JP5641465B2 - Single nucleotide repeat polymorphism analysis method and single nucleotide polymorphism analysis method - Google Patents

Description

  The present invention relates to a single nucleotide repeat polymorphism and a method for analyzing a single nucleotide polymorphism. More specifically, the present invention uses a genotyping marker to analyze the number of repeats in a single nucleotide repeat polymorphism, and to analyze a single nucleotide polymorphism existing in the vicinity of a single nucleotide repeat. About.

  The nucleic acid of a certain organism such as genome or mRNA contains genetic information about that organism. Genetic sequence changes between individuals account for many obvious phenotypic differences (eg pigmentation of hair, skin, etc.) and many non-obvious things (eg drug resistance and disease susceptibility) Is possible. Even minor changes in nucleotide sequences, such as single base pair substitutions that make up a DNA polymorphism, can have a significant effect on the nature or amount of a protein.

  DNA polymorphisms exist within and between genes throughout the genome, and various types may or may not result in different gene functions. Differences in gene function are determined by comparing two distinct types of functions of the same sequence. Most polymorphisms do not alter gene function and in such cases are referred to as neutral mutations, or neutral polymorphisms. Other mutations affect gene function, for example, by changing the amino acid sequence of the protein, or by changing regulatory sequences such as promoters or RNA splicing or degradation signals. DNA polymorphisms that affect gene function may be involved in the disease. That is, in addition to inducing or influencing disease states, mutations may also result in altered pathogenicity of the pathogen, or the patient's susceptibility to disease and resistance to treatment.

  The ability to detect specific nucleotide changes or specific mutations within a DNA sequence is useful for many medical or non-medical purposes. Methods that can identify nucleotide changes allow screening and diagnosis of diseases associated with DNA polymorphisms. Polymorphisms are also useful in genetic research to identify genes involved in disease. When a polymorphism changes the function of one or more genes to increase susceptibility to the disease, such polymorphism is higher in individuals with the disease than in individuals without the disease. Will exist in frequency. Statistical methods can be used to assess the frequency of polymorphisms observed in affected populations when compared to normal populations, and to establish causal relationships between polymorphisms and disease phenotypes Can be made easier. Methods that can rapidly identify sequence mutations that correlate with disease are also valuable in taking prophylactic measures, examining the probability of disease onset, and assessing the prognosis of such diseases.

  Neutral mutations accumulate at a constant rate over time because they are not subject to natural selection. This is the basis for the use of neutral mutation as a molecular clock. DNA polymorphism (neutral polymorphism) due to neutral mutation is used, for example, for phylogenetic analysis from microorganisms to higher organisms, or for detection of specific strains. Polymorphisms that have a sufficiently low frequency of mutation within a certain period and are estimated to have no problem in use are used for DNA identification and forensic analysis of plant varieties.

  Among DNA polymorphisms, a single nucleotide change in genomic DNA, which is the smallest unit, is referred to as a single nucleotide polymorphism or simply SNP (Single Nucleotide Polymorphism). Central to the usefulness of genetic polymorphisms such as SNPs is the ability to determine an individual's genotype with respect to known polymorphisms. Many approaches have been made to this problem. For example, some polymorphisms accidentally result in a change at the restriction endonuclease cleavage site, thereby changing the pattern of fragments observed when electrolyzing digested genomic DNA samples. This can be detected by restriction enzyme fragment length polymorphism analysis, ie RFLP analysis.

  Single strand conformation polymorphism (SSCP) analysis can also detect SNPs in amplified DNA fragments. In this method, the amplified fragment is denatured and then re-annealed during electrophoresis in a non-denaturing polyacrylamide gel. The presence of single nucleotide sequence changes can result in a detectable change in conformation and mobility in sample electrophoresis when compared to wild-type sequences.

  Hybridization-based methods use allele-specific oligonucleotide (ASO) probes (see, for example, Patent Documents 1 and 2). Hybridization-based methods include, for example, detection based on ribonuclease A cleavage at a mismatch in probe RNA: sample DNA duplex or denaturing gradient gel electrophoresis for mismatch in probe DNA: sample DNA duplex (non-) (Patent Documents 1 and 2).

  Other SNP genotyping methods include allele specific amplification (see, for example, patent documents 3-5), mini-sequencing methods, quantitative RT-PCR methods (eg the so-called “TaqMan assay”); , Gelfand US Pat. No. 6,099,086, Livak et al. US Pat. No. 5,056,086, and Haaland US Pat. No. 5,6,6, and Non-Patent Documents 3-6), and 1 nucleotide primer extension (SNuPE) assay (eg, US Pat. Assays are used (eg, US Pat.

  Capillary electrophoresis (CE) has been used for the analysis of SNPs. In one study, CE was used to analyze the results of a single nucleotide polymerase extension assay (7). In that study, PCR involving known SNPs was accomplished by hybridization of primers directly adjacent to the polymorphic site and extension of the primer with a single fluorescently labeled chain terminator, followed by CE separation and detection of the incorporated label. (Polymerase Chain Reaction) Amplified DNA is analyzed. In another study, PCR amplified DNA containing known SNPs was extended using one of two identically fluorescently labeled chain terminators, followed by CE separation and detection of incorporated label. The identity of the incorporated terminator is determined based on sequence-specific differences in CE mobility for oligonucleotides. Non-Patent Document 8 describes a SNP genotyping assay that includes PCR using a set of two different fluorescently labeled primers that have a common upstream primer and differ at the 3 ′ end base, followed by CE and fluorescence detection. ing.

  U.S. Patent No. 6,057,059 teaches the use of CE for simultaneous separation of molecules distributed into subsets according to graph theory techniques and the application of this method to SNP genotyping. U.S. Patent No. 6,057,059 describes the use of CE in a SNP detection method that uses the exonuclease activity of a polymerase to release a fluorescent label from a primer hybridized to a polymorphic site. U.S. Patent No. 6,057,059 also describes the use of CE separation in a SNP genotyping method involving nucleic acid probe depolymerization activity. U.S. Patent No. 6,057,031 describes a sequencing method that produces organically tagged fragments where the tag correlates to a particular nucleotide. Fragments are separated by CE, then the tag is cleaved from the fragment, and the cleaved tag is detected by non-fluorescence spectral analysis or potentiometry. Patent Document 19 describes the use of CE in a SNP detection method that uses a depolymerization activity that releases an identifying nucleotide from a primer hybridized to a polymorphic site.

  A genetic polymorphism found in a small unit as in SNP includes microsatellite. This is an area having adjacent repeats (tandem repeats) of short identical sequence repeat units, also called SSR (Sort Sequence Repeat or Simple Sequence Repeat) or STR (Short Tandem Repeat). Tandem repeats within the genome sequence have come to be referred to as satellites because they are involved in the formation of so-called satellite bands formed in the fractionation of eukaryotic genomic DNA by density gradient centrifugation. Since the initially detected repeating unit was several hundred bp, in general, one having a smaller repeating unit of about 10 to 100 bp is smaller than that of a minisatellite, and that having a smaller repeating unit of about 1 to 13 bp is a microsatellite. It is called. Microsatellites such as SSR were previously thought not to exist in prokaryotes, but have been found to exist in prokaryotes in the process of sequence analysis of various genes. There may be diversity in the number of repeating units in a satellite. At present, in addition to eukaryotes, many prokaryotes whose genomes have been analyzed by the Genome Project can use satellites for genotyping using this diversity. For example, microsatellite is useful for identifying genotypes of varieties in plants, and minisatellite is useful for identifying genotypes of microorganisms (Non-patent Document 9).

  Since many SSRs are often about 100 to 200 bp in a region including the entire SSR, the number of repeats is specified by comparing the lengths of products using PCR amplification. However, when the repetitive unit is a single base, it is relatively difficult to identify a polymorphism by comparing PCR product lengths. In such a case, it is necessary to specify the number of iterations using the same method or sequence method as the above SNP analysis.

European Patent Publication EP-237362 European Patent Publication No. EP-329311 US Pat. No. 5,521,301 US Pat. No. 5,639,611 US Pat. No. 5,981,176 US Pat. No. 5,210,015 US Pat. No. 5,538,848 US Pat. No. 5,863,736 US Pat. No. 5,846,710 US Pat. No. 6,004,744 US Pat. No. 5,888,819 US Pat. No. 5,856,092 US Pat. No. 5,710,028 US Pat. No. 6,013,431 US Pat. No. 6,074,831 US Pat. No. 6,322,980 US Pat. No. 6,270,973 US Pat. No. 6,312,893 US Pat. No. 6,156,178

Landegren et al., Science 242: 229-237, 1988. Rossiter et al. Biol. Chem. 265: 12753-12756, 1990 Heid, C.I. A. Et al., Genome Research 6: 986-994 (1996). Gibson, U. E. M.M. Et al., Genome Research 6: 995-1001 (1996). Holland, P.M. M.M. Et al., Proc. Natl. Acad. Sci. USA 88: 7276-7280 (1991) Livak, K .; J. et al. Et al., PCR Methods and Applications 357-362 (1995). Piggee et al., 1997, J. MoI. Chromatography A. 781: 367-375 McClay et al., 2002, Anal. Biochem. 301: 200-206) Animal Health Institute Research Report No. 109, pp. 25-32 (2002) (http://ss.niah.affrc.go.jp/publication/kenpo/2002/109-4.pdf)

  In SSR, when the repetitive unit is a single base, it is difficult to easily identify a genotype by comparing PCR product lengths. The SNP analysis method or sequence method considered as an alternative is often complicated in operation, and the validity of the technique may be required in terms of stability and reproducibility. Moreover, when the target organism is a microorganism, individuals having a plurality of types of genotypes may be mixed in a single specimen. In such a case, it becomes more difficult to determine the number of repeats of the single nucleotide repeat polymorphism. In addition, when a single nucleotide polymorphism is present in the vicinity of a single nucleotide repeat polymorphism, the influence of the diversity of the number of repeats in the single nucleotide repeat is also assumed, so the conventional single nucleotide that depends on the size of the amplification product, etc. It was difficult to analyze with the polymorphic analysis method.

