WO2008056325A2

WO2008056325A2 - Process for animal species identification in samples with genetic material based on mitochondrial dna size variation

Info

Publication number: WO2008056325A2
Application number: PCT/IB2007/054509
Authority: WO
Inventors: Filipe Adão MACEDO PEREIRA; Barbara Joana Koehler Van Asch; Maria Leonor RODRIGUES DE SOUSA BOTELHO DE GUSMÃO
Original assignee: Universidade Do Porto
Priority date: 2006-11-06
Filing date: 2007-11-06
Publication date: 2008-05-15
Also published as: PT103599B; PT103599A; WO2008056325B1; WO2008056325A3

Abstract

The present invention refers to a process for animal species identification in biological samples with genetic material of animal origin, based on variations in the size of mitochondrial 12s and 16s ribosomal RNA gene sequences. The method of this invention comprises a panel of oligonucleotide PCR (Polymerase Chain Reaction) primers, labelled with fluorescent dyes, for multiplex PCR amplification of seven mitochondrial DNA regions with insertion\deletion polymorphisms, allowing fragment size detection and analysis by automated capillary electrophoresis or similar techniques. The species identification is achieved by comparing the target sample profile (DNA fragment sizes) with pre-established standard species-specific fragment sizes. With the present invention is possible to detect and identify animal species in highly degraded biological samples due to the analysis of mitochondrial DNA, present in many copies per cell. This invention is advantageous when high throughput sample analyses are needed such as for large-scale species identification procedures in forensics, food quality control, ancient DNA, paleogenetics and ecology studies. Another aspect of the present invention relates to a kit containing reagents needed to practice the above-referred method.

Description

PROCESS FOR ANIMAL SPECIES IDENTIFICATION IN SAMPLES WITH GENETIC MATERIAL BASED ON MITOCHONDRIAL DNA SIZE VARIATION

Field of the Invention

[1] The present invention relates generally to animal species identification procedures in biological samples. More specifically, the invention refers to a process based on analysis of variations in the size of mitochondrial 12s and 16s ribosomal RNA gene sequences.

[2] The methods of the present invention permit the detection and identification of several species from highly degraded biological samples due to the simultaneous analysis of seven mitochondrial DNA regions - usually more frequent in biological tissues than nuclear DNA.

[3] The present invention is a useful diagnostic tool for large-scale animal species identification procedures in forensics, food quality control, ecology or archaeology. Summary of the Invention

[4] The present invention provides methods and materials f or the molecular identification of animal species using inter-specific DNA size variation in mitochondrial ubiquitous genes.

[5] More specifically, the present invention comprises a panel of oligonucleotide PCR

(Polymerase Chain Reaction) primers, labelled with fluorescent dyes, for the simultaneous PCR amplification of seven mitochondrial DNA regions with insertion\deletion polymorphisms. The seven amplified regions are located in the mitochondrial genes that encode the ribosomal RNA 12 and 16 subunits (12s and 16s ribosomal RNA). Size detection of PCR amplified products could be achieved by automated capillary electrophoresis or any other non-automated electrophoretic method.

[6] Another aspect of the present invention relates to a kit containing reagents needed to practice the method f or the molecular identification of animal species, which includes a kit comprising a panel of multiplexed oligonucleotides and which may also include conventional PCR reagents, enzymes, allelic ladders and control DNA.

[7] The species identification is carried out by combining the size of different amplified products in order to obtain species-specific codified profiles, which is subsequently compared with pre-established reference profiles for each species. Background of the Invention

[8] The discovery and development of methods for molecular species identification have gone through several phases of development over the last years. The first described methods were based on protein analysis, such as isoelectric focusing, protein precipitation or immunological reactions (Hsieh et al. 1998; Skarpeid et al. 1998). A number of features are known to limit the use of protein-based methods: the rapid protein degradation in samples under stress conditions, the scarcity of available antibodies for immunological reactions, the risk of cross-reactions with proteins from closely related species and the exclusive presence of certain proteins in particular cell types or tissues.

[9] Most of these limitations were overcome with the advent of DNA typing systems, mainly due to the high stability of nucleic acids, its presence in almost all biological tissues and its high information content.

[10] One of the first described DNA-based methods for molecular species identifications was based on hybridizations between a genomic or synthetic DNA probe and the DNA present in the target sample. Several limitations are related with the use of this method: a) it can not be applied to degraded samples because it requires high amounts of DNA; b) it does not allow the comparison of results between different labs because small changes in experimental conditions originate different results; c) species-specific probes are expensive and d) non-discrimination between closely related species are likely to occur due to non-specific DNA hybridizations.

