WO2007081848A2 - Activation of hcv-specific t cells - Google Patents

Activation of hcv-specific t cells Download PDF

Info

Publication number
WO2007081848A2
WO2007081848A2 PCT/US2007/000362 US2007000362W WO2007081848A2 WO 2007081848 A2 WO2007081848 A2 WO 2007081848A2 US 2007000362 W US2007000362 W US 2007000362W WO 2007081848 A2 WO2007081848 A2 WO 2007081848A2
Authority
WO
WIPO (PCT)
Prior art keywords
hcv
sequence
protein
amino acids
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2007/000362
Other languages
English (en)
French (fr)
Other versions
WO2007081848A3 (en
Inventor
Michael Houghton
Yin-Ling Lin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Vaccines and Diagnostics Inc
Original Assignee
Novartis Vaccines and Diagnostics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis Vaccines and Diagnostics Inc filed Critical Novartis Vaccines and Diagnostics Inc
Priority to ES07709585.9T priority Critical patent/ES2551113T3/es
Priority to JP2008549583A priority patent/JP5405832B2/ja
Priority to CA2636032A priority patent/CA2636032C/en
Priority to EP07709585.9A priority patent/EP1981537B1/en
Priority to US12/087,330 priority patent/US8178086B2/en
Publication of WO2007081848A2 publication Critical patent/WO2007081848A2/en
Publication of WO2007081848A3 publication Critical patent/WO2007081848A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/29Hepatitis virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5256Virus expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/545Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55555Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55561CpG containing adjuvants; Oligonucleotide containing adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55566Emulsions, e.g. Freund's adjuvant, MF59
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/24011Flaviviridae
    • C12N2770/24211Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
    • C12N2770/24222New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/24011Flaviviridae
    • C12N2770/24211Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
    • C12N2770/24234Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/36011Togaviridae
    • C12N2770/36111Alphavirus, e.g. Sindbis virus, VEE, EEE, WEE, Semliki
    • C12N2770/36141Use of virus, viral particle or viral elements as a vector
    • C12N2770/36143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present invention relates to the activation of hepatitis C virus (HCV)- specif ⁇ c T cells. More particularly, the invention relates to immunizing a subject using HCV protein compositions that include HCV E1E2 complexes and or proteins comprising HCV non-structural genes and subsequently boosting the immune response using a viral vector comprising nucleic acid compositions encoding HCV E1E2 complexes and or HCV non-structural genes, to stimulate humoral and cell- mediated immune responses, such as, e.g., to activate HCV-specific T cells and elicit antibodies that neutralize infectivity of HCV virus.
  • HCV hepatitis C virus
  • HCV Hepatitis C virus
  • HCV has a 9.5 kb positive-sense, single-stranded RNA genome and is a member of the Flaviridae family of viruses. At least six distinct, but related genotypes of HCV, based on phylogenetic analyses, have been identified (Simmonds et al., J. Gen. Virol. (1993) 74:2391-2399).
  • the virus encodes a single polyprotein having about 3000 amino acid residues (Choo et al., Science (1989) 244:359-362: Choo et al., Proc. Natl. Acad. ScI USA (1991) 88:2451-2455; Han et al., Proc. Natl Acad. Sci. USA (1991) 8&1711-1715).
  • NS2 is an integral membrane protein with proteolytic activity and, in combination with NS3, cleaves the NS2-NS3 junction.
  • the NS3 protease, along with its NS4a cofactor, serves to process the remaining polyprotein.
  • NS3 liberates an NS3 cofactor (NS4a), two proteins (NS4b and NS5a), and an RNA-dependent RNA polymerase (NS5b).
  • NS4a NS3 cofactor
  • NS4b two proteins
  • NS5b RNA-dependent RNA polymerase
  • Completion of polyprotein maturation is initiated by autocatalytic cleavage at the NS3-NS4a junction, catalyzed by the NS3 serine protease.
  • El is detected as a 32 ⁇ 35 kDa glycoprotein species and is converted by endoglycosidase H into an approximately 18 kDa " species.
  • E2 glycoprotein displays a complex pattern upon immunoprecipitation consistent with the generation of multiple species (Spaete et al., Virol. (1992) 188:819-830; Selby et al., J. Virol. (1996) 70:5177-5182; Grakoui et al., J. Virol. (1993) 67:1385-1395; Tomei et al., J. Virol. (1993) 67:4017-4026.).
  • HCV envelope glycoproteins El and E2 form a stable complex that is co-immunoprecipitable (Grakoui et al., J. Virol. (1993) 67:1385-1395; Lanford et al., Virology (1993) 197:225-235; Ralston et al., J. Virol. (1993) 62:6753-6761).
  • El and E2 are retained within the endoplasmic reticulum of cells and lack complex carbohydrate when expressed stably or in a transient Vaccinia virus system (Spaete et al., Virology (1992) 188--819-830; Ralston et al., J. Virol. (1993) 67:6753-6761). Since the El and E2 proteins are normally membrane-bound in these expression systems, secreted truncated forms have been produced in order to facilitate purification of the proteins. See, e.g., U.S. Patent No. 6,121,020. Additionally, intracellular production of E1E2 in HeIa cells has been described. See, e.g., International Publication No.
  • HCV El and E2 glycoproteins are of considerable interest because they have been shown to be protective against viral challenge in primate studies. (Choo et al., Proc. Natl. Acad. Sci. USA (1994) £1:1294-1298; Houghton, M. and Abrignani, S., Nature (2005) 436:961-966). Meunier et al., Proc. Natl. Acad. Sci.
  • T cell immunity to HCV may determine the outcome of HCV infection and disease (Missale et al., J. Clin. Invest. (1996) 98:706; Cooper et al., Immunity (1999) 10:439; and Lechner et al., /. Exp. Med. (2000) 191:1499).
  • Virus-specific T cell responses have been shown to play an important role in resolving acute HCV infections (Shoukry et al., Ann. Rev. Microbiol. (2004) 58:391-424).
  • ThO/Thl CD4+ T helper responses resolved their HCV infections, while those with Th2-type responses tended to progress to chronicity (Tsai et al., Hepatology (1997) 25:449-458).
  • CTLs cytotoxic T lymphocytes
  • Control of HCV in chimpanzees has been shown to be associated with a ThI T cell response (Major et al.. J. Virol. (2002) 76:6586-6595).
  • HCV-specific T cell responses appear to play an important role in controlling HCV infection.
  • Said immune response can provide a protective or therapeutic effect against infection with HCV.
  • Said immune response can be a humoral and or cellular response, such as, e.g., eliciting an immunoglobulin (Ig) response wherein the Ig recognize one or more epitopes of HCV polypeptides and or activating T cells which recognize one or more epitopes of HCV polypeptides.
  • Ig immunoglobulin
  • the invention provides a method of stimulating or enhancing an immune response to a first HCV antigen wherein a subject is exposed to an HCV protein antigen and then exposed to a viral vector comprising a DNA encoding at least one epitope from said first HCV antigen.
  • the method comprises priming and boosting with the antigen as a protein prime followed by a boost delivered with a viral vector encoding an epitope from the protein antigen.
  • the invention provides a method of boosting an immune response to a first protein antigen to which a subject has previously been exposed, the method comprising boosting the immune response to the first antigen by administering a viral vector encoding a DNA which encodes and expresses at least one epitope from the first antigen when the vector is administered to the subject.
  • Immunization with E1/E2 HCV heterodimers can elicit neutralizing antibodies to HCV and CpG can enhance the CD4-t- T cell response to E1/E2.
  • the present invention provides improved combination prime boost methods that provide both a neutralizing antibody response and T cell responses (CD4+ T cell and CTL) to HCV.
  • Immunization with HCV NS345 proteins can elicit T cell responses to HCV and CpG can enhance the response.
  • the present invention provides improved combination prime boost methods that provide both a neutralizing antibody response and T cell responses (CD4+ T cell and CTL) to HCV.
  • the invention provides methods for stimulating immune responses using a combination of HCV proteins and polynucleotides encoding one or more HCV proteins.
  • the polynucleotides encoding the proteins are delivered as part of a viral vector particle.
  • the viral vector particle is an alpahvirus and in a preferred embodiment is a chimeric alpahvirus replicon packaged in a defective alpahvirus particle.
  • the immune response comprises the activation of HCV-specific T cells.
  • the present invention is based in part, on the surprising discovery that priming immune responses using HCV E1E2 protein vaccines, and boosting with HCV E1E2 nucleic acid constructs delivered in a defective alpahvirus particle, stimulates a robust CD8+ T cell response.
  • the use of such combinations provides an effective approach for stimulating a cellular and or humoral immune response to HCV E1E2 immunogens.
  • priming with an HCV polyprotein or HCV fusion protein and boosting with alphavirus encoding at least a portion of the same polyprotein or fusion protein can also provide an increased immune response to HCV.
  • the invention provides a so called "prime-boost" immunization regimen for eliciting or increasing an immune response to HCV in a subject.
  • the priming immunization step comprises immunizing a subject with one or more proteins followed by a boosting step comprising immunizing the subject with a viral vector encoding one or more of said proteins.
  • the viral vector is an alphavirus.
  • the proteins are HCV proteins.
  • the subject is a vertebrate subject.
  • the vertebrate subject is a human.
  • the proteins are HCV proteins and the viral vector is an alphavirus vector and the subject is a vertebrate animal or vertebrate subject.
  • the vertebrate animal or vertebrate subject is a human.
  • immunogenic compositions described herein are administered to a mammalian subject and in some embodiments the subject is a human.
  • Priming means any method whereby a first immunization with the immunogenic protein compositions described herein permits the generation of an immune response to the target antigen or antigens upon a second or subsequent immunization (boosting) with virus replicon particles described herein comprising at least one of the same antigen or antigens administered in the priming step, wherein the second immune response is greater than that achieved where the first immunization is either not provided or where the first immunization administered does not comprise the same antigen or antigens administered in the second immunization.
  • priming encompasses regimens which include a single dose or multiple dosages, administered hourly, daily, weekly, monthly or yearly.
  • priming comprises at least two administrations (comprising one or more dose or dosage).
  • priming by administration of one or more immunogenic compositions described herein entails at least two (e.g., 2, 3, 4, 5, 6, 7 or more) administrations (comprising one or more dose or dosage) of the immunogenic composition(s).
  • the time interval between administrations can be hours, days, weeks, months or years.
  • the repeated steps can be performed using the same or different immunogenic compositions.
  • the immunogenic compositions described herein are administered as a booster to boost the immune response achieved after priming of the subject.
  • alphavirus replicon particles are administered as a booster some time after priming.
  • Virus replicon particles administered as a booster comprise a nucleic acid encoding at least one same antigen administered by at least one priming step.
  • boosting or boosting immunization
  • Boosting encompasses regimens which include a single dose or multiple dosages, administered hourly, daily, weekly, monthly or yearly.
  • boosting (or boosting immunization) comprises at least one administration.
  • boosting comprises at least two administrations (comprising one or more dose or dosage).
  • boosting by administration of one or more virus replicon particle entails at least two (e.g., 2, 3, 4, 5, 6, 7 or more) administrations (comprising one or more dose or dosage) of the virus replicon particle(s).
  • the time interval between administrations can be hours, days, weeks, months or years.
  • the repeated steps can be performed using the same or different virus replicon particles or immunogenic compositions.
  • the priming or boosting immunizations can a combination of one or more of intramuscular, mucosal or systemic routes of immunization.
  • the invention provides a method of immunization which comprises a priming immunization with an HCV protein antigen followed by a boosting immunization with an alphavirus replicon particle comprising a nucleic acid encoding at least one epitope of the HCV antigen of the priming step.
  • the HCV antigen can comprise on or more different HCV antigens.
  • the invention provides the use of a composition as described herein for the preparation of a medicament to be used in a method of immunization which medicament comprises at least one of a priming composition comprising an HCV protein antigen or a boosting composition comprising an alphavirus replicon particle comprising a nucleic acid encoding an HCV antigen to which a subject has already been primed.
  • the priming step(s) comprises immunizing a subject with HCV E1/E2 heterodimer and an adjuvant which in one embodiment is MF59, followed by a boosting step comprising immunization with an alphavirus replicon particle comprising a nucleic acid encoding the E1/E2 protein.
  • the invention provides a method of immunizing a subject which comprises administering an alphavirus encoding an E1/E2 heterodimer complex, wherein said subject has already been exposed to E1/E2 protein following infection with HCV, whereby the cellular immune response to E1/E2 is increased on the subject.
  • the invention provides a method of immunizing a vertebrate which comprises administering an alphavirus encoding an E1/E2 heterodimer complex, wherein said subject has already been exposed to E1/E2 protein following infection with HCV, whereby the cellular immune response to E1/E2 is increased on the subject.
  • the priming step(s) comprise immunizing a subject with
  • the priming step(s) comprise immunizing a vertebrate subject with HCV E1/E2 heterodimer, MF59 and a CpG followed by a boosting step comprising immunization with an alphavirus replicon particle comprising a nucleic acid encoding the E1/E2 protein.
  • the priming step(s) comprise immunizing a subject with
  • HCV polyprotein and an adjuvant which in one embodiment is an ISCOM, followed by a boosting step comprising immunization with an alphavirus replicon particle comprising a nucleic acid encoding at least a portion of the polyprotein.
  • the HCV polyprotein can further be administered in a composition comprising an immunostimulatory molecule, which in one embodiment is a CpG immunostimulatory molecule.
  • the priming step(s) comprise immunizing a vertebrate subject with HCV polyprotein and an adjuvant which in one embodiment is an ISCOM, followed by a boosting step comprising immunization with an alphavirus replicon particle comprising a nucleic acid encoding at least a portion of the polyprotein.
  • the HCV polyprotein can further be administered in a composition comprising an immunostimulatory molecule, which in one embodiment is a CpG .immunostimulatory molecule.
  • the invention provides a method of immunizing a subject which comprises administering an alphavirus encoding an HCV polyprotein, wherein said subject has already been exposed to HCV polyprotein following infection with HCV, whereby the cellular immune response to HCV polyprotein is increased on the subject.
  • the invention provides a method of immunizing a vertebrate which comprises administering an alphavirus encoding an HCV polyprotein, wherein said subject has already been exposed to HCV polyprotein following infection with HCV, whereby the cellular immune response to HCV polyprotein is increased on the subject.
  • kits and the compositions of the invention all can further comprise administration or inclusion of a CpG or other immunostimulatory molecule and or adjuvant.
  • the priming step(s) comprise immunizing a subject with HCV E1/E2 heterodimer, MF59 and a CpG followed by a boosting step comprising immunization with an alphavirus replicon particle comprising a nucleic acid encoding the E1/E2 protein.
  • the priming step(s) comprise immunizing a vertebrate subject with HCV E1/E2 heterodimer, MF59 and a CpG followed by a boosting step comprising immunization with an alphavirus replicon particle comprising a nucleic acid encoding the E1/E2 protein.
  • polypeptides and nucleotides encoding said polypeptides are derived from the same HCV isolate, or from different strains and isolates including isolates having any of the various HCV genotypes, to provide increased protection against a broad range of HCV genotypes.
  • the invention provides a method for treating a subject that has already been exposed to HCV infection (i.e., a vertebrate subject that has already been "primed” by exposure to one or more HCV antigens) with an alphavirus boosting regimen to enhance the immune response to HCV in the vertebrate subject.
  • a vertebrate subject is already infected with or exposed to HCV
  • the method of treatment can include one or more priming steps together with one or more boosting steps.
  • the invention provides a method for treating a vertebrate subject that has already been exposed to HCV infection (i.e., a vertebrate subject that has already been "primed” by exposure to one or more HCV antigens) with an alphavirus boosting regimen to enhance the immune response to HCV in the vertebrate subject.
  • the method of treatment can include one or more priming steps together with one or more boosting steps.
  • the invention provides the use of a composition comprising an HCV protein or an alphavirus particle encoding an HCV protein in the manufacture of a medicament for generating an immune response to HCV in a subject by: at least one administration of the protein followed by at least one administration of the alphavirus particle.
  • the invention provides the use of a composition comprising an HCV protein or an alphavirus particle encoding an HCV protein in the manufacture of a medicament for generating an immune response to HCV in an individual by: at least one administration of the protein followed by at least one administration of the alphavirus particle.
  • the present invention also provides a kit for inducing or generating an immune response in a subject such as a mammal.
  • the kit comprises (i) a first composition which comprises HCV protein and an adjuvant; and (ii) a second composition which comprises a viral vector encoding at least a portion of the HCV protein of the first composition.
  • the adjuvant is an oil in water emulsion that can be MF59.
  • the first composition in said kit comprises MF59 as an adjuvant.
  • the first composition comprising E1/E2 protein and MF59 further comprises CpG.
  • the kit comprises (i) a first composition which comprises E1E2 protein complexes and an adjuvant; and (ii) a second composition which comprises a viral vector encoding E1E2 protein complexes.
