WO2007122823A1

WO2007122823A1 - Tumor target cell capable of producing vector

Info

Publication number: WO2007122823A1
Application number: PCT/JP2007/050013
Authority: WO
Inventors: Takashi Okada; Keiya Ozawa
Original assignee: Jichi Medical University
Priority date: 2006-04-20
Filing date: 2007-01-05
Publication date: 2007-11-01
Also published as: JPWO2007122823A1; JP5283219B2; JP5846650B2; JP2013176374A

Abstract

It is intended to provide a tumor target cell having an ability to produce a virus vector. It is also intended to provide a method of preparing a tumor target cell having an ability to produce a virus vector. The tumor target cell as described above is usable in treating a tumorous disease, an inflammatory disease or a disease related thereto or in detecting a tumor lesion or an inflammatory lesion. Thus, it is furthermore intended to provide a kit for treating a tumorous disease, an inflammatory disease or a disease related thereto or a kit for detecting a tumor lesion or an inflammatory lesion each containing the tumor target cell as described above.

Description

Specification

Vector-produced tumor target cells

Technical field

[0001] The present invention relates to a tumor target cell having the ability to produce a viral vector. The present invention also provides

The present invention also relates to a method for preparing tumor target cells having the ability to produce viral vectors. In addition, the tumor target cells of the present invention can be used for the treatment of neoplastic diseases, inflammatory diseases or related diseases. Therefore, the present invention relates to a pharmaceutical composition comprising the tumor target cell of the present invention. Furthermore, the tumor target cells of the present invention can be used for detection of tumor lesions or inflammatory lesions. Therefore, the present invention relates to a diagnostic composition for detecting a tumor lesion or inflammatory lesion comprising the tumor target cell of the present invention.

Background art

[0002] Various gene transfer methods have been developed for gene therapy in animals, and can be broadly divided into in vivo methods (in vivo methods) and in vitro methods (ex vivo methods). The internal body method is a method in which a vector containing a therapeutic gene is directly injected into the body. The extracorporeal method is a method of introducing a gene into a target cell collected from a patient, selecting and amplifying the gene-introduced cell, and then returning the gene-introduced cell to the body again by transplantation, injection, or the like.

[0003] One of the major strategies in gene therapy for tumors, including cancer, is a strategy to expand the difference in drug sensitivity between normal cells and tumor cells by introducing therapeutic genes into tumor cells. . By introducing a therapeutic gene into a tumor cell, it is possible to expect a long-term and stable expression of the therapeutic protein and the effect of expression in the cell. In addition, due to the presence of a gap junction between cells, the metabolite produced by the therapeutic protein, which is an expression product of the introduced therapeutic gene, is also transmitted to adjacent cells. Expect to have an effect.

[0004] One therapy based on the above strategy is HSV-tkZGCV therapy (Ram, Z. et al., Nat. Med., (1997) 3: 1354-1361). HSV— tk / GCV therapy [This is a combination of introduction of the herpesvirus-derived thymidine kinase (HSV—tk) gene into cells and administration of ganciclovir (GCV). —Tk gene introduced It is a treatment that leads the cells to apoptosis. HSV—tk does not lead to cell death by expressing itself in the cell. However, when ganciclovir (GCV) is administered and taken up by cells, HSV—tk phosphorylates GCV and converts it into GCV—MP (—phosphate), which then ultimately results in cellular DNA synthesis through intracellular metabolism. Inhibiting GCV— converted to TP (triphosphate). This action of GCV-TP leads cells to apoptosis.

<o

[0005] The GLI328 International Study Group has engineered patient glioma cells to produce viral vectors containing the HSV-tk gene, and transplanted the cells into tumors before GCV (See, for example, Rainov NG on behalf of the GLI328 International Study Group, Hum. Gene Ther., Vol. 11, p. 2389—2401, 2000) ). However, this method has a limited ability to spread the vector in the tumor tissue, and the vector transfer efficiency of the vector is extremely low, 0.002 to 2.6%.

[0006] In addition, our research group has previously created a hybrid vector that encapsulates a plasmid designed to produce a retrovirus vector containing the HSV-tk gene in an adenovirus vector. . Then, the adenoviral vector was injected into the tumor tissue to introduce the gene into the tumor cell, the tumor cell was modified to produce the retroviral vector, and gene therapy was attempted in vivo (Okada, T. et al., J. Gene. Med., Vol. 6, p. 288-299, 2004). This method showed improved gene transfer efficiency and spread of the vector in the tumor tissue.

[0007] In order to obtain higher clinical efficacy, there is still a need for a technique that maintains a supply of a sufficient amount of therapeutic protein locally and performs efficient gene transfer in vivo. In addition, there is a need for a technique that can also be used to treat minute metastatic lesions that cannot be detected by ordinary tumor detection methods.

[0008] Mesenchymal stem cells (MSCs) are cells that serve as the foundation of bone marrow, and have an ability to accumulate in tumors and inflamed tissues, have multipotency, and promote stem cell differentiation and engraftment. Therefore, MSCs are expected to be applied to cell therapy as carriers for producing therapeutic proteins. Inherited MSCs to express therapeutic proteins such as cytoforce-in Attempts have been made to use MSCs as carriers to deliver the therapeutic protein to target cells by modification of the molecule (Studeny, M. et al., Journal of the National Cancer Institute, Vol. 96, p. 1593— 1603, 2004; H. Hamada et al., Cancer Sci., Vol. 96, p. 149—156, 2005; and Nakamizo, A. et al., Cancer Res., Vol. 65, p. 3307— 3318, 2005). However, long-term expression is difficult because the amount of therapeutic protein produced from the transplanted gene-modified MSCs depends on the state of the accumulated MSCs.

Non-patent literature l: Ram, Z. et al., Nat. Med., Vol. 3, p. 1354-1361, 1997 Non-patent literature 2: Rainov NG on behalf of the GLI328 International Study Group, Hum. Gene Ther., Vol. 11, p. 2389— 2401, 2000

Non-Patent Document 3: Okada, T. et al., Gene. Med., Vol. 6, p. 288-299, 2004 Patent Document 4: Studeny, M. et al., Journal of the National Cancer Institute

, Vol. 96, p. 1593-1603, 2004

Non-patent literature 5: Hamada, H. et al., Cancer Sci., Vol. 96, p. 149-156, 2005 Non-patent literature 6: Nakamizo, A. et al., Cancer Res., Vol. 65, p. 3307-3318 , 20 05

Disclosure of the invention

Problems to be solved by the invention

[0009] An object of the present invention is to provide tumor target cells having the ability to produce viral vectors. Another object of the present invention is to provide a method for preparing tumor target cells having the ability to produce viral vectors. The present invention further aims to provide a pharmaceutical composition comprising the tumor target cell of the present invention. Another object of the present invention is to provide a diagnostic composition for detecting a tumor lesion or an inflammatory lesion comprising the tumor target cell of the present invention.