[11] The development of the Polymerase Chain Reaction (PCR) technique had significantly improved the efficiency of laboratorial diagnostic procedures by allowing the in vitro formation of a large number of DNA copies (amplification) using as a template a specific genomic region. Therefore, several methods were developed using the PCR technique: Random Amplified Polymorphic DNA (RAPD), Mammalian- wide Interspersed Repeat Fingerprints, Restriction Fragment Length Polymorphism (PCR-RFLP) and DNA Sequencing (e.g. Lee and Chang 1994; Buntjer et al. 1999; Wolf et al. 1999; Parson et al. 2000 ).

[12] A major drawback of using RAPDs or Mammalian- wide Interspersed Repeat Fingerprints is the difficult interpretation of electrophoretic profiles produced by these techniques, particularly in cases where biological materials from different species are present in the same sample. A slightly different PCR primer pair originates a completely different profile. Moreover, these techniques are extremely dependent on variations in laboratorial conditions (such as PCR and electrophoresis settings) making it difficult to compare results from different labs.

[13] The PCR-RFLP method consists in the generation of species-specific profiles through the digestion of DNA extracted from the sample with, at least, one restriction enzyme, followed by an electrophoretic separation of the processed DNA fragments (e.g. Zehner et al. 1998; Wolf et al. 1999). A major disadvantage of this method is that the possible occurrence of polymorphisms at restriction sites may produce undigested DNA fragments and false results. Moreover, this method relies on just a few informative DNA sequence positions, meaning that, in some cases, several restriction enzymes are required to achieve a correct identification. The use of different enzymes makes it very difficult to interpret the complex RFLP pattern in those situations.

[14] The DNA sequence analysis is currently the most used method for molecular species identification, particularly the sequencing of mitochondrial DNA cytochrome b (CYT b) and cytochrome c oxidase (COI) genes (e. g. Zehner et al. 1998; Parson et al. 2000; Branicki et al. 2003). Some studies also reported the sequence analyses of nuclear DNA regions (e.g. Huang, 1997; Marcos, 2005). However, in order to be informative enough for a secure discrimination, most of these studies rely on the sequencing analysis of large DNA regions, usually over 300 base pairs (Bataille el al. 1999; Parson et al. 2000; Hsieh et al. 2000; Branicki et al. 2003). The PCR amplification of such large regions is difficult to obtain from samples with low quality and/or low amounts of DNA. Another disadvantage of the method described in these studies is the analysis of a single DNA region, since a failure in the amplification of that region due to, for instance, the occurrence of a polymorphism in a primer binding region, may originate a false or null result. Moreover, DNA sequencing methods do not allow the discrimination and identification of biological material from different species mixed in a same sample.

[15] In recent years, methods based on species-specific PCR primers have been described for species identification. For example, Kusama et al. (2005) proposed a method using species-specific PCR primers for the amplification of the mitochondrial ATP synthase subunit 8 gene. A severe limitation of this invention is the need for independent PCRs to detect each species that may be present in the target sample. Additionally, the method of Kusama et al. (2005) has limited application in forensic casework studies where only low amounts of the sample are usually available. An example of the potential use of this approach for identification of fish species was published by Donne-Gousse et al. (2005 e 2006).

[16] The present invention represents a significant improvement over existing methods, bringing increased power of discrimination and throughput sample analysis to molecular species identifications in biological samples containing genetic material.

[17] It has been widely demonstrated that certain regions of the mitochondrial DNA molecule are characterized by a higher mutational rate than that usually observed across the nuclear genome (Saccone et al. 2000). Accumulation of polymorphisms, either in coding or non-coding regions of the mitochondrial genome, could be divided into two different classes: single nucleotide polymorphism (SNP) and insertions/ deletions of single bases in a DNA sequence (also known as indel polymorphisms). Since polymorphisms are accumulated through independent events in separated lineages or species, they could be used to accurately identify and discriminate species.

[18] While base substitution polymorphism analysis is currently used in a variety of studies, such as evolutionary genetics, conservation biology and forensic human discrimination, the use of indel polymorphisms has been restricted mainly due to the low mutation rate of these polymorphisms. Nevertheless, a scenario of low mutation rate could be advantageous for species identification procedures since recurrent mutations or intra- specific polymorphisms are less likely to occur.

[19] Inspection of mitochondrial DNA sequence variation has been mentioned in a number of Patent Publications, but always within purposes unrelated to species identification. For instance, the aim of the invention of Tanaka (2003) is to identify human mitochondrial DNA cytochrome b sequence variants; in Morley and Grist (2005), to detect an aberrant population of cells and use them as clonal markers; and in Hirai (2005) to simply detect and quantitatively determine a mitochondrial point mutation (the A/G mutation at the 3243rd position of mitochondrial DNA). In none of these inventions was the analysis of mitochondrial fragment size variation claimed.