  In order to solve the above-described problems in SSR analysis and SNP analysis, the present inventors have conceived that a genotyping marker corresponding to a region containing a single nucleotide repeat polymorphism is prepared and separated together with a test sample. Completed the invention.

Specifically, the present invention has the following features.
[1] A method for analyzing the number of repeats in a single nucleotide polymorphism, comprising the following steps:
(A) preparing a genotyping marker comprising two or more types of labeled nucleic acid fragments corresponding to a nucleic acid region known to produce a single nucleotide repeat of interest, the genotyping Each nucleic acid fragment contained in the marker has a sequence with a different number of repeats in the single base repeat;
(B) a step of preparing a test nucleic acid fragment by amplifying a region corresponding to the nucleic acid fragment contained in the genotyping marker in the test nucleic acid using a PCR method, wherein the test nucleic acid fragment is the gene A step of labeling with a labeling substance different from the nucleic acid fragment in the type determination marker,
(C) mixing the genotyping marker with the test nucleic acid fragment and subjecting it to separation, and (d) comparing the mobility of the test nucleic acid fragment with the mobility of the nucleic acid fragment in the genotyping marker. And determining the number of repeats in a single base repeat of interest in the test nucleic acid fragment.

[2] A method for analyzing the number of repeats in a single nucleotide polymorphism, comprising the following steps:
(A) preparing a genotyping marker comprising two or more types of labeled nucleic acid fragments corresponding to a nucleic acid region known to produce a single nucleotide repeat of interest, the genotyping Each nucleic acid fragment contained in the marker exhibits a behavior similar to that of a nucleic acid fragment having a sequence having a different number of repeats in the single base repeat in the subsequent separation process,
(B) a step of preparing a test nucleic acid fragment by amplifying a region corresponding to the nucleic acid fragment contained in the genotyping marker in the test nucleic acid using a PCR method, wherein the test nucleic acid fragment is the gene A step of labeling with a labeling substance different from the nucleic acid fragment in the type determination marker,
(C) mixing the genotyping marker with the test nucleic acid fragment and subjecting it to separation, and (d) comparing the mobility of the test nucleic acid fragment with the mobility of the nucleic acid fragment in the genotyping marker. And determining the number of repeats in a single base repeat of interest in the test nucleic acid fragment.

[3] A method for analyzing a single nucleotide polymorphism existing in the vicinity of a single nucleotide repeat, comprising the following steps:
(A) a step of preparing a genotyping marker comprising two or more kinds of labeled nucleic acid fragments corresponding to a nucleic acid region known to produce a single nucleotide polymorphism of interest, the genotype Each nucleic acid fragment contained in the determination marker has a sequence having a different number of repeats in a single nucleotide repeat existing in the vicinity of the single nucleotide polymorphism;
(B) a step of preparing a test nucleic acid fragment by amplifying a region corresponding to the nucleic acid fragment contained in the genotyping marker in the test nucleic acid using a PCR method, wherein the test nucleic acid fragment is the gene A step of labeling with a labeling substance different from the nucleic acid fragment in the type determination marker,
(C) mixing the genotyping marker with the test nucleic acid fragment and subjecting it to separation, and (d) comparing the mobility of the test nucleic acid fragment with the mobility of the nucleic acid fragment in the genotyping marker. The method as described above, comprising a step of determining a target single nucleotide polymorphism in the test nucleic acid fragment.

[4] A method for analyzing a single nucleotide polymorphism existing in the vicinity of a single nucleotide repeat, comprising the following steps:
(A) a step of preparing a genotyping marker comprising two or more kinds of labeled nucleic acid fragments corresponding to a nucleic acid region known to produce a single nucleotide polymorphism of interest, the genotype Each nucleic acid fragment contained in the determination marker exhibits a behavior similar to that of a nucleic acid fragment having a sequence having a different number of repeats in a single nucleotide repeat existing in the vicinity of the single nucleotide polymorphism in the subsequent separation process. Step,
(B) a step of preparing a test nucleic acid fragment by amplifying a region corresponding to the nucleic acid fragment contained in the genotyping marker in the test nucleic acid using a PCR method, wherein the test nucleic acid fragment is the gene A step of labeling with a labeling substance different from the nucleic acid fragment in the type determination marker,
(C) mixing the genotyping marker with the test nucleic acid fragment and subjecting it to separation, and (d) comparing the mobility of the test nucleic acid fragment with the mobility of the nucleic acid fragment in the genotyping marker. The method as described above, comprising a step of determining a target single nucleotide polymorphism in the test nucleic acid fragment.

[5] The method according to any one of [1] to [4] above, wherein the nucleic acid fragment is a DNA fragment.
[6] The method according to any one of [1] to [5] above, wherein the nucleic acid region is a genomic region.
[7] The nucleic acid fragment in the genotype determination marker according to any one of the above [1] to [6], wherein each nucleic acid fragment has a sequence that is different by 1 in the number of repetitions in the target single-base repeat. Method.
[8] The method according to any one of [1] to [7], wherein the separation treatment is performed by capillary electrophoresis.
[9] The method according to any one of [1] to [8] above, wherein the nucleic acid fragment in the genotyping marker is labeled with one kind of labeling substance.
[10] The method according to any one of [1] to [9], wherein the label is a fluorescent label.
[11] The method according to any one of [1] to [10] above, wherein the nucleic acid region is a bacterial genomic region.
[12] The method according to [11] above, wherein the bacterium is Johne bacteria.
[13] Any one of the above [1] to [12], wherein the nucleic acid region comprises a sequence shown in SEQ ID NO: 1 or 2 or a sequence that hybridizes with a complementary strand of the sequence under stringent conditions The method described in one.
[14] including two or more kinds of labeled nucleic acid fragments corresponding to a nucleic acid region known to produce a single nucleotide polymorphism of interest or a single nucleotide polymorphism existing in the vicinity of the single nucleotide repeat To analyze the number of repeats or single nucleotide polymorphisms in a single nucleotide repeat polymorphism comprising at least a genotyping marker and a primer pair for amplifying a nucleic acid region corresponding to a nucleic acid fragment contained in the genotyping marker Kit.

  According to the present invention, single nucleotide repeat polymorphisms of organisms can be easily analyzed at the level of 1 repeat. It is also possible to analyze a sample in which individuals having multiple types of genotypes are mixed. Furthermore, simple analysis of single nucleotide polymorphisms existing in the vicinity of single nucleotide repeats becomes possible. This facilitates genotype analysis of plant varieties and high-throughput genotype analysis of microorganisms including pathogenic bacteria.

It is a figure which shows the waveform analysis of the genotype determination marker corresponding to the bacterium genome M1 area | region. It is a figure which shows the wave form analysis of the genotyping marker corresponding to the Aspergillus genus genome M2 area | region. It is a waveform analysis image showing the dispersion | variation in the relative mobility at the time of analyzing repeatedly the same sample by capillary electrophoresis. It is a waveform analysis image which shows that there exists a case (reference strain 3) where a plurality of strains having different genotypes are mixed in a strain isolated from a single specimen. It is a waveform analysis image showing the stability of relative mobility between a genotype determination marker and a test nucleic acid when the same sample is repeatedly analyzed by capillary electrophoresis. It is a graph showing the stability of the relative mobility of a genotype determination marker and a test nucleic acid when the same sample is repeatedly analyzed by capillary electrophoresis. It is shown as raw data of standard size marker, genotyping marker and peak detection point of test nucleic acid. It is a graph showing the stability of the relative mobility of a genotype determination marker and a test nucleic acid when the same sample is repeatedly analyzed by capillary electrophoresis. The peak detection points of the genotype determination marker and the test nucleic acid are corrected with the peak detection points of the standard size marker. It is a waveform analysis image which shows the example of the single nucleotide polymorphism (SNP) analysis by this invention. It is a waveform analysis image which shows the example in which the single nucleotide polymorphism (SNP) analysis in eight single base repetition by a conventional method is difficult. It is a waveform-analysis image which shows the example in which the single nucleotide polymorphism (SNP) analysis in nine single nucleotide repetition by a conventional method is difficult.

The present invention includes the following steps:
(A) preparing a genotyping marker comprising two or more types of labeled nucleic acid fragments corresponding to a nucleic acid region known to produce a single nucleotide repeat of interest, the genotyping Each nucleic acid fragment contained in the marker has a sequence with a different number of repeats in the single base repeat;
(B) a step of preparing a test nucleic acid fragment by amplifying a region corresponding to the nucleic acid fragment contained in the genotyping marker in the test nucleic acid using a PCR method, wherein the test nucleic acid fragment is the gene A step of labeling with a labeling substance different from the nucleic acid fragment in the type determination marker,
(C) mixing the genotyping marker with the test nucleic acid fragment and subjecting it to separation, and (d) comparing the mobility of the test nucleic acid fragment with the mobility of the nucleic acid fragment in the genotyping marker. The present invention relates to a method for analyzing the number of repeats in a single nucleotide repeat polymorphism, comprising the step of determining the number of repeats in a single nucleotide repeat of interest in the test nucleic acid fragment.

