Classifications

• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
  • A01K67/027—New or modified breeds of vertebrates
  • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
  • C12N15/873—Techniques for producing new embryos, e.g. nuclear transfer, manipulation of totipotent cells or production of chimeric embryos
  • C12N15/877—Techniques for producing new mammalian cloned embryos
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2217/00—Genetically modified animals
  • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2227/00—Animals characterised by species
  • A01K2227/10—Mammal
  • A01K2227/105—Murine
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2267/00—Animals characterised by purpose
  • A01K2267/03—Animal model, e.g. for test or diseases
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide
  • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
  • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide
  • C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor

Definitions

• the invention relates to the field of epigenetic modification of genomic DNA in animal cells.
• methods and compositions for controlling methylation of genomic DNA in mammalian cells are particularly useful.
• Epigenetics concerns the transmission of information from a cell or multicellular organism to its descendants without that information being encoded in the nucleotide sequence of genes.
• One mechanism by which epigenetic information is transmitted is via methylation of cytosine (C) bases in the genomic DNA of multicellular organisms.
• DNA methylation in multicellular organisms occurs mainly at CpG dinucleotides, and has important regulatory functions in development and in the epigenetic control of gene expression, including genomic imprinting, X chromosome inactivation, the silencing of transposable elements, and possibly wider roles in silencing of genes in development. Loss of DNA methylation can occur during DNA replication by inactivation of the major maintenance methyltransferase Dnmti . In addition, there are a number of examples in mammals and plants where demethylation occurs without replication of DNA, and hence is likely to be an active enzymatic process.
• Cancer is the second leading cause of death in the United States. An estimated 10.1 million Americans are living with a previous diagnosis of cancer. In 2002, 1 ,240,046 people were diagnosed with cancer in the United States (information from Centres for Disease Control and Prevention, 2004 and 2005, and National Cancer Institute, 2005). By way of example, according to Cancer Research UK, almost 44,100 cases of breast cancer are diagnosed in the UK each year (i.e. 16% of all new cancer cases), and over 12,400 deaths result annually from this disease in the UK. In the same period almost 7,000 new cases of pancreatic cancer are diagnosed in the UK (3% of all new cases), and approximately the same number of deaths result. An appreciation of why and how epigenetic changes are regulated is critical to the understanding, detection and treatment of cancer.
• Methylation and resultant gene silencing plays an important role in cancer development and also in cancer progression. Reversal of the aberrant methylation patterns induced in cancer cells represents a way in which types of cancers that are poorly responsive to conventional chemotherapeutic treatments could be targeted. In addition, epigenetic treatment factors that target DNA methylation could also be used to treat advanced or inoperable cancers, or as a adjunct to other conventional existing therapies.
• Somatic cell nuclear transfer is used to generate animals for livestock production (for cloning or for stem cell therapy), biomanufacturing of proteins and for disease modelling (Wilmut et al, 2002).
• SCNT Somatic cell nuclear transfer
• a major obstacle to the application of SCNT in order to reprogramme somatic donor nuclei to a pluripotent state is the inefficient demethylation of the donor genome by the recipient oocyte. It has been found that genomic patterns of DNA methylation are reprogrammed genome-wide in early embryos and in primordial germ cells. The ability to manipulate in a targeted fashion epigenetic reprogramming in vivo may thus have important applications in regenerative medicine and in cancer therapy.
• Aid in antibody gene diversification and somatic hypermutation (SMH), via deamination of cytosines in specific regions of the immunoglobulin locus, has been previously characterised (Neuberger et al. 2003). In the organism, Aid is usually located in the cytoplasm where it is tightly regulated (Rada et al. 2002). It is believed that Aid activity is moderated by interactions with other proteins in the cell. Thus, it is generally thought that, in vivo, Aid is tightly controlled because an 'unregulated' deamination activity would be potentially hazardous to the cell since it could result in an increased rate of mutation in the genome and/or activation of epigenetically silenced genes.
• the invention provides an isolated polypeptide molecule capable of initiating a demethylation of a methylated DNA sequence in a eukaryotic cell, the molecule comprising at least a first domain that exhibits a cytidine deaminase activity and at least a second domain that confers a DNA binding activity.
• the molecule of the invention further comprises a nuclear localisation signal, which may or may not be comprised within the first domain.
