JP2001292770A - Virus-derived recombinant vector used for human gene therapy - Google Patents

Abstract

PROBLEM TO BE SOLVED: To elucidate a function of a dominant negative mutant of activator protein-1(AP-1) and to provide a new method of a human gene therapy, especially a method of a human oncogene therapy using a gene of the dominant negative mutant of AP-1. SOLUTION: This recombinant vector is characterized in that the gene of the dominant negative mutant of AP-1 is integrated thereinto and the gene can be transduced into a cell and expressed in the cell by infecting to a human cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to human gene therapy,
In particular, it relates to a virus-derived recombinant vector useful for human cancer gene therapy. More specifically, the present invention relates to a virus-derived recombinant vector that can effectively suppress the tumorigenicity of cancer cells by infecting human cancer cells.

[0002]

BACKGROUND OF THE INVENTION The formation of cancer is caused by a series of genetic disorders. Many of these disorders, which are known in recent years, are caused by the acquisition of the dominant oncogene transforming function and the loss of the tumor suppressor function of tumor suppressor genes such as p53. This suggests that introducing a dominant negative mutant of a cancer gene or a tumor suppressor gene into a cancer cell to correct the genetic abnormality may have a sufficient therapeutic effect on cancer. Focusing on this point, we aimed at correcting genetic abnormalities involved in the acquisition of malignant traits as cancer cells using retroviral vectors incorporating p53 and targeting them.
In vivo gene therapy is already under consideration.

[0003] The function of the transcription factor AP-1 (activator protein-1) has been widely studied in chicken embryo fibroblasts (CEF) and established rodent fibroblasts. -1 has been reported to play an important role in some transformed cells (An
gel et al., Biochem. Biophys. Acta, 1072: 129-157, 199
1). This transcription factor is a Fos family protein (c-Fo
s, Fra-1, Fra-2, FosB) and Jun family proteins (c-Jun, JunB, JunD). Jun family proteins can form low-affinity homodimers and can also form high-affinity heterodimers with Fos family proteins.
It is different from s-family proteins. These heterodimers and homodimers have similar DNA binding sites (T
GAC / GTCA, AP-1 binding site), but each dimer has a transcriptional regulatory function, so that transcription is positively or negatively regulated. many
High-level expression of the fos and jun gene families has been reported to cause transformation of CEF and established rodent fibroblasts. Also, JunD
Has no transforming activity, but can acquire transformation potential as a result of spontaneous mutations in the genome of the virus. These facts suggest that uncontrolled expression or qualitative changes of any of the constituent proteins of AP-1 cause cell transformation.

It is known that AP-1 is involved in cell differentiation (Kameda et al., Cell Growth Diffe
r., 8: 495-503, 1997).

The present inventors have previously produced a dominant negative mutant of mouse JunD (SupJunD-1) (Suzuki
J. Virol., 68: 3527-3535, 1994; Kameda et al., Supra). SupJunD-1 has the same basic region and leucine zipper portion as JunD, but lacks most of the N-terminus covering all transactivation domains. Su
pJunD-1 can form a stable heterodimer with the Fos family protein, and can also form a stable homodimer with the Jun family protein. The formed dimer has the ability to bind to DNA, but cannot induce gene expression by trans action. SupJunD-1 not only transforms induced by AP-1 constructs, but also v-src, v-yes, v-fps, c-Ha-ras,
It has also been found that transformation induced by oncogenes such as activated raf is also effectively suppressed (Su
zuki et al., supra).

[0006]

However, there has been no report that the gene of a dominant negative mutant of AP-1 was expressed in human cells using a virus-derived recombinant vector, and the dominant negative mutation of AP-1 has never been reported. Infecting human cells with a virus-derived recombinant vector incorporating the body gene and introducing it into human cells and expressing them, how they act on human cells, in particular, on human cancer cells It was unknown how it would work.
Thus, the present invention provides a method for elucidating the function of a dominant negative mutant of AP-1 in human cells, and a novel method of human gene therapy using the gene of a dominant negative mutant of AP-1, particularly human cancer gene therapy. The aim is to provide a method.

[0007]

Means for Solving the Problems In view of the above points, the present inventors have conducted various studies, and as a result, incorporated a gene of a dominant negative mutant of AP-1 into a retrovirus vector, which was used as a human cancer cell line. When this gene is introduced into cancer cells and expressed, the anchorage-independent growth, that is, the tumorigenic effect, is effectively suppressed without affecting cell growth in monolayer culture. I found that.