  • the adjuvant is an oil in water emulsion that can be MF59.
  • the first composition in said kit comprises MF59 as an adjuvant.
  • the first composition comprising E1/E2 protein and MF59 further comprises CpG.
  • the viral vector is a defective alphaviral particle.
  • the kit can comprise single or multiple doses of the first composition, of the second composition or of both first and second compositions.
  • the kit can comprise a plurality of vials for one or both compositions, each vial comprising the dose to be administered to the subject at each administration.
  • the kit can further comprise instructions for use of the kit.
  • the kit can also comprise an applicator for administering the first composition and/or an applicator for administering the second composition to the mammal.
  • the kits of the invention can further comprise instructions for using the compositions of the kit alone or together with other compositions.
  • the invention is directed to a method of stimulating an immune response in a subject or a vertebrate subject, said method comprising: administering at least once a first composition comprising an HCV protein complex to said subject or vertebrate subject; and subsequently administering at least once a second composition comprising a viral vector comprising a nucleic acid encoding at least a portion of said HCV protein already administered to said subject or vertebrate subject, whereby the nucleic acid encoding an HCV protein is expressed in one or more cells of the subject and the HCV protein is produced.
  • the immune response can be a cellular and or a humoral immune response.
  • the cellular or humoral immune response can be stimulated using any of the various first protein compositions and second viral vector compositions described herein.
  • the subject or vertebrate subject may have already been exposed or infected with HCV or may be na ⁇ ve in regards to exposure to the virus.
  • the invention is directed to a method of stimulating an immune response in a subject or vertebrate subject, said method comprising: administering at least once a first composition comprising an HCV E1E2 protein complex to said subject or vertebrate subject; and subsequently administering at least once a second composition comprising a viral vector comprising a nucleic acid encoding an HCV E1E2 complex to said subject or vertebrate subject, whereby the nucleic acid encoding an HCV E1E2 complex is expressed in one or more cells of the subject and E1E2 protein complex is produced.
  • the immune response can be a cellular and or a humoral immune response.
  • the cellular or humoral immune response can be stimulated using any of the various first protein compositions and second viral vector compositions described herein.
  • the E1/E2 protein complexes and or the alphavirus encoding said E1/E2 complexes can be partial or complete protein (or protein-coding in the case of the viral vector) sequences as described further herein. Furthermore, it is not necessary that the exact sequence used as the protein immunization composition is included in the nucleic acid encoding the protein sequence. Either the protein amino acid sequence or nucleic acid encoding the protein sequence can be partial or complete in regards to the HCV genome.
  • the first and second compositions can be administered one or more times in any variety of combinations, such as for example 1, 2, 3, 4, or 5 or more sequential administrations of the first composition comprising a protein followed by 1, 2, 3, 4 or 5 or more sequential administrations of the second composition comprising a viral vector. Furthermore, administration of the second composition can occur before administration of a second or subsequent first composition.
  • the invention provides a method of activating T cells of a subject or vertebrate subject, wherein said T cells recognize an epitope of a hepatitis C virus (HCV) polypeptide, said method comprising: administering at least once a first composition comprising an HCV E1E2 protein complex to said subject or vertebrate subject; arid subsequently administering at least once a second composition comprising a viral vector comprising a nucleic acid encoding an HCV E1E2 complex to said subject or vertebrate subject, whereby the nucleic acid encoding an HCV E1E2 complex is expressed in one or more cells of the subject and E1E2 protein complex is produced; whereby T cells are activated in said subject and said activated T cells recognize an epitope of El, E2 or the E1E2 complex.
  • the viral vector can be a mammalian viral vector such as an alpahvirus vector and in one embodiment the alpahvirus vector is a defective alphavirus vector particle that can be a
  • the subject or vertebrate subject is either already infected with HCV prior to administration of one or more of said first and second compositions or has not been infected prior to administration.
  • the methods can provide prophylactic and therapeutic effects.
  • the methods stimulate in the activation of the T cells comprise CD8 + T cells, wherein activation includes an increase in the number of CD8+ T-cells producing gamma interferon.
  • the methods stimulate in the activation of the T cells comprise CD4 4" T cells, wherein activation includes an increase in the number of CD4+ T-cells producing gamma interferon.
  • the methods stimulate in the activation of B cells, wherein activation includes an increase in the number of antibodies having a protective of therapeutic effect against HCV.
  • the first protein compositions can further comprise at least one adjuvant and can comprise more than one adjuvant or an adjuvant and another immunostimulatory composition.
  • One preferred adjuvant is a submicron oil-in-water emulsion.
  • the submicron oil-in-water emulsion to be added to the protein composition comprises 4-5% w/v squalene, 0.25- 1.0% w/v polyoxyelthylenesorbitan monooleate, and/or 0.25-1.0% sorbitan trioleate, and optionally, N-acetylmuramyl-L-alanyl-D-isogluatminyl-L-alanine ⁇ -Cr ⁇ '-dipalmitoyl-sn-glycero -3-huydroxyphosphoryloxy)-ethylamine (MTP-PE).
  • the submicron oil-in-water emulsion is MF59.
  • One preferred immunostimulatory composition is an immunostimulatory nucleic
  • the first composition comprising an El E2 protein can be produced by expression of a polynucleotide encoding a sequence of amino acids having at least 80% sequence identity to the sequence of amino acids depicted at positions 192-809 of Figures 2A-2C.
  • the second composition comprising a viral vector comprising a nucleic acid encoding an HCV E1E2 complex encodes a sequence of amino acids having at least 80% sequence identity to the sequence of amino acids depicted at positions 192-746 of Figures 2A-2C.
  • the adjuvant and the protein antigen(s) may be administered simultaneously, sequentially or separately.
  • the adjuvant may be administered to prime the subject before administration of the antigen(s) or after the administration of the antigen(s) to boost the immune response to that antigen.
  • the adjuvant and protein antigen(s) are preferably administered in admixture.
  • the protein antigen(s) and the viral vector may be administered simultaneously, sequentially or separately.
  • the protein composition may be administered to prime the subject before administration of the viral vector.
  • the protein antigen(s) and viral vector are preferably administered sequentially with protein antigen administered at least once before the viral vector is administered.
  • the invention also provides the use of at least one antigen in the manufacture of a medicament for raising an immune response in a patient, wherein the medicament is administered with an adjuvant.
  • the invention provides the use of an adjuvant in the manufacture of a medicament for raising an immune response in a patient, wherein the medicament is administered with at least one antigen.
  • Use of a viral vector in the manufacture of a medicament is also provided.
  • FIGURES Figure 1 is a diagrammatic representation of the HCV genome, depicting the various regions of the HCV polyprotein.
  • Figures 2A-2C show the nucleotide and corresponding amino acid sequence for the HCV-I El/E2/p7 region.
  • the numbers shown in the figure are relative to the full-length HGV-I polyprotein.
  • the El, E2 and p7 regions are shown.
  • Figure 3 shows HCV-specific CD8+ and IFN- ⁇ expression in mice vaccinated as described in the legend and examples.
  • Figure 4 shows HCV-specific CD8+ and IFN- ⁇ expression in mice vaccinated as described in the examples.
  • Figure 5a shows HCV-specific CD4+ and IFN- ⁇ expression in mice vaccinated as described in the legend and examples.
  • Figure 5b shows HCV-specific CD8+ and IFN- ⁇ expression in mice vaccinated as described in the examples.
  • Figure 6 shows the results of ELISA assays for determination of antibody production as described in the examples.
  • Figure 7 shows a diagram of the E2NS3*NS4NS5tcorel21 fusion protein as described in the examples.
  • Figure 8 shows graphically the results of CD4 HCV specific T cells generated following immunization with various NS alphavirus constructs as described in the examples.
  • Figure 9 shows graphically the results of CD8 HCV specific T cells generated following immunization with various NS alphavirus constructs as described in the examples.
  • Figure 10 shows graphically the results of CD8 HCV specific T cells generated following immunization with various NS alphavirus and or NS polypeptide constructs as described in the examples.
  • Figure 11 shows graphically the results of CD4 HCV specific T cells generated following immunization with various NS alphavirus and or NS polypeptide as described in the examples.
  • Figure 12 shows graphically the results of neutralizing antibody titers (i.e., antibody titers for blocking E1E2 binding to CD81)generated in mice immunized with a prime boost regimen of E1E2 as described in the examples.
  • Figure 13 shows graphically the results of prevention of infectivity by prime boost sera in an HCV cell culture/luciferase assay (i.e., an HCVcc neutralizing assay).
  • Figure 14 demonstrates graphically the prevention of infectivity for an HCV cell culture/luciferase assay, in particular the HCVcc neutralizing assay.
  • Glutamic acid GIu (E)
  • Glycine GIy (G)
  • Threonine Thr (T) Tryptophan: Trp (W)
  • polypeptide refers to a protein which includes modifications, such as deletions, additions and substitutions (generally conservative in nature), to the native sequence, so long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.
  • El polypeptide a molecule derived from an HCV El region.
  • the mature El region of HCV-I begins at approximately amino acid 192 of the polyprotein and continues to approximately amino acid 383, numbered relative to the full-length HCV-I polyprotein.
  • Amino acids 192-383 of Figures 2A-2C correspond to amino acid positions 20-211 of SEQ ID NO:2.
  • Amino acids at around 173 through approximately 191 (amino acids 1-19 of SEQ BDNO:2) serve as a signal sequence for El .
  • an "El polypeptide” is meant either a precursor El protein, including the signal sequence, or a mature El polypeptide which lacks this sequence, or even an-El polypeptide with a heterologous signal sequence.
  • the El polypeptide includes a C-terminal membrane anchor sequence which occurs at approximately amino acid positions 360-383 (see, International Publication No. WO 96/04301, published February 15, 1996).
  • An El polypeptide, as defined herein, may or may not include the C-terminal anchor sequence or portions thereof.
  • an “E2 polypeptide” is meant a molecule derived from an HCV E2 region.
  • the mature E2 region of HCV-I begins at approximately amino acid 383-385, numbered relative to the full-length HCV-4 polyprotein. (See, Figures 1 and 2A-2C. Amino acids 383-385 of Figures 2A-2C correspond to amino acid positions 211-213 of SEQ ID NO:2.)
  • a signal peptide begins at approximately amino acid 364 of the polyprotein.
  • an “E2 polypeptide” is meant either a precursor E2 protein, including the signal sequence, or a mature E2 polypeptide which lacks this sequence, or even an E2 polypeptide with a heterologous signal sequence.
  • the E2 polypeptide includes a C-terminal membrane anchor sequence which occurs at approximately amino acid positions 715-730 and may extend as far as approximately amino acid residue 746 (see, Lin et al., J. Virol. (1994) 68:5063-5073).
  • An E2 polypeptide, as defined herein, may or may not include the C-terminal anchor sequence or portions thereof.
  • an E2 polypeptide may also include all or a portion of the p7 region which occurs immediately adjacent to the C-terminus of E2. As shown in Figures 1 and 2A-2C, the p7 region is found at positions 747-809, numbered relative to the full-length HCV-I polyprotein (amino acid positions 575-637 of SEQ ID NO:2).
  • HCV E2 HCV E2
  • E2 encompasses any of these species of E2 including, without limitation, species that have deletions of 1-20 or more of the amino acids from the N-terminus of the E2, such as, e.g, deletions of 1, 2, 3, 4, 5....10...15, 16, 17, 18, 19... etc. amino acids.
  • Such E2 species include those beginning at amino acid 387, amino acid 402, amino acid 403, etc.
  • El and E2 regions from HCV-I are shown in Figures 2A-2C and SEQ ID NO:2.
  • the El and E2 regions are defined with respect to the amino acid number of the polyprotein encoded by the genome of HCV-I, with the initiator methionine being designated position 1. See, e.g., Choo et al., Proc. Natl. Acad. ScL USA (1991) 88:2451-2455.
  • the term an "El polypeptide” or an "E2 polypeptide” as used herein is not limited to the HCV-I sequence.
  • the corresponding El or E2 regions in other HCV isolates can be readily determined by aligning sequences from the isolates in a manner that brings the sequences into maximum alignment. This can be performed with any of a number of computer software packages, such as ALIGN 1.0, available from the University of Virginia, Department of Biochemistry (Attn: Dr. William R. Pearson). See, Pearson et al., Proc. Natl. Acad. Sci. USA (1988) 85-2444-2448.
  • an "El polypeptide” or an “E2 polypeptide” as defined herein is not limited to a polypeptide having the exact sequence depicted in the Figures. Indeed, the HCV genome is in a state of constant flux in vivo and contains several variable domains which exhibit relatively high degrees of variability between isolates. A number of conserved and variable regions are known between these strains and, in general, the amino acid sequences of epitopes derived from these regions will have a high degree of sequence homology, e.g., amino acid sequence homology of more than 30%, preferably more than 40%, more than 60%, and even more than 80-90% homology, when the two sequences are aligned.
  • El or E2 polypeptide refers to native El or E2 sequences from any of the various HCV strains, as well as analogs, muteins and immunogenic fragments, as defined further below.
  • the complete genotypes of many of these strains are known. See, e.g., U.S. Patent No. 6,150,087 and GenBank Accession Nos. AJ238800 and AJ238799.
  • El polypeptide and E2 polypeptide encompass proteins which include modifications to the native sequence, such as internal deletions, additions and substitutions (generally conservative in nature), such as proteins substantially homologous to the parent sequence. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through naturally occurring mutational events. All of these modifications are encompassed in the present invention so long as the modified El and E2 polypeptides function for their intended purpose. Thus, for example, if the El and/or E2 polypeptides are to be used in vaccine compositions, the modifications must be such that immunological activity (i.e., the ability to elicit a humoral or cellular immune response to the polypeptide) is not lost. Generally, then, for purposes of the present invention, the polypeptides will retain at least one T cell epitope such that a cellular immune response can be generated in a subject to which the polypeptides are delivered.
  • immunological activity i.e., the ability to elicit a humoral or cellular
  • El E2 or E1E2 protein complex is meant a protein containing at least one El polypeptide and at least one E2 polypeptide, as described above. Such a complex may also include all or a portion of the p7 region which occurs immediately adjacent to the C-terminus of E2. As shown in Figures 1 and 2A-2C, the p7 region is found at positions 747-809, numbered relative to the full-length HCV-I polyprotein (amino acid positions 575-637 of SEQ ID NO:2). A representative E1E2 complex which includes the p7 protein is termed "ElE2go 9 " herein.
  • the compositions comprising E1E2 protein complexes useful for practice of the invention can further include one or more adjuvants.
  • the mode of association of El and E2 in an E1E2 complex is immaterial.
  • the El and E2 polypeptides may be associated through non-covalent interactions such as through electrostatic forces, or by covalent bonds.
  • the E1E2 polypeptides of the present invention may be in the form of a fusion protein which includes an immunogenic El polypeptide and an immunogenic E2 polypeptide, as defined above.
  • the fusion may be expressed from a polynucleotide encoding an E1E2 chimera.
  • E1E2 complexes may form spontaneously simply by mixing El and E2 proteins which have been produced individually. Similarly, when co-expressed and secreted into media, the El and E2 proteins can form a complex spontaneously.
  • E1E2 complexes also called aggregates
  • Such aggregates may include one or more El monomers in association with one or more E2 monomers.
  • the number of El and E2 monomers present need not be equal so long as at least one El monomer and one E2 monomer are present.
  • Detection of the presence of an E1E2 complex is readily determined using standard protein detection techniques such as polyacrylamide gel electrophoresis and immunological techniques such as immunoprecipitation.
  • analog and mutant refer to biologically active derivatives of the reference molecule, such as E1E2 8O 9, or fragments of such derivatives, that retain desired activity, such as immunoreactivity in assays described herein.
  • analog refers to compounds having a native polypeptide sequence and structure with one or more amino acid additions, substitutions (generally conservative in nature) and/or deletions, relative to the native molecule, so long as the modifications do not destroy immunogenic activity.
  • mutein refers to peptides having one or more peptide mimics ("peptoids").
  • the analog or mutein has at least the same immunoreactivity as the native molecule. Methods for making polypeptide analogs and muteins are known in the art and are described further below.
  • amino acids are generally divided into four families: (1) acidic — aspartate and glutamate; (2) basic — lysine, arginine, histidine; (3) non-polar -- alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar — glycine, asparagine, glutamine, cysteine, serine threonine, tyrosine.
  • Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids.
  • an isolated replacement of leucine with isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar conservative replacement of an amino acid with a structurally related amino acid will not have a major effect on the biological activity.
  • the polypeptide of interest such as an E1E2 polypeptide, may include up to about 5-10 conservative or non-conservative amino acid substitutions, or even up to about 15-25 or 50 conservative or non-conservative amino acid substitutions, or any integer between 5-50, so long as the desired function of the molecule remains intact.
  • fragment is intended a polypeptide consisting of only a part of the intact full-length polypeptide sequence and structure.
