue signal sequence, a 173 aa residue extracellular region, a ll aa residue transmembrane segment, and a 62 aa residue cytoplasmic domain. There are four cysteine-rich motifs in the extracellular region that are accompanied by a juxtamembrane sequence rich in serines and threonines. Cells known to express CD40 include endothelial cells.
  • TNFRI/p55/CD120a TNFRI is a 55 kDa, 455 aa residue transmembrane glycoprotein that is apparently expressed by virtually all nucleated mammalian cells. The molecule has a 190 aa residue extracellular region, a 25 aa residue transmembrane segment, and a 220 aa residue cytoplasmic domain. Both TNF- ⁇ and TNF- ⁇ bind to TNFRI. Among the numerous cells known to express TNFRI are endothelial cells.
  • TNFRII/p75/CD120b Human TNFRII is a 75 kDa, 461 aa residue transmembrane glycoprotein originally isolated from a human lung fibroblast library.
  • This receptor consists of a 240 aa residue extracellular region, a 27 aa residue transmembrane segment and a 173 aa residue cytoplasmic domain. Soluble forms of TNFRII have been identified, resulting apparently from proteolytic cleavage by a metalloproteinase termed TRRE (TNF-Receptor Releasing Enzyme). The shedding process appears to be independent of that for soluble TNFRI.
  • TRRE TNF-Receptor Releasing Enzyme
  • CD134L/OX40L OX40, the receptor for OX40L, is a T cell activation marker with limited expression that seems to promote the survival (and perhaps prolong the immune response) of CD4 + T cells at sites of inflammation. OX40L also shows limited expression. Currently only activated CD4 + , CD8 + T cells, B cells, and vascular endothelial cells have been reported to express this factor.
  • the human ligand is a 32 kDa, 183 aa residue glycosylated polypeptide that consists of a 21 aa residue cytoplasmic domain, a 23 aa residue transmembrane segment, and a 139 aa residue extracellular region.
  • VEGF receptor 1 VEGF receptor 1
  • VEGF R2 also known as KDR or FIk-I
  • VEGF R3 also known as Flt-4
  • Endothelial cells also express additional VEGF receptors, Neuropilin-1 and Neuropilin-2.
  • VEGF-A binds to VEGF Rl and VEGF R2 and to Neuropilin-1 and Neuropilin-2.
  • PlGF and VEGF-B bind VEGF Rl and Neuropilin-1.
  • VEGF-C and -D bind VEGF R3 and VEGF R2. HIV-tat and peptides derived therefrom have also been found to target the VEGFR.
  • PDGF receptors are expressed in the stromal compartment in most common solid tumors. Inhibition of stromally expressed PDGF receptors in a rat colon carcinoma model reduces the tumor interstitial fluid pressure and increases tumor transcapillary transport.
  • PSMA Prostate specific membrane antigen
  • CAMs Cell adhesion molecules
  • CAMs Cell adhesion molecules
  • Ig immunoglobulin
  • integrin family cell surface proteins involved in the binding of cells, usually leukocytes, to each other, to endothelial cells, or to extracellular matrix. Specific signals produced in response to wounding and infection control the expression and activation of certain of these adhesion molecules. The interactions and responses then initiated by binding of these CAMs to their receptors/ligands play important roles in the mediation of the inflammatory and immune reactions that constitute one line of the body's defence against these insults.
  • Most of the CAMs characterised so far fall into three general families of proteins: the immunoglobulin (Ig) superfamily, the integrin family, or the selectin family.
  • Ig immunoglobulin
  • L-Selectin consists of an NH2-terminal lectin type C domain, an EGF-like domain, two complement control domains, a 15 amino acid residue spacer, a transmembrane sequence and a short cytoplasmic domain.
  • L-Selectin on endothelial cells Three ligands for L-Selectin on endothelial cells have been identified, all containing O-glycosylated mucin or mucin-like domains.
  • the first ligand, GIyCAM- 1 is expressed almost exclusively in peripheral and mesenteric lymph node high endothelial venules.
  • the second L-Selectin ligand, originally called sgp90 has now been shown to be CD34.
  • This sialomucin-like glycoprotein often used as a surface marker for the purification of pluripotent stem cells, shows vascular expression in a wide variety of nonlymphoid tissues, as well as on the capillaries of peripheral lymph nodes.
  • the third ligand for L-Selectin is MadCAM 1 , a mucin-like glycoprotein found on mucosal lymph node high endothelial venules.
  • P-Selectin a member of the Selectin family of cell surface molecules, consists of an NH2-terminal lectin type C domain, an EGF-like domain, nine complement control domains, a transmembrane domain, and a short cytoplasmic domain.
  • P-Selectin The tetrasaccharide sialyl Lewisx (sLex) has been identified as a ligand for both P- and E-Selectin, but P- E- and L-Selectin can all bind sLex and sLea under appropriate conditions.
  • P-Selectin also reportedly binds selectively to a 160 kDa glycoprotein present on murine myeloid cells and to a glycoprotein on myeloid cells, blood neutrophils, monocytes, and lymphocytes termed P-Selectin glycoprotein ligand- 1 (PSGL-I), a ligand that also can bind E-Selectin.
  • PSGL-I P-Selectin glycoprotein ligand- 1
  • P-Selectin-mediated rolling of leukocytes can be completely inhibited by a monoclonal antibody specific for PSLG- 1, suggesting that even though P-Selectin can bind to a variety of glycoproteins under in vitro conditions, it is likely that physiologically important binding is more limited.
  • a variety of evidence indicates that P-Selectin is involved in the adhesion of myeloid cells, as well as B and a subset of T cells, to activated endothelium.
  • the Ig superfamily CAMs are calcium-independent transmembrane glycoproteins.
  • Members of the Ig superfamily include the intercellular adhesion molecules (ICAMs), vascular-cell adhesion molecule (VCAM-I), platelet-endothelial-cell adhesion molecule (PECAM-I), and neural-cell adhesion molecule (NCAM).
  • ICMs intercellular adhesion molecules
  • VCAM-I vascular-cell adhesion molecule
  • PECAM-I platelet-endothelial-cell adhesion molecule
  • NCAM neural-cell adhesion molecule
  • Each Ig superfamily CAM has an extracellular domain, which contains several Ig-like intrachain disulfide-bonded loops with conserved cysteine residues, a transmembrane domain, and an intracellular domain that interacts with the cytoskeleton. Typically, they bind integrins or other Ig superfamily CAMs.
  • the neuronal CAMs have been implicated in neuronal
  • VCAM-I vascular cell adhesion molecule
  • CD106 platelet endothelial cell adhesion molecule
  • ICM-1 intercellular adhesion molecules 1, 2 &3
  • VCAM-I vascular cell adhesion molecule
  • PECAM- 1/CD31 platelet endothelial cell adhesion molecule
  • IAM-1 intercellular adhesion molecules 1, 2 &3
  • these molecules in general regulate leukocyte migration across blood vessel walls and provide attachment points for developing endothelium during angiogenesis and are all suitable for targeting in the present invention.
  • Human CD31 is a 130 kDa, type I (extracellular N-terminus) transmembrane glycoprotein that belongs to the cell adhesion molecule (CAM) or C2-like subgroup of the IgSFl.
  • the mature molecule is 711 amino acid (aa) residues in length and contains a 574 aa residue extracellular region, a 19 aa residue transmembrane segment, and a 118 aa residue cytoplasmic tail.
  • aa amino acid
  • aa amino acid
  • Ig-homology units that resemble the C2 domains of the IgSF. Although they vary in number, the presence of these modules is a common feature of all IgSF adhesion molecules (ICAM-1, 2, 3 & VCAM-I).
  • Integrins are non-covalently linked heterodimers of ⁇ and ⁇ subunits. To date, 16 ⁇ subunits and 8 ⁇ subunits have been identified. These can combine in various ways to form different types of integrin receptors.
  • the ligands for several of the integrins are adhesive extracellular matrix (ECM) proteins such as fibronectin, vitronectin, collagens and laminin.
  • ECM adhesive extracellular matrix
  • Many integrins recognise the amino acid sequence RGD (arginine-glycine-aspartic acid) which is present in fibronectin or the other adhesive proteins to which they bind. Peptides and protein fragments containing the RGD sequence can be used to modulate the activities of the RGD-recognising integrins.
  • the present invention may employ as the targeting moiety peptides recognised by integrins.
  • These peptides are conventionally known as "RGD-containing peptides".
  • These peptides may include peptides motifs which have been identified as binding to integrins. These motifs include the amino acid sequences: isoDGR, NGR and CRGDC.
  • the peptide motifs may be linear or cyclic. Such motifs are described in more detail in the following patents which are herein incorporated by reference in relation to their description of an RGD peptides: US Patent 5,536,814 which describes cyclasized CRGDCL, CRGDCA and GACRGDCLGA.
  • US Patent 4,578,079 relates to synthetic peptides of formula X-RGD-T/C-Y where X and Y are amino acids.
  • US Patent 5,547,936 describes a peptide counting the sequence X-RGD- XX where X may be an amino acid.
  • US Patent 4,988,621 describes a number of RGD-counting peptides.
  • US Patent 4,879,237 describes a general peptide of the formula RGD-Y where Y is an amino acid, and the peptide G-RGD-AP.
  • US Patent 5,169,930 describes the peptide RGDSPK which binds to ⁇ v ⁇ l integrin.