• the first domain comprises the cytidine deaminase domain of an Activation induced cytidine deaminase (Aid).
• the first domain comprises the Aid ⁇ NES sequence set out in SEQ ID NO: 1.
• the first domain comprises the cytidine deaminase domain of Apobed .
• the second domain comprises either a non-sequence specific DNA binding domain, or a sequence specific DNA binding domain.
• a sequence specific DNA binding domain may comprise a domain selected from: a zinc finger domain; a leucine zipper domain; a helix-turn-helix domain; a steroid receptor DNA binding domain; and a homeodomain.
• the sequence specific DNA binding domain is targeted to a bind sequence present in the promoter region of one or more genes whose expression is associated with a pluripotent phenotype.
• the sequence specific DNA binding domain is targeted to a bind sequence present in the promoter region of one or more genes whose expression is associated with a tumour suppression phenotype.
• the cell is a mammalian cell, optionally a human cell.
• the cell can be a pluripotent cell, a somatic cell or a cancer cell.
• a second aspect of the invention provides for an isolated nucleic acid molecule that encodes a polypeptide molecule as described in any of the embodiments mentioned above.
• a third aspect of the invention provides for an expression vector for transfection of, and expression within a eukaryotic cell of, a polypeptide molecule capable of initiating a demethylation of a methylated DNA sequence in the cell, the vector comprising a coding sequence that includes a first nucleic acid sequence that encodes a polypeptide sequence that exhibits a cytidine deaminase activity, the first sequence being linked to at least a second nucleic acid sequence that encodes a polypeptide sequence that confers a DNA binding activity, the first and second nucleic acid sequences being operably linked to a promoter sequence.
• a fourth aspect of the invention provides a nucleic acid vector for transfection of a eukaryotic cell, the vector comprising a sequence that encodes a molecule that is capable of initiating demethylation of methylated genomic DNA within the mammalian cell, the vector comprising a first nucleic acid sequence that encodes a polypeptide that exhibits a cytidine deaminase activity linked to a second nucleic acid sequence that encodes a polypeptide sequence that exhibits a DNA binding activity, the first, and second sequences being operably linked to a promoter sequence.
• the vectors further comprise one or more selection marker sequences and/or reporter gene sequences.
• the first and second nucleic acid sequences are separated by one or more intervening sequences.
• the promoter sequence is selected from either a constitutive promoter or an inducible promoter.
• the inducible promoter is selected from: a Tet regulated promoter; a Tamoxifen regulated promoter; and a steroid hormone regulated promoter.
• the vectors further comprise a sequence that encodes a nuclear localisation signal.
• the vectors of the invention comprise a nucleic acid molecule that encodes a polypeptide of the invention.
• the vectors are selected from: a plasmid; a cosmid; a viral vector; and an artificial chromosome.
• vectors are suitable for use in a mammalian cell, optionally a human cell.
• the cell is a pluripotent cell, a somatic cell, and/or a cancer cell.
• Further aspects of the invention provide methods for initiating demethylation of a methylated DNA sequence in a target cell, comprising transfecting the target cell with a vector described above and, if required, initiating expression of the vector within the target cell.
• the demethylation of the DNA sequence is for the purpose of removing epigenetic imprints in the genome of the target cell.
• a further aspect of the invention provides a method for undertaking a somatic cell nuclear transplant (SCNT) procedure comprising expressing within a somatic cell nuclear donor a polypeptide molecule capable of initiating a demethylation of at least one methylated DNA sequence located in the genome of the somatic cell, the molecule comprising at least a first domain that exhibits a cytidine deaminase activity and at least a second domain that confers a DNA binding activity.
• SCNT somatic cell nuclear transplant
• a still further aspect of the invention provides a method for treating cancer present within a patient, comprising expressing within at least one cancer cell in the patient, a polypeptide molecule capable of initiating a demethylation of at least one methylated DNA sequence located in the genome of the cancer cell, the molecule comprising at least a first domain that exhibits a cytidine deaminase activity and at least a second domain that confers a DNA binding activity.
• the invention provides for a transgenic non-human animal that comprises a nucleic acid molecule of the invention that is stably integrated within the genome of the non-human animal.
• expression of the nucleic acid molecule is under the control of a heterologous inducible promoter.
• expression of the nucleic acid molecule is under the control of an endogenous inducible promoter.
• the non- human animal is a mouse.
• a further aspect of the invention provides a pharmaceutical composition
• a pharmaceutical composition comprising a polypeptide or nucleic acid molecule described above and a pharmaceutically acceptable carrier.