  • the fragment can include a C-terminal deletion an N-terminal deletion, and/or an internal deletion of the native polypeptide.
  • an "immunogenic fragment" of a particular HCV protein will generally include at least about 5-10 contiguous amino acid residues of the full-length molecule, preferably at least about 15-25 contiguous amino acid residues of the full-length molecule, and most preferably at least about 20-50 or more contiguous amino acid residues of the full-length molecule, that define an epitope, or any integer between 5 amino acids and the full-length sequence, provided that the fragment in question retains the ability to elicit an immunological response as defined herein.
  • known immunogenic fragments of HCV El and E2 see, e.g., Chien et al., International Publication No. WO 93/00365.
  • epitope refers to a sequence of at least about 3 to 5, preferably about 5 to 10 or 15, and not more than about 500 amino acids (or any integer therebetween), which define a sequence that by itself or as part of a larger sequence, elicits an immunological response in the subject to which it is administered. Often, an epitope will bind to an antibody generated in response to such sequence. There is no critical upper limit to the length of the fragment, which may comprise nearly the full-length of the protein sequence, or even a fusion protein comprising two or more epitopes from the HCV polyprotein. An epitope for use in the subject invention is not limited to a polypeptide having the exact sequence of the portion of the parent protein from which it is derived.
  • epitopes encompasses sequences identical to the native sequence, as well as modifications to the native sequence, such as deletions, additions and substitutions (generally conservative in nature).
  • Regions of a given polypeptide that include an epitope can be identified using any number of epitope mapping techniques, well known in the art. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996) Humana Press, Totowa, New Jersey.
  • linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Such techniques are known in the art and described in, e.g., U.S. Patent No.
  • conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g., x-ray crystallography and 2-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols, supra.
  • Antigenic regions of proteins can also be identified using standard antigenicity and hydropathy plots, such as those calculated using, e.g., the Omiga version 1.0 software program available from the Oxford Molecular Group. This computer program employs the Hopp/Woods method, Hopp et al., Proc. Natl. Acad. Sci USA (1981) 78:3824-3828 for determining antigenicity profiles, and the Kyte-Doolittle technique, Kyte et al., /.
  • the term “conformational epitope” refers to a portion of a full-length protein, or an analog or mutein thereof, having structural features native to the amino acid sequence encoding the epitope within the full-length natural protein. Native structural features include, but are not limited to, glycosylation and three dimensional structure. The length of the epitope defining sequence can be subject to wide variations as these epitopes are believed to be formed by the three-dimensional shape of the antigen (e.g., folding).
  • amino acids defining the epitope can be relatively few in number, but widely dispersed along the length of the molecule (or even on different molecules in the case of dimers, etc.), being brought into correct epitope conformation via folding.
  • the portions of the antigen between the residues defining the epitope may not be critical to the conformational structure of the epitope. For example, deletion or substitution of these intervening sequences may not affect the conformational epitope provided sequences critical to epitope conformation are maintained (e.g., cysteines involved in disulfide bonding, glycosylation sites, etc.). Conformational epitopes are readily identified using methods discussed above.
  • the presence or absence of a conformational epitope in a given polypeptide can be readily determined through screening the antigen of interest with an antibody (polyclonal serum or monoclonal to the conformational epitope) and comparing its reactivity to that of a denatured version of the antigen which retains only linear epitopes (if any). In such screening using polyclonal antibodies, it may be advantageous to absorb the polyclonal serum first with the denatured antigen and see if it retains antibodies to the antigen of interest. Conformational epitopes derived from the El and E2 regions are described in, e.g., International Publication No. WO 94/01778.
  • T-cell epitope refers to a feature of a peptide structure which is capable of inducing T-cell immunity towards the peptide structure or an associated hapten.
  • T-cell epitopes generally comprise linear peptide determinants that assume extended conformations within the peptide-binding cleft of MHC molecules, (Unanue et al., Science (1987) 236:551-557). Conversion of polypeptides to MHC class II-associated linear peptide determinants (generally between 5-14 amino acids in length) is termed "antigen processing" which is carried out by antigen presenting cells (APCs).
  • APCs antigen presenting cells
  • a T-cell epitope is defined by local features of a short peptide structure, such as primary amino acid sequence properties involving charge and hydrophobicity, and certain types of secondary structure, such as helicity, that do not depend on the folding of the entire polypeptide.
  • short peptides capable of recognition by helper T-cells are generally amphipathic structures comprising a hydrophobic side (for interaction with the MHC molecule) and a hydrophilic side (for interacting with the T-cell receptor), (Margalit et al., Computer Prediction of T-cell Epitopes, New Generation Vaccines Marcel-Dekker, Inc, ed. G.C. Woodrow et al., (1990) pp.
  • amphipathic structures have an ⁇ -helical configuration (see, e.g., Spouge et al., J. Immunol. (1987) 138:204-212; Berkower et al., J. Immunol. (1986) 136:2498-2503).
  • segments of proteins that include T-cell epitopes can be readily predicted using numerous computer programs.
  • Such programs generally compare the amino acid sequence of a peptide to sequences known to induce a T-cell response, and search for patterns of amino acids which are believed to be required for a T-cell epitope.
  • an "immunological response" to an HCV antigen or composition is the development in a subject of a humoral and/or a cellular immune response to molecules present in the composition of interest.
  • a “humoral immune response” refers to an immune response mediated by antibody molecules
  • a "cellular immune response” is one mediated by T-lymphocytes and/or other white blood cells.
  • CTLs cytolytic T-cells
  • CTLs have specificity for peptide antigens that are presented in association with proteins encoded by the major histocompatibility complex (MHC) and expressed on the surfaces of cells.
  • helper T-cells help induce and promote the intracellular destruction of intracellular microbes, or the lysis of cells infected with such microbes.
  • Another aspect of cellular immunity involves an antigen-specific response by helper T-cells.
  • Helper T-cells act to help stimulate the function, and focus the activity of, nonspecific effector cells against cells displaying peptide antigens in association with MHC molecules on their surface.
  • a "cellular immune response” also refers to the production of cytokines, chemokines and other such molecules produced by activated T-cells and/or other white blood cells, including those derived from CD4+ and CD8+ T-cells.
  • a composition or vaccine that elicits a cellular immune response may serve to sensitize a vertebrate subject by the presentation of antigen in association with MHC molecules at the cell surface.
  • the cell-mediated immune response is directed at, or near, cells presenting antigen at their surface.
  • antigen-specific T-lymphocytes can be generated to allow for the future protection of an immunized host.
  • the ability of a particular antigen to stimulate a cell-mediated immunological response may be determined by a number of assays, such as by lymphoproliferation (lymphocyte activation) assays; CTL cytotoxic cell assays, or by assaying for T-lymphocytes specific for the antigen in a sensitized subject. Such assays are well known in the art.
  • an immunological response as used herein may be one which stimulates the production of CTLs, and/or the production or activation of helper T cells.
  • the antigen of interest may also elicit an antibody-mediated immune response, including, or example, neutralization of binding (NOB) antibodies.
  • NOB neutralization of binding
  • an immunological response may include one or more of the following effects: the production of antibodies by B-cells; and/or the activation of suppressor T-cells and/or ⁇ T-cells directed specifically to an antigen or antigens present in the composition or vaccine of interest.
  • These responses may serve to neutralize infectivity, and/or mediate antibody-complement, or antibody dependent cell cytotoxicity (ADCC) to provide protection or alleviation of symptoms to an immunized host.
  • ADCC antibody dependent cell cytotoxicity
  • Such responses can be determined using standard immunoassays and neutralization assays, well known in the art.
  • isolated is meant, when referring to a polypeptide, that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macro-molecules of the same type.
  • isolated with respect to a polynucleotide is a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith; or a molecule disassociated from the chromosome.
  • equivalent antigenic determinant an antigenic determinant from different sub-species or strains of HCV, such as from strains 1, 2, 3, etc., of HCV which antigenic determinants are not necessarily identical due to sequence variation, but which occur in equivalent positions in the HCV sequence in question.
  • amino acid sequences of equivalent antigenic determinants will have a high degree of sequence homology, e.g., amino acid sequence homology of more than 30%, usually more than 40%, such as more than 60%, and even more than 80-90% homology, when the two sequences are aligned.
  • Homology refers to the percent identity between two polynucleotide or two polypeptide moieties.
  • Two DNA, or two polypeptide sequences are "substantially homologous" to each other when the sequences exhibit at least about 50% , preferably at least about 75%, more preferably at least about 80%-85%, preferably at least about 90%, and most preferably at least about 95%-98% sequence identity over a defined length of the molecules.
  • substantially homologous also refers to sequences showing complete identity to the specified DNA or polypeptide sequence.
  • identity refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Percent identity can be determined by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100. Readily available computer programs can be used to aid in the analysis, such as ALIGN, Dayhoff, M.O. in Atlas of Protein Sequence and Structure M.O. Dayhoff ed., 5 Suppl.
  • percent identity of a particular nucleotide sequence to a reference sequence can be determined using the homology algorithm of Smith and Waterman with a default scoring table and a gap penalty of six nucleotide positions.
  • Another method of establishing percent identity in the context of the present invention is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics, Inc. (Mountain View, CA). From this suite of packages the
  • Smith- Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six). From the data generated the "Match" value reflects "sequence identity.”
  • Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters.
  • homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments.
  • DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.
  • degenerate variant is intended a polynucleotide containing changes in the nucleic acid sequence thereof, that encodes a polypeptide having the same amino acid sequence as the polypeptide encoded by the polynucleotide from which the degenerate variant is derived.
  • a degenerate variant of E1E280 9 DNA is a molecule with one or more base differences in the DNA sequence from which the molecule is derived but that encodes the same E1E28 09 amino acid sequence.
  • a "coding sequence” or a sequence which "encodes" a selected polypeptide is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences.
  • the boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
  • a transcription termination sequence may be located 3' to the coding sequence.
  • no stop start codons naturally occur in the polyprotein.
  • Synthetic protein expression constructs can be made which comprise E1/E2 fusion proteins further comprising a start codon and optionally a secretory or leader sequence using various techniques known to the skilled artisan and an example of which is provided herein.
  • a “nucleic acid” molecule or “polynucleotide” can include both double- and single-stranded sequences and refers to, but is not limited to, cDNA from viral, procaryotic or eucaryotic mRNA, genomic DNA sequences from viral (e.g. DNA viruses and retroviruses) or procaryotic DNA, and synthetic DNA sequences. The term also captures sequences that include any of the known base analogs of DNA and RNA.
  • An "HCV polynucleotide” is a polynucleotide that encodes an HCV polypeptide, as defined above.
  • “Operably linked” refers to an arrangement of elements wherein the components so described are configured so as to perform their desired function.
  • a given promoter operably linked to a coding sequence is capable of effecting the expression of the coding sequence when the proper transcription factors, etc., are present.
  • the promoter need not be contiguous with the coding sequence, so long as it functions to direct the expression thereof.
  • intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence, as can transcribed introns, and the promoter sequence can still be considered “operably linked" to the coding sequence.
  • Recombinant as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, viral, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation is not associated with all or a portion of the polynucleotide with which it is associated in nature.
  • the term "recombinant” as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide.
  • the gene of interest is cloned and then expressed in transformed organisms, as described further below. The host organism expresses the foreign gene to produce the protein under expression conditions.
  • control element refers to a polynucleotide sequence which aids in the expression of a coding sequence to which it is linked.
  • the term includes promoters, transcription termination sequences, upstream regulatory domains, polyadenylation signals, untranslated regions, including 5'-UTRs and 3'-UTRs and when appropriate, leader sequences and enhancers, which collectively provide for the transcription and translation of a coding sequence in a host cell.
  • promoter as used herein is a DNA regulatory region capable of binding
  • RNA polymerase in a host cell and initiating transcription of a downstream (3' direction) coding sequence operably linked thereto.
  • a promoter sequence includes the minimum number of bases or elements necessary to initiate transcription of a gene of interest at levels detectable above background. Within the promoter sequence is a transcription initiation site, as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eucaryotic promoters will often, but not always, contain "TATA" boxes and "CAT” boxes.
  • a control sequence "directs the transcription" of a coding sequence in a cell when RNA polymerase will bind the promoter sequence and transcribe the coding sequence into mRNA, which is then translated into the polypeptide encoded by the coding sequence.
  • “Expression cassette” or “expression construct” refers to an assembly which is capable of directing the expression of the sequence(s) or gene(s) of interest.
  • the expression cassette includes control elements, as described above, such as a promoter which is operably linked to (so as to direct transcription of) the sequence(s) or gene(s) of interest, and often includes a polyadenylation sequence as well.
  • the expression cassette described herein may be contained within a plasmid construct.
  • the plasmid construct may also include, one or more selectable markers, a signal which allows the plasmid construct to exist as single-stranded DNA (e.g., a Ml 3 origin of replication), at least one multiple cloning site, and a "mammalian" origin of replication (e.g., a SV40 or adenovirus origin of replication).
  • a signal which allows the plasmid construct to exist as single-stranded DNA e.g., a Ml 3 origin of replication
  • a “mammalian" origin of replication e.g., a SV40 or adenovirus origin of replication.
  • transformation refers to the insertion of an exogenous polynucleotide into a host cell, irrespective of the method used for insertion: for example, transformation by direct uptake, transfection, infection, and the like. For particular methods of transformation, see further below.
  • the exogenous polynucleotide may be maintained as a nonintegrated
  • nucleic acid immunization is meant the introduction of a nucleic acid molecule encoding one or more selected immunogens, such as an El E2 complex, into a host cell, for the in vivo expression of the immunogen.
  • the nucleic acid molecule can be introduced directly into a recipient subject, such as by injection, inhalation, oral, intranasal and mucosal administration, or the like, or can be introduced ex vivo, into cells which have been removed from the host. In the latter case, the transformed cells are reintroduced into the subject where an immune response can be mounted against the immunogen encoded by the nucleic acid molecule.
  • alphavirus has its conventional meaning in the art, and includes Eastern Equine Encephalitis virus (EEE), Venezuelan Equine Encephalitis virus (VEE), Everglades virus, Mucambo virus, Pixuna virus, Western Encephalitis virus (WEE), Sindbis virus (SIN), South African Arbovirus No.86 (S.A.AR86), Girdwood S.A.
  • alphaviruses for use in the present invention are SIN strains, VEE strains, Ockelbo virus, and chimeric viruses thereof.
  • a "viral vector” refers to a nucleic acid construct that carries, and within certain embodiments, is capable of directing the expression of a nucleic acid molecule of interest, such as a polynucleotide encoding an E1E2 complex.
  • Viral vectors may be utilized in several formats, including DNA, RNA, and recombinant replicon particles.
  • the term viral vector includes a nucleic acid provided in a viral particle, such as for example a defective chimeric alphavirus particle.
  • alphavirus vector refers to a nucleic acid construct that carries, and within certain embodiments, is capable of directing the expression of a nucleic acid molecule of interest, such as a polynucleotide encoding an E1E2 complex.
  • Alphavirus vectors may be utilized in several formats, including DNA, RNA, and recombinant replicon particles. Such replicon vectors have been derived from alphaviruses that include, for example, Sindbis virus, Semliki Forest virus, and/or Venezuelan equine encephalitis virus. See, e.g., U.S. Patent Nos. 5,789,245;
  • RNA replicon vector refers to an RNA molecule that is capable of directing its own amplification or self-replication in vivo, within a target cell.
  • the RNA molecule should encode the polymerase(s) necessary to catalyze RNA amplification (e.g., alphavirus nonstructural proteins nsPl, nsP2, nsP3, nsP4) and also contain cis RNA sequences required for replication which are recognized and utilized by the encoded polymerase(s).
  • An alphavirus RNA vector replicon typically contains the following ordered elements: 5' viral or cellular sequences required for nonstructural protein-mediated amplification (may also be referred to as 5 1 CSE, or 5' cis, replication sequence, or 5 1 viral sequences required in cis for replication, or 5' sequence which is capable of initiating transcription of an alphavirus), sequences which, when expressed, code for biologically active alphavirus nonstructural proteins ⁇ e.g., nsPl, nsP2, nsP3, nsP4), and 3 1 viral or cellular sequences required for nonstructural protein-mediated amplification (may also be referred as 3' CSE, or 3' viral sequences required in cis for replication, or an alphavirus RNA polymerase recognition sequence).
  • 5 1 CSE or 5' cis
  • replication sequence or 5 1 viral sequences required in cis for replication, or 5' sequence which is capable of initiating transcription of an alphavirus
  • the alphavirus RNA vector replicon also should contain a means to express one or more heterologous sequence(s), such as for example, an IRES or a viral (e.g., alphaviral) subgenomic promoter (e.g., junction region promoter) which may, in certain embodiments, be modified in order to increase or reduce viral transcription of the subgenomic fragment, or to decrease homology with defective helper or structural protein expression cassettes, and one or more heterologous sequence(s) to be expressed.