  As described above, PCR amplification is used for the analysis of SSR. However, when the repeat unit is small, it is difficult to determine the number of repeats by comparing PCR product lengths. For comparison of PCR product length, high-performance capillary electrophoresis (CE) is used. In measurement of fluorescent label PCR amplification products of 5-base VNTR (Variable Numbers of Tandem Repeats) or 2-base STR by ordinary denaturing CE. , It has been reported that the relative size value of the peak is significantly different from the true size value when using a fluorescent label different from the size marker (Hahn et al., Electrophoresis, 22 (13): 2691-700 ( 2001)). In addition, even in the analysis of repeating units of two or more bases, guidelines have been issued that require verification of the validity of the technology in order to ensure the stability and reproducibility of the test results (see “Validity of DNA variety identification technology”). Guidelines for Confirmation -Mainly SSR- ", Seed and Seed Management Center (2008) (http://www.ncss.go.jp/main/DNA/DNAguideline.pdf)).

  When analysis is difficult by simply comparing PCR product lengths, the same method and sequence analysis as SNP analysis are used for SSR analysis (Amonsin et al., J. Clin. Microbiol., 42 (4): 1684). -702 (2004)). As a technique similar to SNP, for example, hybridization of a primer directly adjacent to a polymorphic site and analysis of a primer extension product terminated by a fluorescently labeled chain terminator after a single nucleotide repeat region have been reported (Cohen et al.). al., Human Genet., 115: 213 (2004)). However, these methods are complicated and are not suitable for use in high-throughput inspection.

  By using the method of the present invention, it is possible to easily and very reproducibly analyze the number of repeats of a single nucleotide repeat polymorphism without going through a complicated procedure such as sequence analysis. Therefore, the method of the present invention enables high-throughput analysis of an organism's genotype.

The present invention also includes the following steps:
(A) preparing a genotyping marker comprising two or more types of labeled nucleic acid fragments corresponding to a nucleic acid region known to produce a single nucleotide repeat of interest, the genotyping Each nucleic acid fragment contained in the marker exhibits a behavior similar to that of a nucleic acid fragment having a sequence having a different number of repeats in the single base repeat in the subsequent separation process,
(B) a step of preparing a test nucleic acid fragment by amplifying a region corresponding to the nucleic acid fragment contained in the genotyping marker in the test nucleic acid using a PCR method, wherein the test nucleic acid fragment is the gene A step of labeling with a labeling substance different from the nucleic acid fragment in the type determination marker,
(C) mixing the genotyping marker with the test nucleic acid fragment and subjecting it to separation, and (d) comparing the mobility of the test nucleic acid fragment with the mobility of the nucleic acid fragment in the genotyping marker. Thus, the present invention also relates to a method for analyzing the number of repeats in a single nucleotide repeat polymorphism, including the step of determining the number of repeats in a single nucleotide repeat of interest in the test nucleic acid fragment.

Surprisingly, the method of the present invention can also be applied to single nucleotide polymorphism (SNP) analysis, as shown in the following examples. That is, the present invention includes the following steps:
(A) a step of preparing a genotyping marker comprising two or more kinds of labeled nucleic acid fragments corresponding to a nucleic acid region known to produce a single nucleotide polymorphism of interest, the genotype Each nucleic acid fragment included in the determination marker has a sequence having a different number of repeats in a single base repeat existing in the vicinity of the single nucleotide polymorphism, or a different number of repeats in the single base repeat in the subsequent separation process. Steps that each behave similarly to a nucleic acid fragment having a sequence having
(B) a step of preparing a test nucleic acid fragment by amplifying a region corresponding to the nucleic acid fragment contained in the genotyping marker in the test nucleic acid using a PCR method, wherein the test nucleic acid fragment is the gene A step of labeling with a labeling substance different from the nucleic acid fragment in the type determination marker,
(C) mixing the genotyping marker with the test nucleic acid fragment and subjecting it to separation, and (d) comparing the mobility of the test nucleic acid fragment with the mobility of the nucleic acid fragment in the genotyping marker. Thus, there is also provided a method of analyzing a single nucleotide polymorphism existing in the vicinity of a single nucleotide repeat by a method comprising a step of determining a single nucleotide polymorphism to be a target in the test nucleic acid fragment.

  Single nucleotide polymorphisms (SNPs) are analyzed by various methods as described above, and among them, analysis by comparison of amplification product lengths by CE and the like can be performed relatively easily. However, single nucleotide polymorphisms having single nucleotide repeats in the vicinity are affected by the diversity of the number of repeats of the single nucleotide repeats, making it difficult to perform simple analysis by comparing the lengths of the amplification products described above. According to the method of the present invention, single nucleotide polymorphisms present in the vicinity of single nucleotide repeats, typically adjacent to single nucleotide repeats, can be easily analyzed. High-throughput analysis can be realized.

  In the present invention, in order to analyze the number of repeats in a single nucleotide repeat polymorphism (or a single nucleotide polymorphism existing in the vicinity of a single nucleotide repeat), a target single nucleotide repeat (or single nucleotide polymorphism) can occur. A genotyping marker comprising two or more labeled nucleic acid fragments corresponding to a known nucleic acid region is utilized.

  When the genotyping marker is used for single nucleotide polymorphism analysis, the nucleic acid fragment in the genotyping marker preferably has a sequence that differs by one in the number of repeats in the target single nucleotide repeat. And at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 types of genotyping markers Of nucleic acid fragments. The nucleic acid fragment in the genotyping marker is amplified using the PCR method using, for example, a nucleic acid of an organism having a predetermined number of repeats in a single base repeat of interest as a template. For example, the PCR method is carried out using nucleic acids obtained from individuals having 5 iterations, 6 individuals, 7 individuals, 8 individuals, 9 individuals, and 10 individuals as templates. The nucleic acid fragments having the respective number of repeats in the single nucleotide repeat of interest are prepared and mixed to obtain a genotyping marker having 5 to 10 repeats in the single nucleotide repeat of interest. Alternatively, a synthetic nucleic acid can be used as a template for preparing a genotyping marker. For example, a nucleic acid fragment having 5 repeats, a nucleic acid fragment having 6 repeats, a nucleic acid fragment having 7 repeats, a nucleic acid fragment having 8 repeats, a nucleic acid fragment having 9 repeats, and a nucleic acid fragment having 10 repeats. Are synthesized by a known oligonucleotide synthesizer, etc., and using this as a template, a PCR method is used to prepare nucleic acid fragments having each number of repeats in a single base repeat of interest, and mixing them, A genotyping marker having 5 to 10 repeats in a single nucleotide repeat of interest is obtained.

  As a nucleic acid fragment in a genotyping marker, a mixture of nucleic acid fragments that behaves similarly to a sequence having a different number of repeats in a single nucleotide repeat of interest in the subsequent separation process (for example, electrophoresis) can also be used. . Such a nucleic acid fragment is, for example, an oligonucleotide having a sequence containing an additional repetitive sequence (a single-base repetitive sequence not present in the template) as a primer in PCR for the preparation of a nucleic acid fragment. It can be prepared by varying the number of repeats in the repeat sequence. Specifically, the number of single-base repeats in the target nucleic acid region is fixed to a certain value (N) corresponding to the nucleic acid used as a template, and an additional nucleotide (preferably the single base of interest) is added to the primer. The same type as the nucleotides in the repeat) and the number of additional nucleotides is different by 1 each (eg 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 respectively) The individual PCR is performed to prepare a nucleic acid fragment contained in the genotyping marker and mixed. As a result, a genotyping marker that is a mixture of nucleic acid fragments exhibiting a separation behavior similar to that of a nucleic acid fragment having a sequence having N to N + 10 repeats in the single nucleotide repeat polymorphism of interest can be obtained. It will be apparent to those skilled in the art that such genotyping markers can sufficiently solve the problems of the present invention. In this case, only one type of template nucleic acid may be used for preparing the nucleic acid fragment contained in the genotyping marker, and it is not necessary to prepare a plurality of types of templates as described above. This makes it possible to save a great deal of labor when preparing a template nucleic acid from a naturally occurring individual. Even when a template nucleic acid is obtained by nucleic acid synthesis, it is usually an oligonucleotide used as a primer rather than a template nucleic acid. Since it has a shorter chain length and is easier to synthesize (or cheaper), it can be said that it is advantageous in practice.

  When a genotyping marker is used for analysis of a single nucleotide polymorphism existing in the vicinity of a single nucleotide repeat, the genotyping marker is preferably a target single nucleotide polymorphism of any sequence (for example, C → In the case of the G polymorphism, the sequence is matched to the C or G type sequence, preferably the type occupying the majority in the population to be analyzed), and for single nucleotide repeats, the sequence of each repeat number is mixed as described above. To prepare. Alternatively, as described above, a mixture of nucleic acid fragments exhibiting a separation behavior similar to that of a nucleic acid fragment having a sequence having a different number of single-base repeats can also be used.

  The nucleic acid fragment in the genotyping marker is labeled with a labeling substance. Nucleic acid labeling can be performed as described below.

  Next, the region corresponding to the nucleic acid fragment contained in the genotyping marker in the test nucleic acid, that is, the region containing the target single-base repeat is amplified using the PCR method (details about the PCR method are described below). Described in).