[20] The inspection of DNA size variation in repetitive polymorphic chromosomal regions (such as mini- and micro-satellites) has been widely used for individual identification, paternity testing and genetic mapping purposes. However, the materials and methods of the present invention are based on the analysis of DNA size variations resulting from a different class of polymorphisms: the insertion or deletion of nucleotides (indel polymorphisms).

[21] In a recent study, DNA size variations were used to identify fragments amplified by

PCR (Marcos, 2005). In order to achieve biological identification, this method requires the DNA sequencing analysis of amplified products. In marked contrast with our invention, the study of Marcos (2005) does not use a multiplex PCR technique or labelled PCR primers or any mitochondrial genomic region. Moreover, it only claims the analysis of cytoplasmic beta-actin gene regions and it is not supported by any population genetic study to identify possible intra-specific polymorphisms that may condition its use for species identification purposes. In a different study, Bellis et al. (2003) have already presented a similar technique using the nuclear gene TP53, but also with several differences when compared with our invention. General Description of the Invention

[22] The present invention is generally directed to species identification in biological samples with genetic material from one, or more, animal species. The present method is more specifically directed to the identification of domestic species, such as the Cat ( Felis catus), Cow (Bos taurus), Dog (Canis familiaris), Goat (Copra hircus), Horse ( Equus caballus), Mouse (Mus musculus), Pig (Sus scrofa), Rabbit (Oryctolagus cuniculus) and Sheep (Ovis aries), as well as to detect biological material of human origin. With this invention it is also possible to obtain profiles from non-mammalian species, such as from species of the class Aves.

[23] Additionally, it is an aim of the present invention to provide a kit containing reagents needed to perform the method described herein.

[24] As previously mentioned, accumulation of polymorphisms, either in coding or non- coding regions of the mitochondrial genome, could be divided into two different classes: single nucleotide polymorphism (SNP) or insertions/deletions of single bases in a DNA sequence (also known as indel polymorphisms). Since the accumulation of polymorphisms is an independent event in separated lineages or species, they could be used to an accurate identification and discrimination among them.

[25] While base substitution polymorphism analysis is currently used in a variety of studies, such as evolutionary genetic, conservation biology or forensic human discrimination, the use of indel polymorphism has been restricted mainly due to their low mutation rate. Nevertheless, a scenario of low mutation rate could be an advantage for species identification methodologies since recurrent mutations or intra-specific polymorphisms are less likely to occur.

[26] A search for patterns of nucleotide diversity throughout mammalian mitochondrial genes revealed several indel-rich regions interspersed with highly conserved domains on both 12s and the 16s ribosomal RNA genes (Pereira et al. 2003).

[27] With the purpose of developing a multiplex PCR system for detection of interspecific indel variants, we selected all mitochondrial DNA regions that complied with the following criteria: a) displayed high nucleotide diversity values; b) presented several inter-specific indel polymorphisms; c) were flanked by inter- specific conserved segments, suitable for the design of PCR primers with similar melting temperatures and without hairpin and primer-dimer interactions and d) predicted amplified products with different size ranges allowing their combination in a multiplex PCR. Three segments of the 12s ribosomal RNA gene, two of the 16s ribosomal RNA gene, one partially overlapping the Valine transfer RNA and 16s ribosomal RNA genes and one partially overlapping the Leucine transfer RNA and 16s ribosomal RNA genes, were found to comply with all these selective criteria and were combined into the final multiplex PCR reaction.

[28] Amplification of each of the seven mitochondrial regions was independently tested in

PCR singleplex reactions using samples from ten mammalian species. Under identical PCR conditions and annealing temperatures of 60⁰C all loci were successfully amplified. For the initial construction of the multiplex, all primers were combined and tested under annealing-temperature gradient PCRs (48° C - 64° C). Successful amplifications were obtained and confirmed with conventional electrophoresis and automated fluorescent DNA fragment size analysis for a kit including a panel of oligonucleotides for PCR amplification of these seven loci and all of the reagents necessary to perform the PCR multiplex.

[29] In some cases, traces of unspecific amplifications, as well as peaks resulting from cross-amplifications between primers designed for different loci, were detected but did not interfere with the final profile.

[30] The reliability of the present invention is based on the absence of intra-specific insertion/deletion polymorphisms. To address this question we determined the size of the seven selected loci in 84 samples. Successful amplifications were obtained for all loci, with exception of seven Capra hircus individuals for which no traces of amplified products were observed in one locus. Nevertheless, in those cases the remaining profile is informative enough for correct species identification.