  • US Patents 5,498,694 and 5,700,908 relate to the cytoplasmic domain of the ⁇ 3 integrin sub-unit that strictly speaking is not an RGD-containing peptide; although it does contain the sequence RDG.
  • WO97/08203 describes cyclic peptides that are structural mimics or RGD-binding sites.
  • US Patent 5,612,311 describes 15 RGD-containing peptides that are capable of being cyclized either by C-C linkage or through other groups such as penicillamine or mecapto propionic acid analogs.
  • US Patent 5,672,585 describes a general formula encompassing RGD-containing peptides.
  • a preferred group of peptides are those where the aspartic acid residue of RGD is derivatised into an O- methoxy tyrosine derivative.
  • US Patent 5,120,829 describes an RGD cell attachment promoting binding site and a hydrophobic attachment domain. The D form is described in US Patent 5,587,456.
  • US Patent 5,648,330 describes a cyclic RGD- containing peptide that has high affinity for GP Iib/IIIa.
  • the targeting moiety is a ligand for ⁇ v ⁇ 3 or ⁇ v ⁇ 5 integrin.
  • alpha v beta 3 ligands to convey cytotoxic chemotherapeutic drugs to tumors has been previously reported (WPI 99-215158/199918.).
  • WPI 99-215158/199918. the idea was to deliver to tumor vessels toxic compounds, such as chemotherapeutic drugs or toxins or anti-angiogenic compounds.
  • ActRII include endothelial cells. ActRIIB expression parallels that for ActRII, and is again found in endothelial cells. Cells known to express ActRI include vascular endothelial cells. ActRIB has also been identified in endothelial cells.
  • Angiogenin is a 14 kDa, non-glycosylated polypeptide so named for its ability to induce new blood vessel growth.
  • Annexin V is a member of a calcium and phospholipid binding family of proteins with vascular anticoagulant activity.
  • Various synomyms for Annexin V exist: placental protein 4 (PP4), placental anticoagulant protein I (PAP I), calphobindin I (CPB-I), calcium dependent phospholipid binding protein 33 (CaBP33), vascular anticoagulant protein alpha (VACa), anchorin CII, lipocortin-V, endonexin II, and thromboplastin inhibitor.
  • PP4 placental protein 4
  • PAP I placental anticoagulant protein I
  • CaBP33 calcium dependent phospholipid binding protein 33
  • VACa vascular anticoagulant protein alpha
  • anchorin CII anchorin I
  • lipocortin-V endonexin II
  • thromboplastin inhibitor The number of binding sites for Annexin V has been reported as 6 - 24 x 106/cell in tumor cells and 8.8 x 106/cell for endo
  • CD44 Another molecule apparently involved in white cell adhesive events is CD44, a molecule ubiquitously expressed on both hematopoietic and non-hematopoietic cells. CD44 is remarkable for its ability to generate alternatively spliced forms, many of which differ in their activities. This remarkable flexibility has led to speculation that CD44, via its changing nature, plays a role in some of the methods that tumor cells use to progress successfully through growth and metastasis. CD44 is a 80-250 kDa type I (extracellular N-terminus) transmembrane glycoprotein. Cells known to express CD44H include vascular endothelial cells.
  • CD44 there are multiple ligands for CD44, including osteopontin, fibronectin, collagen types I and IV and hyaluronate. Binding to fibronectin is reported to be limited to CD44 variants expressing chrondroitin sulfate, with the chrondroitin sulfate attachment site localised to exons v8-vll. Hyaluronate binding is suggested to be possible for virtually all CD44 isoforms. One of the principal binding sites is proposed to be centred in exon 2 and to involve lysine and arginine residues. Factors other than the simple expression of a known hyaluronate-binding motif also appear to be necessary for hyaluronate binding.
  • FGF Fibroblast growth factor
  • FGF fibroblast growth factor
  • FGF-I Human FGF-I (also known as FGF acidic, FGFa, ECGF and HBGF-I) is a 17-18 kDa non- glycosylated polypeptide that is expressed by a variety of cells from all three germ layers.
  • the binding molecule may be either an FGF receptor.
  • Cells known to express FGF-I include endothelial cells.
  • FGF-2 Human FGF-2, otherwise known as FGF basic, HBGF-2, and EDGF, is an 18 kDa, non-glycosylated polypeptide that shows both intracellular and extracellular activity. Following secretion, FGF-2 is sequestered on either cell surface HS or matrix glycosaminoglycans. Although FGF-2 is secreted as a monomer, cell surface HS seems to dimerize monomeric FGF-2 in a non-covalent side-to-side configuration that is subsequently capable of dimerizing and activating FGF receptors. Cells known to express FGF-2 include endothelial cells.
  • FGF-3 Human FGF-3 is the product of the int-2 gene [i.e., derived from integration region-2, a region on mouse chromosome 7 that contains a gene (mf-2/FGF-3) accidentally activated following retroviral insertion]. The molecule is synthesised as a 28-32 kDa, 222 aa glycoprotein that contains a number of peptide motifs. Cells reported to express FGF-3 are limited to developmental cells and tumors. Tumors known to express FGF-3 include breast carcinomas and colon cancer cell lines.
  • FGF-4 Human FGF-4 is a 22 kDa, 176 aa glycoprotein that is the product of a developmentally-regulated gene. The molecule is synthesised as a 206 aa precursor that contains a large, ill-defined 30 aa signal sequence plus two heparin-binding motifs (at aa 51-55 and 140-143). The heparin-binding sites directly relate to FGF-4 activity; heparin/heparan regulate the ability of FGF-4 to activate FGFRl and FGFR2.
  • FGF-4 FGF-4 fibroblasts
  • IL-I exerts its effects by binding to specific receptors.
  • Two distinct IL-I receptor binding proteins, plus a non-binding signalling accessory protein have been identified. Each have three extracellular immunoglobulin-like (Ig-like) domains, qualifying them for membership in the type FV cytokine receptor family.
  • the two receptor binding proteins are termed type I IL-I receptor (IL-I RI) and type II IL-I receptor (IL-I RII) respectively.
  • Human IL-I RI is a 552 aa, 80 kDa transmembrane glycoprotein that has been isolated from endothelium cells.
  • RTK receptor tyrosine kinase
  • Eph receptors and their ligands ephrins have been found to be involved in vascular assembly, angiogenesis, tumorigenesis, and metastasis. It has also been that class A Eph receptors and their ligands are elevated in tumor and associated vasculature.
  • MMPs Matrix metalloproteinases
  • NG2 is a large, integral membrane, chondroitin sulfate proteoglycan that was first identified as a cell surface molecule expressed by immature neural cells. Subsequently NG2 was found to be expressed by a wide variety of immature cells as well as several types of tumors with high malignancy. NG2 has been suggested as a target molecule in the tumor vasculature. In particular, collagenase-1 (Cl) is the predominant matrix metalloproteinase present in newly formed microvessels and serves as a marker of neovascularization.
  • the expression of the oncofetal fragment of fibronectin has also been found to be increased during angiogenesis and has been suggested as a marker of tumor angiogenesis.
  • the TM is an antibody or fragment thereof to the oncofetal ED-B domain of fibronectin.
  • the preparation of such an antibody and its conjugation with IL- 12 is described in Halin et al (2002) Nature Biotechnology 20:264-269.
  • Tenascin is a matrix glycoprotein seen in malignant tumors including brain and breast cancers and melanoma. Its expression is malignant but not well differentiated tumors and association with the blood vessels of tumors makes it an important target for both understanding the biology of malignant tumors and angiogenesis, but is a therapeutic cancer target and marker as well.
  • the targeting moiety is preferably a polypeptide which is capable of binding to a tumor cell or tumor vasculature surface molecule. As well as those mentioned above other such surface molecules which are known or become available may also be targeted by the first sequence.
  • High throughput screening as described above for synthetic compounds, can also be used for identifying targeting molecules.
  • This invention also contemplates the use of competitive drug screening assays in which neutralising antibodies capable of binding a target specifically compete with a test compound for binding to a target.
  • the targeting moiety is a peptide comprising a DGR motif.
  • Peptides containing the DGR motif show cell adhesion binding and anti-cancer properties.
  • the isoDGR in particular ⁇ soDGR
  • D DGR isomers show enhanced cell adhesion binding and anti-cancer properties over other isomeric forms.
  • the targeting moiety is a peptide containg isoDGR, L isoDGR or D DGR motifs.
  • Aspartic acid and isoaspartic acid are each chiral molecules, and the different isomers can be referred to as L -Asp ( L D), L isoAsp (iJsoD), oAsp ( D D) and D isoAsp ( D isoD) where usoD and oisoD represent the entantiomers of isoaspartic acid and LD and D D represent the enantiomers of aspartic acid.
  • a peptide or targeting moiety comprising an isoDGR motif it is meant a peptide or targeting moiety wherein the DGR motif is substantially in the form of isoDGR.