[0008] The present invention has been made based on the above findings, and the virus-derived recombinant vector of the present invention comprises:
As described in claim 1, AP-1 (activator protein
It is characterized in that the gene of the dominant negative mutant of -1) is incorporated, and that this gene can be introduced into cells and expressed in cells by infecting human cells. The virus-derived recombinant vector according to claim 2 is the virus-derived recombinant vector according to claim 1, wherein the cell is a cancer cell. Further, the virus-derived recombinant vector according to claim 3 is the same as the virus-derived recombinant vector according to claim 1 or 2,
The dominant negative mutant of -1 is a dominant negative mutant of JunD. The virus-derived recombinant vector according to claim 4 is the virus-derived recombinant vector according to any one of claims 1 to 3, wherein the vector is a retrovirus vector.
Further, the virus-derived recombinant vector according to claim 5 comprises:
The virus-derived recombinant vector according to claim 4,
The retrovirus vector is a VSV-G (Vesicular Stomatitis Virus G Protein) pseudotype retrovirus vector. Further, the pharmaceutical for human gene therapy of the present invention is as defined in claim 6, as defined in claim 1.
A virus-derived recombinant vector according to any one of (1) to (5). Further, as described in claim 7, the medicament of the present invention for suppressing tumorigenicity of human cancer cells contains the virus-derived recombinant vector according to claim 2. The present invention also relates to the use of the virus-derived recombinant vector according to any one of claims 1 to 5 for preparing a medicament for human gene therapy, as described in claim 8. The present invention also relates to the use of the virus-derived recombinant vector according to claim 2 for preparing a medicament for suppressing tumorigenicity of human cancer cells, as described in claim 9. Further, the reagent for assaying tumorigenicity of human cancer cells according to the present invention comprises the virus-derived recombinant vector according to claim 2 as described in claim 10.

[0009]

DETAILED DESCRIPTION OF THE INVENTION The dominant negative mutant of AP-1 is
Fos family proteins (c-Fos, Fra-
1, Fra-2, FosB) and Jun family proteins (c-Jun,
JunB, JunD), as long as it is a dominant negative mutant of any one of the proteins. Naturally, the gene of the dominant negative mutant should have no oncogene potential. Dominant negative mutants are preferred. Such a mutant includes the aforementioned SupJunD-1.

[0010] Virus-derived vectors used to introduce the gene for the dominant negative mutant of AP-1 into human cancer cells include DNA virus vectors such as retrovirus vectors and adenovirus vectors, baculovirus vectors, and vaccinia vectors. Although a viral vector can be used, a retroviral vector integrates a viral genome into a host chromosome after infecting a cell.
A foreign gene incorporated into a vector can be expressed stably and for a long time. Therefore, from this point, it is desirable to use a retroviral vector.

[0011] When a retrovirus vector is used, the retrovirus genome may be Moloney murine leukemia virus (MoM).
LV) and other human immunodeficiency syndrome virus (Human immunodeficiency viru)
s, HIV), and among others, pBabe from MoMLV (Morgenstenm et al., Nuclei
c Acids Res., 18: 3587-3596, 1990).

Among the retroviral vectors, VSV-G
It is desirable to use a pseudotyped retroviral vector. The pseudotype is a phenomenon in which one viral genome germinates surrounded by the coat protein of another virus. VSV (vesicular stomatitis virus: vesic
ular stomatitis virus (VSV) is a virus with a negative single-stranded RNA genome belonging to the family of Rhabdoviridae, and its cell surface receptor for its coat protein (G protein) is an anionic lipid such as phosphatidylserine. It has a very broad host range compared to possible and commonly used amphotropic retroviral vectors. Therefore, by producing a pseudotype retrovirus having this VSV-G gene product in its coat, the gene of the dominant negative mutant of AP-1 can be efficiently expressed in human cancer cells as compared to a retrovirus having the original coat protein. Can be introduced. In addition, VSV-G pseudotype retrovirus has the advantage of high infection efficiency and the ability to obtain a virus stock with a very high titer (1 × 10 ⁶ iu / ml or more) by concentrating by ultracentrifugation. It has the advantage of being able to