[31] The automated fluorescent DNA fragment size analysis only revealed one intra- specific polymorphism in one locus of a Felis catus individual, but it did not mislead its identification.

[32] The design of PCR primers in highly conserved mitochondrial DNA regions significantly increases the probability of successful amplifications in a broad range of species. To address the possibility of applying this invention to other animal groups, we tested three animals from the class Aves. A different profile was obtained for the individuals of this class that could be used to preliminary identifications.

[33] Main differences between this invention and all available methods for molecular species identification are:

• Molecular species discrimination based on inter-specific indel polymorphisms;

• Multiplex PCR amplification of indel-rich mitochondrial DNA regions;

• Simultaneous analysis of seven indel-rich mitochondrial regions;

• A kit including all of the necessary reagents and containers to successfully practice the method;

• Possibility of fragment size detection and analysis with different techniques such as automated capillary electrophoresis, denaturing gel electrophoresis, DNA sequencing or pyrosequencing, DNA microarray, high-performance liquid chromatography (HPLC) or similar techniques;

• Antibodies, DNA probes, restriction enzymes, random PCR primers and/or DNA sequencing are not required.

[34] The fields of application of the method according to this invention are:

1. Forensic sciences. The possibility of using this invention for the identification of human remains from mixtures of animal origin in a large number of highly degraded biological materials is very useful in several forensic casework studies. The use of a less time-consuming, cost-effective and efficient multiplex PCR method is appropriate for a high throughput sample analysis, such as in cases resulting from large-scale natural and terrorist disasters. It is also appropriate for the post-mortem analysis of stomach contents or in the resolution of criminal forensic studies where animals and animal/human mixtures are involved.

2. Food sector. A number of recent epidemiological outbreaks, such as the Bovine Spongiform Encephalopathy (BSE) or the Avian Flu, as well as several cases of fraudulent description of contents on food product labels for human consumption have increased the importance of accurate species identification in the food industry. The applications of the present invention are very useful in this matter since they permit the detection and identification of animal species in highly processed food products, such as canned meat, sausages, milk and dairy products. Another possible application of the present invention is in the investigation of the composition of food products intended for animal consumption, particularly important after the BSE crisis concerning animal feed.

3. Ancient DNA, Paleogenetics and Ecology. The present invention is particularly useful in ancient DNA, paleogenetics and ecology studies because it allows the species identification in low-quantity and/or degraded DNA samples such as from bones, faeces, hairs or any other biological material.

[35] Most important advantages of the present invention are:

1. High sensitivity. Mitochondrial DNA is easier to retrieve from DNA samples than chromosomal DNA since it is present in many copies per cell, providing a clear advantage over nuclear genome-based analysis for species identification methods. In combination with a multiplex PCR typing system it is particularly useful for analysis of suboptimal DNA samples.

2. Appropriate for low-quantity and/or degraded DNA samples. The PCR analysis of short DNA fragments is more likely to generate conclusive results in degraded samples than the analysis of large fragments. The present invention comprises the PCR amplification of five loci with less than 350 base pairs. It also permits to estimate the degradation degree of the sample.

3. Increased genotyping efficiency. The use of a kit comprising a multiplex PCR system for co- amplification of seven regions considerably increases the discriminatory efficiency of the procedure by avoiding the complete absence of results due to the non- amplification of a region - an important limitation of methods relying on singleplex PCR reactions. Even with a non- amplification of some of the selected loci, the remaining are informative enough for an identification or, at least, to guide further research.

4. Suitability for the detection of mixtures. The methods presented in this invention and the corresponding kit allows to discriminate and identify biological material from different species present in the same sample - an important advantage over DNA sequencing methods. Moreover, with the present invention it is possible to determine the relative abundance of two or more species in a sample by comparing the areas of the species-specific peaks in the electropherogram of the automated fragment size analysis. This is particularly useful to detect biological contaminations and mixtures in samples.

5. Suitability for detection of a wide range of species. The design of PCR primers in highly conserved regions of the mitochondrial 12s and 16s ribosomal RNA genes is appropriate for obtain results in a broad range of mammalian and non-mammalian species, as demonstrated by the results obtained with avian samples. This system also allows further analyses, namely by confirmatory or exploratory sequencing of the obtained amplicons, in the cases were initial identification is impossible.

6. Cost-effectiveness. The simultaneous amplification of all loci in a multiplex PCR kit, the fluorescent labelling of PCR primers for automated DNA fragment size analysis and the use of allelic ladders for a reliable fragment- size determination make this invention highly advantageous when a high throughput sample analysis is needed. With this method and corresponding kit it is possible to perform a few hundred assays per day with a reduced cost per sample.