Means for solving the problem

[0010] As a result of intensive research, the present inventor created MSCs having the ability to produce viral vectors by genetically engineering mesenchymal stem cells (MSCs) that have the ability to accumulate in tumor tissues and inflammatory tissues. When the MSCs were administered to a cancer-bearing animal model, the MSCs They found that high-efficiency gene transfer and gene expression occurred in cancerous lesions as a result of accumulation in the nest and production of viral vectors there. Based on this, the present inventors have found that tumor target cells having the ability to produce viral vectors produced by genetically engineering tumor target cells having the ability to accumulate in tumor tissues, inflammatory tissues, etc. The present invention has been completed by conceiving the technical idea that it is useful for gene transfer or gene therapy for lesion tissues such as inflammatory diseases.

[0011] Therefore, the present invention provides tumor target cells having the ability to produce viral vectors.

[0012] The present invention also provides tumor target cells having the ability to produce viral vectors for use in gene transfer or gene therapy for animals or animal cells.

[0013] In addition, when the transgene contained in the viral vector is a therapeutic gene, the tumor target cell having the ability to produce the viral vector of the present invention is used for tumorous diseases, inflammatory diseases, or lesion tissues of related diseases. It can be used for gene transfer or gene therapy. Therefore, the present invention provides a tumor target cell having the ability to produce a viral vector for use in gene transfer or gene therapy for neoplastic diseases, inflammatory diseases, or lesion tissues of closely related diseases.

[0014] In addition, when the transgene contained in the viral vector is a detectable marker gene, the tumor target cell having the ability to produce the viral vector of the present invention can be used for detection of a tumor lesion or an inflammatory lesion. it can. Therefore, in one aspect, the present invention is a marker gene that can detect a transgene contained in a virus vector, and is used for detecting a tumor lesion or an inflammatory lesion by detecting the expression of the marker gene. Tumor target cells having the ability to produce viral vectors are provided.

[0015] In another embodiment, the present invention provides a method for preparing tumor target cells having the ability to produce the viral vector of the present invention.

[0016] In another aspect, the present invention provides a pharmaceutical composition comprising the tumor target cell of the present invention. The present invention also provides a diagnostic composition for detecting a tumor lesion or an inflammatory lesion comprising the tumor target cell of the present invention.

Hereinafter, the present invention will be described in detail.

Virus vector i¾ cattle. The present invention provides tumor target cells having the ability to produce viral vectors.

[0018] In the present specification, a tumor target cell is a cell having a property of accumulating in a tumor tissue or an inflammatory tissue in a living body. Specific examples of tumor target cells include, but are not limited to, mesenchymal stem cells (MSCs), tissue stem cells including vascular endothelial progenitor cells, neural stem cells, and tumor cells. MSCs are the preferred tumor target cells. MSCs are preferred because of their ability to accumulate in tumor tissue and inflamed tissue, as well as for patients who have a low probability of rejection at the time of transplantation, and can be used for a large number of patients as well as relatives. This is because.

[0019] The tumor target cells of the present invention are not particularly limited as long as they are derived from animals, but are preferably derived from mammals.

[0020] In the present specification, a viral vector refers to a vector for introducing a foreign gene into a cell by applying a mechanism in which a virus originally infects and maintains the cell. Further, in the present specification, the term “vector” means a medium that enables introduction of a desired gene or DNA sequence into a host cell.

[0021] The viral vector produced by the tumor target cell of the present invention is not particularly limited as long as it is a viral vector. However, a retroviral vector, an adeno-associated virus (AAV) vector, an adenoviral vector, a lentiviral vector, a foamy viral vector. , Influenza zenores vector, sendai winores betater, simple henope suenoles vector, hepatitis virus vector, papilloma virus vector, baculovirus vector, rabies virus vector, and their hybrid vectors This is the virus vector. Preferred viral vectors are viral vectors selected from the group consisting of adeno-associated viral vectors, adenoviral vectors, retroviral vectors, lentiviral vectors, and their hybrid vector capabilities. A particularly preferred viral vector is a retroviral vector. Retroviral vectors are easily inactivated by complement in the blood, but it is possible to produce retroviral vectors in target tissues by using tumor target cells that produce the viral vectors of the present invention. Stable gene expression can be expected.

[0022] The tumor target cell of the present invention is genetically engineered to produce a viral vector. It is. Specifically, the tumor target cells of the present invention are transfected with (1) a plasmid containing the desired transgene; and (2) one or more plasmids containing a gene encoding a viral protein. . Here, the above plasmids (1) and (2) are included in the plasmid (2) although proteins necessary for the production of virus particles are expressed by the plasmid (2) in the cells into which they have been introduced. The gene that codes for the virus-derived protein is not packaged in the virus particle, and the transgene of the plasmid in (1) is designed to be packaged in the virus particle. Therefore, the viral vector produced by the tumor target cell of the present invention is a viral vector in which a desired transgene is packaged in a viral particle. The viral vector contains the desired transgene, but does not contain the gene that encodes the virus-derived protein! /, So the transgene can be introduced into the infected cell by infecting the cell, and The virus never replicates to the cells! /

In the case of a retroviral vector, the tumor target cell of the present invention includes (l) 5, LTR (long terminal repeat), packaging signal (Ψ), desired transgene, and 3, plasmid containing LTR And (2) a plasmid containing a gagZpol gene and an env gene, or a plasmid containing a gag / pol gene and a plasmid containing an env gene. Here, the gag gene encodes a virus particle constituent protein, the pol gene encodes a reverse transcriptase, and the env gene encodes a virus envelope protein, both of which are genes derived from retroviruses. Here, the virus envelope protein is not particularly limited as long as it is a protein that can be an envelope of a retrovirus. For example, VSV-G (G protein of vesicular stomatitis virus), envelope protein of amphotropic retrovirus, echotropic retro Virus envelope protein, gibbon ape envelope protein, feline RD1 14 envelope protein, etc. may be used. The binding of the retroviral envelope to the target cell receptor is the first step in infection, so the type of envelope defines the cell type into which gene transfer is possible. That is, the homotrophic echotropic virus (ecotropic) that infects only rodents and the amphibian amphotropivirus (amphotropi) that also infects various types of cells including humans in addition to rodents. c), a packaging cell line for the production of each retroviral vector is created. When preparing a vector for gene transfer into human cells, use an unphoto-pick type. Retroviruses have the property of packaging a gene with a packaging signal on the 5th, 3rd, 1 ^ [¾, and a packaging signal on the 5th side. The tumor target cell of the present invention into which the plasmids of (1) and (2) above have been introduced expresses a protein required for virus particle production by the plasmid of (2), and the introduction of the plasmid of (1) Genes are knocked into virus particles. Here, since the LTR sequence and the packaging signal are not present in the plasmid (2), it is not packaged in the produced viral vector. Therefore, the retroviral vector produced by the tumor target cell of the present invention is a retroviral vector containing a desired transgene in a viral particle.