• the methods and compositions of the invention are suitable for use in animal cells, suitably mammalian cell systems.
• the invention is intended to be worked in human cells, although it should be appreciated that the invention is in no way intended to encompass reproductive cloning of human beings.
• Fig. 1 shows the structure of the transgene producing the fusion protein Gal4-Aid, and schematic of the transgenic targeting strategy in vivo
• b) shows the differentially methylated region (DMR) upstream of H19 and the position into which the UAS sequence was inserted (a single loxP site is also present as a result of the recombination strategy).
• DMR differentially methylated region
• Fig. 2 shows a methylation analysis of the H19 DMR in experimental and control crosses; bisulphite analysis of the region indicated in Figure 1 was carried out on neonatal livers of offspring from crosses between CMV Gal4-myc females and H19 DMR UAS males (control) and from CMV Gal4-Aid ⁇ NES females and H19 DMR UAS males. Closed circles, methylated CpGs, open circles, unmethylated circles. The paternal H19 DMR UAS is highly methylated in the control cross, but substantially hypomethylated in the experimental one. Maternal chromosomes are unmethylated in both crosses.
• Fig. 3 shows the sequence of Aid ⁇ NES (SEQ ID NO:1 ).
• Fig. 4 shows the sequence of the CMV-GAL4-Aid ⁇ NES
• Fig. 5 shows a, The Gal4 DNA binding domain was fused to the Aid cDNA from which the C terminus containing the nuclear export signal (NES) was deleted. Amino acids in Aid are numbered. In addition to the wildtype Aid cDNA two mutant forms of Aid cDNA, resulting in amino acid changes D89G and C147R, and E58G, respectively, were used.
• Fig. 6 shows methylation in the H19 DMR-UAS as analysed by bisulphite sequencing on the paternal allele which contains the UAS sequence (left panel), and on the maternal allele which does not (right panel).
• Gal4 transgenic females were crossed with H19 DMR-UAS homozygous males, and methylation was analysed in embryos (E) and placentas (P) at E12.5, or in neonatal liver (L), of transgene positive offspring.
• the 4th CTCF binding site within the DMR is shown.
• the paternal DMR remains highly methylated in strains expressing Gal4-myc or the Gal4-Aid mutants, but is substantially demethylated in strains expressing Gal4- Aid ⁇ NES (shown here simply as Gal4-Aid).
• reprogramming refers to the step of modifying or removing epigenetic imprints from the nucleus of a cell. Reprogramming facilitates a reduction in cell fate commitment and, thus, the differentiation state of the cell as a whole and in particular the nucleus. In essence, reprogramming consists of returning a somatic differentiated or committed nucleus to a gene expression, epigenetic, and functional state characteristic of an embryonic, germ, or stem cell. Reprogramming of somatic cell nuclei is a preferred first step in procedures such as SCNT, but is also of interest in other procedures where control of cell differentiation state - i.e. potency - is important.
• 'imprinting' refers to the "memory" held by a chromosome as to which parent it was inherited from. This memory is brought about by epigenetic marks, including DNA methylation, chemically imprinted onto the DNA and can result in chromosomes behaving differently, depending on the parent of origin. Parent-of- origin-specific gene expression (either from the maternal or paternal chromosome) is often observed in mammals. This is in the parental germlines, which lead to stable gene silencing or activation.
• DNA methylation refers to the addition of a methyl (CH 3 ) group to a specific base in the DNA. In mammals, methylation occurs almost exclusively at the 5 position on a cytosine when this is followed by a guanine (CpG). DNA methylation acts as an epigenetic mark, which has important roles in regulating genome function and expression.
• Cytidine deaminases are a family of enzymes found from prokaryotic organisms such as E. coli through to mammals. These enzymes deaminate the free cytidine or the cytosine in DNA or RNA to uracil, or as shown for Aid and Apobed (two members of the family) the methylated cytosine to thymine.
• DNA mismatch repair' refers to a repair process present in the cell of a host organism that recognises and corrects base pairs in DNA that are mismatched, i.e. deviate from the normal C:G and A:T Watson-Crick DNA base pairing rules.
• 'cancer' is used herein to denote a tissue or a cell located within a neoplasm or with properties associated with a neoplasm.
• Neoplasms typically possess characteristics that differentiate them from normal tissue and normal cells. Among such characteristics are included, but not limited to: a degree of anaplasia, changes in cell morphology, irregularity of shape, reduced cell adhesiveness, the ability to metastasise, increased levels of angiogenesis, increased cell invasiveness, reduced levels of cellular apoptosis and generally increased cell malignancy.
• Terms pertaining to and often synonymous with 'cancer' include sarcoma, carcinoma, tumour, epithelioma, leukaemia, lymphoma, polyp, transformation, neoplasm and the like.
• Bioprocessing' refers to techniques in which living cells, or their components are used to produce a desired end product.
• epigenetic modifications to cells can be used to enhance these cells ability to be used in bioprocessing.