  • a viral subgenomic promoter e.g., junction region promoter
  • the replicons When used as vectors, the replicons will also contain additional sequences, for example, one or more heterologous sequence(s) encoding one or more polypeptides (e.g., a protein-encoding gene or a 3' proximal gene) and/or a polyadenylate tract.
  • additional sequences for example, one or more heterologous sequence(s) encoding one or more polypeptides (e.g., a protein-encoding gene or a 3' proximal gene) and/or a polyadenylate tract.
  • chimeric alphavirus particle and “chimeric alphavirus replicon particle” refer to a chimera or chimeric particle such as a virus, or virus-like particle, specifically modified or engineered to contain a nucleic acid derived from a alphavirus other than the alphavirus from which either the capsid and/or envelope glycoprotein was derived (e.g., from a different virus).
  • the nucleic acid derived from an alphavirus is an RNA molecule comprising one of any number of different lengths, including, but not limited to genome-length (encoding nonstructural and structural proteins) and replicon-length (deleted of one or more structural proteins).
  • chimeric replicon particles may include Sindbis virus (SIN) replicon RNA within a capsid having a Sindbis virus RNA binding domain and a Venezuelan equine encephalitis • virus (VEE) envelope glycoprotein interaction domain, surrounded by a VEE glycoprotein envelope and/or a VEE replicon RNA having a deletion in nsP3, a SIN packaging signal inserted into the deletion in nsP3 and capsid and envelope proteins derived from SIN.
  • Sindbis virus Sindbis virus
  • VEE Venezuelan equine encephalitis • virus
  • Chimeric alphavirus vectors are described, for example, in U.S. Patent Publications 20030232324 and 20030148262, incorporated herein by reference in their entireties.
  • the invention employs defective alphavirus particles that are chimeric.
  • the term "defective alphavirus particle” refers to a virus particle that can generate copies of its RNA upon infection in a cell, thereby expressing any exogenous gene encoded on the alphavirus, but the virus is lacking in one or more functions required for production of new viral particles following infection.
  • defective alphavirus particles lack one or more structural genes required for generation of new particles. (See, e.g., WO/61772).
  • an effective amount or “pharmaceutically effective amount” of an immunogenic composition refers to a nontoxic but sufficient amount of the composition to provide the desired response, such as an immunological response, and optionally, a corresponding therapeutic effect.
  • the exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the condition being treated, and the particular macromolecule of interest, mode of administration, and the like. An appropriate "effective" amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.
  • vertebrate subject any member of the subphylum chordata, including, without limitation, humans and other primates, including non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs; birds, including domestic, wild and game birds such as chickens, turkeys and other gallinaceous birds, ducks, geese, and the like.
  • the term does not denote a particular age. Thus, both adult and newborn individuals are intended to be covered.
  • the invention described herein is intended for use in any of the above vertebrate species, since the immune systems of all of these vertebrates operate similarly.
  • treatment refers to either (1) the prevention of infection or reinfection (prophylaxis), or (2) the reduction or elimination of symptoms of the disease of interest (therapy). 2. MODES OF CARRYING OUT THE INVENT ⁇ ON
  • compositions including the El E2 complexes may also contain adjuvants, such as submicron oil-in- water emulsions described in detail below.
  • Subjects are subsequently boosted with a viral vector composition comprising nucleic acid constructs encoding E1E2 complexes, such as viral vector compositions containing alphavirus replicon particles encoding E1E2 complexes.
  • the E1E2 complexes encoded by the nucleic acid constructs can be either the same E1E2 complex as used initially, or can encode other El E2 proteins, as described further below, so long as an immune response is generated.
  • a viral vector as described herein is a defective alpahvirus particle, which can be a chimeric alphavirus particle.
  • compositions above can be used alone, or in combination with other compositions, such as compositions comprising other HCV proteins, compositions comprising DNA encoding other HCV proteins, as well as compositions comprising ancillary substances, such as immunoglobulins, cytokines, lymphokines, and chemokines, including but not limited to cytokines such as IL-1, 1L-2, IL-4, IL-5, IL-6, IL-7, IL-12 etc. (see, e.g., International Publication No.
  • WO 99/44636 modified IL-2 (cysl25-ser!25), GM-CSF, M-CSF, tumor necrosis factor (TNF), interferons and pegylated interferons, such as ⁇ -interferon, IP-IO, MIPl ⁇ , FLP-3, ribavirin, RANTES, siRNA, antisense RNA, inhibitors of polymerase, helicase, GTPase, ATPase, protease, glycosylation, metal loprotease, and/or IRES.
  • the present methods can be used with other therapeutic regimens for treating HCV infection. If used in combination with other compositions, such compositions can be administered prior to, concurrent with, or subsequent to the E1E2 compositions.
  • E1E2 protein and nucleic acid compositions and additional compositions for use in the subject methods.
  • immune responses in subjects are primed using one or more administrations of compositions including E1E2 complexes.
  • Subjects are then boosted using E1E2 nucleic acid constructs.
  • El, E2 and p7 are known to contain human T cell epitopes (both CD4+ and CD8+).
  • E1E2 complexes comprise El and E2 polypeptides which include one or more T cell epitopes, associated either through non-covalent or covalent interactions. Moreover, multiple copies of specific, conserved T cell epitopes can be used in E1E2 complexes, such as a composite of epitopes from different genotypes.
  • the HCV El polypeptide is a glycoprotein and extends from approximately amino acid 192 to amino acid 383 (numbered relative to the polyprotein of HCV-I). See, Choo et al., Proc. Natl. Acad. Sci. USA (1991) 88:2451-2455. Amino acids at around 173 through approximately 191 represent a signal sequence for El.
  • HCV E2 polypeptide is also a glycoprotein and extends from approximately amino acid 383 or 384 to amino acid 746.
  • a signal peptide for E2 begins at approximately amino ⁇ acid 364 of the polyprotein.
  • full-length El or “not truncated” El as used herein refers to polypeptides that include, at least, amino acids 192-383 of an HCV polyprotein (numbered relative to HCV-I).
  • full-length or “not truncated” as used herein refers to polypeptides that include, at least, amino acids 383 or 384 to amino acid 746 of an HCV polyprotein (numbered relative to HCV-I).
  • E1E2 polypeptides for use with the present invention may include additional amino acids from the p7 region, such as amino acids 747-809.
  • E2 exists as multiple species (Spaete et al., Virol. (1992) 188:819-830: Selby et al, J. Virol. (1996) 70:5177-5182; Grakoui et al., /. Virol. (1993) 62:1385-1395; Tomei et al., J. Virol. (1993) 67:4017-4026) and clipping and proteolysis may occur at the N- and C-termini of the El and E2 polypeptides.
  • an E2 polypeptide as found in an E1E2 complex may comprise at least amino acids 405-661, e.g., 400, 401, 402... to 661, such as 383 or 384-661, 383 or 384-715, 383 or 384-746, 383 or 384-749 or 383 or 384-809, or 383 or 384 to any C-terminus between 661-809, of an HCV polyprotein, numbered relative to the full-length HCV-I polyprotein.
  • preferable El polypeptides for use herein can comprise amino acids 192-326, 192-330, 192-333, 192-360, 192-363, 192-383, or 192 to any C-terminus between 326-383, of an HCV polyprotein.
  • the E1E2 complexes may also be made up of immunogenic fragments of El and E2 which comprise epitopes, preferably T cell epitopes.
  • fragments of El polypeptides can comprise from about 5 to nearly the full-length of the molecule, such as 6, 10, 25, 50, 75, 100, 125, 150, 175, 185 or more amino acids of an El polypeptide, or any integer between the stated numbers.
  • fragments of E2 polypeptides can comprise 6, 10, 25, 50, 75, 100, 150, 200, 250, 300, or 350 amino acids of an E2 polypeptide, or any integer between the stated numbers.
  • the El and E2 polypeptides may be from the same or different HCV strains.
  • epitopes derived from, e.g., the hypervariable region of E2 can be included in the E2 polypeptide.
  • a particularly effective E2 epitope to incorporate into the E2 sequence is one which includes a consensus sequence derived from this region, such as the consensus sequence Gly-Ser-Ala-Ala-Arg-Thr-Thr-Ser-Gly-Phe-Val-Ser-Leu-Phe-Ala-Pro-Gly-Ala-Lys- Gln-Asn (SEQ ID NO:3), which represents a consensus sequence for amino acids 390-410 of the HCV type 1 genome.
  • El and E2 are known and described in, e.g., Chien et al., International Publication No. WO 93/00365.
  • the El and E2 polypeptides of the complex may lack all or a portion of the membrane spanning domain.
  • the membrane anchor sequence functions to associate the polypeptide to the endoplasmic reticulum. Normally, such polypeptides are capable of secretion into growth medium in which an organism expressing the protein is cultured. However, as described in International Publication No. WO 98/50556, such polypeptides may also be recovered intracellularly.
  • Secretion into growth medium is readily determined using a number of detection techniques, including, e.g., polyacrylamide gel electrophoresis and the like, and immunological techniques such as immunoprecipitation assays as described in, e.g., International Publication No. WO 96/04301, published February 15, 1996.
  • detection techniques including, e.g., polyacrylamide gel electrophoresis and the like, and immunological techniques such as immunoprecipitation assays as described in, e.g., International Publication No. WO 96/04301, published February 15, 1996.
  • E2 polypeptides terminating with about amino acid position 370 and higher (based on the numbering of HCV-I El) will be retained by the ER and hence not secreted into growth media.
  • E2 polypeptides terminating with about amino acid position 731 and higher (also based on the numbering of the HCV-I E2 sequence) will be retained by the ER and not secreted. (See, e.g., International
  • the present invention contemplates the use of El and E2 polypeptides which retain the transmembrane binding domain, as well as polypeptides which lack all or a portion of the transmembrane binding domain, including El polypeptides terminating at about amino acids 369 and lower, and E2 polypeptides, terminating at about amino acids 730 and lower, are intended to be captured by the present invention. Furthermore, the C-terminal truncation can extend beyond the transmembrane spanning domain towards the N-terminus.
  • El truncations occurring at positions lower than, e.g., 360 and E2 truncations occurring at positions lower than, e.g., 715 are also encompassed by the present invention. All that is necessary is that the truncated El and E2 polypeptides remain functional for their intended purpose.
  • particularly preferred truncated El constructs are those that do not extend beyond about amino acid 300. Most preferred are those terminating at position 360.
  • Preferred truncated E2 constructs are those with C-terminal truncations that do not extend beyond about amino acid position 715.
  • Particularly preferred E2 truncations are those molecules truncated after any of amino acids 715-730, such as 725. If truncated molecules are used, it is preferable to use El and E2 molecules that are both truncated.
  • the El and E2 polypeptides and complexes thereof may also be present as asialoglycoproteins.
  • asialoglycoproteins are produced by methods known in the art, such as by using cells in which terminal glycosylation is blocked. When these proteins are expressed in such cells and isolated by GNA lectin affinity chromatography, the El and E2 proteins aggregate spontaneously. Detailed methods for producing these E1E2 aggregates are described in, e.g., U.S. Patent No. 6,074,852.
  • the E1E2 complexes may comprise a heterogeneous mixture of molecules, due to clipping and proteolytic cleavage, as described above.
  • a composition including E1E2 complexes may include multiple species of E1E2, such as E1E2 terminating at amino acid 746 (EIE2746), E1E2 terminating at amino acid 809 (ElE2gO9), or any of the other various El and E2 molecules described above, such as E2 molecules with N-terminal truncations of from 1-20 amino acids, such as E2 species beginning at amino acid 387, amino acid 402, amino acid 403, etc.
  • the El and E2 regions are generally defined with respect to the amino acid number relative to the polyprotein encoded by the genome of HCV-Ia, as described in Choo et al. (1991) Proc Natl Acad Sci USA 88 :2451 , with the initiator methionine being designated position 1.
  • the polypeptides for use with the present invention are not limited to those derived from the HCV-Ia sequence. Any strain or isolate of HCV can serve as the basis for providing immunogenic sequences for use with the invention. In this regard, the corresponding regions in another HCV isolate can be readily determined by aligning sequences from the two isolates in a manner that brings the sequences into maximum alignment.
  • HCV Jl.1 is described in Kubo et al. (1989) Japan. Nucl. Acids Res. 17:10367-10372; Takeuchi et al.(1990) Gene 9J_:287-291; Takeuchi et al. (1990) J. Gen. Virol. 71:3027-3033; and Takeuchi et al. (1990) Nucl. Acids Res.18:4626.
  • the complete coding sequences of two independent isolates, HCV-J and BK are described by Kato et al., (1990) Proc. Natl. Acad.
  • HCV-I isolates are described by Choo et al. (1990) Brit. Med. Bull 46:423-441; Choo et al. (1991) Proc. Natl. Acad. Sci. USA 88:2451-2455 and Han et al. (1991) Proc. Natl. Acad. ScL USA 88:1711-1715.
  • HCV isolates HC-Jl and HC-J4 are described in Okamoto et al. (1991) Japan J. Exp. Med. 60:167-177.
  • HCV isolates HCT 18, HCT 23, Th, HCT 27, ECl and EClO are described in Weiner et al. (1991) Virol. 180:842-848.
  • HCV isolates Pt-I, HCV-Kl and HCV-K2 are described in Enomoto et al. (1990) Biochem. Biophys. Res. Commun. 170:1021-1025.
  • HCV isolates A, C, D & E are described in Tsukiyama- Kohara et al. (1991) Virus Genes 5:243-254.
  • HCV E1E2 polynucleotides and polypeptides for use in the compositions and methods of the invention can be obtained from any of the above cited strains of HCV or from newly discovered isolates isolated from tissues or fluids of infected patients.
  • E1E2 complexes are readily produced recombinantly, either as fusion proteins or by e.g., co-transfecting host cells with constructs encoding for the El and E2 polypeptides of interest.
  • Co-transfection can be accomplished either in trans or cis, i.e., by using separate vectors or by using a single vector which bears both of the El and E2 genes. If done using a single vector, both genes can be driven by a single set of control elements or, alternatively, the genes can be present on the vector in individual expression cassettes, driven by individual control elements. Following expression, the El and E2 proteins will spontaneously associate.
  • the complexes can be formed by mixing the individual proteins together which have been produced separately, either in purified or semi-purified form, or even by mixing culture media in which host cells expressing the proteins, have been cultured, if the proteins are secreted.
  • the E1E2 complexes for use with the present invention may be expressed as a fusion protein wherein the desired portion of El is fused to the desired portion of E2.
  • Polynucleotides encoding El, E2 and E1E2 proteins contain less than an entire HCV genome and can be RNA or single- or double-stranded DNA. Preferably, the polynucleotides are isolated free of other components, such as proteins and lipids.
  • the polynucleotides encode the El and E2 polypeptides and complexes thereof, described above, and thus comprise coding sequences thereof.
  • Polynucleotides of the invention can also comprise other non-HCV nucleotide sequences, such as sequences coding for linkers, signal sequences, or ligands useful in protein purification such as glutathione-S-transferase and staphylococcal protein A.
  • Polynucleotides encoding the various HCV polypeptides can be isolated from a genomic library derived from nucleic acid sequences present in, for example, the plasma, serum, or liver homogenate of an HCV infected individual or can be synthesized in the laboratory, for example, using an automatic synthesizer.
  • An amplification method such as PCR can be used to amplify polynucleotides from either HCV genomic DNA or cDNA encoding therefor.
  • Polynucleotides can comprise coding sequences for these polypeptides which occur naturally or can include artificial sequences which do not occur in nature. For example, it may be useful to provide an methionine start codon and leader sequence for the El E2 protein, since this protein is part of a larger fusion protein. These polynucleotides can be ligated to form a coding sequence for the E1E2 complexes using standard molecular biology techniques. If desired, polynucleotides can be cloned into an expression vector and transformed into, for example, bacterial, yeast, insect, or mammalian cells so that the fusion proteins of the invention can be expressed in and isolated from a cell culture.
  • the expression constructs of the present invention may be used for nucleic acid immunization, in order to boost and stimulate an immunological response, such as a cellular immune response, using a viral vector that encodes and expresses the HCV E1/E2 proteins.
  • the viral vector is a defective alpahvirus particle that is a chimeric alpahvirus particle.
  • Liposomal preparations for use with the present invention include cationic (positively charged), anionic (negatively charged) and neutral preparations, with cationic liposomes particularly preferred.
  • Cationic liposomes are readily available.
  • N[I -2,3-dioleyIoxy)propyl]-N,N,N-triethylammonium (DOTMA) liposomes are available under the trademark Lipofectin, from GIBCO BRL, Grand Island, NY. (See, also, Feigner et al., Proc. Natl. Acad. Sci. USA (1987) 84:7413- 7416).
  • lipids include transfectace (DDAB/DOPE) and DOTAP/DOPE (Boerhinger).