When the viral vector is an adeno-associated viral vector (AAV), the tumor target cell of the present invention includes (1) 5, ITR (inverted terminal repeat), packaging signal, promoter and poly A , 3, AAV vector plasmid containing ITR, (2) AAV V helper plasmid capped crep gene except ITR of AAV genome, (3) E2A, E4, VA-RNA of type 2 or type 5 adenovirus An adenovirus helper plasmid cloned with the gene is introduced. Here, the rep gene codes for an enzyme protein and the cap gene codes for a capsid protein, both of which are AAV-derived genes. As the cap gene, those containing AAV cap genes derived from various serotypes or cap genes of multiple serotypes can be used. Here, in the case of wild type AAV, rep and cap genes are expressed in the presence of a helper virus such as adenovirus and herpes virus, and AAV proliferates. For this reason, it is also possible to use a helper virus such as adenovirus and herpes virus and their genome instead of the adenovirus helper plasmid. AAV has the property of packaging a gene inserted between ITRs at both ends together with a packaging signal into a viral capsid. In the tumor target cell of the present invention into which the plasmid (or helper virus) of (1), (2) and (3) above has been introduced, a protein necessary for the production of virus particles is expressed by the plasmid of (2), And the introduction of the plasmid of (1) The transferred gene is packaged into a viral particle. Here, since the ITR sequence and the packaging signal do not exist in the plasmid (2), it is not packaged in the produced viral vector. Therefore, the AAV vector produced by the tumor target cell of the present invention is an AAV vector containing a desired transgene in a viral particle.

When the viral vector is an adenoviral vector, the tumor target cells of the present invention include (1) 5, an ITR (inverted terminal repeat), a packaging signal, the gene expression cassette containing a promoter and poly A, the E1 gene ( Or, in addition to this, E

Type 2 or type 5 adenovirus gene other than (2, E3, E4 gene), adenoviral vector plasmid containing 3 'ITR, viral vector, (2) type 1 or type 5 adenovirus E1 gene (or In addition, adenovirus helper plasmids or viral vectors cloned with E2, E3, and E4 genes) have been introduced. Here, when a viral vector is used as (2), the viral vector is not necessarily limited to the force derived from retrovirus or AAV. Here, the El, E2, E3, and E4 genes of the human adenovirus early genes are mainly virus DN

Involved in the replication of A. The late gene encodes a capsid protein. The adenoviral vector usually used as a gene therapy vector replaces the E1 region consisting of E1A and E1B, which activates the adenoviral promoter, with a foreign gene expression cassette containing the promoter and poly A, and El protein. Only cells that can be supplied separately can grow. Therefore, adenoviral vectors lacking the E1 region are

If the E1 gene product is expressed, it cannot grow in normal cells and becomes a virus that cannot grow. Also, since the E3 region is not essential for virus growth, it is often removed for the purpose of increasing the insertion size of foreign genes. Adenovirus has the property of packaging a gene inserted between ITRs at both ends together with a DNA / caging signal into a viral capsid. In the tumor target cell of the present invention into which the plasmid or virus vector of (1) and (2) is introduced, a protein necessary for production of virus particles is expressed by the plasmid or virus vector of (2), and The plasmid or virus vector transgene of (1) is packaged into a virus particle. Here, adenovirus-derived ITR sequences and packages are included in the plasmid or virus vector in (2). No packaging signal is present, so it is not packaged into the viral vector produced. Therefore, the adenoviral vector produced by the tumor target cell of the present invention is an adenoviral vector containing the desired transgene in the viral particle.

[0026] In the present specification, gene introduction refers to introduction of a gene into a cell. When a gene is introduced into a cell using a plasmid, the electopore position method or its improved method, the Nucleofector method (using Nucleofector (registered trademark) technology; am axa), lipofuxion method, calcium phosphate method, Or a method known to those skilled in the art such as DEAE dextran method. When a gene is introduced into a cell using a viral vector, since the virus originally uses a mechanism that infects and maintains the cell, the gene is introduced into the cell by infecting the cell with the viral vector. The In addition, similar to plasmids, viral vectors are introduced into cells by methods such as the electopore position method or its improved methods such as the nucleo-off-exclusion method, lipofuxion method, calcium phosphate method, and DEAE-dextran method. It may be introduced. In such a method, if the structural protein of the viral vector is involved in gene expression after viral vector uptake into the cell, it is difficult to infect the viral vector because of the idea that the viral vector is incorporated into the cell. Sometimes used to introduce well.

[0027] In the present specification, the transgene is a gene intended to be introduced into a cell by gene introduction or introduced into a cell.

[0028] The transgene contained in the viral vector produced by the tumor target cell of the present invention is not particularly limited, but is preferably a therapeutic gene or a detectable marker gene.

[0029] Preferred therapeutic genes include simple herpesvirus thymidine kinase (HS V—tk): Bim, FADD, p53, GM—CSF, interleukin (IL) -2, IL-10, IL-12, IL24 (mda-7), B7ZB70, angiostatin, endostatin, sFlt-1 (free VEGF receptor), NK4, cytosine deaminase (CD), mdr-1, VZV-tk, Including, but not limited to, X GPRT, or a combination of two or more thereof. More preferred therapeutic genes are HSV-tk, CD, VZV-tk, XGPRT, etc. These genes are genes that lead to cell death when expressed in the introduced cell. A child. These genes are preferred because these genes can be used as transduction factors. (I) When infected normal cells become malignant, the cells can be killed.