  • substantially it is meant the w/w% of peptide or targeting moiety comprising the isoDGR motif relative to total DGR containing peptide or targeting moiety is greater than 55%, more preferably greater than 60% more preferably greater than 65%, more preferably greater than 70%, more preferably greater than 75%, more preferably greater than 80%, more preferably greater than 85%, more preferably greater than 90%, more preferably greater than 95%, more preferably greater than 97%, more preferably greater than 99%.
  • the isoDGR may comprise both enantiomers of L/ D ⁇ SOD, but preferably comprises at least 5, more preferably at least 10, more preferably at least 30, more preferably at least 40, more preferably at least 50 w/w% of L isoD.
  • a peptide or targeting moiety comprising an ijsoDGR motif it is meant a peptide or targeting moiety wherein the DGR motif is substantially in the form of JsoDGR.
  • L isoDGR motif relative to total DGR containing peptide or targeting moiety is greater than 55%, more preferably greater than 60% more preferably greater than 65%, more preferably greater than 70%, more preferably greater than 75%, more preferably greater than 80%, more preferably greater than 85%, more preferably greater than
  • a peptide or targeting moiety comprising a D DGR motif it is meant a peptide or targeting moiety wherein the DGR motif is substantially in the form of D DGR.
  • substantially it is meant the w/w% of peptide or targeting moiety comprising the D DGR motif relative to total DGR containing peptide or targeting moiety is greater than 55%, more preferably greater than 60% more preferably greater than 65%, more preferably greater than 70%, more preferably greater than 75%, more preferably greater than 80%, more preferably greater than 85%, more preferably greater than
  • DGR motif preferably comprises a turn involving the G and R residues.
  • the DGR motif may arrived at by deamidation of a peptide comprising an NGR motif described herein.
  • the DGR containing peptide comprises the sequence XDGRX' wherein X is selected from the group consisting of L, V, A, C, G, Y, P, H, K, Q and I and X' is selected from the group consisting of C, G, H, L, E, T, Q, R, S and P.
  • the targeting moiety is a peptide comprising a sequence selected from CDGRCVSGCAGRC, DGRAHA, GDGRG, CVLDGRMEC, CDGRC, CDGRCG, GCDGRC LDGRE, YDGRT, LQCICTGDGRGEWKCE, LQCISTGDGRGEWKCE, CICTGDGRGEWKC, CISTGDGRGEWKC, MRCTCVGDGRGEWTCY, MRCTSVGDGRGEWTCY, CTCVGDGRGEWTC or CTSVGDGRGEWTC, preferably a sequence selected from cycloCVLDGRMEC, linear CDGRC, cyclic CDGRC, linear CDGRCG and cyclic CDGRCG, linear GCDGRC and cyclic GCDGRC.
  • the targeting moiety is a peptide comprising a sequence selected from CisoDGRCVSGCAGRC, isoDGRAHA, GisoDGRG, CVLisoDGRMEC, CisoDGRC, CisoDGRCG, GCisoDGRC LisoDGRE, YisoDGRT, LQCICTGisoDGRGEWKCE, LQCISTGisoDGRGEWKCE, CICTGisoDGRGEWKC, CISTGisoDGRGEWKC,
  • CTCVGisoDGRGEWTC or CTSVGisoDGRGEWTC preferably a sequence selected from cycloCVLisoDGRMEC, linear CisoDGRC, cyclic CisoDGRC, linear CisoDGRCG and cyclic CisoDGRCG, linear GCisoDGRC and cyclic GCisoDGRC.
  • the targeting moiety is a peptide comprising a sequence selected from C L isoDGRCVSGCAGRC, L isoDGRAHA, G L isoDGRG, CVL L isoDGRMEC, C L isoDGRC, C L isoDGRCG, GC L isoDGRC L L isoDGRE, Y L isoDGRT, LQCICTG ⁇ soDGRGEWKCE, LQCISTG L isoDGRGEWKCE, CICTG L isoDGRGEWKC, CISTG L isoDGRGEWKC,
  • MRCTCVG L isoDGRGEWTCY, MRCTSVG L isoDGRGEWTCY, CTCVG L ⁇ SODGRGEWTC and CTSVG L isoDGRGEWTC more preferably a sequence selected from cycloCVL L isoDGRMEC, linear CiJsoDGRC, cyclic C L isoDGRC, linear C L isoDGRCG and cyclic C L isoDGRCG, linear GC L isoDGRC and cyclic GC L isoDGRC.
  • the targeting moiety is a peptide comprising a sequence selected from C D DGRCVSGCAGRC, D DGRAHA, G 0 DGRG, CVL D DGRMEC, CDDGRC, C D DGRCG, GC 0 DGRC L 0 DGRE, Y 0 DGRT,
  • the targeting moiety generally takes the form of a binding partner (BP) to a surface molecule comprising or consisting of one or more binding domains.
  • the targeting moiety (TM) of the present invention may take the form of a ligand.
  • the ligands may be natural or synthetic.
  • the term "ligand” also refers to a chemically modified ligand.
  • the one or more binding domains of the BP may consist of, for example, a natural ligand for a receptor, which natural ligand may be an adhesion molecule or a growth-factor receptor ligand (e.g. epidermal growth factor), or a fragment of a natural ligand which retains binding affinity for the receptor.
  • Synthetic ligands include the designer ligands.
  • the term means "designer ligands" refers to agents which are likely to bind to the receptor based on their three dimensional shape compared to that of the receptor.
  • a further embodiment of the invention is provided by bifunctional derivatives in which the IFN ⁇ conjugates of the invention are further conjugated with antibodies, or their fragments, against tumoral antigens or other tumor angiogenic markers, e.g. ⁇ v integrins, metalloproteases or the vascular growth factor, or antibodies or fragments thereof directed against components of the extracellular matrix, such as anti-tenascin antibodies or anti-f ⁇ bronectin EDB domain.
  • tumoral antigens or other tumor angiogenic markers e.g. ⁇ v integrins, metalloproteases or the vascular growth factor, or antibodies or fragments thereof directed against components of the extracellular matrix, such as anti-tenascin antibodies or anti-f ⁇ bronectin EDB domain.
  • a further embodiment of the invention is provided by the tumoral pre-targeting with the biotin/avidin system.
  • a ternary complex is obtained on the tumoral antigenic site, at different stages, which is formed by 1) biotinylated mAb, 2) avidin (or streptavidin) and 3) a peptide or conjugate of the invention and biotin.
  • the pre-targeting approach can also be carried out with a two-phase procedure by using a bispecific antibody which at the same time binds the tumoral antigen and the modified cytokine.
  • IDO immunoregulatory enzyme indoleamine 2,3-dioxygenase
  • IDO is well characterized (see, for example, Taylor et al., FASEB Journal 1991;5 -.2516-2522; Lee et al., Laboratory Investigation, 2003 ;83 -.1457-1466; and Grohmann et al., Trends in Immunology 2003,24:242-248) and degrades the essential amino acid tryptophan (for reviews see Taylor et al., FASEB Journal 1991;5:2516- 2522; Lee et al., Laboratory Investigation, 2003;83:1457-1466; and Grohmann et al., Trends in Immunology 2003;24:242-248).
  • Expression of IDO by human monocyte- derived macrophages (Munn et al., J. Exp.
  • IDO has also been implicated in maintaining tolerance to self antigens (Grohmann et al., J. Exp. Med. 2003;198:153-160), in suppressing T cell responses to MHC- mismatched organ transplants (Miki et al., Transplantation Proceedings 2001 ;33: 129- 130), and in the tolerance-inducing activity of recombinant CTLA4-Ig (Grohmann et al., Nature Immunology 2002;3:985-l 109).
  • the mouse mastocytoma tumor cell line forms lethal tumors in naive hosts, but is normally rejected by pre-immunized hosts.
  • IDO-expressing APCs in tumor-draining lymph nodes are phenotypically similar to a subset of dendritic cells recently shown to mediate profound IDO-dependent immunosuppression in vivo (Mellor et al., Journal of Immunology 2003; 171:1652- 1655). IDO-expressing APCs in tumor-draining lymph nodes thus constitute a potent tolerogenic mechanism. ,
  • the present invention is based on the observation that the administration of an inhibitor of IDO to a subject suffering from a tumor in combination with administration of an IFN ⁇ conjugate, results in an improved efficacy of therapeutic outcome.
  • IDO inhibitor refers to an agent capable of inhibiting the activity of IDO and thereby reversing IDO-mediated immunosuppression.
  • An IDO inhibitor may be a competitive, noncompetitive, or irreversible IDO inhibitor.
  • a “competitive IDO inhibitor” is a compound that reversibly inhibits IDO enzyme activity at the catalytic site (for example, without limitation, 1- methyl-tryptophan) ;
  • a “noncompetitive IDO Inhibitor” is a compound that reversibly inhibits IDO enzyme activity at a non- catalytic site (for example, without limitation, norharman);
  • an "irreversible IDO inhibitor” is a compound that irreversibly destroys IDO enzyme activity by forming a covalent bond with the enzyme (for example, without limitation, cyclopropyl/aziridinyl tryptophan derivatives).
  • Whether a given agent acts as an IDO inhibitor modulator can be determined, for example, by the following methods:
  • Methods for modulating IDO function include introducing a compound which interacts with the IDO or a homologue thereof or a fragment of either. Such compounds can be identified in screening assays.
  • a method of screening for a compound which inhibits IDO may comprises
  • the method may comprise:
  • the functional activity of IDO may be modified by suitable compounds (molecules/agents) which bind either directly or indirectly to IDO protein, or to the nucleic acid encoding it.
  • Compounds may be naturally occurring molecules such as peptides and proteins, for example antibodies, or they may be synthetic molecules.
  • Methods of modulating the level of expression of IDO include, for example, using antisense techniques. Antisense constructs are described in detail in US 6,100,090 (Monia et al), and Neckers et al., 1992, CrU Rev Oncog 3(1-2):175-231, the teachings of which document are specifically incorporated by reference.
  • Candidate IDO inhibitor compounds may be identified from a variety of sources, for example, cells, cell-free preparations, chemical libraries, peptide and gene libraries, and natural product mixtures.