  • DDAB/DOPE transfectace
  • DOTAP/DOPE DOTAP/DOPE
  • Other cationic liposomes can be prepared from readily available materials using techniques well known in the art. See, e.g., Szoka et al.,
  • DOTAP l,2-bis(oleoyloxy)-3- (trimethylammonio)propane liposomes.
  • the various liposome-nucleic acid complexes are prepared using methods known in the art. See, e.g., Straubinger et al., in METHODS OF IMMUNOLOGY (1983), Vol. 101, pp. 512-527; Szoka et al., Proc. Natl. Acad. ScL USA (1978) 75:4194-4198; Papahadjopoulos et al, Biochim.
  • a number of viral based systems have been developed for gene transfer into mammalian cells.
  • retroviruses provide a convenient platform for gene delivery systems, such as murine sarcoma virus, mouse mammary tumor virus, Moloney murine leukemia virus, and Rous sarcoma virus.
  • a selected gene can be inserted into a vector and packaged in retroviral particles using techniques known in the art.
  • the recombinant virus can then be isolated and delivered to cells of the subject either in vivo or ex vivo.
  • retroviral systems have been described (U.S. Patent No. 5,219,740; Miller and Rosman, BioTechniques (1989) 7:980-990; Miller, A.D., Human Gene Therapy (1990) 1:5-14; Scarpa et al., Virology (1991) 180:849-852; Burns et al, Proc. Natl. Acad. ScL USA (1993) 90:8033-8037; and Boris-Lawrie and Temin, Cur. Opin. Genet. Develop.
  • retroviral gene delivery vehicles of the present invention may be readily constructed from a wide variety of retroviruses, including for example, B, C, and D type retroviruses as well as spumaviruses and Antiviruses such as FIV, HIV, HIV-I, HFV- 2 and SIV (see RNA Tumor Viruses, Second Edition, Cold Spring Harbor Laboratory, 1985).
  • retroviruses may be readily obtained from depositories or collections such as the American Type Culture Collection ("ATCC”; 10801 University Boulevard., Manassas, VA 201 10-2209), or isolated from known sources using commonly available techniques.
  • adenovirus vectors have also been described, such as adenovirus Type 2 and Type 5 vectors. Unlike retroviruses which integrate into the host genome, adenoviruses persist extrachromosomally thus minimizing the risks associated with insertional mutagenesis (Haj-Ahmad and Graham, J. Virol. (1986) 57:267-274; Belt et al, J. Virol (1993) 67:5911-5921; Mittereder et al. Human Gene Therapy (1994) 5:717-729; Seth et al, J. Virol. (1994) 68:933-940; Barr et al. Gene Therapy (1994) 1:51-58; Berkner, K.L. BioTechniques (1988) 6:616-629; and Rich et al., Human Gene Therapy (1993) 4:461-476).
  • Molecular conjugate vectors such as the adenovirus chimeric vectors described in Michael et al, J. Biol Chem. (1993) 268:6866-6869 and Wagner et al., Proc. Natl. Acad. Sci. USA (1992) 89:6099-6103, can also be used for gene delivery.
  • Members of the Alphavirus genus such as but not limited to vectors derived from the Venezuelan Equine Encephalitis virus (VEE), Sindbis virus (SIN) and Semliki Forest viruses, will also find use as viral vectors for delivering the gene of interest.
  • VEE Venezuelan Equine Encephalitis virus
  • Sindbis virus Sindbis virus
  • Semliki Forest viruses will also find use as viral vectors for delivering the gene of interest.
  • Several members of the alphavirus genus have been developed as "replicon" expression vectors for use as vaccines and therapeutics.
  • Replicon vectors may be utilized in several formats, including DNA and RNA, to make recombinant virus-like particles containing the replicon vectors (replicon particles).
  • replicon vectors can be derived from any of the above-described alphaviruses, such as SIN (Xiong et al. (1989) Science 243:1188-1191; Dubensky et al., (1996) J. Virol. 70:508-519; Hariharan et al. (1998) J. Virol. 72:950-958; Polo et al. (1999) PNAS 95:4598-4603), Semliki Forest virus (Liljestrom (1991) Bio/Technology P: 1356-1361; Berglund et al.
  • RNA vectors of this configuration are termed RNA "replicons” and may be transcribed in vitro from cDNA using a bacteriophage promoter, or, generated in vivo directly from DNA when linked to a eukaryotic promoter.
  • Alphavirus replicon RNA is generally packaged into recombinant vector particles by transient co-transfection with in vitro transcribed defective helper RNA, or, using stable packaging cell lines having structural protein expression cassettes.
  • the structural protein expression cassette(s) also called “defective helper” constructs when they are incapable of replication on their own, used for vector packaging encode either the intact "native" alphavirus structural polyprotein that is post-translationally processed into mature C,
  • a chimeric alphavirus vector such as replicon particle chimeras of SIN and VEE.
  • Chimeric alphavirus vectors are described, for example, in U.S. Patent Publications 20030232324 and 20030148262, incorporated herein by reference in its entirety, and Perri et al., J. Virol (2003) 77:10394-10403.
  • particles with VEE-E1E2 replicon RNA packaged within SIN envelope glycoproteins or SIN-E1E2 replicon RNA within VEE envelope glycoproteins will find use with the present methods.
  • VEE/SIN replicon particles induced HCV-specific CD8+ T cell responses in murine models when administered after priming with E1E2 protein vaccines.
  • Other vectors can be used, including but not limited to simian virus 40 and cytomegalovirus.
  • Bacterial vectors such as Salmonella ssp. Yersinia enterocolitica, Shigella spp., Vibrio cholerae, Mycobacterium strain BCG, and Listeria monocytogenes can be used.
  • Minichromosomes such as MC and MCl, bacteriophages, cosmids (plasmids into which phage lambda cos sites have been inserted) and replicons (genetic elements that are capable of replication under their own control in a cell) can also be used.
  • the expression constructs may also be encapsulated, adsorbed to, or associated with, particulate carriers.
  • particulate carriers present multiple copies of a selected molecule to the immune system and promote trapping and retention of molecules in local lymph nodes.
  • the particles can be phagocytosed by macrophages and can enhance antigen presentation through cytokine release.
  • particulate carriers include those derived from polymethyl methacrylate polymers, as well as microparticles derived from poly(lactides) and poly(lactide-co-glycolides), known as PLG. See, e.g., Jeffery et al., Pharm. Res. (1993) 10:362-368; and McGee et al., J. Microencap. (1996).
  • microparticles are rehydrated and dispersed to an essentially monomeric suspension of microparticles using dialyzable anionic or cationic detergents.
  • Useful detergents include, but are not limited to, any of the various N-methylglucamides (known as MEGAs), such as heptanoyl-N-methylglucamide (MEGA-7), octanoyl-N-methylglucamide (MEGA -8), nonanoyl-N-methylglucamide (MEGA-9), and decanoyl-N-methyl-glucamide (MEGA-IO); cholic acid; sodium cholate; deoxycholic acid; sodium deoxycholate; taurocholic acid; sodium taurocholate; taurodeoxycholic acid; sodium taurodeoxycholate; 3-[(3-cholamidopropyl)dimethylammonio] -1 -propane-sulfonate (CHAPS); 3-[(3-cholamidopropyl) dimethylammonio]-2-hydroxy-l -propane- sulfonate (CHAPSO); -dodecyl-N s N-dimethyl-S
  • the above detergents are commercially available from e.g., Sigma Chemical Co., St. Louis, MO.
  • Various cationic lipids known in the art can also be used as detergents. See Balasubramaniam et al., 1996, Gene Ther , 3: 163- 72 and Gao, X., and L. Huang. 1995, Gene Ther., 2:7110-722.
  • a wide variety of other methods can be used to deliver the expression constructs to cells. Such methods include DEAE dextran-mediated transfection, calcium phosphate precipitation, polylysine- or polyornithine-mediated transfection, or precipitation using other insoluble inorganic salts, such as strontium phosphate, aluminum silicates including bentonite and kaolin, chromic oxide, magnesium silicate, talc, and the like.
  • Other useful methods of transfection include electroporation, sonoporation, protoplast fusion, liposomes, peptoid delivery, or microinjection.
  • the HCV polynucleotides can be adsorbed to, or entrapped within, an ISCOM.
  • Classic ISCOMs are formed by combination of cholesterol, saponin, phospholipid, and immunogens, such as viral envelope proteins.
  • the HCV molecules (usually with a hydrophobic region) are solubilized in detergent and added to the reaction mixture, whereby ISCOMs are formed with the HCV molecule incorporated therein.
  • ISCOMS are also referred to herein as IMX.
  • ISCOM matrix compositions are formed identically, but without viral proteins. Proteins with high positive charge may be electrostatically bound in the ISCOM particles, rather than through hydrophobic forces.
  • biolistic delivery systems employing particulate carriers such as gold and tungsten, are especially useful for delivering the expression constructs of the present invention.
  • the particles are coated with the construct to be delivered and accelerated to high velocity, generally under a reduced atmosphere, using a gun powder discharge from a "gene gun.”
  • a gun powder discharge from a "gene gun” For a description of such techniques, and apparatuses useful therefore, see, e.g., U.S. Patent Nos. 4,945,050; 5,036,006; 5,100,792; 5,179,022; 5,371,015; and 5,478,744.
  • compositions comprising HCV immunogens or DNA encoding such immunogens.
  • Such compositions can be delivered prior to, subsequent to, or concurrent with the E1E2 complex compositions, as well as prior to, subsequent to, or concurrent with E1E2 nucleic acid compositions for boosting the immune response.
  • the methods of the present invention may also employ other HCV proteins in place of the E1/E2 as antigen for priming and boosting the immune response to HCV.
  • the invention may employ non-structural (NS) proteins from HCV fused to one or more structural proteins of HCV such as El, E2 and or core protean.
  • NS non-structural
  • the invention provides a priming protein composition comprising an HCV fusion protein consisting essentially of an E2
  • the genome of the hepatitis C virus typically contains a single open reading frame of approximately 9,600 nucleotides, which is transcribed into a polyprotein.
  • the full-length sequence of the polyprotein is disclosed in European Publication No. 388,232 and U.S. Patent No. 6,150,087.
  • An HCV polyprotein upon cleavage, produces at least ten distinct products, in the order of NH2_Core-El-E2-p7-NS2-NS3-NS4a-NS4b-NS5a-NS5b-COOH.
  • the core polypeptide occurs at positions 1-191, numbered relative to HCV-I (see, Choo et al. (1991) Proc. Natl Acad. Sci.
  • HCV-I USA 88:2451-2455, for the HCV-I genome).
  • This polypeptide is further processed to produce an HCV polypeptide with approximately amino acids 1-173.
  • the envelope polypeptides, El and E2 occur at about positions 192-383 and 384-746, respectively.
  • the P7 domain is found at about positions 747-809.
  • NS2 is an integral membrane protein with proteolytic activity and is found at about positions 810-1026 of the polyprotein.
  • NS2 either alone or in combination with NS3 (found at about positions 1027-1657), cleaves the NS2-NS3 sissle bond which in turn generates the NS3 N-terminus and releases a large polyprotein that includes both serine protease and RNA helicase activities.
  • the NS3 protease found at about positions 1027-1207, serves to process the remaining polyprotein.
  • the helicase activity is found at about positions 1193-1657.
  • Completion of polyprotein maturation is initiated by autocatalytic cleavage at the NS3-NS4a junction, catalyzed by the NS3 serine protease.
  • Subsequent NS3-mediated cleavages of the HCV polyprotein appear to involve recognition of polyprotein cleavage junctions by an NS3 molecule of another polypeptide.
  • NS3 liberates an NS3 cofactor (NS4a, found about positions 1658-1711), two proteins (NS4b found at about positions 1712-1972, and NS5a found at about positions 1973-2420), and an RNA-dependent RNA polymerase (NS5b found at about positions 2421-3011).
  • HCV polypeptides derived from the Core region such as polypeptides derived from the region found between amino acids 1-191; amino acids 10-53; amino acids 10-45; amino acids 67-88; amino acids 86-100; 81-130; amino acids 121-135; amino acids 120-130; amino acids 121-170; and any of the Core epitopes identified in, e.g., Houghton et al., U.S. Patent No. 5,350,671; Chien et al. Proc. Natl. Acad. Sci. USA (1992) 89:10011-10015; Chien et al. J. Gastroent. Hepatol.
  • polypeptides derived from the nonstructural regions of the virus will also find use herein.
  • the NS3/4a region of the HCV polyprotein has been described and the amino acid sequence and overall structure of the protein are disclosed in Yao et al. Structure (November 1999) 7:1353-1363. See, also, Dasmahapatra et al., U.S. Patent No. 5,843,752.
  • either the native sequence or immunogenic analogs can be used in the subject formulations.
  • polypeptides for use in the subject compositions and methods may be derived from the NS3 region of the HCV polyprotein.
  • a number of such polypeptides are known, including, but not limited to polypeptides derived from the c33c and clOO regions, as well as fusion proteins comprising an NS3 epitope, such as c25.
  • These and other NS3 polypeptides are useful in the present methods and are known in the art and described in, e.g., Houghton et al, U.S. Patent No. 5,350,671; Chien et al. Proc. Natl. Acad. Sci. USA (1992) 89:10011-10015; Chien et al. J. Gastroent.
  • MEFAs multiple epitope fusion antigens
  • Such MEFAs include multiple epitopes derived from two or more of the various viral regions.
  • the epitopes are preferably from more than one HCV strain, thus providing the added ability to protect against multiple strains of HCV in a single vaccine.
  • HCV polypeptides and polynucleotides for use with the present invention are not limited to those derived from the HCV-Ia sequence and any strain or isolate of HCV can serve as the basis for providing antigenic sequences for use with the invention, as explained in detail above.
  • polypeptides and polypeptides can be obtained using the methods of recombinant production described above for E1E2 polypeptides and polynucleotides.
  • the E1E2 polynucleotides, complexes or other immunogens may be provided in immunogenic compositions, in e.g., prophylactic (i.e., to prevent infection) or therapeutic (to treat HCV following infection) vaccine compositions.
  • compositions will generally include one or more "pharmaceutically acceptable excipients or vehicles" such as water, saline, glycerol, ethanol, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
  • pharmaceutically acceptable excipients or vehicles such as water, saline, glycerol, ethanol, etc.
  • auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
  • a carrier is optionally present, e.g., in protein compositions used to prime the immune response to E1E2.
  • Carriers are molecules that do not themselves induce the production of antibodies harmful to the individual receiving the composition.
  • Suitable carriers are typically large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycollic acids, polymeric amino acids, amino acid copolymers, lipid aggregates (such as oil droplets or liposomes), and inactive virus particles.
  • Such carriers are well known to those of ordinary skill in the art.
  • the immunogenic polypeptide may be conjugated to a bacterial toxoid, such as toxoid from diphtheria, tetanus, cholera, etc.
  • Adjuvants may also be present in the compositions to enhance the immune response.
  • Adjuvants for use with the invention include, but are not limited to, one or more of the following set forth below: A. Mineral Containing Compositions
  • Mineral containing compositions suitable for use as adjuvants in the invention include mineral salts, such as aluminum salts and calcium salts.
  • the invention includes mineral salts such as hydroxides (e.g. oxyhydroxides), phosphates (e.g. hydroxyphosphates, orthophosphates), sulfates, etc. (e.g. see chapters 8 & 9 of Vaccine Design... (1995) eds. Powell & Newman. ISBN: 030644867X. Plenum.), or mixtures of different mineral compounds (e.g. a mixture of a phosphate and a hydroxide adjuvant, optionally with an excess of the phosphate), with the compounds taking any suitable form (e.g. gel, crystalline, amorphous, etc.), and with adsorption to the salt(s) being preferred.
  • the mineral containing compositions may also be formulated as a particle of metal salt (WO00/23105).
  • Aluminum salts may be included in vaccines of the invention such that the dose ofAl 3+ is between 0.2 and 1.0 mg per dose.
  • the aluminum based adjuvant for use in the present invention is alum (aluminum potassium sulfate (A1K(SO 4 )2)), or an alum derivative, such as that formed in-situ by mixing an antigen in phosphate buffer with alum, followed by titration and precipitation with a base such as ammonium hydroxide or sodium hydroxide.
  • Aluminum-based adjuvant for use in vaccine formulations of the present invention is aluminum hydroxide adjuvant (Al(OHTb) or crystalline aluminum oxyhydroxide (AlOOH), which is an excellent adsorbant, having a surface area of • approximately 500m 2 /g.
  • Al(OHTb) or crystalline aluminum oxyhydroxide (AlOOH) which is an excellent adsorbant, having a surface area of • approximately 500m 2 /g.
  • aluminum phosphate adjuvant AIPO 4
  • aluminum hydroxyphosphate which contains phosphate groups in place of some or all of the hydroxyl groups of aluminum hydroxide adjuvant is provided.