The production of a VSV-G pseudotype retroviral vector into which the gene of the dominant negative mutant of AP-1 has been incorporated can be performed, for example, by the method developed by the present inventors (WO98 / 27217). ). In summary,
The retroviral genome into which the gene for the dominant negative mutant of AP-1 was inserted was introduced into prepackaging cells that express the gag and pol genes of the retrovirus and express the VSV-G gene by recombinase. This is performed by introducing a recombinase into a pre-packaging cell containing the genome to prepare a packaging cell that produces a VSV-G pseudotype retrovirus in which the gene of the dominant negative mutant of AP-1 has been incorporated. According to this method, a high-titer vector can be produced in a large amount.

As the pre-packaging cells, PtG-S2 (Arai et al., J. Viro, previously produced by the present inventors) was used.
l., 72: 1115-1121, 1998) (Human fibrosarcoma cells HT1080)
For example, cells containing the gag gene and pol gene of MoMLV, and the VSV-G gene (Indiana type) can be used.
Examples of the recombinase include Cre recombinase encoded by P1 phage of Escherichia coli.In order to introduce a Cre recombinase expression system for allowing Cre recombinase to act in cells, an adenovirus vector, etc. (Japanese Patent Laid-Open No. 8-84589).

The method for preparing the DNA construct and the operation for handling viruses and cells can be carried out by a commonly known method.
Cell culture technology (1990): Tokyo Kagaku Dojin, Basic technology of gene therapy (1996): Youtosha, Molecular Cloning. A Labor
atory Manual., T. Manitis et al. (1989), Cold Sprin
g Harbor Laboratory or the like may be used.

The AP of the present invention produced as described above
A virus-derived recombinant vector in which the gene of the dominant negative mutant of -1 has been incorporated, in particular, the VSV-G pseudotype retrovirus vector shows a high titer and efficiently expresses the dominant negative mutant of AP-1 in human cells. Gene can be introduced. Furthermore, it is usually very difficult to control the copy number of a gene to be introduced into cells, whereas using a VSV-G pseudotype retrovirus vector introduces a gene in a MOI (multiplicity of infection) -dependent manner. (Arai et al., Virology., 260: 109-11
5, 1999). Therefore, the copy number of the gene to be introduced into cells can be controlled by the MOI to be infected,
It allows the introduction of genes of the desired copy number to effectively suppress anchorage-independent growth without affecting cell growth in monolayer culture. In other words, the tumorigenicity of cancer cells can be suppressed without affecting the growth of normal cells.
It can be a useful medicine in ivo gene therapy.

[0017] Further, target cancer cells are taken out of the body from a cancer patient, and the taken out cancer cells are infected with a virus-derived recombinant vector in which the gene of the dominant negative mutant of AP-1 of the present invention has been incorporated. By examining the inhibitory effect of the dominant negative mutant on anchorage-independent growth of target cancer cells, the therapeutic effect of the dominant negative mutant of AP-1 on target cancer cells can be predicted. The virus-derived recombinant vector into which the gene of the dominant negative mutant of AP-1 has been incorporated becomes a test reagent for suppressing tumorigenicity of cancer cells, which is useful for determining the treatment strategy after the test.

Further, as described above, since AP-1 is involved in cell differentiation, a virus-derived recombinant vector in which the gene of the dominant negative mutant of AP-1 of the present invention is incorporated, for example, a human The cells removed from the solid are cultured ex vivo, and infected with a virus-derived recombinant vector into which the gene for the dominant negative mutant of AP-1 of the present invention has been incorporated, and the dominant negative mutant of AP-1 is intracellularly infected. By expressing the body, it modifies the process of cell differentiation, and is expected to be a highly convenient drug in cell transplantation and regenerative medicine.

[0019]

EXAMPLES The present invention will be described below in detail with reference to examples, but the present invention is not limited to the following description.