(ii) when the tumor target cell producing the viral vector of the present invention itself is malignant, the cell can be killed; and (iii) the tumor target cell producing the viral vector of the present invention is a tumor cell. When the malignancy is promoted, such as by increasing the expression of a protein that adversely affects the proliferative ability / metastasis ability of itself or surrounding normal cells, the tumor target cells and tumor cells can be killed. This is because safety is high when the cells of the present invention are used for treatment.

[0030] HSV-tk does not lead to cell death by expressing itself in the cell, but leads to cell death when used in combination with ganciclovir (GCV) administration. Specifically, when GCV is taken up by a cell into which H SV-tk has been introduced, HSV-tk phosphorylates GCV to GCV-MP (-phosphate). GCV—MP is then converted into GCV—DP (diphosphate) and GCV—TP (triphosphate) by intracellular enzymes, and this GCV—TP inhibits cell DNA synthesis, leading to cell death. (Z. Ram et al., Nat. Med., Vol. 3, p. 1354–1361, 1997). CD, VZV-tk, and ZGPRT are also suicide genes, and in combination with administration of 5-FC, AraM, and 6-TX, respectively, leads to cell death in cells expressing the suicide gene. In the present invention, a particularly preferred therapeutic gene is HSV-tk.

[0031] Preferred examples of detectable marker genes include, but are not limited to, green fluorescent protein (GFP), red fluorescent protein (RFP), luciferase, and the like.

[0032] The tumor target cells having the ability to produce the viral vector of the present invention can be used for gene transfer or gene therapy for animals or animal cells. The animal or animal cell is preferably a mammal or a mammalian cell, respectively.

[0033] When the transgene contained in the viral vector is a therapeutic gene, the tumor target cell having the ability to produce the viral vector of the present invention can be used for tumorous diseases, inflammatory diseases, or lesion tissues of related diseases. It can be used for gene transfer or gene therapy. In the present specification, the neoplastic disease is not particularly limited as long as it is a disease accompanied by abnormal cell proliferation. For example, benign epithelial tumor (papilloma, adenoma, cyst, etc.), malignant epithelium Tumors (undifferentiated cancer, squamous cell carcinoma, adenocarcinoma, hepatocellular carcinoma, renal cancer, etc.), non-epithelial tumors (lipoma, osteoma, myoma, hemangioma, etc.), special organ tumors (hematopoietic tumor, Mesothelioma, neural tissue tumor, melanoma, etc.). More specifically, brain tumor, thyroid cancer, pharyngeal 'laryngeal cancer, ovarian cancer, bone tumor, ganglion tumor, sarcoma, liver cancer, skin cancer, breast cancer, lung cancer, digestive organ cancer, prostate cancer, uterine cancer, bladder cancer , Lymphoma, leukemia, and the like.

[0035] In the present specification, the inflammatory disease is not particularly limited as long as it is a disease accompanied by a local reaction to a disorder of living tissue, but it is degenerative inflammation (herpes virus or hepatitis virus infection, Jacob disease), serous fluid. Pneumonia (infection of anthrax, burns and frostbite, allergic reaction), lethargic inflammation (sinusitis, bronchitis, gastritis, enteritis), purulent inflammation (infection of staphylococci and Pseudomonas aeruginosa), Fibrinitis (diphtheria, dysentery, typhoid infection), hemorrhagic inflammation (pulmonary plague, influenza pneumonia, epidemic hemorrhagic fever), gangrenitis (anaerobic infection), proliferative inflammation (tuberculosis, syphilis, fungus) Disease, cirrhosis, nephritis, pulmonary fibrosis, idiopathic cardiomyopathy), granulomatous diseases other than infectious diseases (asbestosis, sarcoidosis, silicosis, Hodgkin's disease), and the like. More specifically, it includes immune-related inflammatory diseases such as rheumatoid arthritis, multiple sclerosis, Crohn's disease, pelvic inflammatory disease, ovitis, fallopian tubeitis, fallopian tube ovitis, fallopian tube peritonitis, etc. .

[0036] In this specification, neoplastic diseases or closely related diseases of inflammatory diseases refer to diseases known to those skilled in the art that inflammation control therapy is effective for the treatment. Examples include, but are not limited to, neurodegenerative diseases, arteriosclerosis (eg, atherosclerosis, stroke, ischemic heart disease), and hypertension.

[0037] In addition, when the transgene contained in the viral vector is a detectable marker gene, the tumor target cells having the ability to produce the viral vector of the present invention accumulate in the tumor lesion or inflammatory lesion. By detecting this, tumor lesions or inflammatory lesions can be detected.

[0038] Viral vector cattle. Preparation method of II heavy tumor target cells

The present invention provides a method for preparing tumor target cells having the ability to produce viral vectors. [0039] The present invention relates to a method for preparing a tumor target cell having the ability to produce a viral vector, comprising (1) a plasmid containing a desired transgene in the tumor target cell; and (2) a gene encoding a viral protein. Wherein the plasmid of (1) and (2) above is a virus particle in the tumor target cell into which they have been introduced by the plasmid of (2). The gene encoding the virus-derived protein contained in the plasmid in (2) is not packaged in the virus particle, but the transgene in the plasmid in (1) is packaged in the virus particle. Provided is the method, which is designed to be In the method of the present invention, the plasmids (1) and (2) are usually introduced at the same time, but the plasmid (1) may be introduced first, or the plasmid (2) may be introduced first. It may be introduced.

[0040] For the method of the present invention, tumor target cells, virus vectors, transgenes, as defined above.

[0041] In a preferred embodiment of the method of the present invention, the tumor target cells are mesenchymal stem cells (MSCs) and the viral vector produced is a retroviral vector. Therefore, the present invention provides a method for preparing mesenchymal stem cells having the ability to produce retroviral vectors, and comprises (1) 5, LTR, knocking signal (Ψ), transgene, and 3 And (2) a plasmid containing an LTR; and (2) a plasmid containing a gagZpol gene and an env gene, or a plasmid containing a gagZpol gene and a plasmid containing an env gene; In the method of the present invention, usually the plasmids (1) and (2) can be introduced at the same time. The plasmid of (1) may be introduced first, or the plasmid of (2) may be introduced first. You can introduce it!

[0042] According to the method of the present invention, gene transfer of a plasmid into a tumor target cell is performed by using the electopore position method or the modified method, Nucleofector (registered trademark) technology; amaxa ), A ribofusion method, a calcium phosphate method, a DEAE-dextran method, and the like. A preferred gene transfer method is a nucleo-off excision method or a lipofussion method.