  As used herein, “test nucleic acid” refers to a nucleic acid obtained from a sample containing an individual organism or a population of organisms to be analyzed for the number of repeats in a single nucleotide polymorphism or a single nucleotide polymorphism. The term “nucleic acid” as used herein means a polynucleotide such as genomic DNA, mRNA, cDNA, or plasmid DNA. When DNA such as genomic DNA is used as the test nucleic acid, the PCR method can be carried out using the test nucleic acid directly as a template. When RNA such as mRNA is used as the test nucleic acid, reverse transcription with reverse transcriptase is performed before normal PCR, and PCR is performed using the obtained cDNA as a template (RT-PCR).

  In the present specification, a nucleic acid fragment amplified using a test nucleic acid is referred to as a “test nucleic acid fragment”.

  When preparing the test nucleic acid fragment, the generated nucleic acid fragment is labeled with a labeling substance different from the nucleic acid fragment in the genotyping marker. Thereby, for example, when nucleic acids are separated by capillary electrophoresis or the like, the nucleic acid fragment in the genotype determination marker and the test nucleic acid fragment can be distinguished from each other due to the difference in signal properties.

  Subsequently, the obtained genotyping marker and the test nucleic acid fragment are mixed and subjected to separation treatment. By comparing the mobility of the test nucleic acid fragment in this separation with the mobility of the nucleic acid fragment contained in the genotyping marker, the number of repeats (or single nucleotide polymorphisms) in the single nucleotide repeat of interest in the test nucleic acid is calculated. decide.

  In the present invention, the nucleic acid fragment is preferably a DNA fragment, and the nucleic acid region known to be capable of producing a single nucleotide repeat polymorphism or single nucleotide polymorphism of interest is preferably a genomic region.

  As used herein, the term “sample” or “sample” refers to a biomaterial isolated from its natural environment and comprising a polynucleotide. A “sample” or “sample” according to the present invention consists of a purified or isolated polynucleotide, or it is a tissue sample, biological fluid sample or cell sample containing a polynucleotide, Good. The sample or specimen of the invention can be any plant, animal, microorganism or virus-derived material that contains the polynucleotide. Samples suspected of containing the organism's chromosomes or sequences related to the organism's chromosomes are cells, chromosomes isolated from cells (eg, metaphase chromosome spreads), (in solution or for Southern blot analysis) Genomic DNA (bound to a solid support such as), RNA (bound to a solid support such as in solution or for Northern blot analysis), cDNA (in solution or bound to a solid support), etc. .

  As used herein, the term “polymorphism” refers to a change in nucleic acid sequence. Polymorphisms may be present in the population at a frequency of 0.01%, 0.1%, 1% or higher when compared to the native sequence. As used herein, a polymorphism can be an insertion, deletion, duplication or rearrangement. As used herein, “SSR” refers to a region that includes repeats of repeat units. As used herein, “single nucleotide repeat polymorphism” means the diversity of the number of repeats in a plurality of repeats of the same base.

  As used herein, the term “SNP”, “SNPs” or “single nucleotide polymorphism” refers to a single base change at a particular position in the genome of an organism (eg, human).

  As used herein, the term “allele” refers to a variant of a given sequence (eg, but not limited to, a gene comprising one or more polymorphisms). In the population, there are a large number of genes as multiallelic types. A homozygote has two copies of the same allele, whereas a diploid organism with two different alleles of a gene is said to be heterozygous for that gene.

  As used herein, the term “genotype” refers to a genomic organization that includes a particular polymorphism (eg, a particular number of repeats in a SSR, a particular SNP type).

  As used herein, the term “genotyping marker” refers to two or more types of labeled nucleic acid fragments corresponding to nucleic acid regions known to produce single nucleotide repeat polymorphisms or single nucleotide polymorphisms. It refers to a mixture of nucleic acid fragments comprising.

  As used herein, the terms “complementary” or “complementarity” are used in reference to polynucleotides (ie, sequences of nucleotides) that are related by base pairing rules. For example, the sequence “5′-AGT-3 ′” is complementary to the sequence “3′-TCA-5 ′”. Complementarity may be “partial” in which only some of the nucleic acid bases are aligned according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions as well as in detection methods that rely on binding between nucleic acids.

  As used herein, the term “hybridization” is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (ie, the strength of binding between nucleic acids) is determined by the degree of complementarity between nucleic acids, the stringency of the conditions involved, the Tm of the constructed hybrid, and the G: C within the nucleic acid. It is strongly influenced by factors such as ratio.

  As used herein, the term “Tm” is used in reference to “melting temperature”. The melting temperature is a temperature at which a group of double-stranded nucleic acid molecules is half-dissociated into a single strand. The equation for calculating the Tm of nucleic acids is well known in the art. As shown by standard references, a simple estimate of the Tm value can be calculated by the equation: Tm = 81.5 + 0.41 (% G + C) when the nucleic acid is in an aqueous solution of 1M NaCl ( See Anderson and Young, “Quantitative Filter Hybridization”, “Nucleic Acid Hybridization” (1985)). Other references include more complex calculation methods that take into account sequence and structural properties for the calculation of Tm.

  As used herein, the terms “stringency” or “stringent” are used in reference to the conditions of the presence of other compounds, such as temperature, ionic strength, and organic solvents, when nucleic acid hybridization is performed. . One of ordinary skill in the art will recognize that “stringency” conditions can be changed by changing the above parameters separately or simultaneously. In “stringent” conditions, nucleobase pairing will occur only between nucleic acid fragments that have a high frequency of complementary base sequences (eg, hybridization under “stringent” conditions is about 85 % -100% identity, preferably between homologues with about 70% -100% identity). Under moderately stringent conditions, nucleobase pairing will occur between nucleic acids with complementary base sequences at intermediate frequencies (eg, hybridization under “moderately stringent” conditions) Can occur between homologues with about 50% to 70% identity). Thus, for nucleic acids from genetically diverse organisms, conditions of “weak” or “low” stringency are often required because the frequency of complementary sequences is usually lower.

“Stringent conditions” when used in connection with nucleic acid hybridization are, for example, 5 × SSPE (43.8 g / L NaCl, 6.9 g / L NaH ₂ PO ₄₎ when a probe having a length of about 500 nucleotides is used. Bind or high at 42 ° C. in a solution consisting of H ₂ O and 1.85 g / L EDTA, adjusted to pH 7.4 with NaOH), 0.5% SDS, 5 × Denhardt's reagent and 100 μg / mL denatured salmon sperm DNA Hybridization followed by conditions equivalent to washing at 42 ° C. in a solution containing 0.1 × SSPE, 1.0% SDS.

“Moderately stringent conditions” when used in connection with nucleic acid hybridization means, for example, 5 × SSPE (43.8 g / L NaCl, 6.9 g / L NaH) when using a probe having a length of about 500 nucleotides. ₂ PO ₄ .H ₂ O and 1.85 g / L EDTA, adjusted to pH 7.4 with NaOH), 0.5% SDS, 5 × Denhardt's reagent and 100 μg / ml denatured salmon sperm DNA at 42 ° C. Includes conditions equivalent to binding or hybridization followed by washing at 42 ° C. in a solution containing 1.0 × SSPE, 1.0% SDS.

“Low stringency conditions” refer to, for example, 5 × SSPE (43.8 g / L NaCl, 6.9 g / L NaH ₂ PO ₄ .H ₂ O and 1. 85 g / L EDTA, adjusted to pH 7.4 with NaOH), 0.1% SDS, 5 × Denhardt's reagent (50 × 500 ml of Denhardt's reagent, 5 g Ficoll (type 400, Pharmacia), 5 g BSA (fraction V; Sigma) and 100 g / mL denatured salmon sperm DNA in binding or hybridization at 42 ° C. followed by washing at 42 ° C. in a solution containing 5 × SSPE, 0.1% SDS. Including conditions equivalent to

  “Amplification” is a special case of nucleic acid replication associated with template specificity. It is in contrast to non-specific template replication (ie, template dependent but not specific template). Template specificity is here distinguished from replication fidelity (ie, synthesis of the correct polynucleotide sequence) and nucleotide (ribonucleotide or deoxyribonucleotide) specificity. Template specificity is often described in terms of “target” specificity. Target sequences are “targets” in the sense that they are sought to be distinguished from other nucleic acids.

  Taq and Pfu polymerases have been found to exhibit high specificity for sequences bound by primers and thus limited due to their ability to function at high temperatures, which results in As a result, a thermodynamic state is produced which is advantageous for the hybridization of a primer with its target sequence and not favorable for the hybridization with a target-free sequence (HA Erlich (ed.), "PCR Technology (PCR Technology). ”, Stockton Press, 1989).

  As used herein, the term “primer” refers to the synthesis of a primer extension product that is complementary to a nucleic acid strand, whether present in a purified restriction enzyme digest or synthetically produced. Refers to an oligonucleotide that is capable of functioning as a starting point for synthesis when placed under controlled conditions (ie, in the presence of an inducer such as nucleotides and DNA polymerase, at a suitable temperature and pH). . The primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be long enough to initiate the synthesis of the extension product in the presence of an inducer. The appropriate length of a primer will depend on many factors, including temperature, primer source and method application.

  Usually, one pair (two types) of primers are used for PCR, a primer having a target sense strand sequence is called a “forward primer”, and a primer having an antisense strand sequence is called a “reverse primer”. In the generated amplification product, the sequence derived from the forward primer is located at the 5 'end of the sense strand, and the sequence derived from the reverse primer is located at the 5' end of the antisense strand.