  • Chemical libraries include combinatorial chemistry libraries and, in particular, a combinatorial chemical library comprising compounds that interact with GPCRs.
  • Such antagonists or inhibitors so-identified may be natural or modified substrates, ligands, receptors, enzymes, antibodies (as described above) etc., as the case may be, of the IDO protein; or may be structural or functional mimetics thereof (see Coligan et al., Current Protocols in Immunology l(2):Chapter 5 (1991)).
  • the screening methods used may simply measure the binding of a candidate compound (agent) to the IDO or a fusion protein thereof by means of a label directly or indirectly associated with the candidate compound.
  • the screening method may involve competition with a labelled competitor.
  • a screening assay or method for identifying potential IDO inhibitors may comprise contacting an assay system capable of detecting the effect of a test compound against expression level of IDO, with a test compound and assessing the change in expression level of IDO.
  • Compounds that modulate the expression of DNA or RNA of IDO polypeptides may be detected by a variety of assay systems.
  • a suitable assay system may be a simple
  • a reporter gene such as beta-galactosidase, luciferase, green fluorescent protein or others known to the person skilled in the art (reviewed by Naylor, Biochem. Pharmacol. 58:749-57
  • the assay system may be made quantitative by comparing the expression or function of a test sample with the levels of expression or function in a standard sample.
  • test compounds include low molecular weight chemical compounds (preferably with a molecular weight less than
  • Test compounds 1500 daltons suitable as pharmaceutical or veterinary agents for human or animal use, or compounds for non-administered use such as cleaning/sterilising agents or for agricultural use.
  • Test compounds may also be biological in nature, such as antibodies.
  • Active IDO enzyme can be produced by expressing the cloned, His-tagged version of the mammalian gene in bacteria (Littlejohn, T. K. , et al. (2000) Prot. Exp. Purif. 19:
  • C-terminal His- tagged IDO protein can be produced in E. coli using the IPTG-inducible pET5a vector system and isolated over a nickel column.
  • the yield of the partially purified protein can be verified by gel electrophoresis and the concentration estimated by comparison to protein standards.This provides a convenient source of enzyme for biochemical analysis.
  • a conventional biochemical assay for IDO activity based on spectaphotometric measurement of the production kynurenine (the hydrolysis product of N- formylkynurenine) from tryptophan (Daubener, W. , et al. (1994) J. Immunol. Methods 168: 39-47) is used as the read-out for both the enzymatic and cell-based assays.
  • the enzymatic assay provides a facile, high-throughput screen for identifying compounds with IDO inhibitory activity. This assay is also used to determine Ki values for specific compounds, which is important for the development of SAR (structure activity relationship) around the different compound series.
  • the cell-based assay both confirms the IDO inhibitory activity of identified compounds, and addresses the initial issue of bioavailability-the ability of compounds to inhibit intracellular IDO. Specificity for IDO inhibition is examined in the cell-based assay by comparing against the other known tryptophan catabolizing enzyme tryptophan dioxygenase (TDO, also referred to in the literature asTD02).
  • TDO tryptophan catabolizing enzyme tryptophan dioxygenase
  • IDO activity may be assayed by means of a reaction mixture (100 microlitre total volume) containing potassium phosphate buffer (50 mM, pH 6.5), ascorbic acid (20 mM), catalase (200 microgram/mL), methylene blue (10 mM), L- tryptophan (400 mM), and purified, human IDO.
  • the reaction may be allowed to proceed for 40 min (37 0 C) and stopped by the addition of 20 microlitre of 30% (w/v) trichloroacetic acid.
  • the iV-formyl kynurenine formed from tryptophan in the reaction mixture during this time is then converted to kynurenine by incubating the reaction mixture at 65 0 C for 15 minutes.
  • reaction mixture After cooling the reaction mixture to room temperature, an equal volume of 2% (w/v) p-dimethylamino benzaldehyde in acetic acid may be added to convert the kynurenine present in the reaction mixture to a yellow adduct that can be detected at 480 nm.
  • a standard curve for this latter reaction may be constructed with the use of standard solutions prepared from authentic L- kynurenine. Protein concentration may be determined by the Coomassie blue dye- binding method of Bradford with bovine serum albumin as a standard. (Takikawa et al, J. Biol. Chem. 263, 2041-2048).
  • compounds can be evaluated at a single concentration of, for example, 200 uM against 50 ng of IDO enzyme inlOO ul reaction volumes with tryptophan added at increasing concentrations at, for example, 0,2, 20, and 20OuM.
  • Cells e.g., COS-I cells
  • COS-I cells are transiently transfected with a CMV promoter-driven plasmid expressing IDO cDNA using Lipofectamine 2000 (Invitrogen) as recommended by the manufacturer.
  • a companion set of cells is transiently transfected with TDO-expressing plasmid.
  • 48 hours post-transfection the cells are apportioned into a 96-well format at 6x10 4 cells per well. The following day the wells are washed and new media (phenol red free) containing 20 ug/ml tryptophan is added together with inhibitor.
  • reaction is stopped at 5 hours and the supernatant removed and spectraphotometrically assayed for kynurenine as described for the enzyme assay (Littlejohn, et al. (2000) Prot. Exp. Purif. 19: 22- 29; Takikawa et al. (1988) J. Biol. Chem. 263: 2041- 8).
  • enzyme assay Littlejohn, et al. (2000) Prot. Exp. Purif. 19: 22- 29; Takikawa et al. (1988) J. Biol. Chem. 263: 2041- 8.
  • compounds can be evaluated at a single concentration of, for example, 10OpM. More extensive dose escalation profiles can be collected for select compounds.
  • IDO inhibitors of the instant invention may include, without limitation 1-methyl- tryptophan (IMT), ⁇ -(3-benzofuranyl)-alanine, ⁇ -(3-benzo(b)thienyl)-alanine), 6- nitro-tryptophan, 6-fluoro-tryptophan, 4-methyl-tryptophan, 5-methyl tryptophan, 6- methyl-tryptophan, 5-methoxy-tryptophan, 5-hydroxy-tryptophan, indole 3-carbinol, 3,3'-diindolylmethane, epigallocatechin gallate, 5-Br-4-Cl-indoxyl 1,3-diacetate, 9- vinylcarbazole, acemetacin, 5-bromo-tryptophan, 5-bromoindoxyl diacetate, 3- Amino-naphtoic acid, pyrrolidine dithiocarbamate, 4-phenylimidazole a brassinin derivative, a thio
  • IDO inhibitors may also include dione substituted naphthalene and anthracene diones Such compounds have been shown to function as IDO inhibitors, as disclosed in WO 2006/005185 which is herein incorporated by reference.
  • the inhibitor of IDO is selected from 1-methyl-tryptophan (IMT), ⁇ -(3-benzofuranyl)-alanine, ⁇ -(3-benzo(b)thienyl)- alanine, 6-nitro-tryptophan or 3 -Amino-naphtoic acid.
  • IMT 1-methyl-tryptophan
  • ⁇ -(3-benzofuranyl)-alanine ⁇ -(3-benzo(b)thienyl)- alanine
  • 6-nitro-tryptophan 6-nitro-tryptophan or 3 -Amino-naphtoic acid.
  • the IDO inhibitor may be a racemic mixture.
  • the IDO inhibitor may be present as a non-racemic mixture.
  • the IDO inhibitor is substantially homochiral (e.g. the L-isomer or the D-isomer).
  • the non- racemic mixture has an enantiomeric excess of greater than about 50% ee, more preferably greater than about 75% ee, more preferably greater than about 95% ee, more preferably greater than about 99% ee.
  • the inhibitor of indoleamine-2,3-dioxygenase is a D isomer of an inhibitor of IDO, including, for example, the D isomer of 1-methyl-tryptophan, the D isomer of ⁇ -(3-benzofuranyl)-alanine, the D isomer of ⁇ -(3-benzo(b)thienyl)- alanine, or the D isomer of 6-nitro-tryptophan.
  • the inhibitor of indoleamine-2,3-dioxygenase is an L isomer of an inhibitor of IDO, including, for example, the L isomer of 1-methyl-tryptophan, the L isomer of ⁇ -(3-benzofuranyl)-alanine, the L isomer of ⁇ -(3-benzo(b)tbienyl)- alanine, or the L isomer of 6-nitro-tryptophan.
  • the IDO inhibitor used in the present invention has at least 10, 20, 40, 50, 60, 70, 80 or 90% of the IDO inhibitory activity of 1 -methyl -tryptophan (1-MT).
  • Inhibitors of the IDO enzyme are readily commercially available, for example, from Sigma-Aldrich Chemicals, St. Louis, Mo.
  • agents e.g., IFN ⁇ conjugates and IDO inhibitors
  • the agents can be present as salts or esters, in particular pharmaceutically acceptable salts or esters.
  • any reference to INF ⁇ conjugates and IDO inhibitors includes active salts, solvates or derivatives that may be formed from said INF ⁇ conjugates and IDO inhibitors.
  • salts of the agents of the invention include suitable acid addition or base salts thereof.
  • suitable pharmaceutical salts may be found in Berge et al, J Pharm Sci, 66,1-19 (1977). Salts are formed, for example with strong inorganic acids such as mineral acids, e.g., sulphuric acid, phosphoric acid or hydrohalic acids; with strong organic carboxylic acids, such as alkanecarboxylic acids of 1 to 4 carbon atoms which are unsubstituted or substituted (e.g., by halogen), such as acetic acid; with saturated or unsaturated dicarboxylic acids, for example oxalic, malonic, succinic, maleic, fumaric, phthalic or tetraphthalic ; with hydroxycarboxylic acids, for example ascorbic, glycolic, lactic, malic, tartaric or citric acid; with amino acids, for example aspartic or glutamic acid; with benzoic acid; or with organic sulf