[0043] rnm /

The present invention provides a pharmaceutical group comprising a tumor target cell having the ability to produce the viral vector of the present invention. Provide composition. The tumor target cells having the ability to produce a viral vector contained in the pharmaceutical composition of the present invention are as described above except that the transgene contained in the produced viral vector is a therapeutic gene.

[0044] The present invention also provides a diagnostic composition for detecting a tumor lesion or an inflammatory lesion, comprising a tumor target cell having the ability to produce the virus vector of the present invention. The tumor target cell having the ability to produce a viral vector contained in the diagnostic composition of the present invention is as described above except that it is a marker gene capable of detecting the transgene force contained in the produced viral vector.

In the present specification, the pharmaceutical composition of the present invention and the diagnostic composition of the present invention are sometimes collectively referred to as the composition of the present invention. The only difference between the pharmaceutical composition and the diagnostic composition of the present invention is whether the transgene is a therapeutic gene or a detectable marker gene. The essential nature of things is the same.

[0046] The composition of the present invention may contain a pharmaceutically acceptable carrier or diluent in addition to the tumor target cells having the virus vector producing ability of the present invention. A pharmaceutically acceptable carrier or diluent or the like is an essentially chemically inert and harmless composition that does not affect the biological activity of the composition of the present invention at all. Examples of such carriers or diluents include, but are not limited to, salt solutions, sugar solutions, glycerol solutions, ethanol. The composition of the present invention may further contain an appropriate amount of any pharmaceutically acceptable additive such as an emulsification aid, a stabilizer, an isotonic agent, and a pH adjusting agent. Specifically, fatty acids having 6 to 22 carbon atoms (for example, strong prillic acid, strong puric acid, lauric acid, myristic acid, palmitic acid, stearic acid, oleic acid, linoleic acid, arachidonic acid, docosahexaenoic acid) And pharmaceutically acceptable salts thereof (eg, sodium salt, potassium salt, calcium salt); glycerin; emulsification aids such as albumin and dextran; stabilizers such as cholesterol and phosphatidic acid; sodium chloride, glucose and maltose , Latatoses, sucrose, trehalose and the like; pH adjusters such as hydrochloric acid, nitric acid, phosphoric acid, acetic acid, sodium hydroxide, potassium hydroxide, triethanolamine, and the like. [0047] The composition of the present invention includes a tumor target cell having the ability to produce the viral vector of the present invention effective for treatment or diagnosis, and is provided in a form that can be appropriately administered to a patient. The composition of the present invention may be prepared in the form of a liquid such as an injection or an infusion.

[0048] The composition of the present invention is administered to animals including humans in the left ventricular cavity, intravenous administration, intraarterial administration, tissue administration, tumor nutrition intravascular administration, or intrathecal administration to the ventricle. It can be administered by an appropriate route according to the patient's condition. In particular, administration in the left ventricular cavity or intratumoral administration of blood vessels by force tail manipulation is preferable. The pharmaceutical composition of the present invention is administered in a dosage form suitable for these administration methods.

[0049] The dose of the composition of the present invention is preferably determined in consideration of the drug, dosage form, patient condition such as age and weight, administration route, nature and degree of illness and the like. A preferred dose range is one in which the cells of the invention are present in the range of lxlO ⁶ to 1χ10 ^ω Zkg body weight. More preferred dose range, to the cells of the present invention is LxlO ⁶ no LxlO ⁹ amino Zkg weight, 1x1 0 ⁶ to LxlO ⁸ pieces Zkg weight, LxlO ⁶ to LxlO ⁷ amino Zkg weight or LxlO ⁶ to 3 XLO ⁶ pieces Zkg weight, It exists in the range of. In some cases, this may be sufficient, or vice versa. Administration may be performed once or multiple times. When administered multiple times, it may be administered once to several times a day, once to several days, once to several weeks, or once to several months. The invention's effect

[0050] Tumor target cells having the ability to produce the viral vector of the present invention accumulate in tumors and inflamed tissues in the living body when injected into the living body. Therefore, by injecting the tumor target cells of the present invention into a living body, it is possible to produce a viral vector in the target tissue and to maintain the infection in the target tissue. As a result, gene transfer can be performed with high efficiency. It can be done.

Brief Description of Drawings

[0051] FIG. 1 is a graph showing the retroviral secretion ability of vector-produced MSCs and the degree of infection of mouse 9L cells by the secreted retrovirus. NC on the horizontal axis indicates a control (negative control), and the number of days indicates the number of days of culture after plasmid introduction. . The right vertical axis shows the titer of virus secreted by MSCs. The left vertical axis indicates the amount of luciferase produced by mouse 9L cells infected with the secreted virus, which evaluates the biological titer due to the infectivity and gene transfer capacity of the virus.

[Fig. 2-1] Fig. 2-1 shows gene expression in a tumor-bearing animal model of viral vector-producing MSCs (VS V—G group: producing viral vectors using VSV-G as an envelope) It is a graph (a) and a biological imaging image (b). In the graph, the horizontal axis shows the number of days after MS Cs administration; the left vertical axis shows the total luminous flux of luciferase fluorescence, circled plots (luciferase fluorescence in tumors) and squared plots (background: BG) The right vertical axis represents the tumor volume and is the vertical axis for the plots shown as diamonds.

[Fig. 2-2] Fig. 2-2 is a graph showing gene expression in a cancer-bearing animal model of viral vector-producing MSCs (env group: producing a viral vector having an amphotropic retroviral envelope) ( a) and biological imaging image (b). In the graph, the horizontal axis indicates the number of days after administration of MSCs; the left vertical axis indicates the total luminous flux of luciferase fluorescence, a circle plot (luciferase fluorescence in the tumor) and a square plot (background: BG) is the vertical axis; the right vertical axis represents the tumor volume and is the vertical axis for the plots shown as diamonds.

[FIGS. 2-3] FIGS. 2-3 are graphs (a) and biological imaging images (b) showing gene expression in MSCs (NC group) tumor-bearing animal models that do not produce viral vectors. These are the results of a control experiment against the experiments in Figure 2-1 and Figure 2-2. In the graph, the horizontal axis shows the number of days after administration of MSCs; the left vertical axis shows the total luminous flux of luciferase fluorescence, circled plots (luciferase fluorescence in tumors) and squared plots (background: BG) The vertical axis is the vertical axis; the right vertical axis is the volume of the tumor and plots the diamonds.