  In the present invention, preferably, at least one of a pair of primers used for PCR amplification is labeled with a labeling substance.

  In PCR amplification, due to the nature of the polymerase, additional adenine (A) that does not correspond to the template may be added to the 3 'end of the amplified product. Since this A addition does not necessarily occur stably, two types of amplification products (those that are not supposed to have an A addition) are generated, each having a different fragment length. In electrophoretic analysis of SSR markers or SNPs using PCR-amplified fragment lengths, such a mixture of amplification products having different fragment lengths makes analysis difficult. In PCR amplification, it is known that A-addition can be forcibly performed by adding a 7-base sequence called a tail (such as GTTTCTT or GGTTCTT) to a reverse primer (for example, WO 97/16566). Issue). If PCR amplification is performed using a reverse primer having a tail sequence (tailed primer), all amplification products are A-added, and the above-described problem of mixing amplification products having different fragment lengths can be avoided. it can. Therefore, it is preferable to add the above tail sequence to the reverse primer among the primers used in the present invention.

  As used herein, the term “probe” or “hybridization probe” may exist in the form of a purified restriction enzyme digest, but may be made synthetically, recombinantly, or by PCR amplification. Refers to an oligonucleotide that is capable of at least partially hybridizing to another oligonucleotide of interest. The probe can be single-stranded or double-stranded. Probes are useful for the detection, identification and isolation of specific sequences. The probe may be detectable in any detection system, including but not limited to enzymes (eg, ELISA, and enzyme-based histochemical assays), fluorescent, radioactive, and luminescent systems. Are labeled with a “reporter molecule”.

  As used herein, the term “target” refers to a nucleic acid sequence or structure to be detected or characterized.

  The term “polymerase chain reaction” (“PCR”), as used herein, describes a method for increasing the concentration of segments of a target sequence in a mixture of genomic DNA without cloning or purification. B. Refers to the method of Mullis (see, eg, US Pat. Nos. 4,683,195, 4,683,202, and 4,965,188, incorporated herein by reference). This step for amplifying the target sequence introduces a large excess of two oligonucleotide primers into the DNA mixture containing the desired target sequence, followed by an accurate sequence of thermal cycling in the presence of DNA polymerase. Become. The two primers (the forward primer and reverse primer described above) are complementary to each strand of the double stranded target sequence. To effect amplification, the mixture is denatured and then the primers are annealed to their complementary sequences within the target molecule. After annealing, the primer is extended with a polymerase to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times to obtain a high concentration of amplified segment of the desired target sequence (ie, denaturation, annealing and extension are one “cycle”). And there can be many “cycles”). The length of the amplified segment of the desired target sequence is determined by the relative position of the primers with respect to each other, and thus this length is a controllable parameter. By repeating the amplification step, the method is called “polymerase chain reaction” (hereinafter “PCR”). They are said to be “PCR amplified” because the segments of the desired amplified target sequence become the dominant sequences (in terms of concentration) in the mixture.

Using PCR, a single copy of a specific target sequence in genomic DNA can be made in several different ways (eg, hybridization with a labeled probe; incorporation of a biotinylated primer followed by avidin-enzyme conjugate detection; Incorporation of ³² P-labeled deoxynucleotide triphosphates into the amplified segment, such as dCTP or dATP, can be amplified to detectable levels. In addition to genomic DNA, any oligonucleotide or polynucleotide sequence can be amplified with an appropriate set of primer molecules. In particular, the amplified segments produced by the PCR step itself are themselves effective templates for subsequent PCR amplification.

  As used herein, the terms “PCR product”, “PCR fragment”, and “amplification product” refer to a mixture of compounds that results after two or more cycles of denaturation, annealing, and extension PCR steps have been completed. Point to. These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.

  As used herein, the term “amplification reagent” refers to those reagents (deoxyribonucleotide triphosphates, buffers, etc.) required for amplification except for primers, nucleic acid templates and amplification enzymes. Typically, amplification reagents are placed with other reaction components and placed in reaction vessels (test tubes, microwells, etc.).

The term “label” as used herein refers to any atom or molecule that can be used to provide a detectable (preferably quantifiable) effect and that can be attached to a nucleic acid or protein. Point to. Labels include, but are not limited to, dyes; radioactive labels such as ³² P; binding moieties such as biotin; haptens such as digoxigenin; luminescent, phosphorescent or fluorogenic moieties; and fluorescence It includes the combination of a dye alone or a moiety capable of suppressing or converting the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or adsorption, magnetism, enzyme activity, and the like. The label can be a charged moiety (positive or negative charge) or can be electrically neutral. The label may comprise or consist of a nucleic acid or protein sequence so long as the sequence containing the label is detectable.

  As used herein, the term “signal” refers to any detectable effect as caused or provided by a label or assay reaction.

  Nucleic acid fragments useful in the present invention, including primers, nucleic acid fragments contained in genotyping markers, are spectroscopic means, photochemical means, biochemical means, immunochemical means, enzymatic means or chemical means. By incorporating a detectable moiety, labeling can be performed as described below. The method of linking or conjugating a label to a nucleic acid fragment will, of course, depend on the type of label used and the position of the label on the nucleic acid fragment (ie, the label on the 3 'end, 5' end or body portion).

Although fluorescent dyes are preferred, various labels suitable for use in the present invention, as well as methods for incorporation into nucleic acid fragments, are known in the art, eg, to interact to enhance, change or attenuate the signal. Such as enzymes (eg, alkaline phosphatase and horseradish peroxidase) and enzyme substrates, radioactive atoms, chromophores, fluorescent quenchers, chemiluminescent labels, and electrochemiluminescent labels such as Origen ™ (Igen). However, it is not limited to these. Of course, if a labeled molecule is used in a PCR-based amplification assay with thermal cycling, the label must be able to withstand the temperature cycling required in this automated step. Ideally, two or more labels that can be detected using similar devices, methods and / or substrates are preferred. Fluorophores for use as labels in the construction of labeled nucleic acid fragments of the invention include, for example, rhodamine and derivatives (eg Texas Red), fluorescein and derivatives (eg 5-bromomethylfluorescein), Cy5, Cy3, JOE, FAM (trademark) ) (6-carboxyfluorescein), VIC ™ (2′-chloro-7′-phenyl-1,4-dichloro-6-carboxyfluorescein), NED ™ (2′-chloro-5′-fluoro- 7 ′, 8′-fused phenyl-1,4-dichloro-6-carboxyfluorescein), Oregon Green ™, Lucifer Yellow, IAEDANS, 7-Me ₂ N-coumarin-4-acetate, 7-OH-4- CH ₃ - _{coumarin-3-acetate, 7-NH 2 -4-CH} 3 - bear Down-3- acetate (AMCA), monobromobimane, pyrene trisulfonates, such Cascade Blue, and mono-bromo trimethyl - encompasses the Anmoniobiman, without limitation. Preferably, the fluorophore for use as a label in the construction of the labeled nucleic acid fragment of the invention is FAM, VIC, or NED. In general, fluorophores with a wide Stokes shift are preferred to allow the use of a fluorometer with a filter rather than a monochromator and to increase the efficiency of detection.

  The label can be linked to the oligonucleotide directly or indirectly using various techniques. Depending on the exact type of label or tag used, the label can be located at the 5 'end of the primer, can be located inside the primer, or can be linked to spacer arms of various sizes and compositions. Can promote signal interaction. A 5 'end label is preferred. Commercially available phosphoramidite reagents can be used to make oligomers containing functional groups (eg thiols or primary amines) at the 5 ′ end via appropriately protected phosphoramidites, and for example “PCR Protocols: Methods and Methods and Applications”, Innis et al. (Ed.), Academic Press, Ind. , 1990 can be used to label them.

A method of using an oligonucleotide functionalizing reagent to introduce one or more sulfhydryl, amino or hydroxyl moieties within an oligonucleotide primer sequence, typically at the 5 ′ end, is described in US Pat. No. 4,914,210. Have been described. The 5 ′ phosphate group can be introduced as a radioisotope by using polynucleotide kinase and γ- ³² P-ATP or γ- ³³ P-ATP, thereby forming a reporter group. Biotin can be added to the 5 ′ end by reacting an aminothymidine residue or 6-aminohexyl residue introduced during synthesis with the N-hydroxysuccinimide ester of biotin.

The PCR method is well known to those skilled in the art and is described, for example, in Mullis and Faloona, 1987, Methods Enzymol. , 155: 335; Saiki et al., 1985, Science, 230: 1350 and U.S. Pat. Nos. 4,683,202, 4,683,195, and 4,800,159. In its simplest form, PCR is for enzymatically synthesizing specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flanking the region of interest of the target DNA. In vitro method. A series of iterative reaction steps, including template denaturation, primer annealing, and extension of the annealed primer with DNA polymerase, results in an exponential accumulation of a specific fragment whose end is defined by the 5 'end of the primer. PCR is reported to be able to selectively concentrate specific DNA sequence in the ^109-fold.