  • Esters are formed either using organic acids or alcohols/hydroxides, depending on the functional group being esterified.
  • Organic acids include carboxylic acids, such as alkanecarboxylic acids of 1 to 12 carbon atoms which are unsubstituted or substituted (e.g., by halogen), such as acetic acid; with saturated or unsaturated dicarboxylic acid, for example oxalic, malonic, succinic, maleic, fumaric, phthalic or tetraphthalic; with hydroxycarboxylic acids, for example ascorbic, glycolic, lactic, malic, tartaric or citric acid; with amino acids, for example aspartic or glutamic acid; with benzoic acid; or with organic sulfonic acids, such as (Q-C 4 )-alkyl or aryl-sulfonic acids which are unsubstituted or substituted (for example, by a halogen) such as methane-or p-toluene
  • Suitable hydroxides include inorganic hydroxides, such as sodium hydroxide, potassium hydroxide, calcium hydroxide, aluminium hydroxide.
  • Alcohols include alkanealcohols of 1-12 carbon atoms which may be unsubstituted or substituted, e.g., by a halogen.
  • the invention also includes where appropriate all enantiomers and tautomers of the agents provided said forms retain the appropriate functional activity.
  • the man skilled in the art will recognise compounds that possess an optical properties (one or more chiral carbon atoms) or tautomeric characteristics.
  • the corresponding enantiomers and/or tautomers may be isolated/prepared by methods known in the art.
  • agents of the invention may exist as stereoisomers and/or geometric isomers - e. g. they may possess one or more asymmetric and/or geometric centres and so may exist in two or more stereoisomeric and/or geometric forms.
  • the present invention contemplates the use of all the individual stereoisomers and geometric isomers of those inhibitor agents, and mixtures thereof.
  • the terms used in the claims encompass these forms, provided said forms retain the appropriate functional activity (though not necessarily to the same degree).
  • the present invention also includes all suitable isotopic variations of the agent or pharmaceutically acceptable salts thereof.
  • An isotopic variation of an agent of the present invention or a pharmaceutically acceptable salt thereof is defined as one in which at least one atom is replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually found in nature.
  • isotopes that can be incorporated into the agent and pharmaceutically acceptable salts thereof include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine and chlorine such as 2 H, 3 H, 13 C 5 14 C, 15 N 17 O 18 O 31 P 32 P, 35 S, 18 F and 36 Cl, respectively.
  • isotopic variations of the agent and pharmaceutically acceptable salts thereof are useful in drug and/or substrate tissue distribution studies. Tritiated, i.e., 3 H, and carbon- 14, i.e., 14 C, isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with isotopes such as deuterium, i.e., 2 H, may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements and hence may be preferred in some circumstances. Isotopic variations of the agent of the present invention and pharmaceutically acceptable salts thereof of this invention can generally be prepared by conventional procedures using appropriate isotopic variations of suitable reagents.
  • the present invention also includes solvate forms of the agents of the present invention.
  • the terms used in the claims encompass these forms.
  • the invention furthermore relates to agents of the present invention in their various crystalline forms, polymorphic forms and (an)hydrous forms. It is well established within the pharmaceutical industry that chemical compounds may be isolated in any of such forms by slightly varying the method of purification and or isolation from the solvents used in the synthetic preparation of such compounds.
  • Prodrugs The invention further includes agents of the present invention in prodrug form.
  • Such prodrugs are generally agents of the invention wherein one or more appropriate groups have been modified such that the modification may be reversed upon administration to a human or mammalian subject.
  • Such reversion is usually performed by an enzyme naturally present in such subject, though it is possible for a second agent to be administered together with such a prodrug in order to perform the reversion in vivo.
  • Examples of such modifications include ester (for example, any of those described above), wherein the reversion may be carried out be an esterase etc.
  • Other such systems will be well known to those skilled in the art.
  • polypeptide as used herein includes polypeptides and proteins.
  • polypeptide includes single-chain polypeptide molecules as well as multiple- polypeptide complexes where individual constituent polypeptides are linked by covalent or non-covalent means.
  • polypeptide includes peptides of two or more amino acids in length, typically having more than 5, 10 ,20, 30, 40 , 50 or 100, amino acids.
  • Peptides may not consist solely of naturally-occurring amino acids but which have been modified, for example to reduce immunogenicity, to increase circulatory half- life in the body of the patient, to enhance bioavailability and/or to enhance efficacy and/or specificity.
  • a number of approaches have been used to modify peptides for therapeutic application.
  • One approach is to link the peptides or proteins to a variety of polymers, such as polyethylene glycol (PEG) and polypropylene glycol (PPG) - see for example U.S. Patent Nos. 5,091,176, 5,214,131 and US 5,264,209.
  • PEG polyethylene glycol
  • PPG polypropylene glycol
  • bifunctional crosslinkers such as N-succinimidyl 3-(2 pyridyldithio) propionate, succinimidyl 6-[3-(2 pyridyldithio) propionamido] hexanoate, and sulfosuccinimidyl 6-[3-(2 pyridyldithio) propionamidojhexanoate (see US Patent 5,580,853).
  • bifunctional crosslinkers such as N-succinimidyl 3-(2 pyridyldithio) propionate, succinimidyl 6-[3-(2 pyridyldithio) propionamido] hexanoate, and sulfosuccinimidyl 6-[3-(2 pyridyldithio) propionamidojhexanoate.
  • the active conformation of the peptide may be stabilised by a covalent modification, such as cyclization or by incorporation of gamma-lactam or other types of bridges.
  • a covalent modification such as cyclization or by incorporation of gamma-lactam or other types of bridges.
  • side chains can be cyclized to the backbone so as create a L-gamma- lactam moiety on each side of the interaction site. See, generally, Hruby et al., "Applications of Synthetic Peptides," in Synthetic Peptides: A User's Guide: 259-345 (W. H. Freeman & Co. 1992).
  • Cyclization also can be achieved, for example, by formation of cysteine bridges, coupling of amino and carboxy terminal groups of respective terminal amino acids, or coupling of the amino group of a Lys residue or a related homolog with a carboxy group of Asp, GIu or a related homolog. Coupling of the .alpha-amino group of a polypeptide with the epsilon-amino group of a lysine residue, using iodoacetic anhydride, can be also undertaken. See Wood and Wetzel, 1992, Int'l J. Peptide Protein Res. 39: 533-39.
  • a further technique for improving the properties of therapeutic peptides is to use non-peptide peptidomimetics.
  • a wide variety of useful techniques may be used to elucidating the precise structure of a peptide. These techniques include amino acid sequencing, x-ray crystallography, mass spectroscopy, nuclear magnetic resonance spectroscopy, computer-assisted molecular modelling, peptide mapping, and combinations thereof.
  • Structural analysis of a peptide generally provides a large body of data which comprise the amino acid sequence of the peptide as well as the three- dimensional positioning of its atomic components. From this information, non-peptide peptidomimetics may be designed that have the required chemical functionalities for therapeutic activity but are more stable, for example less susceptible to biological degradation. An example of this approach is provided in US 5,811,512.
  • variant or derivative in relation to peptides (e.g., IFN ⁇ conjugates) of the present invention includes any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) amino acids from or to the sequence providing the resultant amino acid sequence preferably has targeting activity, preferably having at least 25 to 50% of the activity as the polypeptides presented in the Examples, more preferably at least substantially the same activity.
  • sequences may be modified for use in the present invention.
  • modifications are made that substantially maintain the activity of the sequence.
  • amino acid substitutions may be made, for example from 1 , 2 or 3 to 10, 20 or 30 substitutions provided that the modified sequence retains at least about 25 to 50% of, or substantially the same activity.
  • Amino acid substitutions may include the use of non-naturally occurring analogues, for example to increase blood plasma half-life of a therapeutically administered polypeptide (see below for further details on the production of peptide derivatives for use in therapy). Conservative substitutions may be made, for example according to the Table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:
  • fragments include those which include an epitope or binding domain, and maintain tumor targeting and IFN ⁇ function.
  • Suitable fragments will be at least about 15, e.g. 20, 30 or 50 amino acids in length. They may also be less than 300, 200 or 100 amino acids in length.
  • Polypeptide fragments of the proteins and allelic and species variants thereof may contain one or more (e.g. 2, 3, 5, or 10) substitutions, deletions or insertions, including conserved substitutions. Where substitutions, deletion and/or insertions have been made, for example by means of recombinant technology, preferably less than 20%, 10% or 5% of the amino acid residues are altered.
  • Conjugates of the invention are typically made by recombinant means. However they may also be made by synthetic means using techniques well known to skilled persons such as solid phase synthesis. Various techniques for chemical synthesising peptides are reviewed by Borgia and Fields, 2000, TibTech 18: 243-251 and described in detail in the references contained therein.
  • the term "derivative" as used herein includes chemical modification of one or more of the agents, e.g., IDO inhibitors, of the invention. Illustrative of such chemical modifications would be replacement of hydrogen by a halo group, an alkyl group, an acyl group or an amino group.
  • Polynucleotides for use in the invention comprise nucleic acid sequences encoding the IFN ⁇ conjugates of the invention.
  • Polynucleotides of the invention may comprise DNA or RNA. They may be single- stranded or double-stranded. They may also be polynucleotides which include within them synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones, addition of acridine or polylysine chains at the 3' and/or 5' ends of the molecule. For the purposes of the present invention, it is to be understood that the polynucleotides described herein may be modified by any method available in the field of the invention.
  • Such modifications may be carried out in order to enhance the in vivo activity or life span of polynucleotides.
  • Polynucleotides of the invention can be incorporated into a recombinant replicable vector.
  • the vector may be used to replicate the nucleic acid in a compatible host cell.
  • the polynucleotide within the vector is operably linked to a control sequence that is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector.
  • operably linked means that the components described are in a relationship permitting them to function in their intended manner.
  • a regulatory sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under condition compatible with the control sequences.
  • control sequences may be modified, for example by the addition of further transcriptional regulatory elements to make the level of transcription directed by the control sequences more responsive to transcriptional modulators.
  • the vectors may be transformed or transfected into a suitable host cell as described below to provide for expression of a protein e.g. expression of an IFN ⁇ conjugate.
  • This process may comprise culturing a host cell transformed with an expression vector as described above under conditions to provide for expression by the vector of a coding sequence encoding the protein, and optionally recovering the expressed protein.
  • the vectors may be for example, plasmid or virus vectors provided with an origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter.
  • the vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammalian vector. Vectors may be used, for example, to transfect or transform a host cell.
  • Control sequences operably linked to sequences encoding the protein to be used in the invention include promoters/enhancers and other expression regulation signals. These control sequences may be selected to be compatible with the host cell for which the expression vector is designed to be used in.
  • the term "promoter” is well-known in the art and encompasses nucleic acid regions ranging in size and complexity from minimal promoters to promoters including upstream elements and enhancers.
  • the promoter is typically selected from promoters which are functional in mammalian cells, although prokaryotic promoters and promoters functional in other eukaryotic cells may be used.
  • the promoter is typically derived from promoter sequences of viral or eukaryotic genes.
  • it may be a promoter derived from the genome of a cell in which expression is to occur.
  • eukaryotic promoters they may be promoters that function in a ubiquitous manner (such as promoters of a-actin, b-actin, tubulin) or, alternatively, a tissue-specific manner (such as promoters of the genes for pyruvate kinase). Tissue-specific promoters specific for certain cells may also be used. They may also be promoters that respond to specific stimuli, for example promoters that bind steroid hormone receptors.
  • Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR) promoter, the rous sarcoma virus (RSV) LTR promoter or the human cytomegalovirus (CMV) IE promoter.
  • MMLV LTR Moloney murine leukaemia virus long terminal repeat
  • RSV rous sarcoma virus
  • CMV human cytomegalovirus
  • the promoters may also be advantageous for the promoters to be inducible so that the levels of expression of the heterologous gene can be regulated during the life-time of the cell. Inducible means that the levels of expression obtained using the promoter can be regulated.
  • any of these promoters may be modified by the addition of further regulatory sequences, for example enhancer sequences.
  • Chimeric promoters may also be used comprising sequence elements from two or more different promoters described above.
  • Vectors and polynucleotides may be introduced into host cells for the purpose of replicating the vectors/polynucleotides and/or expressing the proteins encoded by the polynucleotides.
  • the proteins may be produced using prokaryotic cells as host cells, it is preferred to use eukaryotic cells, for example yeast, insect or mammalian cells, in particular mammalian cells.
  • Vectors/polynucleotides may be introduced into suitable host cells using a variety of techniques known in the art, such as transfection, transformation and electroporation.
  • vectors/polynucleotides are to be administered to animals, several techniques are known in the art, for example infection with recombinant viral vectors such as retroviruses, herpes simplex viruses and adenoviruses, direct injection of nucleic acids and biolistic transformation.
  • recombinant viral vectors such as retroviruses, herpes simplex viruses and adenoviruses
  • direct injection of nucleic acids and biolistic transformation.
  • Host cells comprising polynucleotides described herein may be used to express conjugates of the invention.
  • Host cells may be cultured under suitable conditions which allow expression of the polypeptides and conjugates used in the invention.
  • Expression of the polypeptides and polynucleotides may be constitutive such that they are continually produced, or inducible, requiring a stimulus to initiate expression.
  • protein production can be initiated when required by, for example, addition of an inducer substance to the culture medium, for example dexamethasone or IPTG.
  • the present invention also provides a pharmaceutical composition for treating an individual wherein the composition comprises a therapeutically effective amount of the pharmaceutical product of the present invention.
  • the pharmaceutical composition may be for human or animal usage. Typically, a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular individual.
  • the IFN ⁇ conjugate (e.g. IFN ⁇ conjugated to peptide containing the NGR motif) may be provided in a dosage generally in the range of, for example, 0.1 to 500 ng/Kg, 0.5 to 500 ng/Kg, 1 to 5 ng/kg or 5 to 15 ng/kg.
  • the IDO inhibitor may conveniently be administered at a dose generally in the range of, for example, 0.1 to 10000 mg, 0.1 to 5000 mg,0.1 to 1000 mg, 0.1 to 500 mg, 0.1 to 200 mg, 0.1 to 100 mg, 0.1 to 50 mg, 5 to 5000 mg, 5 to 1000 mg, 5 to 500 mg, 5 to 200 mg, 5 to 100 mg, 5 to 50 mg, 10 to 5000 mg, 10 to 1000 mg, 10 to 500 mg, 10 to 200 mg, 10 to 100 mg, 10 to 50 mg, 50 to 5000 mg, 50 to 1000 mg, 50 to 500 mg, 50 to 200 mg, 50 to 100 mg, 100 to 5000 mg, 100 to 1000 mg or 100 to 500 mg.
  • the composition may optionally comprise a pharmaceutically acceptable carrier, diluent, excipient or adjuvant.
  • a pharmaceutically acceptable carrier diluent, excipient or adjuvant.
  • the choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice.
  • the pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents that may aid or increase the viral entry into the target site (such as for example a lipid delivery system).
  • Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline. Details of excipients may be found in The Handbook of Pharmaceutical Excipients, 2nd Edn, Eds Wade & Weller, American Pharmaceutical Association.
  • the pharmaceutical compositions can be administered by any one or more of: inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or they can be injected parenterally, for example intracavernosally, intravenously, intramuscularly or subcutaneously.
  • compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood.
  • compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner.