Example 1 Construction of Vector Plasmid pBabe (Ui et al., Gene Ther., 6: 1670-1678, 1999)
The 4.2-kb EcoRI-EcoRV fragment and pIR1 (Murakami
, Gene, 202: 23-29, 1997) 0.6-kb EcoRI-PmII.
The fragment was ligated to generate pBabe-IRES.
5'AGACG to obtain a DNA fragment containing the puro gene
ACCTTCCATGGCCGAGTACAAGC3 '(SEQ ID NO: 1) and 5'TCGGACA
A 0.7-kb DNA fragment was amplified by PCR using a primer pair of TATGGGGTCGTGCGCTCCTTT3 ′ (SEQ ID NO: 2) and pPUR (Gibco / BRL) as a template. The PCR product was cut out with NcoI and NdeI, and inserted into the NcoI-NdeI site of pBabe-IRES to prepare pBabe-IRESpuro. Full length nlsl
The 3.1-kb BamHI fragment containing the acZ gene was pMFGnlsl
acZ (Dranoff et al., Proc. Natl. Acad. Sci. USA, 90: 3
539-3543, 1993), a 0.3-kb BgIII fragment containing the full-length supjunD-1 gene was converted to pDS-supjunD-1 (Kameda
Et al., Supra), insert each into the unique BamHI site on pBabe-IRESpuro and insert pBabe-lacZ-I
RESpuro and pBabe-supjunD-1-IRESpuro were prepared.

Example 2 DNA Transfection and Selection of Transfectants PtG-S2, a prepackaging cell (Arai et al., Supra) (DMEM (Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum) : Dulbecco's modified Eagle's medium)
(High glucose) (Gibco / BRL), kept at 37 ° C, 4 μg / ml blasticidin S (Funakoshi) and 1 mg / m
2x10 ⁶ ce of G418 (growing in the presence of Gibco / BRL)
Pour into lls / 10cm dish, hold for 1 day, then 4μg
PBabe-IRESpuro, pBabe-lacZ-IRESpuro, pBabe-supju
Use nD-1-IRESpuro with Lipofectamine Plus Reagent (LIPOF
Transfected using ECTAMINE PLUS Reagent (Gibco / BRL). Two days after transfection, the cultures were distributed in several ratios, puromycin (final concentration 1 μg / ml) was added and kept for 3-4 days to select stable transfectants. Populations with puromycin resistant colonies grew.

Example 3 Preparation of VSV-G Pseudotype Retrovirus Vector The transfectant obtained by the above method was kept at 37 ° C. and spread to 7.5 × 10 ⁵ cells / 10 cm dish for one day. After retention, the adenovirus AxCANCre (Kanegae
, Nucleic Acids Res., 23: 3816-3821, 1995)
Infected at I = 10. Blasticidin S, G418, puromycin were removed from the medium immediately prior to infection with AxCANCre. Two days after infection with AxCANCre, the culture was kept at 32 ° C to produce VSV-G pseudotyped retrovirus more stably. The medium was changed daily, and the retroviral vector stock was recovered each time. Hereinafter, the virus incorporating the supjunD-1 gene is referred to as SupJunD
The virus obtained by transfecting the -1 virus, pBabe-IRESpuro, is called a control virus.

Example 4: Effect of SupJunD-1 on cell growth of NIH3T3 transformed with Ras To analyze the function of AP-1 in transformed cells,
s virus infection NIH3T3 (NIH3T3 / Ras) infected with SupJunD-1 virus (infection at MOI = 10: almost 10 copies of provirus per cell), cell morphology became flat within 2 days after infection . On the other hand, cells infected with the control virus did not show any change in cell morphology, and the morphology was similar to that of control NIH3T3 (NIH3T3
/ Neo). SupJunD-1 completely suppressed the colony formation of NIH3T3 / Ras in soft agar. This indicates that almost all populations were transduced. This also suggested that at least one or more copies of supjunD-1 were required for suppression of anchorage-independent growth of NIH3T3 / Ras. Next, it was examined whether one copy of supjunD-1 (infection at MOI = 0.1) suppressed the anchorage-independent growth of NIH3T3 / Ras. Colony formation was approximately equal to that of NIH3T3 / Ras infected with the control virus. 40%. Therefore, by introducing one copy of supjunD-1, NIH3
It was found that most T3 / Ras cultures inhibited anchorage-independent growth. The heterogeneity of colony formation suppression depends on the integration site of each provirus.
Partially explained by the difference in expression levels of 1. Then, S
upJunD-1 virus infection NIH3T3 / Ras and control NIH3T3
Examination of growth curves in monolayer cultures of / Neo showed that transduction of 10 copies of supjunD-1 reduced both growth rate and saturation density for all cells. supjun
Analysis of the growth curve of cells transfected with one copy of D-1 showed that the growth rate and saturation density were NIH3T3 / Neo and NIH3T3 / Ras
However, it was not affected by supjunD-1 transduction. This result indicates that one copy of supjunD-1 has no significant inhibitory effect on cell proliferation. Therefore, SupJunD-
1 is N effectively transformed to normal NIH3T3
It was also found that IH3T3 suppressed the transforming activity without affecting cell growth in monolayer culture. In addition, Ras virus infection NIH3T3 (NIH3T3 / Ra
s) and Neovirus-infected NIH3T3 (NIH3T3 / Neo) (Okazaki
Et al., Biochem. Biophys. Res. Commun., 250: 347-353.
1998) is a DMEM (low glucose) supplemented with 10% bovine serum
(Gibco / BRL) in the presence of 400 μg / ml G418 at 37 ° C. Drug selection was 2 μg / ml puromycin (Sigm
Performed in a). In addition, observation of colony formation in soft agar was performed using Noble agar (Difco) on Bacto agar (Difco) (0.5%).
co) (0.38%), 1 × 10 ⁴ cells / 6 virus-infected cells
The seeds were spread in a cm dish and kept at 37 ° C. for 21 days.