  The length and temperature of each step of the PCR cycle and the number of cycles are actually adjusted according to stringency requirements. Annealing temperature and time are determined by both the expected efficiency of the primer annealing to the template and the degree of mismatch allowed. The ability to optimize the stringency of primer annealing conditions is well known to those skilled in the art. An annealing temperature of 20 ° C to 72 ° C is most commonly used. Initial denaturation of the template molecule is usually achieved by incubation for 4 minutes at 92 ° C. to 99 ° C., followed by denaturation (94 ° C. for 15 seconds to 1 minute), annealing (temperature is lowest based on Tm as described above) Typically 20 to 40 cycles consisting of about 5 degrees below the Tm of the oligonucleotide in the reaction having Tm; usually 1-2 minutes) and elongation (usually 1-3 minutes at 72 ° C.) are performed.

  As used herein, the term “separate nucleic acid molecules” refers to the process of physically separating nucleic acid molecules in a sample or a portion thereof based on size and / or charge. Separation of nucleic acids according to the present invention can be accomplished by any means suitable for separation of nucleic acids including, for example, electrophoresis, HPLC or mass spectrometry. Separation by electrophoresis is preferred, and separation by capillary electrophoresis is most preferred.

  As used herein, the term “capillary electrophoresis” (CE) refers to the electrophoretic separation of nucleic acid molecules in a portion from an amplification reaction, where the separation is performed in a capillary tube. Capillary tubes with an inner diameter of about 10-300 μm are available and the length may range from about 0.2 cm to about 3 m, but preferably 0.5 cm to 20 cm, more preferably 0.5 cm to The range is 10 cm. Furthermore, the use of microfluidic microcapillaries (eg available from Caliper or Agilent Technologies) is specifically included within the meaning of “capillary electrophoresis”.

  CE is an efficient analytical separation technique for microanalysis of samples. CE is performed in a narrow inner diameter capillary tube filled with an electrically conductive medium called a “carrier electrolyte”. An electric field is applied between the ends of the capillary tube, and the species in the sample moves from one electrode to the other, depending on the mobility of each species and the rate of fluid movement in the tube. Move with. CE may be performed using a liquid such as a gel or buffer in a capillary. In one liquid system known as “free zone electrophoresis”, the separation is based on the difference in the mobility of the free solution of the sample species. In another liquid system, separation based on the difference in hydrophobicity is performed using micelles. This is known as Micellar Electrokinetic Capillary Chromatography (MECC).

  CE separates nucleic acid molecules based on charge, which effectively results in its separation by size or number of nucleotides. If several fragments are produced, they pass through the fluorescence detector near the end of the capillary in order of increasing size. That is, smaller fragments migrate prior to larger ones and are detected first.

  CE has significant advantages over conventional electrophoresis, mainly at the separation rate, small amount of sample required (on the order of 1-50 nL) and high resolution. For example, the separation speed using CE is 10 to 20 times faster than conventional gel electrophoresis, and staining after electrophoresis is not necessary. CE provides a high degree of resolution, separating molecules in the range of about 10 to 1,000 base pairs that differ by only one base pair. A high degree of partitioning is possible, in part, because the larger surface area of the capillary efficiently dissipates heat and allows the use of higher voltages. Furthermore, band broadening is minimized by the narrow inner diameter of the capillary. In free zone electrophoresis, the phenomenon of electroosmosis, ie electroosmotic flow (EOF), occurs. This is a bulk flow of liquid that affects all of the sample molecules regardless of charge. Under certain conditions, EOF may contribute to improving the resolution and separation rate of the free zone CE.

  CE is well known in the art as described, for example, in US Pat. Nos. 6,217,731; 6,001,230 and 5,963,456, which are incorporated herein by reference. It can be carried out by known methods. As for the high-throughput CE apparatus, for example, an HTS9610 high-throughput analysis system and an SCE9610 fully automatic 96-capillary electrophoresis gene analysis system are sold by Spectrum Corporation (State College, PA). Others include Beckman Instruments Inc. (Fullerton, CA) P / ACE 5000 series, and ABI PRISM 3130 gene analyzer (Applied Biosystems, Foster City, CA). Each of these devices includes a fluorescence detector that monitors the emission of light by molecules in the sample near the end of the CE column. A standard fluorescence detector can discriminate between many different wavelengths of fluorescence emission, thereby providing the ability to detect multiple fluorescently labeled species in a single CE run from an amplified sample.

  Another means of increasing the CE separation throughput is to use multiple capillaries, or preferably an array of capillaries. Capillary array electrophoresis (CAE) devices have been developed with 96 capillaries (eg, MegaDynamics MegaBACE instrument), and with capacities as high as 1000 capillaries. A confocal fluorescence scanner can be used (Quesada et al., 19991, Biotechniques) to avoid the problems associated with the detection of fluorescence from DNA caused by light dispersion between adjacent capillaries. 10: 616-25).

  The nucleic acid fragment detection method useful in the present invention measures the intensity of fluorescence emitted by a labeled nucleic acid fragment when illuminated by light within the excitation spectrum range of the fluorescent label. Fluorescence detection techniques are highly developed, extremely sensitive, and in some cases, clear detection is possible up to one molecule. High sensitivity fluorescence detection is a standard aspect of most commercial plate readers, microarray detection setups and CE instruments. For CE devices, optical fiber transmission of excitation and emission signals is often used. Spectrummix, Applied Biosystems, Beckman Coulter, and Agilent each sell CE devices with sufficient fluorescence detectors for the fluorescence detection required for the methods described herein.

  Fluorescent signals arising from two or more different fluorescent labels are distinguishable from each other when the emission peak wavelengths are each 20 nm or more apart in the spectrum. In general, specialists select fluorophores with greater separation between peak wavelengths, especially when the selected fluorophore has a broad emission wavelength peak.

  The method for analyzing the number of repeats (or single nucleotide polymorphisms) in a single nucleotide repeat polymorphism of the present invention can be applied to any organism. Preferably, the target organism is a plant or a microorganism. More preferably, the target organism is an eubacteria. Most preferably, the organism of interest is Johne fungus. In this case, the nucleic acid region to be analyzed includes the sequence shown in SEQ ID NO: 1 or 2, or a sequence that hybridizes to the sequence under stringent conditions.

  Mycobacterium avium subsp. Paratuberculosis is a pathogenic myco that causes chronic granulomatous enteritis called Johne's disease (paratuberculosis) in livestock (particularly ruminants such as cattle, sheep and goats). It is a bacterium.

  Conventionally, IS900-RFLP (Pavlik I, et al., J. Microbiol. Methods, 38: 155 (1999)) has been used as a genotype discrimination method for the bacterium, but a large amount of this method is carried out. Therefore, it was not a useful means for slow-growing Yone bacteria, which may require about 3 months for colony formation. The present inventors have developed a method called VNTR (Variable Numbers of Tandem Repeats) method as a means to replace the conventional method for genotyping of Aspergillus niger (National Institute of Animal Health Research Report No. 109, 25-32). Page (2002) (http://ss.niah.affrc.go.jp/publication/kenpo/2002/109-4.pdf)). This is a technique for discriminating the genotype from the number of tandem repeats having a repeat unit of about 50 bp. Analysis of the number of repeats of single nucleotide repeats in the sequence shown in SEQ ID NO: 1 and / or 2 makes it possible to perform genotyping of the bacterium in more detail than these conventional techniques.

  By analyzing the genotypes of the bacterium in the population, preventive measures against Johne's disease (preventive epilepsy, movement restrictions, changes in the disinfection method, blocking of the infection route, etc.) according to the determined genus genus It can be set appropriately.

Therefore, the present invention comprises the following steps:
(A) preparing a genotyping marker comprising two or more kinds of labeled nucleic acid fragments comprising the sequence shown in SEQ ID NO: 1 or 2;
(B) obtaining a labeled test fragment by amplifying a region corresponding to the nucleic acid fragment contained in the genotyping marker in the test nucleic acid using a PCR method;
(C) mixing the genotyping marker with the test nucleic acid fragment and subjecting it to separation, and (d) comparing the mobility of the test nucleic acid fragment with the mobility of the nucleic acid fragment in the genotyping marker. Thus, the present invention relates to a method for determining the genotype of a bacterium including the step of determining the number of repeats (or single nucleotide polymorphisms) in a single nucleotide repeat of interest in the nucleic acid fragment.

  In this case, preferably, the test nucleic acid is a separately-cultured Yone bacterium or a nucleic acid obtained from an animal sample containing the bacterium. Here, animal samples include fecal samples from animals, body fluid samples, and tissue samples such as intestinal tract.

  In addition, the present invention provides two or more types of labeled corresponding to nucleic acid regions that are known to cause the target single nucleotide repeat polymorphism (or single nucleotide polymorphism existing in the vicinity of the single nucleotide repeat). A genotyping marker comprising the nucleic acid fragment of and a primer pair for amplifying a nucleic acid region corresponding to the nucleic acid fragment contained in the genotyping marker (or a single nucleotide polymorphism in a single nucleotide repeat) It also relates to a kit for analyzing. Preferably, one of the primer pairs is labeled.

  As used herein, the term “kit” refers to a combination of assay components. In the context of a reaction assay, such combinations can be used from one location to another, such as reaction reagents (eg, oligonucleotides, enzymes, etc. in appropriate containers) and / or auxiliary materials (eg, buffers, Including a system that allows storage, transport or delivery of written instructions for performing the assay). As used herein, the term “assay component” refers to a component of a system capable of performing an assay. Assay components include, but are not limited to, genotyping markers, primers, buffers and the like. For example, the kit includes one or more enclosures (eg, boxes) that contain relevant reaction reagents and / or auxiliary materials. As used herein, the term “split kit” refers to a combination comprising two or more separate containers, each containing part of the total kit component. The containers are delivered together or separately to the intended recipient. For example, a first container contains an assay enzyme, while a second container contains an oligonucleotide. Any combination comprising two or more separate containers, each containing part of the total kit component, is included in the term “split kit”. In contrast, an “integrated kit” refers to a combination that includes all of the components of a reaction assay in a single container (eg, in a single box containing each of the desired components). The term “kit” includes both segmented kits and integrated kits.