Detailed Description of the Invention

[36] 1. Analysis of mammalian mitochondrial DNA reference sequences

All publicly available mammalian mitochondrial DNA complete reference sequences (n=123) were assembled into a single database in order to identify indel-rich regions (responsible for inter- specific sequence size differences) interspersed with conserved segments (identical regions in different species suitable for PCR primers design). Sequence alignments of the two ribosomal RNA genes and the 13 protein coding mitochondrial genes were performed using the Clustal W software (Thompson et al. 1994). Nucleotide diversity (π) and theta (θ) per site were assessed using a sliding window scan across these genes in 100 base pairs windows, overlapped by 1 base pair, implemented by the DNAsp ver. 4.10.2 software (Rozas et al. 2003).

[37] 2. Multiplex PCR primers design

For a broad range of species amplification, PCR primers were designed within the mitochondrial DNA conserved regions previously identified in the mammalian sequence alignment. Primers were designed with similar melting temperatures (T _m ~60°C) in order to achieve balanced PCR amplifications in the multiplex reaction. Candidate primers were checked for potential hairpin and primer-dimer interactions using the Oligo Calculator version 3.07 software (http://www.basic.northwestern.edu/biotools/oligocalc.html) and the screening for potential cross-reactivity among all primer pairs was performed using the AutoDimer version 1.0 program (Vallone and Butler 2004).

Degenerate primers were designed for some mitochondrial loci in order to avoid possible non-amplification due to the presence of inter- specific polymorphism within primer binding sites. For detection of PCR products, some primers were 5' end labelled with 6-Carboxyfluorescein (6-FAM), 6-Carboxy-2'-, 4-, 7-, 7'-tetrachlorofluorescein (TET) and 6-Carboxy-2'-, 4-, 4'-, 5'-, 7-, 7'-hexachlorofluorescein (HEX) fluorescent dyes. All primers were purchased from Thermo Electron Corp. ( Waltham , MA , USA ) with Reversed Phase HPLC purification. [38] 3. Sample collection and DNA extraction

The test the reliability of the present invention we analysed 84 mammalian samples: domestic cat (Felis catus; n=10), cow (Bos taurus; n=6), dog (Canis familiaris; n=10), goat (Capra hircus; n=10), horse (Equus caballus; n=2), mouse (Mus musculus; n=10), pig (Sus scrofa; n=6), rabbit (Oryctolagus cuniculus; n=10), sheep (Ovis aries; n=10) and humans (Homo sapiens; n=10). An avian species (Gallus gallus, n=3J was also tested with this invention. DNA was extracted from dried blood on FTA paper (Whatman, Clifton , NJ , USA ), buccal swabs, soft tissue and liver. Extraction methods used were Chelex (Biorad, Hercules , CA , USA ), phenol-chloroform and saline protocols. [39] 4. Optimization of multiplex PCRs

Each locus was initially tested in a PCR singleplex reaction in order to evaluate the amplification specificity using 2 μl of extracted DNA in a 12.5 μl reaction volume containing 1.25 μl of 1OX PCR buffer, 0.25 μl of the four dNTPs (0.2 mM each), 1.0 μl of MgCl₂ (25 mM), 1.25 μl of each primer (2.5 μM), and 0.1 μl of Taq polymerase (BIORON GmbH). After a 95⁰C pre-incubation step of 2 minutes, PCR amplifications were performed for a total of 35 cycles by using the following conditions: denaturation at 95⁰C for 30 seconds, annealing at 6O⁰C for 30 seconds, and extension at 72⁰C for 1 minute, with a final extension step of 10 minutes at 72⁰C.

Multiplex PCRs were performed by combining 2 μl of extracted DNA, 1 μl of a primer mix (2 μM of each primer) and 5 μl of Multiplex PCR Master Mix (QIAGEN) carried out in a 10 μl final volume. PCR reactions were performed as follows: initial denaturation step at 95⁰C for 15 minutes, followed by 10 cycles of 30 seconds at 94⁰C, 1 minute and 30 seconds at 6O⁰C, and 1 minute at 72⁰C and 20 cycles of 30 seconds at 94⁰C, 1 minute and 30 seconds at 58⁰C, and 1 minute at 72⁰C with a final extension step of 50 minutes at 72⁰C.