Example 5: SupJ on the growth of human cancer cells
Effect of unD-1 To investigate whether the inhibitory effect of SupJunD-1 on anchorage-independent growth of cells is also exerted on human cancer cells, SupJunD-1 virus was derived from six types of human solid tumors. Cells, US-O2 and Saos-2 (human osteosarcoma cells), A549 and H
Infected with 1299 (human non-small cell lung cancer cells), Hela and SiHa (human cervical cancer cells) (infection at MOI = 10: almost
10 copies of provirus). As a result, the colony forming activity of US-O2 and A549 was reduced to 10% or less. Saos-2 and H
For ela, a decrease in colony size was observed with the number of colonies. Therefore, it was found that SupJunD-1 effectively suppressed anchorage-independent growth of human cancer cells. These results indicate that endogenous AP-1 activity is essential for the oncogenic potential in these human cancer cells. Next, growth curves of SupJunD-1 virus-infected cells in monolayer culture were analyzed. supjun
Transduction of 10 copies of D-1 greatly reduced the growth rate of US-O2, causing a slight decrease for Saos-2 and A549. On the other hand, in Saos-2 and Hela, their saturation density was greatly reduced. Regarding H1299 and SiHa, no significant growth inhibitory effect was observed even when SupJunD-1 was expressed at a high level, as judged from the growth rate and saturation density. The effect on several expression levels of SupJunD-1 on cell proliferation was examined. In all cells examined (US-O2, Saos-2, A549), transduction of one copy (infection with MOI = 0.1) of supjunD-1 resulted in
Colony formation is about 40% of control virus infected cells
, But the growth rate and saturation density were not affected. Therefore, transduction with only one copy of supjunD-1 was found to inhibit anchorage-independent growth of human cancer cells, similar to NIH3T3 / Ras. SupjunD to US-O2 and A549
Transduction of 3 copies of -1 (infection at MOI = 3) suppressed colony formation by 90% or more. However, cell growth in monolayer culture was not affected in any of the cells. These results show that even at low levels of SupJunD-1 expression that does not affect cell growth in monolayer culture, it inhibits anchorage-independent growth of most cell populations. Is shown. In addition, the above-mentioned cells derived from the six types of human solid tumors were obtained from DMEM (high glucose) supplemented with 10% fetal calf serum (Gibco / BRL).
Medium, kept at 37 ° C. These grew in the presence of 4 μg / ml blasticidin S (Funakoshi) and 1 mg / ml G418 (Gibco / BRL). Drug selection for US-O2, A549 was performed with 2 μg / ml puromycin (Sigma), drug selection for Saos-2 was 1
Performed with μg / ml puromycin. In addition, observation of colony formation in soft agar was performed using Bacto agar (Difco) (0.5
%) In the above Noble agar (Difco) (0.38%), seed each virus-infected cell into 3 × 10 ² -6 × 10 ⁴ cells / 6cm dish, and after keeping at 37 ° C. for 21-28 days, went.

The results of Examples 4 and 5 are summarized in Table 1.