  • Preferred aluminum phosphate adjuvants provided herein are amorphous and soluble in acidic, basic and neutral media.
  • the adjuvant of the invention comprises both aluminum phosphate and aluminum hydroxide.
  • the adjuvant has a greater amount of aluminum phosphate than aluminum hydroxide, such as a ratio of 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1 or greater than 9:1, by weight aluminum phosphate to aluminum hydroxide.
  • aluminum salts in the vaccine are present at 0.4 to 1.0 mg per vaccine dose, or 0.4 to 0.8 mg per vaccine dose, or 0.5 to 0.7 mg per vaccine dose, or about 0.6 mg per vaccine dose.
  • the preferred aluminum-based adjuvant(s), or ratio of multiple aluminum-based adjuvants, such as aluminum phosphate to aluminum hydroxide is selected by optimization of electrostatic attraction between molecules such that the antigen carries an opposite charge as the adjuvant at the desired pH.
  • adsorbs lysozyme but not albumin at pH 7.4.
  • albumin be the target
  • aluminum hydroxide adjuvant would be selected (iep 11.4).
  • pretreatment of aluminum hydroxide with phosphate lowers its isoelectric point, making it a preferred adjuvant for more basic antigens.
  • Oil-emulsion compositions suitable for use as adjuvants in the invention include squalene-water emulsions, such as MF59 (5% Squalene, 0.5% Tween 80, and 0.5% Span 85, formulated into submicron particles using a microfluidizer). See WO90/14837; and U.S. Patent Nos. 6,299,884 and 6,451,325, incorporated herein by reference in their entireties.
  • Particularly preferred adjuvants for use in the compositions are submicron oil- in-water emulsions.
  • Preferred submicron oil-in-water emulsions for use herein are squalene/water emulsions optionally containing varying amounts of MTP-PE, such as a submicron oil-in-water emulsion containing 4-5% w/v squalene, 0.25-1.0% w/v Tween 80TM (polyoxyelthylenesorbitan monooleate), and/or 0.25-1.0% Span 85TM (sorbitan trioleate), and, optionally, N-acetylmuramyl-L-alanyl-D-isogluatminyl-L- alanine-2-(r-2'-dipalmitoyl- ⁇ «-glycero-3-huydroxyphosphophoryloxy)-ethylamine (MTP-PE), for example, the submicron oil-in-water e
  • MF59 contains 4-5% w/v Squalene (e.g.4.3%), 0.25-0.5% w/v Tween 80TM, and 0.5% w/v Span 85TM and optionally contains various amounts of MTP-PE, formulated into submicron particles using a microfluidizer such as Model HOY microfluidizer (Microfluidics, Newton, MA).
  • MTP-PE may be present in an amount of about 0-500 ⁇ g/dose, more preferably 0-250 ⁇ g/dose and most preferably, 0-100 ⁇ g/dose.
  • MF59-0 refers to the above submicron oil-in-water emulsion lacking MTP-PE
  • MF59-MTP denotes a formulation that contains MTP-PE.
  • MF59-100 contains 100 ⁇ g MTP-PE per dose, and so on.
  • MF69 another submicron oil-in-water emulsion for use herein, contains 4.3% w/v squalene. 0.25% w/v Tween 80TM, and 0.75% w/v Span 85TM and optionally MTP-PE.
  • MF75 also known as SAF, containing 10% squalene, 0.4% Tween 80TM, 5% pluronic- blocked polymer L121, and thr-MDP, also microfluidized into a submicron emulsion.
  • MF75-MTP denotes an MF75 formulation that includes MTP, such as from 100-400 ⁇ g MTP-PE per dose.
  • CFA Complete Freund's adjuvant
  • IFA incomplete Freund's adjuvant
  • Saponin Formulations Saponin formulations, may also be used as adjuvants in the invention.
  • Saponins are a heterologous group of sterol glycosides and triterpenoid glycosides that are found in the bark, leaves, stems, roots and even flowers of a wide range of plant species. Saponins isolated from the bark of the Quil ⁇ aia saponaria Molina tree have been widely studied as adjuvants. Saponins can also be commercially obtained from Smilax ornata (sarsaprilla), Gypsophilla paniculata (brides veil), and Saponaria officianalis (soap root). Saponin adjuvant formulations include purified formulations, such as QS21, as well as lipid formulations, such as ISCOMs.
  • Saponin compositions have been purified using High Performance Thin Layer Chromatography (HP-TLC) and Reversed Phase High Performance Liquid Chromatography (RP-HPLC). Specific purified fractions using these techniques have been identified, including QS7, QS 17, QS 18, QS21, QH-A, QH-B and QH-C.
  • the saponin is QS21.
  • a method of production of QS21 is disclosed in US Patent No. 5,057,540.
  • Saponin formulations may also comprise a sterol, such as cholesterol (see WO96/33739). Combinations of saponins and cholesterols can be used to form unique particles called Immunostimulating Complexes (ISCOMs).
  • ISCOMs Immunostimulating Complexes
  • ISCOMs typically also include a phospholipid such as phosphatidylethanolamine or phosphatidylcholine. Any known saponin can be used in ISCOMs.
  • the ISCOM includes one or more of Quil A, QHA and QHC.
  • ISCOMs are further described in EP0109942, WO96/11711 and WO96/33739.
  • the ISCOMS may be devoid of (an) additional detergent(s). See WO00/07621.
  • VLPs Virosomes and Virus Like Particles
  • VLPs can also be used as adjuvants in the invention.
  • These structures generally contain one or more proteins from a virus optionally combined or formulated with a phospholipid. They are generally nonpathogenic, non-replicating and generally do not contain any of the native viral genome. The viral proteins may be recombinantly produced or isolated from whole viruses.
  • viral proteins suitable for use in virosomes or VLPs include proteins derived from influenza virus (such as HA or NA), Hepatitis B virus (such as core or capsid proteins), Hepatitis E virus, measles virus, Sindbis virus, Rotavirus, Foot-and- Mouth Disease virus, Retrovirus, Norwalk virus, human Papilloma virus, HIV, RNA- phages, Q ⁇ -phage (such as coat proteins), GA-phage, fr-phage, AP205 phage, and Ty (such as retrotransposon Ty protein pi).
  • influenza virus such as HA or NA
  • Hepatitis B virus such as core or capsid proteins
  • Hepatitis E virus measles virus
  • Sindbis virus Rotavirus
  • Foot-and- Mouth Disease virus Retrovirus
  • Norwalk virus Norwalk virus
  • human Papilloma virus HIV
  • RNA- phages Q ⁇ -phage (such as coat proteins)
  • GA-phage such as fr-phage,
  • VLPs are discussed further in WO03/024480, WO03/024481, and Niikura et al., "Chimeric Recombinant Hepatitis E Virus-Like Particles as an Oral Vaccine Vehicle Presenting Foreign Epitopes", Virology (2002) 293:273-280; Lenz et al., “Papillomarivurs-Like Particles Induce Acute Activation of Dendritic Cells", Journal of Immunology (2001) 5246-5355; Pinto, et al., “Cellular Immune Responses to Human Papillomavirus (HPV)-16 Ll Healthy Volunteers Immunized with Recombinant HPV- 16 Ll Virus-Like Particles", Journal of Infectious Diseases (2003) 188:327-338; and Gerber et al., "Human Papillomavrisu Virus-Like Particles Are Efficient Oral Immunogens when Coadministered
  • Virosomes are discussed further in, for example, Gluck et al., "New Technology Platforms in the Development of Vaccines for the Future", Vaccine (2002) 20:B 10 — B 16.
  • Immunopotentiating reconstituted influenza virosomes are used as the subunit antigen delivery system in the intranasal trivalent INFLEXALTM product ⁇ Mischler & Metcalfe (2002) Vaccine 20 Suppl 5 :B 17-23 ⁇ and the INFLUVAC PLUSTM product.
  • Adjuvants suitable for use in the invention include bacterial or microbial derivatives such as:
  • Such derivatives include Monophosphoryl lipid A (MPL) and 3-O-deacylated MPL (3dMPL).
  • 3dMPL is a mixture of 3 De-O-acylated monophosphoryl lipid A with 4, 5 or 6 acylated chains.
  • a preferred "small particle" form of 3 De-O-acylated monophosphoryl lipid A is disclosed in EP 0689454.
  • Such "small particles" of 3dMPL are small enough to be sterile filtered through a 0.22 micron membrane (see EP 0 689 454).
  • Other non-toxic LPS derivatives include monophosphoryl lipid A mimics, such as aminoalkyl glucosaminide phosphate derivatives e.g. RC-529. See Johnson et al. (1999) Bioorg Med Chem Lett 9:2273-2278.
  • Lipid A derivatives include derivatives of lipid A from Escherichia coli such as OM- 174.
  • OM- 174 is described for example in Meraldi et al., "OM- 174, a New Adjuvant with a Potential for Human Use, Induces a Protective Response with Administered with the Synthetic C-Term ⁇ nal Fragment 242-310 from the circumsporozoite protein of Plasmodium berghei", Vaccine (2003) 2J . :2485-2491 ; and Pajak, et al., "The Adjuvant OM-174 induces both the migration and maturation of murine dendritic cells in vivo", Vaccine (2003) 21:836-842.
  • Immunostimulatory oligonucleotides suitable for use as adjuvants in the invention include nucleotide sequences containing a CpG motif (a sequence containing an unmethylated cytosine followed by guanosine and linked by a phosphate bond). Bacterial double stranded RNA or oligonucleotides containing palindromic or poly(dG) sequences have also been shown to be immunostimulatory.
  • the CpG's can include nucleotide modifications/analogs such as phosphorothioate modifications and can be double-stranded or single-stranded.
  • the guanosine may be replaced with an analog such as 2'-deoxy-7- deazaguanosine. See Kandimalla, et al., "Divergent synthetic nucleotide motif recognition pattern: design and development of potent immunomodulatory oligodeoxyribonucleotide agents with distinct cytokine induction profiles", Nucleic Acids Research (2003) 31.(9): 2393-2400; WO02/26757 and WO99/62923 for examples of possible analog substitutions.
  • CpG oligonucleotides The adjuvant effect of CpG oligonucleotides is further discussed in Krieg, "CpG motifs: the active ingredient in bacterial extracts?", Nature Medicine (2003) 9(7): 831-835; McCluskie, et al., "Parenteral and mucosal prime-boost immunization strategies in mice with hepatitis B surface antigen and CpG DNA", FEMS Immunology and Medical Microbiology
  • the CpG sequence may be directed to TLR9, such as the motif GTCGTT or TTCGTT. See Kandimalla, et al., "Toll-like receptor 9: modulation of recognition and cytokine induction by novel synthetic CpG DNAs", Biochemical Society Transactions
  • the CpG sequence may be specific for inducing a ThI immune response, such as a CpG-A ODN, or it may be more specific for inducing a B cell response, such a CpG-B ODN.
  • CpG-A and CpG-B ODNs are discussed in Blackwell, et al., "CpG-A-Induced Monocyte IFN-gamma-Inducible Protein-lO Production is Regulated by Plasmacytoid Dendritic Cell Derived IFN-alpha", J. Immunol.
  • the CpG is a CpG-A ODN.
  • the CpG oligonucleotide is constructed so that the 5' end is accessible for receptor recognition.
  • two CpG oligonucleotide sequences may be attached at their 3' ends to form "immunomers".
  • Kandimalla "Secondary structures in CpG oligonucleotides affect immunostimulatory activity" BBRC (2003) 306:948-953; Kandimalla, et al., "ToIl- like receptor 9: modulation of recognition and cytokine induction by novel synthetic GpG DNAs", Biochemical Society Transactions (2003) 3_L(part 3):664-658; Bhagat et al., "CpG penta- and hexadeoxyribonucleotides as potent immunomodulatory agents” BBRC (2003) 300:853-861 and WO03/035836.
  • ADP-ribosylating toxins and detoxified derivatives thereof Bacterial ADP-ribosylating toxins and detoxified derivatives thereof may be used as adjuvants in the invention.
  • the protein is derived from E. coli (i.e., E. coli heat labile enterotoxin "LT), cholera ("CT”), or pertussis ("PT").
  • E. coli heat labile enterotoxin
  • CT cholera
  • PT pertussis
  • the use of detoxified ADP-ribosylating toxins as mucosal adjuvants is described in WO95/17211 and as parenteral adjuvants in WO98/42375.
  • the adjuvant is a detoxified LT mutant such as LT-K63, LT-R72, and LTRl 92G.
  • ADP-ribosylating toxins and detoxified derivatives thereof, particularly LT-K63 and LT-R72, as adjuvants can be found in the following references: Beignon, et al., "The LTR72 Mutant of Heat-Labile Enterotoxin of Escherichia coli Enhances the Ability of Peptide Antigens to Elicit CD4+ T Cells and Secrete Gamma Interferon after Co application onto Bare Skin", Infection and Immunity (2002) 70(6):3012-3019; Pizza, et al., "Mucosal vaccines: non toxic derivatives of LT and CT as mucosal adjuvants", Vaccine (2001) 19:2534-2541; Pizza, et al., "LTK63 and LTR72, two mucosal adjuvants ready for clinical trials" Int.
  • Numerical reference for amino acid substitutions is preferably based on the alignments of the A and B subunits of ADP-ribosylating toxins set forth in Domenighini et al., MoI. Microbiol (1995) .15(6): 1165-1167.
  • Bioadhesives and mucoadhesives may also be used as adjuvants in the invention.
  • Suitable bioadhesives include esterified hyaluronic acid microspheres (Singh et al. (2001) J. Cont. ReIe. 70:267-276) or mucoadhesives such as cross-linked derivatives of polyacrylic acid, polyvinyl alcohol, polyvinyl pyrollidone, polysaccharides and carboxymethylcellulose. Chitosan and derivatives thereof may also be used as adjuvants in the invention. E.g. WO99/27960.
  • Microparticles Microparticles
  • Microparticles may also be used as adjuvants in the invention.
  • Microparticles i.e. a particle of ⁇ 1 OOnm to ⁇ 150 ⁇ m in diameter, more preferably ⁇ 200nm to ⁇ 30 ⁇ m in diameter, and most preferably ⁇ 500nm to ⁇ 10 ⁇ m in diameter
  • materials that are biodegradable and non-toxic e.g. a poly( ⁇ -hydroxy acid), a polyhydroxybutyric acid, a polyorthoester, a polyanhydride, a polycaprolactone, etc.
  • a negatively- charged surface e.g. with SDS
  • a positively-charged surface e.g. with a cationic detergent, such as CTAB
  • liposome formulations suitable for use as adjuvants are described in US Patent No. 6,090,406, US Patent No. 5,916,588, and EP 0 626 169.
  • Adjuvants suitable for use in the invention include polyoxyethylene ethers and polyoxyethylene esters. WO99/52549. Such formulations further include polyoxyethylene sorbitan ester surfactants in combination with an octoxynol (WOO 1/21207) as well as polyoxyethylene alkyl ethers or ester surfactants in combination with at least one additional non-ionic surfactant such as an octoxynol (WO01/21152).
  • Preferred polyoxyethylene ethers are selected from the following group: polyoxyethylene-9-lauryl ether (laureth 9), polyoxyethylene-9-steoryl ether, poIyoxytheylene-8-steoryl ether, polyoxyethylene-4-lauryl ether, polyoxyethylene-35- lauryl ether, and polyoxyethylene-23-lauryI ether.
  • PCPP Polyphosphazene
  • muramyl peptides suitable for use as adjuvants in the invention include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl- normuramyl-1-alanyl-d-isoglutamine (nor-MDP), and N-acetylmuramyl-1-alanyl-d- isoglutaminyl-l-alanine-2-(r-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)- ethylamine MTP-PE).
  • thr-MDP N-acetyl-muramyl-L-threonyl-D-isoglutamine
  • nor-MDP N-acetyl- normuramyl-1-alanyl-d-isoglutamine
  • N-acetylmuramyl-1-alanyl-d- isoglutaminyl-l-
  • imidazoquinoline compounds suitable for use adjuvants in the invention include Imiquimod and its analogues, described further in Stanley, “Imiquimod and the imidazoquinolines: mechanism of action and therapeutic potential” Clin Exp Dermatol (2002) 27(7):571-577; Jones, “Resiquimod 3M", Curr Opin Investig Drugs (2003) 4(2):214-218; and U.S. Patent Nos. 4,689,338, 5,389,640, 5,268,376, 4,929,624, 5,266,575, 5,352,784, 5,494,916, 5,482,936, 5,346,905, 5,395,937, 5,238,944, and 5,525,612.
  • thiosemicarbazone compounds as well as methods of formulating, manufacturing, and screening for compounds all suitable for use as adjuvants in the invention include those described in WO04/60308.
  • the thiosemicarbazones are particularly effective in the stimulation of human peripheral blood mononuclear cells for the production of cytokines, such as TNF- ⁇ .