Successful amplifications were obtained with a kit including a panel of oligonucleotides for PCR amplification of these seven loci and all of the reagents necessary to perform the PCR multiplex, such as purified water, buffers, magnesium chloride, dNTP's and DNA polymerase enzymes. [40] 5. Allelic ladders construction

Amplified products of each allele were mixed together and its concentration optimized to produce single ladders for each locus. Each allelic ladder was then re- amplified to increase the final stock volume. [41] 6. Detection and analysis of PCR products

Samples were prepared for fragment-size detection by adding 1 μL of PCR product to 15 μL deionized formamide containing 0.75 μL GeneScan™ 500 TAMRA size standard. The separation and detection of PCR products were accomplished with the ABI Prism™ 310 Genetic Analyzer (Applied Biosystems, Foster City, CA) using filter set C with 6-FAM, TET and HEX. Sizing was performed using the GeneScan™ 350 TAMRA size standard and the ABI Prism™ GeneScan™ v3.1.2 software package (Applied Biosystems). [42] 7. Species identification

The identification of a species using the present invention is achieved by comparing the obtained target sample profile (the combination of the sizes of the seven mitochondrial regions under scrutiny) with the species-specific standard codes, previously obtained from the population study with 84 mammalian samples. Determination of amplified DNA fragment sizes could be performed by automated capillary electrophoresis, denaturing gel electrophoresis, DNA sequencing or pyrosequencing, DNA microarray, high-performance liquid chromatography (HPLC) or similar techniques. Definitions

[43] The following definitions are intended to assist in providing a clear understanding of the scope and detail of the terms: Allele one of two, or more, alternative forms of a DNA sequence occupying the same locus. Allelic ladder a standard size marker consisting of amplified alleles from a locus.

Amplicon the DNA product of a polymerase chain reaction.

DNA polymorphism the condition in which two, or more, different nucleotide sequences of a gene, or any other genomic region, coexist in the same population. DNA sequencing a technique for determining the order of nucleotide bases in a segment of DNA. Electrophoresis a method of separating large molecules (such as DNA fragments or proteins) from a mixture of similar molecules in an electric field across a porous medium. Homologous DNA regions DNA regions that could be compared in different species.

Indel (insertion/deletion) an insertion or deletion of one, or more, nucleotides in a DNA sequence.

Locus (plural, loci) a specific position on a genome.

Mitochondrial DNA DNA molecule located in the mitochondrial organelle and genetically independent from nuclear genome.

Multiplex PCR a PCR technique where more than one primer pair is included in a single reaction tube allowing different DNA targets to be simultaneously amplified.

PCR Primer a single- stranded DNA or RNA fragment which hybridizes with a template DNA strand of a locus in order to initiate the synthesis of a new DNA strand by the enzymatic action of DNA polymerase. Polymerase chain reaction (PCR) a technique in which cycles of de- naturation, annealing with PCR primers and extension with DNA polymerase are used to exponentially amplify the number of copies of a target DNA sequence.

SNP (Single Nucleotide Polymorphism) a DNA sequence variation that involves a change in a single nucleotide. References [44] Bataille,M., Crainic,K., Leterreux,M., Durigon,M., and de Mazancourt,P. 1999.

Multiplex amplification of mitochondrial DNA for human and species identification in forensic evaluation. Forensic Sci. Int., 99(3): 165-170. [45] BeIUs₅C, Ashton,KJ, Freney,L, Blair,B, Griffiths,LR. 2003. A molecular genetic approach for forensic animal species identification. Forensic Sci Int., 134(2-3):99-108. [46] Branicki,W., Kupiec,T., and Pawlowski,R. 2003. Validation of cytochrome b sequence analysis as a method of species identification. J. Forensic Sci., 48(1): 83-87. [47] BuntjerJ.B., Lamine,A., Haagsma,N., and LenstraJ.A. 1999. Species identification by oligonucleotide hybridisation: the influence of processing of meat products. Journal of the Science of Food and Agriculture, 79(1): 53-57. [48] Donne-Gousse,C, Laudet,V., Hanni,C. 2005. Method for detecting material from gadiform fish, useful for detecting adulteration of foods, based on amplification of mitochondrial DNA, also new oligonucleotides and amplicons. Patent n° FR2858631. [49] Donne-Gousse,C, Laudet,V., Hanni,C. 2006. Method for detecting and identifying the presence of biological materials derived from fish and oligonucleotides therefor. Patent n° US2006166195. [50] Hirai M. 2005. Method Of Detecting Or Quantitatively Determining Mitochondrial

Dna 3243 Variation, and Kit Therefor. Patent n° EP 1619258. [51] Hsieh,H.M., Chiang,H.L., Tsai,L.C, Lai,S.Y., Huang,N.E., Linacre,A., and LeeJ.C.