• targeted demethylation of the genome can be used to improve efficiency of cloned animal production via SCNT, where the cloned animals are transgenic and produce a desired end product.
• Somatic cells typically develop along a differentiation pathway progressing from a less specialised to a more specialised or committed state. Less specialised somatic cells can demonstrate the ability to act as progenitor stem cells giving rise to several different cell types. The amount of these different cell types that a given stem cell can act as a progenitor for is typically referred to as the 'potency' of that stem cell.
• pluripotent stem cells can act as progenitors for very many different differentiated cell types. If a cell can differentiate into all cells in the body, it is totipotent. If it can differentiate into most cell types, it is pluripotent. Embryonic stem cells are usually referred to as pluripotent as they can generate most cell types in mammals with the exception of extra-embryonic tissues (i.e. trophectoderm).
• 'derivative or homologues' of Aid refer to mRNA and polypeptides that have substantially similar sequence identity to that of human or murine Aid.
• Derivatives and homologues are considered to include orthologues of the sequences from other species and mutants that nonetheless exhibit a high level of functional equivalence - i.e. cytidine deaminase activity in vivo.
• substantially similar sequence identity it is meant that the level of sequence identity is from about 50%, 60%, 70%, 80%, 90%, 95% to about 99% identical. Percent sequence identity can be determined using conventional methods (e.g. Henikoff & Henikoff, 1992; and Altschul et al., 1997).
• sequence identity refers to both polypeptide sequences and polynucleotide sequences (DNA or RNA).
• homologues of the cytidine deaminase domains - e.g. Aid ⁇ NES - can be those sequences that are able to demonstrate the ability to hybridise with the Aid sequences described herein, under conditions of high, medium or low stringency.
• polypeptide is a polymer of amino acid residues joined by peptide bonds, whether produced naturally or in vitro by synthetic means. Polypeptide of less than approximately 12 amino acid residues in length is typically referred to as a "peptide".
• polypeptide denotes the product of a naturally occurring polypeptide, precursor form or proprotein. Polypeptides also undergo maturation or post-translational modification processes that may include, but are not limited to: glycosylation, proteolytic cleavage, lipidization, signal peptide cleavage, propeptide cleavage, phosphorylation, and such like.
• a “protein” is a macromolecule comprising one or more polypeptide chains.
• promoter denotes a region within a gene to which transcription factors and/or RNA polymerase can bind so as to control expression of an associated coding sequence. Promoters are commonly, but not always, located in the 5' non-coding regions of genes, upstream of the translation initiation codon.
• the promoter region of a gene may comprise one or more consensus sequences that act as recognisable binding sites for sequence specific DNA binding domains of DNA binding proteins. Nevertheless, such binding sites may also be located in regions outside of the promoter, for example in enhancer regions located in introns or downstream of the coding sequence.
• the present invention resides in part in the identification of a modified form of a cytidine deaminase, termed Aid ⁇ NES, that when expressed in mammalian cells leads to demethylation of imprinted regions within the genome.
• Aid ⁇ NES a modified form of a cytidine deaminase
• the modified form of Aid lacks a nuclear export signal ( ⁇ NES) and as a result when heterologously expressed in cells the enzyme remains localised to the nuclei of the cells, whereas wild type Aid would be usually found mainly in the cytoplasm.
• ⁇ NES nuclear export signal
• the present C terminal truncation is novel and more extensive than that performed previously.
• CSR class switch recombination
• SHM somatic hypermutation
• a fusion of Aid ⁇ NES and the GAL4 DNA binding protein bound to a UAS sequence placed upstream of the H19 gene in mouse cells and resulted in demethylation of cytidine residues in a DMR up to approximately 600 bases on either side of the UAS.
• the demethylation of this region results in switching on of H19 gene expression.
• Sequencing of the promoter sequence afterwards indicated that the level of mismatch point mutation was not increased to statistically significant levels. This is an important and surprising result, as Aid is a deaminase and relies essentially on host excision repair mechanism to correct the T-G mismatch following the deamination of the methylated C to a T.
• Aid represents a part of a notional 'demethylase' function characterised by deamination of methylcytosine followed by excision repair by the host's own mechanisms. It is believed that this is the first time that the Aid mediated demethylation of DNA has been shown to work in-vivo and in a targeted manner.
• the present invention has demonstrated a number of important factors. First, it shows that local targeting of a cytidine deaminase activity, such as that of Aid or Apobec, to a methylated region in the genome in vivo can lead to its efficient demethylation without causing potentially catastrophic point mutations. Second, it demonstrates that full methylation in a DMR of an imprinted gene can be erased by an enzymatic mechanism; such erasure normally occurs during the development of primordial germ cells at E11.5 to E12.5 (in the mouse model) and may also involve active demethylation.