FIG. 3 is a graph showing the gene amplification effect by administration of vector-producing mesenchymal stem cells in a tumor-bearing animal model. Horizontal axis: 9LZLNCN is an animal model of cancer that has not been administered MSCs; MSC has been gene-transfected! /, A model of tumor-bearing animal that has been administered MSCs; TK is a thymidine kinase-expressing retroviral vector Plasmid (LTR-TK) Tumor-bearing animal model administered with introduced MSCs; TK VSV-G is a tumor-bearing animal model administered with MSCs introduced with LTR-TK and V SV-G expression plasmids; and TK V SV-G gag-pol is , LTR-TK, VSV-G expression plasmid, and gag-pol expression plasmid, a tumor-bearing animal model administered with MSCs. The vertical axis represents the amount of thymidine kinase gene when the amount of thymidine kinase gene in a subcutaneous tumor of a tumor-bearing animal model administered with MSCs into which LTR-TK has been introduced is 1.

[Fig. 4-1] Fig. 41 is a schematic diagram showing the experimental procedure of therapeutic gene transfer and therapeutic effect by GCV in a cancer-bearing animal model.

[Fig. 4-2] Fig. 42 shows (a) graphs and (b) biological imaging photographs showing the experimental results of therapeutic gene transfer and therapeutic effects by GCV in cancer-bearing animal models. In the graph of (a), “9LZLNCL” (oral) is an untreated group; “MSC” (◊) is a non-transgenic MS C administration group; “tk” (◯) is a pLTR-HSV—tk introduction MSC administration group; “TkZVSV—G” (△) indicates pLTR-HSV-tk and pVSV-G-introduced MSC administration group; and “tkZgag—pol / VSV-GJ (〇) indicates pLTR—HSV—tk, pGag—pol and p VSV—G-introduced MSC group, respectively, The amount of tumor luminescence between the “tk” and “tkZgag—polZVSV—G” groups was n = 4, and the risk rate was less than 5%, with a significant difference. ,Met.

Example

[0052] Hereinafter, the present invention will be described more specifically with reference to examples, but these are not intended to limit the technical scope of the present invention. Those skilled in the art can easily modify or change the present invention based on the description in the present specification, and these are included in the technical scope of the present invention.

Example 1: Selection of gene transfer method for mesenchymal cocoon cells (MSCs)

Green fluorescent protein (GFP) expression plasmid was introduced into mesenchymal stem cells (MSCs) derived from Sprague-Dawley (SD) rat bone marrow. For the gene transfer, a nucleo-off-excitation method, a calcium phosphate method, or a lipofusion method was used. As a control, MSCs into which no GFP expression plasmid was introduced were used.

[0053] The Nucleof-Exclusion method was performed using the Nucleofector (registered trademark) technology of the company, using the gene introduction system Nucleofector (registered trademark) of amaxa. The nucleo-exclusion method is an improved version of the electopore position method, which introduces genes directly into the cell nucleus. Technology. Gene transfer according to amaxa product manual

^Six lxlO cells per well were seeded in a ^6-well plate and cultured in a D-MEMZF12 medium containing 10% FBS for 24 hours. An appropriate amount of Nucleofector Solution for MSC was added to 4 μg of cells resuspended in Nucleofector Solution and 4 μg of eGFP expression plasmid so that the total amount was 100 μ1. This was transferred to a dedicated cuvette with electrodes, and gene transfer was performed using a dedicated gene transfer device Nucleofector (Amaxa) according to the product manual. After pre-warming, 500 μl of the medium was added to the cuvette, transferred to a 6-well plate containing the warmed medium, and cultured for 24 hours.

[0054] For gene transfer by the calcium phosphate method, ⁶ lxlO cells per well were seeded in a ^6-well plate and cultured in DMEMZF12 medium supplemented with 10% FBS for 24 hours. Add 4 g of plasmid to 100 1 of 300 mM CaCl, then add 100 1 of 2xHBS (280 mM NaCl

2

Cl, 1.5 mM Na HPO, 50 mM HEPES, pH 7.0) and mix immediately.

twenty four

% FBS-supplemented D—Mixed uniformly with 2 ml of MEMZF12 culture solution. This was replaced with the supernatant of the cells that had been cultured in the 6-well plate and cultured. After 6 hours, the culture solution was removed, and 2 ml of 2% FBS-supplemented D-MEM / F12 culture solution heated at 37 ° C was added and cultured for 24 hours.

[0055] For the gene transfer by the lipofussion method, lipofucamine 2000 (Invitrogen) was used as a ribosome, lxlO ⁶ cells per well were seeded in a ^6-well plate, and cultured in DMEMZF 12 culture medium with 10% FBS for 24 hours. . After exchanging the medium with Opti-MEM (registered trademark), the plasmid (4 / zg) was transfected under the recommended conditions according to the product manual using Lipofectamine 2000 (15 μ1, Invitrogen). . After 6 hours, the medium was changed to D-MEMZF12 medium supplemented with 10% FBS, and cultured for 24 hours.

[0056] After the gene transfer, the cells were cultured at 37 ° C for 24 hours in D-MEMZF-12 medium (Invitrogen ゝ 11320-033) containing 10% final concentration of fetal bovine serum (Sigma, F-2442).

[0057] The rate of gene transfer into mesenchymal stem cells was evaluated by flow cytometry for the fluorescence of GFP expressed in the cells. Gene transfer was observed in 60.11% of the nucleophilic method, 3.13% of the calcium phosphate method, and 12.26% of the lipofusicion method. In the control cells, fluorescence was observed in 0.01% of cells. It is a knock ground. Therefore, it was revealed that the nucleophilic or ribofunctional method is preferable for gene introduction into mesenchymal stem cells.

Example 2: Intermittent cells II severe ulcer parents

4 g of the luciferase expression plasmid was introduced into 2xl0 ⁶ SD rat bone marrow-derived MSCs by nucleolysis. After the introduction, the cells were cultured in D-MEM / F-12 medium containing 10% ushi fetal serum at 37 ° C for 24 hours, and 5xl0 ⁵ MSCs were used for administration to mice.

[0058] On the back of nude mice, 3xl0 ⁶ mouse glioma 9L cells were injected subcutaneously to create a tumor-bearing animal model. For comparison, 3xl0 ⁶ mouse neuroblasts Rat-1 were also subcutaneously injected into the back of a mouse.