2001. Cytochrome b gene for species identification of the conservation animals.

Forensic Sci. Int., 122(1): 7-18. [52] Huang, Wai Mun. 1997. Method and compositions for identification of species in a sample using type II topoisomerase sequences. Patent n° US5645994. [53] Kusama,T., Kadowaki,K., Nomura T. 2005. Oligonucleotide sequences that identify species of animal. Patent n° US2005233334. [54] LeeJ.C. e Chang J.G., 1994. Random amplified polymorphic DNA polymerase chain reaction (RAPD PCR) fingerprints in forensic species identification. Forensic Sci. Int.,

67(2): 103-107. [55] MarcosJ. R. 2005. Method for identifying biological species. Patent n°

WO2005040423. [56] Morley,A. A, e Grist,S. A. 2005. The use of mitochondrial point mutations as sensitive clonal markers. Patent n° WO2005103289. [57] Parson,W., Pegoraro,K., Niederstatter,H., Foger,M., and Steinlechner,M., 2000.

Species identification by means of the cytochrome b gene. Int. J. Legal Med., 114(1-2):

23-28.

[58] Pereira, F., Meirinhos J., Amorim A., Pereira L., 2006. Analysis of inter-specific mitochondrial DNA diversity for accurate species identification' Progress in Forensic

Genetics 11. 1288: 103- 105. [59] Rozas J., Sanchez-DelBarrioJ.C, Messeguer,X., and Rozas,R., 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics., 19(18):

2496-2497. [60] Saccone,C, Gissi,C, Lanave,C, Larizza,A., Pesole,G., and Reyes,A. 2000.

Evolution of the mitochondrial genetic system: an overview. Gene, 261(1): 153-159. [61] Skarpeid,HJ., Kvaal,K., and Hildrum,K.I. 1998. Identification of animal species in ground meat mixtures by multivariate analysis of isoelectric focusing protein profiles.

Electrophoresis, 19(18): 3103-3109. [62] Tanaka,M. 2003 . Gene Detection Method Using Human Mitochondrial DNA. Patent n° WO03033737. [63] ThompsonJ.D., Higgins,D.G., and Gibson,TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22(22):

4673-4680. [64] Vallone,P.M. and Butler ,J.M. 2004. AutoDimer: a screening tool for primer-dimer and hairpin structures. Biotechniques, 37(2): 226-231. [65] WoIf₅C, RentschJ., and Hubner,P., 1999. PCR-RFLP analysis of mitochondrial

DNA: a reliable method for species identification. J. Agric. Food Chem., 47(4): 1350-1355.

[66] Zehner,R., Zimmermann,S., and Mebs,D., 1998. RFLP and sequence analysis of the cytochrome b gene of selected animals and man: methodology and forensic application. Int. J. Legal Med., 111(6): 323-327.

Claims

[1] A method for molecular detection and identification of animal species characterized in that polymorphic insertion and deletion of nucleotides are analysed in mitochondrial DNA 12s and 16s ribosomal RNA genes, amplified in a multiplex polymerase chain reaction (PCR), or similar technique, with a PCR primer set, wherein the size of amplified DNA fragments is determined by automated capillary electrophoresis, denaturing gel electrophoresis, DNA sequencing or pyrosequencing, DNA microarray, high-performance liquid chromatography (HPLC) or similar techniques, and the species identification is achieved by comparing the size of DNA fragments from the sample with genetic material of unknown origin with pre-established standard DNA fragment sizes obtain from reference samples with genetic material of known origin.

[2] A method for molecular detection and identification of animal species, according to claim 1, characterized by the following steps: a) sample collection; b) sample DNA extraction; c) identification of polymorphic regions with insertion or deletion of nucleotides, interspersed with inter- specific conserved regions; d) PCR primers design; e) singleplex or multiplex PCRs; f) allelic ladders construction; g) analysis of DNA fragments sizes, determined in base pairs or any other measure, from insertion/deletion polymorphic regions by means of automated capillary electrophoresis or other non-electrophoretic method; h) identification of a species by comparing the target sample profile (DNA fragment sizes) with standard species-specific fragment sizes, previously obtained in a population study.

[3] A method for molecular detection and identification of animal species according to any preceding claim, wherein the samples to be investigated contain genetic material, in particular DNA.

[4] A method for molecular detection and identification of animal species according to any preceding claim, wherein the DNA to be investigated is isolated from biological tissues or isolated cells, such as from soft tissue, liver, blood, buccal swabs, sperm or urine of one or more individuals.

[5] A method for molecular detection and identification of animal species according to claims 1 and 2, characterized in that identification of DNA regions with polymorphic insertion and deletion of nucleotides, interspersed with inter- specific conserved regions, is performed with computer software using reference DNA sequences from different species.

[6] A method for molecular detection and identification of animal species according to claims 1 and 2, wherein PCR primers are design in inter- specifically conserved region of mitochondrial 12s and 16s ribosomal RNA genes, by means of reference DNA sequence alignments from target species.