• a cytidine deaminase activity such as that of Aid or Apobec
• the current system has been shown to work in a transgenic system, whereby expression in mice of a Gal4-Aid ⁇ NES fusion gene together with a UAS (Gal4- binding site) into a methylated region (H19 DMR) results in its demethylation, without apparent mutations.
• the suggested mechanism is by deamination of 5 methylcytosine by Aid to T, followed by T:G mismatch repair (by mismatch glycosylases). This therefore establishes a system by which methylated genes can be targeted for demethylation in vivo, which may lead to their expression (methylation being a repressive modification most of the time).
• the model system exemplified in the present example relies on the fact that the target gene in question (H19) has been modified by addition of a UAS sequence, to its promoter region.
• a UAS sequence for example Aid ⁇ NES
• this is not a requirement of the embodiments of the present invention which can also work by using fusions of a cytidine deaminase domain, for example Aid ⁇ NES, to specific or non-specific DNA binding domains, for example, zinc finger proteins that have specific DNA binding properties or simply protein domains with a net positive charge that favour nonspecific DNA binding.
• a site specific DNA binding domain allows for targeted demethylation of specific subsets of genes activated at particular times in development or during the cell cycle.
• the DNA binding domains of the Oct4, SOX-2 or Nanog proteins when fused to Aid ⁇ NES could provide for a demethylation activity that is directed towards genes that are involved in cell fate decisions relating to promotion of a pluripotent or stem cell-like phenotype.
• Alternative DNA binding domains that could optionally be utilised include those from T-box transcription factors such as Brachyury, or steroid hormone receptor DNA binding domains such as the RAR and RXR DNA binding domains.
• Aid ⁇ NES expression alone (without targeting domain) could be also sufficient to demethylate the promoters of the pluripotent marker genes Oct4 and Nanog as it has been found that there are several putative binding sites for Aid itself in the upstream regions of these genes.
• the cytidine deaminase domain is suitably fused to a protein domain of net positive charge - for example, comprising a histone tail sequence from histones H2A/B, H3 and/or H4.
• Custom peptide sequences that permit non-specific DNA binding can also be incorporated, in accordance with this embodiment of the invention.
• Cytidine deaminase activity combined with DNA binding is therefore an epigenetic reprogramming, or imprint erasure, factor.
• the identification of such factors is of great interest for the improvement of somatic cell nuclear transfer techniques (cloning), stem cells and regenerative medicine, and certain approaches to cancer therapy. Indeed, according to the Examples of the present invention in use (see below) it is clear that exposure of a fully methylated H19 DMR to Aid activity by direct targeting in vivo of the Aid ⁇ NES protein to the DNA in the zygote results in efficient and almost complete demethylation at this locus.
• the DNA binding region from any one of these transcription factors can be combined with a cytidine deaminase activity, such as that mediated by Aid, in order to obtain a demethylation factor that targets the nanog promoter.
• Targeting of cytidine deaminase activity to genes of interest in cancer can include, for example, fusion of the cytidine deaminase to a tumour suppressor DNA binding domain - such as the zinc finger DNA core binding region of the p53 protein. It is believed that in many cancers, mutation of the DNA binding domain of p53 can contribute to transformation. In addition, the promoter regions of many tumour suppressor genes, including p53 targets, are methylated in cancer cells.
• the present invention also provides to methods and compositions for the treatment of cancer.
• Therapeutic embodiments of the present invention comprise pharmaceutical compositions that can be directed towards the treatment of cancer - for both solid tumours and lymphatic cancers.
• a fusion polypeptide comprising at least a cytidine deaminase domain and at least a DNA binding domain.
• the DNA binding domain may be either specific to a target DNA sequence or a non-specific polypeptide domain with DNA binding affinity.
• the therapeutic compositions of the invention also typically comprise a pharmaceutically acceptable carrier.
• Pharmaceutical preparations of the invention are formulated to conform with regulatory standards and can be administered orally, intravenously, topically, or via other standard routes.
• the pharmaceutical preparations may be in the form of tablets, pills, lotions, gels, liquids, powders, suppositories, suspensions, liposomes, microparticles or other suitable formulations known in the art.
• the pharmaceutical preparations of the present invention may be utilised as the primary form of cancer therapy.
• the demethylation activity is targeted to sites in the promoters of tumour suppressor genes that are known to be methylated in the specific cancer cell to be treated (including p53) so as to induce 'reactivation' of these tumour suppressor genes and consequent apoptosis or cell cycle arrest in the target cancer cell.