  • Formulations for oral or parenteral administration are preferred and formulations for oral administration are particularly preferred.
  • Formulations for parenteral administration comprise injectable solutions or suspensions and liquids for infusions.
  • an effective amount of the active ingredient will be dissolved or suspended in a sterile carrier, optionally adding excipients such as solubilizers, isotonicity agents, preservatives, stabilizers, emulsifiers or dispersing agents, and it will be subsequently distributed in sealed vials or ampoules.
  • composition may be formulated such that administration daily, weekly or monthly will provide the desired daily dosage. It will be appreciated that the composition may be conveniently formulated for administrated less frequently, such as every 2, 4, 6, 8, 10 or 12 hours.
  • Polynucleotides/vectors encoding polypeptide components may be administered directly as a naked nucleic acid construct, preferably further comprising flanking sequences homologous to the host cell genome.
  • Uptake of naked nucleic acid constructs by mammalian cells is enhanced by several known transfection techniques for example those including the use of transfection agents.
  • transfection agents include cationic agents (for example calcium phosphate and DEAE-dextran) and lipofectants (for example lipofectamTM and transfectamTM).
  • cationic agents for example calcium phosphate and DEAE-dextran
  • lipofectants for example lipofectamTM and transfectamTM.
  • nucleic acid constructs are mixed with the transfection agent to produce a composition.
  • a polynucleotide for use in the invention is combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition.
  • Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline.
  • the composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular or transdermal administration.
  • the term "subject" represents an organism, including, for example, an animal.
  • An animal includes, but is not limited to, a human, a non-human primate, a horse, a pig, a goat, a cow, a rodent, such as, but not limited to, a rat or a mouse, or a domestic pet, such as, but not limited to, a dog or a cat.
  • compositions of the invention may be used in therapeutic treatment.
  • the patient treated in the present invention in its many embodiments is desirably a human patient, although it is to be understood that the principles of the invention indicate that the invention is effective with respect to all mammals, which are intended to be included in the term "patient".
  • a mammal is understood to include any mammalian species in which treatment of diseases associated with cancer is desirable, particularly agricultural and domestic mammalian species.
  • the pharmaceutical product or pharmaceutical composition of the present invention may be used to treat or prevent cancer including but not limited to melanoma, cancer of the lung, pancreas, breast, colon, prostate, larynx, ovary or brain.
  • cancer including but not limited to melanoma, cancer of the lung, pancreas, breast, colon, prostate, larynx, ovary or brain.
  • the cancer comprises a solid tumor.
  • the pharmaceutical product and pharmaceutical compositions of the invention can be used in combined, separated or sequential preparations, also with other diagnostic or therapeutic substances.
  • the efficacy of treatment of a tumor may be assessed by any of various parameters well known in the art. This includes, but is not limited to, determinations of a reduction in tumor size, determinations of the inhibition of the growth, spread, invasiveness, vascularization, angiogenesis, and/or metastasis of a tumor, determinations of the inhibition of the growth, spread, invasiveness and/or vascularization of any metastatic lesions, and/or determinations of an increased delayed type hypersensitivity reaction to tumor antigen.
  • the efficacy of treatment may also be assessed by the determination of a delay in relapse or a delay in tumor progression in the subject or by a determination of survival rate of the subject, for example, an increased survival rate at one or five years post treatment.
  • Murine RMA lymphoma (Ljunggren, et al., J Exp Med 1985; 162: 1745-59) and B 16/Fl melanoma cells were cultured as described previously (Moro, et al., Cancer Res 1997;57: 1922-8).
  • Recombinant murine IFN ⁇ was from PeproTech, London, UK.
  • Murine IFN ⁇ -NGR (IFN ⁇ 4 . ⁇ 35 fused with the N-terminus of SGCNGRC) was prepared by recombinant DNA technology as described previously (Curnis et al Cancer Res.
  • the cDNA coding for murine IFN ⁇ -NGR (IFNg-NGR) (IFNg4-135 fused with the N-terminus of SGCNGRC - the S residue was introduced to replace a C residue in position 136 of the IFN ⁇ mouse sequence) was obtained by reverse transcription-PCR on total RNA purified from the splenocytes of C57BL/6 mice (Harlan, Italy).
  • RNA extraction the splenocytes were stimulated for 20 h with 10 ⁇ g/ml lipopolysaccaride in RPMI (Euroclone, Milan, Italy) supplemented with 2 mM glutamine, 100 U/ml penicillin, 100 ⁇ g/ml streptomycin, 0.25 ⁇ g/ml amphotericin- B, and 10% fetal bovine serum (FBS).
  • RT-PCR was performed using the following primers: ATATCTACATATGCACGGCACAGTCATTGAAAGCC (forward primer); TCGGATCCTCAGCAACGGCCGTTGCAGCCGGAGCGACTCCTTTTCCGCTTCC TGAGGC (reverse primer).
  • Primer sequences were designed to include the Nde I and Bam HI restriction sites for cloning in pETll plasmid (Novagen, Madison, WI).
  • the cDNA coding for murine IFNg-C136S (an IFNg4-136-mutant with Cysl36 replaced with Ser) was prepared by PCR on the IFNg-NGR plasmid, using ATATCTACATATGCACGGCACAGTCATTGAAAGCC (forward primer) and TCGGATCCTCAGGAGCGACTCCTTTTCCGC (reverse primer), and cloned in pETl l.
  • Both cDNAs were expressed in BL21(DE3) E.coli cells (Novagen).
  • the products were purified from cell extracts by ammonium sulfate precipitation and hydrophobic interaction chromatography on Phenyl-Sepharose 6 Fast Flow (Amersham Biosciences Europe GmbH, Freiburg, Germany), followed by ion-exchange chromatography on DEAE-Sepharose Fast Flow (Amersham).
  • the products were gel-filtered through an HR-Sephacryl S-300 column (1025 ml) (Amersham) pre-equilibrated with 150 mM sodium chloride, 50 mM sodium phosphate, pH 7.3, containing 5% sucrose.
  • Murine NGR-TNF (TNF fused with the C-terminus of CNGRCG was prepared by recombinant DNA technology as described previously (Curnis, et al., Nature Biotech., 18:1185-90). Melphalan (Alkeran) was from Glaxo Wellcome (London, UK).
  • mice were challenged with subcutaneous injection in the left flank of 7 x 10 ⁇ RMA or B 16Fl living cells; 6-10 days later, mice were treated, i.p., with IFN ⁇ -NGR solutions (100 ⁇ l) diluted with 0.9% sodium chloride containing 100 ⁇ g/ml endotoxin-free human serum albumin (Farma-Biagini SpA, Lucca, Italy).
  • mice were given 1-methyl-L-tryptophan (1-MT) (Sigma- Aldrich) (5 mg/ml, pH 9.5-10) in the drinking water, of which they drank 3-4 ml/day. Tumor growth was monitored daily by measuring tumor volumes with calipers as previously described (Gasparri, et al. Cancer Res 1999;59:2917-23). Animals were sacrificed before tumors reached 1.0 - 1.5 cm in diameter. Tumor sizes are shown as mean ⁇ SE (5 animals/group).
  • RMA cells (5 x 10 3 /well) were plated in RPMI 1640 medium containing 10% fetal bovine serum, 100 units/ml penicillin, 100 ⁇ g/ml streptomycin, IFN ⁇ -NGR and IMT at various concentrations (200 ⁇ l/well) and incubated for three days at 37 0 C, 5% CO 2 .
  • 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solution (10 ⁇ l, 5 mg/ml in phosphate buffered saline), was added to each well and left to incubate for 2 h.
  • the cells were treated with 10% (w/v) sodium dodecyl sulphate, 50 % (v/v) N,N dimethylformamide, 0.025 M hydrocloric acid and 0.35 M acetic acid solution (100 ⁇ l/well, 24 h at 37 °C).
  • the absorbance of each well at 570 and 650 nm was then measured using a microplate reader.
  • the same procedure was applied for proliferation assays involving B 16Fl cells except that after MTT staining cell culture medium was removed, replaced with 200 ⁇ l of dimethylsulfoxide and mixed with a pipette before spectrophotometric measurements.
  • IFNy-NGR is composed of two bioactive domains: the IFN ⁇ domain, which can interact with IFN ⁇ receptor, and the CNGRC targeting domain, which can interact with CD 13 and specific integrins.
  • the CNGRC domain in the induction of IDO, we studied the effect of 1-MT on NGR-TNF, a different CNGRC-cytokine conjugate. Repeated treatments of RMA-bearing mice with NGR-TNF significantly delayed tumor growth. This is in line with previous studies showing that low doses of NGR-TNF, alone, can affect, albeit in a modest manner, the grow of this tumor (Figure 4).
  • Example 6 Repeated treatments with IFN ⁇ -NGR increases IDO activity in RMA lymphoma tumors To assess the hypothesis that the repeated treatments with IFN ⁇ -NGR can lead to induction of IDO in tumors, the levels of IDO activity were measured in RMA tumor extracts after treatment.
  • mice were treated with 100 pg of IFN ⁇ -NGR for five times, every day, and IDO activity was analysed in tumors 2 h after the last treatment. As expected, a significant increase of IDO activity was observed (Figure 5), supporting the hypothesis that IDO activity is increased after repeated IFN ⁇ -NGR administrations.
  • Example 7 IFN ⁇ -NGR and IMT, in combination, do not inhibit tumor growth in nu/nu mice