  In particular, the present invention includes at least a genotyping marker including a labeled nucleic acid fragment corresponding to the region containing the sequence represented by SEQ ID NO: 1 or 2, and a primer pair for amplifying the nucleic acid region corresponding to the region. The present invention relates to a kit for determining the genotype of a bacterium. In this kit, the primer pair preferably has the sequences shown in SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6.

  EXAMPLES The present invention will be specifically described below with reference to examples, but the present invention is not limited to the examples.

Generating genotyping markers
Preparation of labeled nucleic acid fragments: Isolated from reference strains 1 to 4 of Johne bacteria purchased from ATCC (American Type Culture Collection) (accession numbers ATCC 19698, ATCC 49164, ATCC 70000535, and ATCC 19851, respectively) and domestic cases of Johne's disease Yone fungus field strains 1 to 11 (part of the strain collected for joint research on VNTR type and pathological evaluation, etc. at the National Institute of Animal Health, National Agriculture and Food Research Organization) Each was cultured on a Harold egg yolk agar medium supplemented with mycobactin at 37 ° C. for 3 months to form colonies. The colony of each sample was added to 200 μL of a nucleic acid purification reagent instagene matrix (Bio-Rad), heated at 56 ° C. for 30 minutes, stirred by vortexing for 10 seconds, and then at 100 ° C. on boiling water. Treated for 8 minutes. The mixture was again vortexed for 10 seconds and then centrifuged at 12000 rpm for 3 minutes. The resulting sample was stored at −20 ° C. until use. At the time of use, after dissolution, the mixture was vortexed for 10 seconds, centrifuged at 12000 rpm for 3 minutes, and the supernatant was used as a template solution for subsequent PCR amplification.

  The following primers were custom-made as a custom primer for GeneScan (registered trademark) Analysis of Applied Biosystems Japan.

M1-F2-Fam (SEQ ID NO: 3)
M1-F2-Vic (SEQ ID NO: 3)
M1-R2-Tailed (SEQ ID NO: 4)
M2-F2-Fam (SEQ ID NO: 5)
M2-F2-Vic (SEQ ID NO: 5)
M2-R2-Taled (SEQ ID NO: 6)
T2-F3-Ned (SEQ ID NO: 8)
T2-R3-Taled (SEQ ID NO: 9)

Of the above primers, those with “Fam” at the end of the name have a 6-FAM ^TM label at the 5 ′ end, and those with “Vic” have a VIC ^TM label at the 5 ′ end. However, those marked with “Ned” have a NED ^TM label. Each primer has the sequence indicated by the SEQ ID No. shown in parentheses, but those with “Tailed” at the end of the name have a tail sequence (GTGTTCTT) added to the 5 ′ end in addition to those sequences. Has been.

  For each primer, a 100 μM stock solution was prepared with water. These stock solutions were further diluted to 25 μM with water to obtain working solutions and used for PCR.

An amplification solution having the following composition was prepared using a PCR reagent kit AmpliTaq Gold (registered trademark) (manufactured by Applied Biosystems Japan):
Distilled water 57μL
10 × Gold buffer 10 μL
8 mM dNTP 10 μL
25 mM MgCl _{2 6} μL
DMSO 4μL
25 μM labeled primer 2 μL
25μM tailed primer 2μL
Taq Gold polymerase 1 μL
Total 92μL

1 μL of the template solution was added to 11.5 μL of the amplification solution, and PCR amplification was performed using the GeneAmp® PCR System 9700 with the following temperature cycle:
Preheat 95 ° C 5 minutes 36 cycles Denaturation step 95 ° C 10 seconds
Annealing 67 ℃ 30 seconds
Elongation step 72 ° C 60 sec.
The obtained PCR products are the following five types:
M1-Fam
M1-Vic
M2-Fam
M2-Vic
T2-Ned

The sequences of the M1, M2, and T2 regions obtained from the database are as follows (underlined parts are repetitive sequences, M1 and M2 are single-base repeats of C, and T2 is a triple base repeat of CCG):
M1 (SEQ ID NO 1): GCGGTGTTCGGCAAAGTCGTTGTGCCGGGCGGCGTTTGGCCCGCGGACGTGCTGCCGGAGCCCGGGGCGATGCCGGTCACCACCCAGTGCACGTACGS CCCCCCCCCCCCCCCCCCC GGGGCGTCGGGGTCGTCGACCACCAGGGCCGCACCCGTTGGCGCGGACCACGCCAGCGGCGGTGCGATGCCCTCGCCCTTGCAGGTGTACCGCGGCGGGATCGGGGCGCCGTCGGTGAATGCCGGGCTGGTGATCGTCAA (S is C or G)
M2 (SEQ ID NO: 2): TGCTCAGCAGCCAGGTAGTCCGCATCCCGTGCCGCTCGATGCCGCTCGGCAGACCTGTGGTGGGCTTCGACGTCACCGAAG CCCCCCCCCC GGCAGCTCTGTCGTGCAACTGCGCGGCACGCTCATGGGCATCGCCGGCGGACAGGCGGGCCGCATGCAGACGTTCACGTGCCGCCGCGACACGCTCGGCCGCCTCATCAGCGGACCTACGTGCGGCTCCCGAAACTCTGGACCGCCGTTCGGCGTCGTCGCTCATGCGGCACCTCCAAGCCCACAACGCTAC
T2 (SEQ ID NO: 7): CAACGACAATGCCCACCGACAATGCCA CCGCCCGCCGCCGCCCG CCCTCCACGCCCGCGACCGGCGGTCAAGCCCTCGGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGC

Sequence analysis and waveform analysis The obtained PCR product was purified using QIAquick PCR Purification Kit (manufactured by QIAGEN), and the purity and the amount of DNA were measured using a Cosmo Eye (Kaynos) capillary electrophoresis apparatus. Using this purified PCR product as a template, a cycle sequence reaction using BigDye Terminator v3.1 (manufactured by Applied Biosystems) using a primer having the above sequence to which neither a fluorescent label nor a tail sequence is added at the 5 ′ end Went. After removing the unreacted labeling substance and the like from the reaction solution by the terminator reaction product purification column, it is applied to Genetic Analyzer Applied Biosystems 3130 (50 cm capillary, POP-7) or ABI PRISM (registered trademark) 3100 (80 cm capillary, POP-4). Sequence analysis. Alignment analysis was performed using GENETYX-MAC gene information processing software.

For each labeled PCR product, capillary electrophoresis was performed using Genetic Analyzer Applied Biosystems 3130 (50 cm capillary, POP-7) or ABI PRISM (registered trademark) 3100 (80 cm capillary, POP-4), and GeneMapper ^TM was used. Waveform analysis was performed. In the electrophoresis, GeneScan ^™ 600 LIZ size standard (Applied Biosystems) was mixed with the sample as a standard marker and subjected to electrophoresis at the same time.

  From the obtained sequence information, the number of repeats in the M1 region (SEQ ID NO: 1), M2 region (SEQ ID NO: 2), and T2 region (SEQ ID NO: 7) was clarified for each strain as follows. The number in parentheses is the number of repetitions, and the number of underline is the main peak revealed from waveform analysis.

Strain M1 region M2 region T2 region (in parentheses are VNTR type)
Reference strain 1 (7) (10) (5)
(Map-1)
Reference strain 2 (7) (10) (6)
(Map-1)
Reference strain 3 (15, 16, 17 , (10, 11) (5)
(Map-1) 18, 19)
Reference strain 4 (10) (9) (5)
(Map-1)
Outdoor strain 1 (15, 16 , 17 , (10) (4)
(Map-2) 18)
Outdoor stock 2 (8) (11) (5)
(Map-1)
Outdoor shares 3 (9) (11, 12 ) (5)
(Map-1)
Outdoor shares 4 (11) (10) (5)
(Map-1)
Outdoor shares 5 (13, 14 ) (10) (4)
(Map-2)
Outdoor stock 6 (14, 15 , 16) (10, 11 ) (4)
(Map-2)
Outdoor strain 7 (18, 19, 20 , (10, 11 ) (4)
(Map-2) 21)
Outdoor shares 8 (8) (10) (5)
(Map-1)
Outdoor shares 9 (9) (11) (6)
(Map-1)
Outdoor shares 10 (9) (9) (5)
(Map-1)
Wild strain 11 (9) (13, 14) (5)
(Map-1)

  From the above results, it should be noted that each strain obtained from a single specimen may actually contain multiple strains of different genotypes.

Preparation of genotyping markers From the number of repeats revealed above, the strains of the M1 and M2 regions are covered so as to cover the possible number of repeats (M1: 7-21; M2: 10-14). Combinations were selected and labeled PCR products were mixed to produce genotyping markers. Specifically, for the M1 region, the VIC-labeled PCR products obtained from the reference strain 1 and the field strains 2 to 7 were mixed, and the M2 region was obtained from the reference strain 1 and the field strains 2, 3, and 11. The obtained FAM-labeled PCR product was mixed to obtain a genotyping marker. When mixing, the blending ratio of each PCR product was determined from the above waveform analysis, and the blending ratio was determined so that the peak heights of the respective number of repetitions were as uniform as possible.