• the pharmaceutical preparations of the invention can be used as adjuncts to conventional cancer chemotherapeutics and other anti-cancer drugs.
• the pharmaceutical compositions of the invention can increase the susceptibility of the cancer cells to treatment with the conventional pharmaceutical approach, by reducing the inherent 'resistance' of the cancer cells to the chemotherapeutic agent.
• compositions of the present invention provide a unique epigenetic route to treatment of cancers.
• the molecules and pharmaceutical compositions of the present invention can be assessed for their anti-cancer/anti-tumorigenic effects by utilising in vitro and ex vivo assays.
• a nucleic acid vector that expresses a molecule of the invention is transfected into a cancer cell line (e.g. HeLa cell line).
• a cancer cell line e.g. HeLa cell line.
• Appropriate controls are established comprising the cancer ceil line transfected with vector backbone only, or vector plus a molecule of the invention in which the cytidine deaminase domain is rendered non-functional (e.g. see the ⁇ Aid2 domain) described in more detail below.
• a suitable ex vivo assay assesses the ability of the molecules of the invention to inhibit tumour formation in an organism.
• the assay involves transfecting a cancer cell line (e.g. NIH-3T3 cells) with nucleic acid vectors, such as those described above, and then injecting the transfected cells sub-cutaneously into nude mice. Rapidly growing tumours would be expected in mice injected with the vector backbone only or a molecule with a non-functional cytidine deaminase domain by 21 days post injection.
• the animals injected with cells transfected with molecules of the invention that exhibit targeted cytidine deaminase activity and which successfully demethylate promoter regions of silenced tumour suppressor genes, would be expected to either not exhibit tumour growth, or exhibit reduced or diminished tumours.
• This assay could be used to screen many targeted and non- targeted variants of the molecules of the invention.
• the ex vivo assay is particularly suited for screening of several fusion molecules comprising the cytidine deaminase domain of Aid (e.g. Aid ⁇ NES) or Apobed with different DNA binding domains (e.g. zinc finger domains).
• a specific embodiment of the invention provides for a transgenic animal comprising a nucleic acid sequence that expresses a molecule of the invention. Methods suitable for producing transgenic animals are described, for example in European Patent No. 419621.
• the nucleic acid sequence is inducible in response to an exogenous factor.
• the inducible promoter sequence may be a heterologous sequence that is introduced at the same time as the nucleic acid sequence that expresses a molecule of the invention.
• the inducible promoter sequence may be an endogenous sequence that is present normally in the genome of the target cell.
• Transgenic animals of the invention can express molecules exhibiting either targeted or non-targeted demethylation activity and are therefore of considerable use in drug screening models or as a system for investigating systems biology associated with erasure of genetic imprints.
• the transgenic animal of the invention is a mouse comprising a stably integrated gene that expresses a polypeptide including an Aid ⁇ NES domain and a non-specific DNA binding domain.
• the integrated gene comprises a heterologous promoter that is inducible in response to exposure of the animal to an exogenous factor, such as a steroid hormone or a molecule such as tamoxifen or Tet.
• an exogenous factor such as a steroid hormone or a molecule such as tamoxifen or Tet.
• nucleic acid vectors suitable for transfection of the target cell of interest are used.
• the vectors are designed according to conventional protocols for the intended use, such as for expression of the molecules of the invention, and/or stable integration into the genome of the target cell (Sambrook J. et al, Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY).
• the vectors of the invention encompass a DNA molecule that is either linear or circular, into which other DNA sequence fragment(s) of appropriate size can be integrated, and wherein the DNA fragment(s) include the nucleic acid sequences encoding the molecules of the invention and, optionally, additional segments that provide for transcription of the sequence encoded by the DNA sequence fragment.
• the additional segments can include and are not limited to: promoters, transcription terminators, enhancers, internal ribosome entry sites, untranslated regions, polyadenylation signals, selectable markers, origins of replication, homologous DNA flanking regions and such like.
• Suitable vectors are often derived from plasmids, cosmids, viral vectors and yeast artificial chromosomes; vectors are often recombinant molecules containing DNA sequences from several sources.
• an expression vector comprises a first nucleic acid sequence that encodes a polypeptide sequence that exhibits a cytidine deaminase activity, the first sequence being linked to at least a second nucleic acid sequence that encodes a polypeptide sequence that confers a DNA binding activity.