[0059] MSCs (M SCZpLuc) into which 5xl0 ⁵ luciferase expression plasmids were introduced were administered into the left ventricular cavity in a cancer-bearing animal model (group 9L). As a positive control (PC), 5xl0 ⁵ MSCZpLuc were subcutaneously injected into the back of nude mice instead of tumor cells. As a negative control (NC), 5xl0 ⁵ MSCZpLuc were administered into the left ventricular cavity of nude mice without subcutaneous injection of tumor cells. For comparison, 5xl0 ⁵ MSC / pLuc were administered into the left ventricular cavity of a nude mouse injected with Rat-1 cells subcutaneously on the back (Rat-1 group).

[0060] 24 hours after administration of MSCZpLuc, the expression site of luciferase was evaluated using an in vivo imaging apparatus (IVIS Imaging System; Xenogen). In the 9L group, a tumor-bearing animal model, luciferase was strongly expressed on the back subcutaneously injected with 9L cells. This indicates that MSCZpLuc accumulated in the tumor cells and the luciferase gene was expressed there. On the other hand, in the Rat-1 group, luciferase was weakly expressed mainly in the head, and in animals that did not have cancer, luciferase was expressed nonspecifically along the bloodstream. In the positive control, strong luciferase expression was observed in the dorsal skin injected with MSCZpLuc. In the negative control, luciferase was weakly expressed mainly in the head, and site-specific expression along the bloodstream was observed.

Example 3: Virus vector cattle.

Luciferase-expressing retroviral vector plasmid 4 g, gag-pol expression plasmid 0.5 g, and VSG-G (vesicular stomatitis virus G protein) expression plasmid 0.5 / zg was introduced into 2xl0 ⁶ SD rat bone marrow-derived mesenchymal stem cells (MSCs) by the nucleo-exclusion method. A mesenchymal stem cell into which the above plasmid was not introduced was used as a control. After introduction, cultured in D-MEMZF-12 medium with final concentration of 10% urchin fetal serum at 37 ° C. Over time, specifically, the first day (24 hours later), the second day (48 After 3 hours (after 72 hours) and 4 days (after 96 hours), the culture supernatant was collected. When the virus titer in the culture supernatant was analyzed by RNA dot plotting, virus expression was confirmed 24 hours after gene transfer (Fig. 1).

[0061] In addition, 5xl0 ⁴ rat 9L cells per well were seeded in a 96-well plate and supplemented with 10% FBS D

The cells were cultured in MEMZF 12 culture solution for 24 hours. To this culture supernatant, 1001 of a culture solution containing virus produced by MSC and collected over time was added, and gene transfer was performed. After culturing for 3 days, luciferase assay was performed to evaluate the amount of gene expression in infected 9L cells (Fig. 1).

¾ Example 4: In cow body:

Luciferase-expressing retroviral vector plasmid 4 g, gag-pol expression plasmid 0. and VSG-G expression plasmid 0. were introduced into 2xl0 ⁶ SD rat bone marrow-derived mesenchymal stem cells (MSCs) (VSG- G group). In addition, a group (env group) into which 0.5 μg of an amphotropic retrovirus envelope protein expression plasmid was introduced instead of the VSV-G expression plasmid was prepared. As a control without virus production, 4 μg of luciferase-expressing retrovirus vector plasmid and 1 g of LacZ expression plasmid were introduced to prepare a group that did not produce virus (NC group). The gene transfer was performed by the Nucleo-off-exclusion method.

[0062] After introduction, the cells were cultured in D-MEMZF-12 medium with a final concentration of 10% urchin fetal serum at 37 ° C. After 24 hours of culture, the cells were collected, and 6xl0 ⁵ gene-transferred MSCs were transferred to the left of the nude mouse. Systemic administration was performed by injection into the ventricular cavity. The nude mice are a tumor-bearing animal model in which mouse glioma 9L cells (hereinafter also simply referred to as 9L cells) are injected subcutaneously on their backs immediately before administration of MSCs. The expression of luciferase in the tumor was evaluated over time using an in vivo imaging system (IVIS Imaging System; Xenogen) (Fig. 2-1, Fig. 2-2, and Fig. 2-3). Gene expression at 21 days after administration does not produce virus NC group Compared with the VSV-G group, it was enhanced by 9.8 times and in the env group by 2.5 times.

Example 5: 'Treatment transfer in animal model

Simple herpesvirus-derived thymidine kinase expression retroviral vector plasmid 4 g, gag-pol expression plasmid 0.5 g, and VSG-G expression plasmid 0.5 g 2xl0 ⁶ mesenchymal lines derived from SD rat bone marrow Stem cells (MSCs) were introduced by the nucleo-off-exclusion method.

After introduction, culture with D-MEMZF-12 medium at a final concentration of 10% urchin fetal serum, cultured at 37 ° C in 12 medium, and after 24 hours of culture, cells were collected and 5xl0 ⁵ gene-introduced MSCs were placed in the left ventricular cavity of nude mice Systemic administration was performed by injection. The nude mice are a tumor-bearing animal model in which mouse 9L cells were injected subcutaneously on their back immediately before administration of MSCs. 24 days after administration, subcutaneous tumors were collected, and DNA extraction was performed using an animal tissue DNA extraction kit DNeasy Tissue Kit (QIAGE N). According to the standard procedure of the kit, DNA was concentrated and extracted by adsorption onto the silica gel membrane. Primer set corresponding to thymidine kinase gene (5'—TTCTGGCTCCTCATGTCGG-3, (SEQ ID NO: 1) and 5'-ATTGGC AAGC AGCCCGTAA-3 '(SEQ ID NO: 2)) as extracted DNA and rat GAPDH gene as control Primer sets (5′-CAGCAATGCATC CTGCAC 3 ′ (SEQ ID NO: 3) and 5 ′ one GAGTTGCTGTTGAAGTCACAGG 3 ′ (SEQ ID NO: 4)) were applied, and the amount of thymidine kinase gene was measured by quantitative PCR. Animals treated with MSCs introduced with all three of the above plasmids include animals administered MSCs with only the thymidine kinase-expressing retroviral vector plasmid, and thymidine kinase-expressing retroviral vector plasmid and VSG-G expression plasmid. The gene amplification effect was approximately 122 times that of animals administered with MSCs into which L was introduced (Fig. 3). In addition, the thymidine kinase gene was not detected in cancer-bearing animal models that were not administered MSCs and in cancer-bearing animal models that were administered gene transduction!