  • tryptanthrin compounds as well as methods of formulating, manufacturing, and screening for compounds all suitable for use as adjuvants in the invention include those described in WO04/64759.
  • the tryptanthrin compounds are particularly effective in the stimulation of human peripheral blood mononuclear cells for the production of cytokines, such as T ⁇ F- ⁇ .
  • the invention may also comprise combinations of aspects of one or more of the adjuvants identified above.
  • adjuvant compositions may be used in the invention:
  • RibiTM adjuvant system (RAS), (Ribi Immunochem) containing 2% Squalene, 0.2% Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL + CWS (DetoxTM); and (8) one or more mineral salts (such as an aluminum salt) + a non-toxic derivative of LPS (such as 3dPML).
  • RAS RibiTM adjuvant system
  • Ribi Immunochem containing 2% Squalene, 0.2% Tween 80
  • MPL monophosphorylipid A
  • TDM trehalose dimycolate
  • CWS cell wall skeleton
  • LPS such as 3dPML
  • one or more mineral salts such as an aluminum salt
  • an immunostimulatory oligonucleotide such as a nucleotide sequence including a CpG motif.
  • Human immunomodulators suitable for use as adjuvants in the invention include cytokines, such as interleukins (e.g. IL-I, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (e.g. interferon- ⁇ ), macrophage colony stimulating factor, and tumor necrosis factor.
  • cytokines such as interleukins (e.g. IL-I, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (e.g. interferon- ⁇ ), macrophage colony stimulating factor, and tumor necrosis factor.
  • Aluminum salts and MF59 are preferred adjuvants for use with injectable influenza vaccines.
  • Bacterial toxins and bioadhesives are preferred adjuvants for use with mucosally-delivered vaccines, such as nasal vaccines.
  • compositions for use in the invention will comprise a therapeutically effective amount of DNA encoding the E1E2 complexes (or a therapeutically effective amount of protein) and any other of the above-mentioned components, as needed.
  • therapeutically effective amount is meant an amount of an protein or DNA encoding the same which will induce an immunological response, preferably a protective immunological response, in the individual to which it is administered. Such a response will generally result in the development in the subject of an antibody- mediated and/or a secretory or cellular immune response to the composition.
  • such a response includes but is not limited to one or more of the following effects; the production of antibodies from any of the immunological classes, such as immunoglobulins A, D, E, G or M; the proliferation of B and T lymphocytes; the provision of activation, growth and differentiation signals to immunological cells; expansion of helper T cell, suppressor T cell, and/or cytotoxic T cell and/or ⁇ T cell populations.
  • immunological classes such as immunoglobulins A, D, E, G or M
  • B and T lymphocytes the proliferation of B and T lymphocytes
  • the provision of activation, growth and differentiation signals to immunological cells expansion of helper T cell, suppressor T cell, and/or cytotoxic T cell and/or ⁇ T cell populations.
  • E1E2 protein compositions can comprise mixtures of one or more of the E1E2 complexes, such as E1E2 complexes derived from more than one viral isolate, as well as additional HCV antigens. Moreover, as explained above, the El E2 complexes may be present as a heterogeneous mixture of molecules, due to clipping and proteolytic cleavage.
  • a composition including El E2 complexes may include multiple species of E1E2, such as E1E2 terminating at amino acid 746 (EIE2746), E1E2 terminating at amino acid 809 (ElE2go9), or any of the other various El and E2 molecules described above, such as E2 molecules with N-terminal truncations of from 1-20 amino acids, such as E2 species beginning at amino acid 387, amino acid 402, amino acid 403, etc.
  • compositions may be administered in conjunction with other antigens and immunoregulatory agents, such - as immunoglobulins, cytokines, lymphokines, and chemokines, including but not limited to cytokines such as IL-I, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 etc.
  • immunoglobulins such as immunoglobulins, cytokines, lymphokines, and chemokines, including but not limited to cytokines such as IL-I, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 etc.
  • cytokines such as IL-I, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 etc.
  • WO 99/44636 modified IL-2 (cysl25-serl25), GM- CSF, M-CSF, tumor necrosis factor (TNF), interferons and pegylated interferons, such as ⁇ -interferon, IP-10, MlPl ⁇ , FLP-3, ribavirin, RANTES, SiRNA, antisense RNA, inhibitors of polymerase, helicase, GTPase, ATPase, protease, glycosylation, metalloprotease, and/or IRES.
  • the present methods can be used with other therapeutic regimens for treating HCV infection. If used in combination with other compositions, such compositions can be administered prior to, concurrent with, or subsequent to the E1E2 compositions.
  • HCV-Specific T cells can be used prior to, concurrent with, or subsequent to the E1E2 compositions.
  • HC V-specific T cells that are activated by the above-described E 1 E2 complexes expressed in vivo or in vitro, preferably recognize an epitope of an HCV polypeptide such as an El and/or E2 polypeptide, or an E1E2 complex.
  • HC V-specific T cells can be CD8 + or CD4 + .
  • HCV-specific CD8 + T cells preferably are cytotoxic T lymphocytes (CTL) which can kill HCV-infected cells that display El and/or E2 epitopes complexed with an MHC class I molecule.
  • CTL cytotoxic T lymphocytes
  • HCV-specific CD8 + T cells may also express interferon- ⁇ (IFN- ⁇ ).
  • IFN- ⁇ interferon- ⁇
  • HCV-specific CD8 + T cells can be detected by, for example, 51 Cr release assays (see the examples). 51 Cr release assays measure the ability of HCV-specific CD8 + T cells to lyse target cells displaying an El, E2 or El E2 epitope.
  • HCV-specific CD8 + T cells which express IFN- ⁇ can also be detected by immunological methods, preferably by intracellular staining for IFN- ⁇ after in vitro stimulation with an El, E2 or E1E2 polypeptide (see the examples).
  • HCV-specific CD4 + T cells can be detected by a lymphoproliferation assay
  • Lymphoproliferation assays measure the ability of HCV-specific CD4 + T cells to proliferate in response to an El, E2 and/or E1E2 epitope.
  • the E1E2 proteins or polynucleotides can be used to stimulate an immune response, such as to activate HCV-specific T cells either in vitro or in vivo.
  • Activation of HCV-specific T cells can be used, inter alia, to provide model systems to optimize CTL responses to HCV and to provide prophylactic or therapeutic treatment against HCV infection.
  • proteins are preferably supplied to T cells via a plasmid or a viral vector, such as an alphavirus vector, as described above.
  • Polyclonal populations of T cells can be derived from the blood, and preferably from peripheral lymphoid organs, such as lymph nodes, spleen, or thymus, of mammals that have been infected with an HCV. Preferred mammals include mice, chimpanzees, baboons, and humans.
  • the HCV serves to expand the number of activated HCV-specif ⁇ c T cells in the mammal.
  • the HCV-specific T cells derived from the mammal can then be restimulated in vitro by adding, e.g., HCV E1E2, to the T cells.
  • the HCV-specific T cells can then be tested for, inter alia, proliferation, the production of lFN- ⁇ , and the ability to lyse target cells displaying E1E2 epitopes in vitro.
  • HCV-activated CD4 + T cells proliferate when cultured with an E1E2 epitopic peptide, but not in the absence of an epitopic peptide.
  • particular El and E2 epitopes or other HCV antigens that are recognized by HCV-specific CD4 + T cells can be identified using a lymphoproliferation assay.
  • detection of IFN- ⁇ in HCV-specific CD8 + T cells after in vitro stimulation with the above-described HCV proteins can be used to identify El, E2, and E1E2 epitopes or other HCV antigens that are particularly effective at stimulating CD8 + T cells to produce IFN- ⁇ (see examples).
  • HCV-specific CD8 + T cells can be derived from the liver of an HCV infected mammal. These T cells can be tested in 51 Cr release assays against target cells displaying, e.g., E1E2 epitopes. Several target cell populations expressing different E1E2 epitopes can be constructed so that each target cell population displays different epitopes of E1E2. The HCV-specif ⁇ c CD8 + cells can be assayed against each of these target cell populations.
  • the results of the 51 Cr release assays can be used to determine which epitopes of E1E2 are responsible for the strongest CTL response to HCV.
  • E1E2 complexes which contain the epitopes responsible for the strongest CTL response can then be constructed using the information derived from the 51 Cr release assays.
  • the immunogenic compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection may also be prepared.
  • the compositions are conventionally administered parenterally, e.g., by injection, either subcutaneously or intramuscularly. Additional formulations suitable for other modes of administration include oral and pulmonary formulations, suppositories, and transdermal applications.
  • Dosage treatment may be a single prime dosage and a single boost, or may be a multiple dose schedule. The interval between dosages (priming and boosting) will vary according to factors such as the age of the patient and the nature of the composition and these factors can be assessed by a physician.
  • Administration of the first priming and boosting doses is generally separated by at least 2 weeks, typically at least 4 weeks.
  • the methods of the invention may comprise more than one priming dose and/or more than one boosting dose, e.g., two or more priming doses followed by two or more booster doses.
  • the term "memory" boost refers to any boosting dose given after the initial boost.
  • the time at which the "memory" boost is administered can vary from hours (e.g., 1 to 72 hours or any timepoint therebetween) or days (e.g, 1 to 90 days or any timepoint therebetween) to months (e.g., 1 to 36 months or any timepoint therebetween) or even years after the initial boost.
  • More than one memory boost may be administered at the same or varying time intervals with respect to each other. Identical or different immunogenic compositions may be used for each priming dose. Priming and boosting doses may be therefore distinguished by the route of administration, rather than by their timing.
  • the amount administered is sufficient to bring about treatment or prevention of disease symptoms.
  • the exact amount necessary will vary depending on the subject being treated; the age and general condition of the individual to be treated; the capacity of the individual's immune system to engage in an immune response; the degree of protection desired; the severity of the condition being treated; the particular macromolecule selected and its mode of administration, among other factors.
  • An appropriate effective amount can be readily determined by one of skill in the art.
  • a "therapeutically effective amount” will fall in a relatively broad range that can be determined through routine trials using in vitro and in vivo models known in the art.
  • E1E2 nucleic acid and polypeptides used in the examples below provides general guidance which can be used to optimize the elicitation of HCV- specif ⁇ c cellular immune responses, such as to activate HCV-specific T cells in vivo.
  • the immunogen is preferably injected intramuscularly to a large mammal, such as a primate, for example, a baboon, chimpanzee, or human.
  • E1E2 protein For delivery of E1E2 protein, generally about 0.1 ⁇ g to about 5.0 mg of immunogen will be delivered per dose, or any amount between the stated ranges, such as .5 ⁇ g to about 10 mg, 1 ⁇ g to about 2 mg, 2.5 ⁇ g to about 250 ⁇ g, 4 ⁇ g to about 200 ⁇ g, such as 4, 5, 6, 7, 8, 9, 10...20...30...40...50...60...70...80...90...100, etc., ⁇ g per dose.
  • the amount of E1E2 nucleic acid constructs delivered will depend on the vector, if any used.
  • E1E2 DNA is delivered without a viral vector
  • about 1 ⁇ g to 500 mg of DNA such as 5 ⁇ g to 100 mg of DNA , e.g., 10 ⁇ g to 50 mg, or 100 ⁇ g to 5 mg, such as 20...30...40...50...60...100...200 ⁇ g and so on, to 500 ⁇ g DNA, and any integer between the stated ranges, will find use in the subject methods.
  • an effective dose will include on the order of from about 10 s to 1O 20 infectious units of the viral vectors, more preferably 10 8 to 10 15 , and even more preferably about 10 10 to 10 13 infectious units of the viral vectors, or any value within these ranges.
  • E1E2 nucleic acid constructs of the present invention are administered using standard gene delivery protocols. Methods for gene delivery are known in the art. See, e.g., U.S. Patent Nos. 5,399,346, 5,580,859, 5,589,466. E1E2 nucleic acid constructs can be delivered either directly to the vertebrate subject or, alternatively, delivered ex vivo, to cells derived from the subject and the cells reimplanted in the subject.
  • E1E2 polypeptides and nucleic acid can elicit a cellular immune response, and/or an anti-El, anti-E2 and/or anti-El E2 antibody titer in the mammal that lasts for at least 1 week, 2 weeks, 1 month, 2 months, 3 months, 4 months, 6 months, 1 year, or longer.
  • El E2 nucleic acid can also be administered to provide a memory response. If such a response is achieved, antibody titers or the cellular immune response may decline over time, however exposure to the HCV virus or immunogen results in the rapid induction of antibodies and/or a cellular immune response, e.g., within only a few days.
  • such responses can be maintained in a mammal by providing one or more booster injections of the E1E2 nucleic acid constructs, as explained above, at 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 1 year, or more after the primary injection.
  • a composition for use with the methods of the invention is administered in a manner compatible with the particular composition used and in an amount which is effective to stimulate an immune response, such as to activate HCV-specific T cells as measured by, inter alia, a 51 Cr release assay, a lymphoproliferation assay, or by intracellular staining for IFN- ⁇ .
  • the proteins and/or polynucleotides can be administered either to a mammal which is not infected with an HCV or can be administered to an HCV-infected mammal.
  • An effective amount of the composition of the invention can be readily determined using only routine experimentation. In vitro and in vivo models described above can be employed to identify appropriate doses.
  • the amount of protein and polynucleotide used in the example described 5 below provides general guidance which can be used to optimize the activation of HCV-specific T cells either in vivo or in vitro.
  • Enzymes were purchased from commercial sources, and used according to the manufacturers' directions.
  • Sources for chemical reagents generally include Sigma Chemical Company, • 25 St. Louis, MO; Alrich, Milwaukee, WI; Roche Molecular Biochemicals, Indianapolis, IN.
  • the plasmid pCMVtpaElE2p7 (6275 bp) was constructed by cloning HCV-I 30 encoding amino acids 192 to 809 with the upstream tissue plasminogen activator (tpa) signal sequence into the pnewCMV-II expression vector.
  • the pnewCMV vector is a pUC19-based cloning vector comprising the following elements: an SV40 origin of replication, a human CMV enhancer/promoter, a human CMV intron, a human tissue plasminogen activator (tPA) leader, a bovine growth hormone poly A terminator and an ampicillin resistance gene.
  • E1E2 809 was expressed from recombinant CHO cells as described previously (Spaete et al., Virology (1992) 188:819-830). E1E2 complexes extracted from inside the CHO cells with Triton X-100 detergent. The E1E2 complexes were purified using Galanthus nivalis lectin agarose (Vector Laboratories, Burlingame, Calif.) chromatography and fast flow S-Sepharose cation-exhange chromatography (Pharmacia).
  • E1E2 complexes produced by expressing the ElE2 8 o 9 polynucleotides were emulsified with the submicron oil-in-water emulsion MF59.
  • MF59 was manufactured at Chiron Vaccines, Marburg and has previously been described in detail (Ott et al., "MF59 — Design and Evaluation of a Safe and Potent Adjuvant for Human Vaccines" in Vaccine Design: The Subunit and Adjuvant Approach (Powell, M.F. and Newman, MJ. eds.) Plenum Press, New York, 1995, pp.277-296)
  • Replication-defective alphavirus particles represent an efficient vaccine delivery platform because of high-level expression of the foreign antigen, the lack of preexisting immunity in humans, the targeting of dendritic cells, and potent stimulation of innate immunity.
  • VEE/SIN replicon particle chimeras were used that combine the selected desirable qualities of Sinbis virus (SIN) and Venezuelan equine encephalitis virus (VEE). Such chimeras were produced as described in Perri et al., J. Virol. (2003) 77:10394-10403 and Patent Publications 20030232324 and 20030148262, incorporated herein by reference in their entireties.
  • BHK-21 cells were maintained in Dulbecco minimum essential medium (DMEM) supplemented with 10% fetal calf serum (FCS), 10 mM sodium pyruvate, and penicillin and streptomycin at 37°C with 5% CO 2 .
  • DMEM Dulbecco minimum essential medium
  • FCS fetal calf serum
  • FCS penicillin and streptomycin
  • VCR-Chim2.1 was derived from VCR(Perri et al., J Virol. 2003, 77: 10394- 403) by (i) inserting a PCR-amplif ⁇ ed Sindbis virus (SIN) packaging sequence (nt 945 to 1076 of the SlN genome) as an in-frame fusion within the Venezuelan equine encephalitis virus (VEE) nonstructural protein gene 3 (nsP3) gene between the Xhol sites at nt 5493 and 5595 and (ii) replacing the VEE 3' untranslated region (3'UTR) with the SIN 3 1 UTR from the previously published SIN-derived replicon vector, SINCR (Perri et al., J Virol.
  • SIN Sindbis virus
  • VCR-DH VEE-based defective helper backbone
  • Chimeric replicon particles were generated by coelectroporation of invitro- transcribed RNAs corresponding to a replicon and two defective helpers, one expressing capsid protein and the other expressing envelope glycoproteins, as previously described (Perri et al., J Virol. 2003, 77: 10394-403).