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un produit pharmaceutique qui comporte, en combinaison, (i) un inhibiteur de l'indoléamine 2,3-dioxygénase (IDO) et (ii) un produit de conjugaison de IFNγ et une fraction de ciblage (TM) ou un polynucléotide codant pour celui-ci.
PCT/IB2007/004299 2006-12-05 2007-12-05 Produit de combinaison WO2008068621A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB0624308.3 2006-12-05
GB0624308A GB0624308D0 (en) 2006-12-05 2006-12-05 Combination product

Publications (2)

Publication Number Publication Date
WO2008068621A2 true WO2008068621A2 (fr) 2008-06-12
WO2008068621A3 WO2008068621A3 (fr) 2008-07-31

Family

ID=37711599

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2007/004299 WO2008068621A2 (fr) 2006-12-05 2007-12-05 Produit de combinaison

Country Status (2)

Country Link
GB (1) GB0624308D0 (fr)
WO (1) WO2008068621A2 (fr)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011081523A1 (fr) 2009-12-31 2011-07-07 Rijksuniversiteit Groningen Analogues d'interférons
CN106075453A (zh) * 2016-07-12 2016-11-09 中国医学科学院基础医学研究所 一种抗肿瘤药物制剂组合
WO2016181349A1 (fr) * 2015-05-14 2016-11-17 Pfizer Inc. Combinaisons comprenant un inhibiteur d'ido1 de type pyrrolidine-2,5-dione et un anticorps
WO2017009842A2 (fr) 2015-07-16 2017-01-19 Biokine Therapeutics Ltd. Compositions et méthodes pour le traitement du cancer
US9603836B2 (en) 2014-05-15 2017-03-28 Iteos Therapeutics Pyrrolidine-2, 5-dione derivatives, pharmaceutical compositions and methods for use as IDO1 inhibitors
WO2017080934A1 (fr) * 2015-11-09 2017-05-18 F. Hoffmann-La Roche Ag Essai de criblage permettant d'identifier des modulateurs de id01 et/ou de tdo
US9873690B2 (en) 2015-03-17 2018-01-23 Pfizer Inc 3-indol substituted derivatives, pharmaceutical compositions and methods for use
US10544095B2 (en) 2015-08-10 2020-01-28 Pfizer Inc. 3-indol substituted derivatives, pharmaceutical compositions and methods for use
CN112118747A (zh) * 2017-12-08 2020-12-22 驰若莫塞尔公司 作为甜味剂的色氨酸衍生物
CN114375163A (zh) * 2019-06-12 2022-04-19 玉米产品开发公司 具有似糖特征的组合物

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006067633A2 (fr) * 2004-12-23 2006-06-29 Molmed Spa Produit de conjugaison

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006067633A2 (fr) * 2004-12-23 2006-06-29 Molmed Spa Produit de conjugaison

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ADIKARI S B ET AL: "Interferon-gamma-modified dendritic cells suppress B cell function and ameliorate the development of experimental autoimmune myasthenia gravis." CLINICAL AND EXPERIMENTAL IMMUNOLOGY NOV 2004, vol. 138, no. 2, November 2004 (2004-11), pages 230-236, XP002481684 ISSN: 0009-9104 *
BRANDACHER G ET AL: "Antitumoral activity of interferon-[gamma] involved in impaired immune function in cancer patients" CURRENT DRUG METABOLISM 200608 NL, vol. 7, no. 6, August 2006 (2006-08), pages 599-612, XP009100735 ISSN: 1389-2002 *
CURNIS FLAVIO ET AL: "Targeted delivery of IFNgamma to tumor vessels uncouples antitumor from counterregulatory mechanisms." CANCER RESEARCH 1 APR 2005, vol. 65, no. 7, 1 April 2005 (2005-04-01), pages 2906-2913, XP002481685 ISSN: 0008-5472 *
MULLER ALEXANDER J ET AL: "Inhibition of indoleamine 2,3-dioxygenase, an immunoregulatory target of the cancer suppression gene Bin1, potentiates cancer chemotherapy" NATURE MEDICINE, vol. 11, no. 3, March 2005 (2005-03), pages 312-319, XP002481687 ISSN: 1078-8956 *
MUNN ET AL: "Indoleamine 2,3-dioxygenase, tumor-induced tolerance and counter-regulation" CURRENT OPINION IN IMMUNOLOGY, ELSEVIER, OXFORD, GB, vol. 18, no. 2, 1 April 2006 (2006-04-01), pages 220-225, XP005321333 ISSN: 0952-7915 *
ZHENG XIUFEN ET AL: "Reinstalling antitumor immunity by inhibiting tumor-derived immunosuppressive molecule IDO through RNA interference." JOURNAL OF IMMUNOLOGY (BALTIMORE, MD. : 1950) 15 OCT 2006, vol. 177, no. 8, 15 October 2006 (2006-10-15), pages 5639-5646, XP002481686 ISSN: 0022-1767 *

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2343081A1 (fr) 2009-12-31 2011-07-13 Rijksuniversiteit Groningen Analogues d'interféron
US9381230B2 (en) 2009-12-31 2016-07-05 BiOrion Technologies, B.V. Interferon analogs
US10442845B2 (en) 2009-12-31 2019-10-15 Biorion Technologies B.V. Interferon analogs
WO2011081523A1 (fr) 2009-12-31 2011-07-07 Rijksuniversiteit Groningen Analogues d'interférons
US10398679B2 (en) 2014-05-15 2019-09-03 Iteos Therapeutics Treatment method utilizing pyrrolidine-2, 5-dione derivatives as IDO1 inhibitors
US9949951B2 (en) 2014-05-15 2018-04-24 Iteos Therapeutics Pyrrolidine-2, 5-dione derivatives, pharmaceutical compositions and methods for use as IDO1 inhibitors
US9603836B2 (en) 2014-05-15 2017-03-28 Iteos Therapeutics Pyrrolidine-2, 5-dione derivatives, pharmaceutical compositions and methods for use as IDO1 inhibitors
US9873690B2 (en) 2015-03-17 2018-01-23 Pfizer Inc 3-indol substituted derivatives, pharmaceutical compositions and methods for use
WO2016181348A1 (fr) * 2015-05-14 2016-11-17 Pfizer Inc. Combinaisons comprenant un inhibiteur d'ido1 de type pyrrolidine-2,5-dione et un anticorps
WO2016181349A1 (fr) * 2015-05-14 2016-11-17 Pfizer Inc. Combinaisons comprenant un inhibiteur d'ido1 de type pyrrolidine-2,5-dione et un anticorps
US10945994B2 (en) 2015-05-14 2021-03-16 Pfizer Inc. Combinations comprising a pyrrolidine-2,5-dione IDO1 inhibitor and an anti-body
WO2017009842A2 (fr) 2015-07-16 2017-01-19 Biokine Therapeutics Ltd. Compositions et méthodes pour le traitement du cancer
EP3744340A2 (fr) 2015-07-16 2020-12-02 Biokine Therapeutics Ltd. Compositions et procédés pour le traitement du cancer
EP3943098A2 (fr) 2015-07-16 2022-01-26 Biokine Therapeutics Ltd. Compositions et procédés pour le traitement du cancer
US10544095B2 (en) 2015-08-10 2020-01-28 Pfizer Inc. 3-indol substituted derivatives, pharmaceutical compositions and methods for use
WO2017080934A1 (fr) * 2015-11-09 2017-05-18 F. Hoffmann-La Roche Ag Essai de criblage permettant d'identifier des modulateurs de id01 et/ou de tdo
CN108026565A (zh) * 2015-11-09 2018-05-11 豪夫迈·罗氏有限公司 用于鉴定ido1和/或tdo调节剂的筛选测定法
CN106075453A (zh) * 2016-07-12 2016-11-09 中国医学科学院基础医学研究所 一种抗肿瘤药物制剂组合
CN112118747A (zh) * 2017-12-08 2020-12-22 驰若莫塞尔公司 作为甜味剂的色氨酸衍生物
CN114375163A (zh) * 2019-06-12 2022-04-19 玉米产品开发公司 具有似糖特征的组合物

Also Published As

Publication number Publication date
WO2008068621A3 (fr) 2008-07-31
GB0624308D0 (en) 2007-01-17

Similar Documents

Publication Publication Date Title
WO2008068621A2 (fr) Produit de combinaison
US9782496B2 (en) Immunoconjugates for the treatment of tumours
AU2016203098B2 (en) Antagonists of activin-ActRIIa and uses for increasing red blood cell levels
AU2005317684B2 (en) Conjugation product
US20050074426A1 (en) Fusions of cytokines and tumor targeting proteins
RU2758139C2 (ru) Иммуноконъюгаты il2 и мутантного tnf
JP6466376B2 (ja) 鉄恒常性を制御するための組成物およびそれを用いる方法
JP7221545B2 (ja) ホスファチジルセリン標的化融合分子およびそれらの使用方法
CA2723823C (fr) Conjugues pour le traitement du mesotheliome
US20030181377A1 (en) Inhibition of VEGF receptor signaling reverses tumor resistance to radiotherapy
WO2008152508A2 (fr) Conjugué cytokinique
CA2504963C (fr) Conjugues de tnf et un ligand du recepteur cd13 utilises en combinaison avec des interferons gamma pour le traitement du cancer
WO2018219301A1 (fr) VARIANT DE LIGAND INDUISANT L'APOPTOSE LIÉ AU FACTEUR DE NÉCROSE DE TUMEURS CIBLÉ PAR PDGFRβ, SON PROCÉDÉ DE PRÉPARATION ET SON UTILISATION
EP2827908A2 (fr) Peptides
CN109503719B (zh) 一种plg和crd功能片段重组融合蛋白及其制备方法和抗癌药物
KR20210133947A (ko) 디프테리아 독소-인간 인터루킨-3 접합체를 다른 제제와 조합하여 사용해서 골수증식성 신생물을 치료하는 조합 치료 방법
CN111454909A (zh) 天然配体介导的多靶点识别可调控基因工程化免疫细胞的制备方法
AU2012202866A1 (en) Conjugation product

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07859330

Country of ref document: EP

Kind code of ref document: A2

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07859330

Country of ref document: EP

Kind code of ref document: A2