[7] A method for molecular detection and identification of animal species according to claim 6, wherein PCR primers are designed with similar PCR melting temperatures to achieve balanced amplifications in a multiplex PCR.

[8] A method for molecular detection and identification of animal species according to claims 6 and 7, wherein at least one PCR primer is labelled with fluorescent dyes.

[9] A method for molecular detection and identification of animal species according to claim 8, characterized in that PCR primers are 5' end labelled with 6-Carboxyfluorescein (6-FAM), 6-Carboxy-2'-, 4-, 7-, 7'-tetrachlorofluorescein (TET) and 6-Carboxy-2'-, 4-, 4'-, 5'-, 7-, 7'-hexachlorofluorescein (HEX) fluorescent dyes.

[10] A method for molecular detection and identification of animal species according to any of claims 6 to 9, wherein degenerate PCR primers are designed in order to avoid possible non- amplification due to the presence of insertion, deletion or substitution polymorphisms within primers binding sites.

[11] A method for molecular detection and identification of animal species according to claim 10, characterized in that at least one of the following oligonucleotides is used as PCR primers:

5 CCCCACGGGAAACAGCAG3', 5 CCCC ACGGG ACTC AGC AG3', 5 CCCCAAGGGATACAGCAG3', 5 CCCC ACGGG AG AC AGC AG3'; 5ΑCAATAGCTAAGACCCAAACTG3',

5ΑCGATAGCTAAGGCCCAAACTG3'; 5'GGTTTGCTGAAGATGGCGGS'; 5'GGCAAGAAATGGGCTACATTTTCS',

5'GGGAAGAAATGGGCTACATTCTCS'; 5'GGTGACGGGCGGTGTGTS'; 5'GGTAAGTGTACTGGAAAGTGS', 5'GGTAAGCATACCGGAAGGTGS'; S'TAGCTCGTCTGGTTTCGGGS'_Ϊ S'GGCCTAAAAGCAGCCACCAATS', 5'GGCCTAAAAGCAGCCATCAAT3'; 5 'TTTTTGGT A A AC AGGCGGGG 3'; S'GACGAGAAGACCCTATGGAGS'ϊ S'TCCGAGGTCGCCCCAACCS', 5'GGGTTTACGACCTCGATGTTGS¹J S¹GCGATTACCGGGCTCTGCS', 5'GCAGTTACCGGGCCCTG3', 5'GCAATTTCCTGGCTCTGC3'.

[12] A method for molecular detection and identification of animal species according to claims 1 and 2, wherein a multiplex PCR technique is used.

[13] A method for molecular detection and identification of animal species according to claims 1 and 2, wherein a singleplex PCR technique is used.

[14] A method for molecular detection and identification of animal species according to claims 1 and 2, wherein allelic ladders for each locus are constructed by combining amplified PCR products of each identified allele in an optimized solution.

[15] A method for molecular detection and identification of animal species according to claims 1 and 2, wherein detection of amplified DNA fragment sizes is performed by automated capillary electrophoresis, denaturing gel electrophoresis, DNA sequencing or pyrosequencing, DNA microarray, high- performance liquid chromatography (HPLC) or similar techniques.

[16] A method for molecular detection and identification of animal species according to claims 1 and 2, wherein the species identification is achieved by comparing the size of DNA fragments amplified from the genetic material of unknown origin in a sample with pre-established standard DNA fragment sizes obtained from reference samples containing genetic material of known origin.

[17] A method for molecular detection and identification of animal species according to any preceding claim, characterized in that DNA fragment-size variation resulting from insertion/deletion nucleotide polymorphisms are analyzed in mitochondrial DNA 12s and 16s ribosomal RNA genes.

[18] A method or use for molecular detection and identification of animal species according to claim 17, further characterized in that PCR amplification of short mitochondrial DNA fragments is used.

[19] A method or use for molecular detection and identification of animal species according to claims 17 and 18, wherein quantitative and/or qualitative detection and identification of genetic material is achieved in samples containing a mixture of biological material from different species.

[20] A method or use for molecular detection and identification of animal species according to claim 19, wherein degraded or non-degraded biological samples are analyzed, such as blood, saliva, bones, faeces, hairs and mixtures of any of the biological materials listed above.

[21] A method or use for molecular detection and identification of animal species according to any of claims 17 to 20, for applications in forensics, food industry sector, ecology and archaeology.

[22] A kit for species identification procedures, according to the previous claims, comprising at least one oligonucleotide PCR primer capable of specifically priming at mitochondrial DNA regions with or surrounding insertion/deletion polymorphisms, a panel of allelic ladders, a DNA polymerase, a supply of PCR- suitable dNTP's and additional reagents necessary to perform a PCR.