• the 'linkage' between the first and second sequences can be direct in the sense that the two domains are spatially proximate. In alternative embodiments of the invention the linkage may be less direct in the sense that one or more intervening polypeptide sequences can be included to assist with tertiary conformation, cellular regulation, labelling or protein purification.
• Aid and Apobed and 3 can deaminate cytosine in DNA leading to hypermutation of DNA in immunoglobulin genes and viruses (Petersen-Mahrt 2005). Deamination of cytosine results in uracil which is normally efficiently repaired by the mismatch glycosylases Ung and Smug, but this repair may be rate limiting in somatic hypermutation of immunoglobulin genes (DiNoia et al 2006). Similarly, deamination of 5 methylcytosine can be mutagenic if the resulting T:G mismatches are not repaired efficiently within the same cell cycle.
• the generation of the H19 DMR UAS and of the CMV Gal4-myc mice have been described (Murrell et al 2004 also WO-A-04106550).
• the CMV Gal4-Aid ⁇ NES transgene was constructed by fusing Aid in-frame with the Gal4 DNA binding domain.
• the construct was verified by DNA sequencing (see Fig. 4).
• the CMV Gal4-Aid ⁇ NES DNA fragment (see Fig. 1b) was then linearized by Nrul and Dralll enzymes and microinjected into F1xF1 mouse zygotes. From five positive founder mice, three permanent transgenic lines were established (termed lines 4, 5, and 7). These were bred with the H19 DMR UAS mice as described in the text. DNA was isolated from neonatal organs by standard methods, was bisulphite treated as described (Oswald et al., 2000) and amplified with outer and inner primers;
• PCR products were cloned into PCR2.1 using TOPO TA cloning kit (Invitrogen) according to the manufacturer's instructions. The cloned PCR fragments were then sequenced with M13 forward primers.
• CMV Gal4- ⁇ Aid1 carries two amino-acid changes, which were designed to affect its catalytic function and its DNA binding, respectively
• CMV Gal4- ⁇ Aid2 has a single amino acid change in the catalytic domain (see Figure 5a). Both CMV Gal4- ⁇ Aid1 and CMV Gal4- ⁇ Aid2 lack the C- terminal NES. Plasmids CMV Gal4- ⁇ Aid1 and CMV Gal4- ⁇ Aid2 were derived from CMV Gal4-Aid ⁇ NES by standard in vitro mutagenesis and were verified by sequencing.
• transgenic lines Four independent transgenic lines were established. Two of the lines were made (as described above in Example 1 ) with CMV Gal4-Aid ⁇ NES (denoted as lines TG 4 and 5), the third with CMV Gal4- ⁇ Aid1 (denoted as line TG7), and the fourth with CMV Gal4- ⁇ Aid 2 (denoted as line TG8). In all lines the transgenes were expressed in embryos and placentas on E12.5, and in postnatal tissues notably in the ovary, with some exceptions such as the liver ( Figure 5b, see further discussion in Example 3 below). The RT PCR results were confirmed by Western blotting using an antibody against the DNA binding domain of Gal4 (data not shown).
• RNA and protein expression of transgenes and RNA expression of Igf2 and H19 Total RNA was extracted from different embryonic and postnatal tissues with the RNeasy mini/midi ® kit (Qiagen). cDNA was synthesized by using SuperScriptTM Il reverse transcriptase (Invitrogen). The efficiency of cDNA synthesis was evaluated by PCR for Hprt. To ensure there is no DNA contamination, reactions without reverse transcriptase were always done in parallel. Expression of Gal4-Aid ⁇ NES transcripts was analyzed by RT-PCR using primers in the Gal4 region (s: AAGTGCGCCAAGTGTCTGAA) and Aid region (as:
• Gal4-Aid ⁇ NES protein expression was confirmed by western blotting of total protein extracted from different tissues of transgenic mice. Briefly, tissue extracts were prepared using standard protocols and the protein concentration was determined by Bradford assay. Protein samples were run on 10% SDS- polyacrylamide gels, electroblotted onto Hybond-P membranes (Amersham), blocked and incubated with 1 :200 dilution of the anti-Gal4 primary antibody (Santa Cruz) and 1 :2000 anti-tubulin antibody (Abeam®). The membrane was then incubated with 1 :2000/1 :10000 dilution of secondary antibody (Amersham) against rabbit/goat immunoglobulin.
• Detection was done with the enhanced chemiluminescence system (ECL, Amersham).
• Expression levels of Igf2 (Mm00439565_g1 ), H19 (MmO1156721_g1 ), and Gapdh (Mm99999915_g1) transcripts were determined by TaqMan® probes purchased from Applied Biosystems.
• Quantitative real time PCR experiments were performed in triplicate with a ABI PRISM 7700 thermocycler (Applied Biosystems); the relative quantification, amplification efficiencies, and comparative method of relative quantification were done according to instructions supplied by Qiagen.
• Fertilised oocytes were washed in PBS, and after fixation in 4% paraformaldehyde in PBS for 15 minutes, the zonae were removed with Tyrode's Solution Acidic (Sigma) and the oocytes permeabilised with 0.2% Triton X-100 in PBS for 1 hour, at room temperature. After blocking in 0.05% Tween-20 in PBS containing 1 % BSA (BS) overnight at 4°C, the oocytes were incubated with anti-Gal4 rabbit polyclonal antibody (Santa Cruz, sc-577) diluted 1 :30 (BS) for 3 hours at room temperature. Detection was achieved using goat ⁇ -rabbit IgG-Alexa (Molecular Probes) as secondary antibody.
• Baylin SB DNA methylation and gene silencing in cancer. Nat Clin Pract Oncol.
• Dnmt3a binds deacetylases and is recruited by a sequence-specific repressor to silence transcription EMBO J 20, 2536-2544.