[0026]

[Table 1]

From the above results, by infecting cells derived from Ras-transformed NIH3T3 and various human solid tumors with the SupJunD-1 virus, the cell growth in monolayer culture was not affected and the anchorage-independent Proliferation was effectively suppressed.

NIH3T3 / Neo, NIH3T3 / Ras, Saos-2, A549,
H1299 was infected with the SupJunD-1 virus and a control virus, and gel shift analysis using the nuclear extract was performed using a DNA probe containing a single AP-1 DNA binding site derived from the human collagenase gene. Shown in When the nuclear extract of the cells infected with the control virus was used, only the band shift indicated by band A was observed (SupJunD-1 :-), but the nuclear extract of the cells infected with the SupJunD-1 virus was used. , A band shift indicated by band B was observed in addition to the band shift indicated by band A (SupJunD-1: +). Thus, the aforementioned effect of the SupJunD-1 virus was attributed to the infection of cells with the SupJunD-1 virus and the expression of FupJunD-1 at a high level.
Significant changes in the structure of the os / Jun heterodimer occur, and it is based on the fact that the heterodimer formed from SupJunD-1 and the Fos family protein, which seems to have very low transactivation ability, is a major component. all right.

[0029]

According to the present invention, the gene of a dominant negative mutant of AP-1 is incorporated, and by infecting human cells, the gene can be introduced into cells and expressed in cells. A virus recombinant vector is provided. Since this vector can effectively suppress the tumorigenicity of human cancer cells, it can be a useful drug for in vivo gene therapy in human cancer gene therapy. In addition, target cancer cells were removed from the body of a cancer patient, and the extracted cancer cells were infected with this vector to obtain AP-1.
By examining the inhibitory effect of the dominant negative mutant on anchorage-independent growth of target cancer cells, the therapeutic effect of the dominant negative mutant of AP-1 on target cancer cells can be predicted. It is an assay reagent for suppressing tumorigenicity of cancer cells, which is useful for setting a therapeutic course. In addition, this vector modifies the differentiation process of cells and is expected to be a highly convenient drug in cell transplantation and regenerative medicine.

[0030]

[Sequence list]

<110> Eisai Co., Ltd. <120> Recombinant virus vector used in gene therap
y <130> 00P038EZ <160> 2 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <220><223><400> 1 agacgacctt ccatggccga gtacaagc 28 <210> 2 <211> 28 <212 > DNA <213> Artificial Sequence <220><223><400> 2 tcggacatat ggggtcgtgc gctccttt 28

[Brief description of the drawings]

FIG. 1 is a diagram showing the results of gel shift analysis performed by infecting various cells with SupJunD-1 virus and control virus.

Continued on front page F-term (reference) 4B024 AA01 AA11 BA80 CA01 DA02 EA02 GA11 GA18 HA01 HA14 HA17 4B065 AA97X AB01 AC14 BA01 CA24 CA44 CA46 4C084 AA13 NA14 ZB262 4C087 AA01 AA02 BB65 BC83 CA12 NA14 ZB26

Claims (10)

[Claims] 1. A gene of a dominant negative mutant of AP-1 (activator protein-1) is incorporated, and by infecting a human cell, the gene is introduced into the cell and expressed in the cell. A virus-derived recombinant vector characterized in that it can be used. 2. The virus-derived recombinant vector according to claim 1, wherein the cell is a cancer cell. 3. The virus-derived recombinant vector according to claim 1, wherein the dominant negative mutant of AP-1 is a dominant negative mutant of JunD. 4. The virus-derived recombinant vector according to claim 1, wherein the vector is a retrovirus vector. 5. The virus-derived recombinant vector according to claim 4, wherein the retrovirus vector is a VSV-G (G protein of vesicular stomatitis virus) pseudotype retrovirus vector. 6. A medicament for human gene therapy, comprising the virus-derived recombinant vector according to any one of claims 1 to 5. 7. A medicament for suppressing tumorigenicity of human cancer cells, comprising the virus-derived recombinant vector according to claim 2. 8. Use of the virus-derived recombinant vector according to any one of claims 1 to 5 for preparing a medicament for human gene therapy. 9. Use of the virus-derived recombinant vector according to claim 2, for preparing a medicament for suppressing tumorigenicity of human cancer cells. 10. A reagent for suppressing tumorigenicity of human cancer cells, comprising the virus-derived recombinant vector according to claim 2.