  The results of waveform analysis for each genotyping marker are shown in FIG. 1A (M1 region) and FIG. 1B (M2 region).

Determination of the number of repeats in single-base repeats using genotyping markers Single-base repeat polymorphism analysis is promising for electrophoretic methods that can discriminate fragment length at the level of one base, particularly capillary electrophoresis for fluorescently labeled nucleic acid samples It is. However, it was difficult to accurately determine the number of repeats only by comparison with a standard having a predetermined fragment length that is usually used. Capillary electrophoresis also has slight mobility differences between individual runs, which makes it possible to accurately determine the number of single-base repeats by simply subjecting nucleic acid samples to electrophoresis. It was difficult (see FIG. 2). In addition, as indicated above, strains isolated from a single specimen may contain multiple strains with different genotypes, which further analyzes single nucleotide repeats. It was difficult (see “Reference strain 3” in FIG. 3).

  Therefore, the genotyping marker prepared as described above was separated at the same time as the test nucleic acid fragment, thereby enabling more precise analysis of single-base repeats.

  As shown in FIG. 4, the peak of the test nucleic acid (reference strain 1, FAM label) (black peak in FIG. 4) is located relative to the standard (light colored peaks at both ends of the waveform analysis in FIG. 4). Is slightly different for each run, but the relative position with the genotyping marker (the peak of the intermediate color in FIG. 4) is constant without changing with the run.

  FIG. 5A shows a graph of peak data points. Here, the data points change from run to run, but the distance between each peak is very different between the genotyping marker of the present invention and the test nucleic acid fragment compared to the standard size marker indicated by the dotted line. It can be seen that it is stable. FIG. 5B shows a graph of the relative size value of each peak by correction of the standard size marker. Even with this correction, the relative size values still remain, but it can be seen that the spacing between the peaks between the genotyping marker and the test nucleic acid fragment is very well maintained over multiple runs. . Therefore, by using the genotyping marker of the present invention, when the number of test nucleic acid repeats and multiple genotypes are mixed, the genotype composition (mixing ratio of each genotype) is also reproduced. It is clear that the determination can be made with high performance.

  Here, in FIG. 4 and FIG. 5, the peak of the test nucleic acid and the peak of the genotyping marker do not completely match, but this is because the test nucleic acid is FAM-labeled while the genotyping marker is This is because they are prepared as VIC labels, and these labeling substances have different mobility. This does not interfere with the determination of the number of test nucleic acid repeats. This is because the difference in mobility of the labeling substance is known in many cases, and can be easily known by electrophoresis of samples with the same sequence and different labels. In the electrophoretic analysis of a fluorescently labeled sample, when the signal of one fluorescent substance is remarkably strong, the fluorescence often causes crosstalk and is recognized as a small peak of a different fluorescent substance. Therefore, the use of labels with different mobility between the test nucleic acid and the genotyping marker as in the experiment of FIG. 4 indicates that the peak positions do not completely match, which is a possibility of such fluorescence crosstalk. Is rather advantageous.

  Thus, by using the method of the present invention, it was shown that the analysis of the number of repeats of a single nucleotide repeat polymorphism can be realized easily and very reproducibly without going through a complicated procedure such as sequence analysis. .

  It is clear that the method of the present invention is applicable to the analysis of single nucleotide repeat polymorphisms in sequences other than the specifically shown genome sequence of Y.

Application to genotyping marker single nucleotide polymorphism analysis The inventors of the present invention used this genotyping marker in the process of realizing single nucleotide polymorphism analysis using the genotyping marker as described above. It has been found that nucleotide polymorphisms (SNPs) can sometimes be analyzed.

  In the sequence of the M1 region of the Y. pneumoniae genome shown in SEQ ID NO: 1, a position where a single nucleotide polymorphism occurs adjacent to the single nucleotide repeat (the 98th base of SEQ ID NO: 1; C or G). Here, the case where the 98th base of SEQ ID NO: 1 is C is referred to as “a type” (GC), and the case where G is G is referred to as “b type” (GG).

  As shown in FIG. 6, when the SNP site is a-type (field strains 8 and 10) and b-type (field strains 2 and 9), the PCR product has the same fragment length and one base. Even if the number of repeats in the repeat polymorphism is the same, the difference in mobility from the genotyping marker is different. That is, by analyzing this difference, it is possible to determine which type the SNP site is. On the other hand, as shown in FIG. 7, the mixture of a-type and b-type labeled with the same fluorescent substance formed a single peak and could not be separated into the respective peaks of the two types.

  The reference strain 1 and the wild strains 2 to 7 used for the production of the genotyping marker in the M1 region were all b-type. In addition, a-type is currently detected only in VNTR-type Map-1, and out of 80 VNTR-type Map-1 strains whose sequence was confirmed, 68 were a-type.

  As described above and shown in FIG. 5, the relative positions of the peaks of the test nucleic acid and the genotype determination marker when electrophoresis is performed at the same time are very stable even when the run is repeated. This makes it possible to sensitively detect a slight difference in mobility due to a difference in the sequence of the SNP site, and also enables single nucleotide polymorphism analysis by the method of the present invention.

  It is obvious that such a method of SNP analysis can be applied to SNPs in sequences other than the specifically shown genome sequence of Y. pneumoniae.

  According to the present invention, it is possible to realize simple and high-throughput genotype analysis of organisms including microorganisms and plants. This is applicable to pathogen genotype analysis, plant variety analysis, animal disease susceptibility analysis and the like. Accordingly, the present invention has applicability in a wide range of technical fields such as the human medical field, veterinary field, and plant field.

SEQ ID NO: 1: M1 region SEQ ID NO: 2: M2 region SEQ ID NO: 3-6: Primer SEQ ID NO: 7: T2 region SEQ ID NO: 8 and 9: Primer

Claims (12)

A method for analyzing the number of repeats in a single nucleotide repeat polymorphism comprising the following steps:
(A) preparing a genotyping marker comprising two or more types of labeled nucleic acid fragments corresponding to a nucleic acid region known to produce a single nucleotide repeat of interest, the genotyping Each nucleic acid fragment contained in the marker has a sequence with a different number of repeats in the single base repeat;
(B) a step of preparing a test nucleic acid fragment by amplifying a region corresponding to the nucleic acid fragment contained in the genotyping marker in the test nucleic acid using a PCR method, wherein the test nucleic acid fragment is the gene A step of labeling with a labeling substance different from the nucleic acid fragment in the type determination marker,
(C) mixing the genotyping marker with the test nucleic acid fragment and subjecting it to separation by electrophoresis; and (d) transferring the nucleic acid fragment in the genotyping marker according to the mobility of the test nucleic acid fragment. Determining the number of repeats in a single base repeat of interest in the test nucleic acid fragment by comparing to the degree. A method for analyzing a single nucleotide polymorphism present in a nucleic acid region that is PCR amplified with a single nucleotide repeat, comprising the following steps:
(A) a step of preparing a genotyping marker comprising two or more kinds of labeled nucleic acid fragments corresponding to a nucleic acid region known to produce a single nucleotide polymorphism of interest, the genotype Each nucleic acid fragment contained in the determination marker has a sequence having a different number of repeats in the single base repeat;
(B) a step of preparing a test nucleic acid fragment by amplifying a region corresponding to the nucleic acid fragment contained in the genotyping marker in the test nucleic acid using a PCR method, wherein the test nucleic acid fragment is the gene A step of labeling with a labeling substance different from the nucleic acid fragment in the type determination marker,
(C) mixing the genotyping marker with the test nucleic acid fragment and subjecting it to separation by electrophoresis; and (d) transferring the nucleic acid fragment in the genotyping marker according to the mobility of the test nucleic acid fragment. The said method including the step which determines the single nucleotide polymorphism used as the object in this test nucleic acid fragment by comparing with a degree. The method according to claim 1 or 2 , wherein the nucleic acid fragment is a DNA fragment. The method according to any one of claims 1 to 3 , wherein the nucleic acid region is a genomic region. The method according to any one of claims 1 to 4 , wherein each nucleic acid fragment in the genotyping marker has a sequence that differs by 1 in the number of repeats in the target single-base repeat. The method according to any one of claims 1 to 5 , wherein the separation treatment by electrophoresis is performed by capillary electrophoresis. The method according to any one of claims 1 to 6 , wherein the nucleic acid fragment in the genotyping marker is labeled with one kind of labeling substance. The method according to any one of claims 1 to 7 , wherein the label is a fluorescent label. It said nucleic acid region is a genomic region of a bacterial method according to any one of claims 1-8. The method according to claim 9 , wherein the bacterium is Yone fungus. The method according to any one of claims 1 to 10 , wherein the nucleic acid region comprises a sequence that hybridizes under stringent conditions to the sequence shown in SEQ ID NO: 1 or 2 or a complementary strand of the sequence. Corresponds to nucleic acid regions that are known to be capable of generating single nucleotide repeat polymorphisms of interest, or nucleic acid regions that are known to be PCR amplified together with single nucleotide repeats and are capable of generating single nucleotide polymorphisms of interest A genotyping marker comprising two or more types of labeled nucleic acid fragments having sequences having different numbers of repeats in the single nucleotide repeat , and a nucleic acid region corresponding to the nucleic acid fragment contained in the genotyping marker A kit for analyzing the number of repeats in a single nucleotide repeat polymorphism or a single nucleotide polymorphism, comprising at least a primer pair for

Images