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Zoology (AREA)
• Organic Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Wood Science & Technology (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Biomedical Technology (AREA)
• Veterinary Medicine (AREA)
• Molecular Biology (AREA)
• Microbiology (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Developmental Biology & Embryology (AREA)
• Physics & Mathematics (AREA)
• Animal Behavior & Ethology (AREA)
• Environmental Sciences (AREA)
• Plant Pathology (AREA)
• Medicinal Chemistry (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Animal Husbandry (AREA)
• Biodiversity & Conservation Biology (AREA)
• Pharmacology & Pharmacy (AREA)
• Public Health (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Enzymes And Modification Thereof (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Peptides Or Proteins (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Priority Applications (4)

Applications Claiming Priority (8)

Related Child Applications (2)

Publications (2)

Family

ID=36539563

Family Applications (1)

Country Status (5)

Cited By (13)

Families Citing this family (8)

Citations (1)

Family Cites Families (11)

• 2006
  • 2006-04-07 GB GBGB0607063.5A patent/GB0607063D0/en not_active Ceased
  • 2006-11-27 GB GBGB0623644.2A patent/GB0623644D0/en not_active Ceased
• 2007
  • 2007-04-10 JP JP2009503661A patent/JP2009532053A/ja active Pending
  • 2007-04-10 US US12/226,094 patent/US8298529B2/en not_active Expired - Fee Related
  • 2007-04-10 EP EP07732348.3A patent/EP2010660B1/en not_active Not-in-force
  • 2007-04-10 WO PCT/GB2007/001304 patent/WO2007128982A2/en not_active Ceased
• 2012
  • 2012-10-05 US US13/646,008 patent/US8658393B2/en not_active Expired - Fee Related

Patent Citations (1)

Non-Patent Citations (22)

Also Published As

Similar Documents

Legal Events