Example 6: 'Therapeutic effect male and female with' Guide to treatment 'and GCV' in male model

2xl0 ⁶ SD rat-derived mesenchymal stem cells MSC, (1) simple herpesvirus-derived Midine kinase (HS V-tk) expression retroviral vector plasmid pLTR-HSV-tk, (2) pLTR—HSV—tk and VSV—G expression plasmid pVSV—G, or (3) pLT R-HSV-tk, Gag— The pol expression plasmids pGag—pol and pVSV—G were introduced by the nucleation method (AMAXA, Human MSC Nucleofection Kit, pulse program U-23). After 24 hours, each cell was collected, suspended in PBS, and adjusted to a final concentration of 5xl0 ⁵ cells ZlOO / z1. At the same time, the target tumor cell 9LZLNCL constitutively expressing luciferase was suspended in PBS containing 25% matrigel (BD Biosciences, Two Oak Park, Bedford, MA, USA) at a concentration of 3xl0 ⁶ cells ZlOO / z1.

[0064] 9LZLNCL cells were subcutaneously injected into the left and right backs of BalbZc nude mice (Clea Japan, Inc.) one by one, and immediately after that, the intraventricular force in the left ventricle was also administered systemically with MSC suspension 100 1 . Thereafter, 100 μl of 15 mgZml luciferin solution (Ieda Trading Cor P., Tokyo, Japan) was administered intraperitoneally over time, and an in vivo imaging device (IVIS; Xenogen

Corp., Alamada, CA, USA) was used to measure the amount of luminescence at the tumor site (Total Flux) to examine the viability of the tumor cells. Furthermore, 10 days after the administration of MSC, an osmotic pump (MICRO—OSMOTIC PU MP MODEL 1002) into which ganciclovir (GCV) (Denosin; F. Hoffmann-La Roche L td., Basel, Switzerland) was injected so that lOOmgZkg / day was obtained. ; DURECT Corp., Cupertino, CA, USA) was placed in the mouse abdominal cavity.

[0065]

The MSC was administered only by subcutaneous injection of tumor cells. The untreated group was the “9LZLNCL” group; the non-transgenic MSC-administered group was the “MSC” group; the pLTR-HSV-tk-introduced MSC-administered group was “tk” PLTR-HSV-tk and pVS V—G-introduced MSC administered group is “tkZVS V-G” group; and pLTR—HSV—tk, pGag-pol and pVSV—G-introduced MSC administered group is rtk / gag -pol / VSV—G ”group;

[0066] In the “tk” and “tkZpVSV-G” groups, there was almost no antitumor effect due to GCV administration, but in the “tkZgag-polZVSV-G” group, the viability of tumor cells decreased (Fig. 4 2).

[0067] This result indicates that a retroviral vector containing the HSV-tk gene was produced. When MSC into which rasmid was introduced was administered, the HSV—tk gene was transferred to tumor cells by the tumor affinity of MSC. As a result, the combination of HSV—tk and GCV in tumor cells resulted in tumor cells becoming apoptotic. Led to a significant reduction in tumor viability compared to other treatment groups.

Industrial applicability

[0068] Since the tumor target cells having the ability to produce the viral vector of the present invention accumulate in a tumor or an inflamed tissue in the living body when injected into the living body, the viral vector is produced in the target tissue, and then to the target tissue. Infection persists. Therefore, the tumor target cell having the ability to produce the virus vector of the present invention can be used for highly efficient gene transfer.

[0069] Further, mesenchymal stem cells as tumor target cells having the ability to produce the virus vector of the present invention

It is desirable to use (MSCs). MSCs can be used universally for many patients as well as for patients and relatives who have a low chance of rejection at the time of transplantation. Therefore, there are fewer ethical problems than regenerative medicine using dead fetal cells or fertilized eggs. The use of MSCs as therapeutic viral vector-producing cells in the treatment of neoplastic diseases or inflammatory diseases is likely to be put into practical use.

Claims

The scope of the claims

[1] A tumor target cell capable of producing a viral vector.

[2] The cell according to claim 1, wherein the tumor target cell is selected from the group consisting of a mesenchymal stem cell, a vascular endothelial progenitor cell, and a tissue stem cell force.

[3] The cell according to claim 1 or 2, which is derived from a mammal.

[4] The virus vector is a retrovirus vector, adeno-associated virus (AAV) vector, adenovirus vector, lentivirus vector, foamy virus vector, influenza virus vector, Sendai Winores vector, 4. A virus vector selected from the group consisting of Nores vector, hepatitis virus vector, papilloma virus vector, baculovirus vector, rabies virus vector, and hybrid vector force thereof. The cell according to item.

[5] The cell according to claim 1, which is used for gene transfer or gene therapy for an animal or animal cell, or 4!

[6] The cell according to any one of claims 1 to 4, for use in gene transfer or gene therapy for neoplastic disease, inflammatory disease, or a lesion tissue of a related disease.

[7] The transgene contained in the viral vector is a detectable marker gene, and is used for detection of a tumor lesion by detecting the expression of the marker gene. 4 !, The cell according to item 1 above.

[8] A mesenchymal stem cell derived from a mammal, having a retroviral vector-producing ability, and the transgene contained in the retroviral vector is simply a herpesvirus-derived thymidine kinase, and ganciclovir The cell, which is used for the treatment of neoplastic diseases, inflammatory diseases or related diseases thereof in combination with the above.

[9] A method for preparing tumor target cells having the ability to produce viral vectors, comprising (1) a plasmid containing a desired transgene in a tumor target cell; and (2) a gene encoding a viral protein 1 The plasmids of (1) and (2) above are produced in the tumor target cells into which they have been introduced by the plasmid (2). Protein required for The gene encoding the virus-derived protein contained in the plasmid of (1) is not packaged in the virus particle, and the transgene of the plasmid of (1) is designed to be packaged in the virus particle. .

[10] A method for preparing mesenchymal stem cells having the ability to produce retroviral vectors, comprising: (1) 5, LTR, knocking signal (Ψ), transgene, and 3, L TR And (2) a plasmid containing a gagZpol gene and an env gene, or a plasmid containing a gag / pol gene and a plasmid containing an env gene.

[11] The method according to claim 9 or 10, wherein the introduction of the plasmid is carried out by a Nucleo-off-exclusion method or a lipofection method.

[12] A pharmaceutical composition comprising the cell according to any one of claims 1 to 6.

[13] The pharmaceutical composition according to claim 12, for the treatment of neoplastic diseases, inflammatory diseases or related diseases thereof.

[14] A diagnostic composition for detecting a tumor lesion or an inflammatory lesion, comprising the cell according to claim 7.