  • Replicon particles expressing HCV-E1E2?46 or ElE2so9 were harvested as culture supernatants at 24 h postelectroporation, clarified by filtration, and purified by cation exchange chromatography.
  • Replicon particle titers were determined by intracellular staining of expressed El and E2, following overnight infection of BHK- 21 cells with serial dilutions of particles. Infected cells were permeabilized and fixed by using a Cytofix/Cytoperm kit (Pharmingen) and then stained with fluorescein isothiocyanate-conjugated antibodies to HCV El or E2 antigen. Using flow cytometry analysis, the percentage of El or E2-positive cells was determined and used to calculate titers.
  • NS polyproteins The absence of contaminating replication-competent virus was determined by five consecutive infections of naiveBHK-21 cell and determination of titers. Finally, endotoxin levels were measured for all replicon particle samples and shown to be ⁇ 0.5 endotoxin unit/ml.
  • Epitopes recognized by a T-cell receptor on an HCV-activated T cell can also be identified by, for example, 5Cr release assay or by lymphoproliferation assay (see the examples).
  • target cells can be constructed that display the epitope of interest by cloning a polynucleotide encoding the epitope into an expression vector and transforming the expression vector into the target cells.
  • HCV 30 specific CD8+ T cells will lyse target cells displaying, for example, an NS3, NS4, NS5a, NS5b, NS3NS4NS5a, or NS3NS4NS5aNS5b epitope and will not lyse cells that do not display such an epitope.
  • HCV- activated CD4+ T cells will proliferate when cultured with, for example, an NS3, NS4, NS5a, NS5b, NS3NS4NS5a, or NS3NS4NS5aNS5b epitopic peptide, but not in the absence of an HCV epitopic peptide.
  • E2, NS3, NS4, NS5a, and NS5b polypeptides can occur in any order in the fusion protein. If desired, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more of one or more of the polypeptides may occur in the fusion protein.
  • Multiple viral strains of HCV occur, and NS3, NS4, NS5a, and NS5b polypeptides of any of these strains can be used in a fusion protein.
  • a representative fusion protein for use in the present invention is shown in Figure 7, with amino acid numbering is relative to the HCV-I polyprotein.
  • Alphavirus expressing NS345 polyprotein Alphavirus expressing NS345 polyprotein
  • a nucleic acid encoding NS345 was generated by PCR amplification of NS3- NS5 , and then the cDNA (aa 1027-3012) was inserted into the VCR-Chim2.1 (J Virol. 2003, 77: 10394-403) replicon vectors, resulting in constructs VEE/SIN-NS345.
  • Replicon particles expressing HCV-NS345 were harvested as culture supernatants at 24 h post electroporation, clarified by filtration, and purified by cation exchange chromatography. Replicon particle titers were determined by intracellular staining of expressed NS3, NS4, NS5a and NS5b, following overnight infection of BHK-21 cells with serial dilutions of particles. Infected cells were permeabilized and fixed by using a Cytofix/Cytoperm kit (Pharmingen) and then stained with antibodies to HCV NS3, NS4, NS5a and NS5b and Alexa fluor 488-conjugated anti-mouse IgG.
  • mice per group of balb/c mice were injected im with the indicated materials at week 0, 3, and 6.
  • the mice were prime at week 0 and 3, and boosted at week 6.
  • the mice were scarified at week 8 and the spleens were harvested to detect the CD4 and CD8 response.
  • Spleen cells (1E*6) were stimulated with 10 ⁇ g/ml of the indicated peptides for 6 hours at 37 0 C in the presence of anti-CD28 (l ⁇ g/ml) (BD Biosciences, San Jose, CA) and Brefeldin A (BD Biosciences, San Jose, CA), and then stained with antibodies for CD8 (BD Biosciences, San Jose, CA). The cells were then fixed and permeabilized for IFN- ⁇ staining (BD Biosciences, San Jose, CA). After staining, the cells were analyzed by flow-cytometry. The data represent IFN- ⁇ and CD8 double positive population in CD8+ T cells.
  • NS3, NS4, NS5a or NS5b pool 20 mer over-lapping peptides covering NS3, NS4, NS5a orNS5b region.
  • NS3-1 pep LVALGINAVAYYRGL (SEQ ID NO:6) (Simon, Georgia et al. 2003)
  • NS3-2 pep TTVRLRAYMNTPGLP (SEQ ID NO:7) (Simon, Georgia et al. 2003)
  • NS3-3 pep SSPPVVPQSF (SEQ ID NO:8) (Arribillaga, de Cerio et al. 2002; Arribillaga, Sarobe et al. 2005)
  • NS5b pep MSYSWTGALVTPCAAE (SEQ ID NO:9) (Uno-Furuta, Matsuo et al. 2003)
  • SOD-ClOO recombinant NS4 protein purified from yeast
  • SOD-NS5 recombinant NS5A/B protein purified from yeast
  • Intracellular Staining for Interferon-gamma was used to identify the CD8 + T cells that secrete IFN- ⁇ after in vitro stimulation with the El or E2 pooled peptides, or individual CD4 E2 or CD8 E2 peptides, indicated below.
  • 1 x 10 6 spleen cells were stimulated with 10 ⁇ g/ml of the El or E2 peptides as indicated in Figure 4, for 6 hours at 37°C in the presence of anti-CD28 (1 ⁇ g/ml) (BD Biosciences, San Jose, CA) and Brefeldin A (BD Biosciences, San Jose, CA), and then stained with antibodies for CD8 (BD Biosciences, San Jose, CA). The cells were then fixed and permeabilized for IFN- ⁇ staining BD Biosciences, San Jose, CA). After staining, the cells were analyzed by flow-cytometry.
  • the data represent IFTvPy and CD8 double positive population in CD8+ T cells.
  • El pool 20mer over-lapping peptides covering the El region.
  • E2 pool 20mer over-lapping peptides the covering E2 region.
  • CD4 E2 pep QTHTTGGQAGHQAHSLTGLFSPGAKQN (SEQ ID NO:4) (Zucchelli et al., J. Virol. (2000) 74:11598-11607).
  • CD8 E2 pep DATYSRCGSGPWITPRCLVD (SEQ ID NO:5) (Zucchelli et al., J. Virol. (2000) 74: 11598- 11607).
  • NS3, NS4, NS5a, NS5b polypeptides or fusion proteins comprising any combination of the above, can be isolated, for example, by immunoaff ⁇ nity purification using a monoclonal antibody for the polypeptide or protein.
  • the isolated protein sequence can then be screened by preparing a series of 20 short peptides by proteolytic cleavage of the purified protein, which together span the entire protein sequence.
  • each polypeptide can be tested for the presence of epitopes recognized by a T-cell receptor on an HCV-activated T cell, progressively smaller and overlapping fragments can then be tested from an identified 100-mer to map the epitope of interest.
  • mice were immunized three times with PBS (naiVe), VEE/SIN chimeric alpha virus replicons (4E+6 or 4E+5 replication particle of V/S-E1E2 and V/S-E1E2P7), E1E2P7 protein plus MF59, and E1E2P7 protein plus MF59 and CpG.
  • PBS naiVe
  • VEE/SIN chimeric alpha virus replicons (4E+6 or 4E+5 replication particle of V/S-E1E2 and V/S-E1E2P7)
  • E1E2P7 protein plus MF59 and E1E2P7 protein plus MF59 and CpG.
  • the mice were immunized at week 0 and 3, and 6, and then the spleens were harvested at week 8.
  • the spleen cells were stimulated with 10 ug/ml of HCV peptide pools (El pool and E2 pool) or individual peptides (CD4 E2 pep and CD8 E2 pep) and then stained with antibody for CD8 and IFN- Y for flow cytometry analysis.
  • the data present the percentage of the IFN- y positive population in the CD8+ T cells after the immunization. As the red arrow indicated, prime with V/S-E1E2 or V/S-E1E2P7 could stimulate very good CD8+ T cells response for IFN- y production.
  • mice (10 mice per group) were injected intramuscularly (im) with the indicated materials (Figure 4) at week 0, 3, and 6, and the serum was collected at week 2, 5, and 8.
  • the mice were primed at week 0 and 3 with E1E2P7 protein plus MF59, and boosted with the indicated chimeric replicon particles at week 6.
  • VEE/SIN-E 1E2 and VEE/SIN-E lE2 8 o9 also termed E1E2P7
  • 2 ⁇ g of E1E2 protein complexes ElE2so9 derived from expression of the E1E2 8O9 construct described above in Materials and Methods, "Production of ElE2so 9 protein "
  • E1E2/MF59 protein production is described for example in WO03/002065
  • the mice were sacrificed at week 8 and the spleens were harvested to detect the CD4 and CD 8 response.
  • VEE/SIN-E1E2 chimeric alphavirus encoding E1/E2
  • CpG sequence "7909" was used in these experiments was in 5' to 3' direction TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 10).
  • CpG 7909 is a 24-mer B-Class CpG oligodeoxynucleotide (Vaccine. 2004 Aug 13;22(23-24):3136-43.)
  • EXAMPLE 5 Antibody titers to El and E2 were also examined following prime boost with an E1/E2 regimen.
  • Alphavirus alone encoding E1/E2 or E1/E2P7 did not elicit significant anti El or E2 responses but when administered as part of a prime with E1/E2 protein and boosting with alphavirus encoding E1/E2, antibody to El and E2 were produced.
  • Isotype response to prime-boost regimens for E1/E2 were compared between protein prime with and without CpG as part of the protein priming step. As shown in Figure 6, when CpG was administered with protein priming, the immune response resembled a THl response (increased IgG2A) while without CpG a TH2- like response (increased IgGl) was induced.
  • a quantitative cytofluorimetric assay was used to assess the binding of hepatitis C envelope glycoprotein to human cells (Proc. Natl. Acad. Sci. USA Vol.93, pp.1759-1763, 1996; Science Vol.282, pp.938-941, 1998). This assay has demonstrated a positive correlation between chimpanzee protective antibody titer and the ability of these antibodies to inhibit recombinant E2 protein from binding to target cell.
  • Human CD81 a member of the tetraspanin super family, binds recombinant E2 protein and, most important, the envelope associated HCV RNA.
  • HCV E2 The binding site of HCV E2 was mapped to major extra cellular loop of CD81 (EC2) that is conserved in both humans and chimpanzees.
  • EC2 major extra cellular loop of CD81
  • Our assay data suggests HCV protective antibodies derived from chimpanzees immunized with an E1/E2 vaccine can inhibit both E1/E2 and E2 protein binding to CD81.
  • CD81 recombinant receptor protein is coated onto 96-weIl plates. Anti-E2 specific monoclonal antibody with Europium labeled is used for detection.
  • CD81 recombinant receptor, 250ng per assay, in Sodium Borate buffer was coated in 96 well medium binding Costar plate (Plate A) overnight. Dilute separately antigen CHO E1/E2 (5ug/ml) and Moab 5E5/H7*Eu3+ (O.33ug/ml in working reagent. In a dilution plate (Plate B), 55ul diluted CHO E1/E2 was added together with 55ul 5E5/H7-Eu3+ Moab in working reagent to each well. The plates were shaken for 15 minutes at 40 0 C.
  • % Inhibition is equal to: (Signal of Negative Control - Signal of Sample)/Signal of Negative Control x 100%.
  • E1E2 glycoprotein plus MF59 and without CpG produced the highest neutralizing (i.e., anti-CD81) antibody titers but immunization with a regimen of priming with E1/E2 MF59 plus CpG followed by boosting with defective alphavirus encoding E1E2 and immunizing with E1E2 glycoprotein plus MF59 and CpG also produced significant neutralizing of binding antibodies (anti- CD81).
  • mice were immunized three times with PBS (naive), VEE/SIN chimeric alpha virus replicons encoding Green Fluorescent Protein or NS345 (5E+5 or 5E+6).
  • the mice were immunized at week 0 and 3, and 6, and then the spleens were harvested at week 8.
  • the spleen cells were stimulated with 10 ug/ml of HCV peptide pools and then stained with antibody for CD4 ( Figure 8) or CD8 ( Figure 9), and IFN- Y for flow cytometry analysis.
  • the data present the percentage of the IFN- Y positive population in the CD8+ or CD4+ T cells after the immunization. Results are shown in Figures 8 and 9 .
  • VEE/S1N-NS345 replicons Induced broad HCV-specific CD4+ and CD8+ T cell responses especially CD8+ T cell responses.
  • NS345core/ISCOM protein vaccine prime followed by alphavirus chimeric replicons encoding NS345 protein regions as described above for particle boosts.
  • amino acids 384-715 of E2 amino acids 1018 to 1026 of NS2, amino acids 1027 to 1657 of NS3, amino acids 1658 to 1972 of NS4, amino acids 1973 to 2990 of NS5 and amino acids 1 to 121 of core, wherein the serine at position 1165 of the NS3 sequence is replaced with an alanine, amino acid 9 of the core sequence is a lysine and amino acid 11 of the core sequence is arginine.
  • This sequence is represented schematically in Figure 7 with amino acid numberings relative to the HCV-I sequence.
  • the invention comprises HCV NS polyproteins having a mutation in NS3 which inactivates the protease activity. Such mutations enable expression of a fusion protein, as described in WO2004/005473. Additionally, in one embodiment, the invention comprises HCV NS polyproteins further comprising one or more structural protein sequences from HCV in the fusion protein is also preferred.
  • the fusion protein encoded therein was expressed in yeast Sacchromyces cerevisiae.
  • the fusion protein was cloned and expressed from plasmid pBS24.1 further containing the fusion protein insert DNA utilizing standard recombinant cloning techniques and in particular those methods described previously in US2006- 0088819Al, WO01/38360 and WO2004/005473.
  • the above fusion protein is designated "e2ns3 m ns5tr.cl21" or "E2NS3*NS4NS5tcorel21"
  • the e2ns3 m ns5tr.cl21polyprotein was genetically engineered for expression in Saccharomyces cerevisiae using the yeast expression vector pBS24.1 (United States Patent 6,458,527 section 4.2.4.2 and United States Patent 5,635,374 ).
  • This vector contains the 2 ⁇ sequence for autonomous replication in yeast and the yeast genes Ieu2d and URA3 as selectable markers.
  • the ⁇ -factor terminator, ⁇ -lactamase gene and the CoIBl origin of replication, required for plasmid replication in bacteria, are also present in this expression vector.
  • the following steps were taken to construct the expression cassette for the e2ns3 m ns5tr.cl21 polyprotein:
  • Hindlll/AcII fragment of 819bp was gel isolated from pGEM7.d.E2 (Hindlll/Xhol) subclone #3 .
  • the 5' HindIII cloning site is followed by the sequence ACAAAACAAA, the inititator ATG, and codons for the HCV-I E2 ectodomain, beginning at aa384 and continuing to an AcII restriction site at aa650.
  • the ligation mixture was transformed into HBlOl competent cells and plated onto Luria-ampicillin agar plates (lOO ⁇ g/ml). After miniprep DNA analysis, identification of the desired clones and sequence confirmation, pT7Blue2.E2/ns2.3 #23 was digested with HindIII and BInI to isolate a 108 lbp fragment.
  • a Blnl/Clal fragment of 703bp was gel isolated from pSP72 HindIII/ClaI.ns3mut 1165 #15.
  • This 703bp fragment encodes aal040-aal274 of the HCV-I genome in which Sern65 was mutated to Ala by site-directed mutagenesis.
  • the 108 lbp Hindlll/Blnl fragment and the 703bp Bln/Clal fragment were ligated into the pSP72 Hindlll/Clal vector.
  • the ligation mixture was transformed as above, and after DNA analysis the resultant clone was named pSP72.HindIII/Cla e2.ns3 m #1 Fourth, a 1784bp Hindlll/Clal fragment was gel purified from pSP72.HindIII/Cla e2.ns3 m # 1 described above.
  • a Clal/Nhel 2787bp fragment encoding aal274-aa2202 from NS3-NS5a of HCV-I was isolated from a full-length HCV-I clone, pUC.HCV3.
  • Nhe/Sall fragment was gel isolated from a pSP72.HindIII/SalI.ns5ab.2990.corel21 #27 subclone.
  • the Nhe/Sal fragment corresponds to aa2203-2990 of NS5a and NS5b, followed by aal-121 of the core domain.
  • consensus aa were incorporated at position 9 (Lys) and 11 (Arg).
  • S.cerevisiae strain AD3* genotype (mat ⁇ ,leu2,trpl,ura3-52,prb-1122,pep4- 3,prcl-407, cir°,t ⁇ +, :DM 15 [GAP/ADR] , was transformed with pd.e2ns3 m ns5tr.cl21 yeast expression plasmid, yeast cells were transformed with the expression plasmid using a lithium acetate protocol. Ura- transformants were streaked for single colonies and patched onto leu-/8% glucose plates to increase plasmid copy number.
  • Leu-starter cultures were grown for 24 hours at 30° C and then diluted 1:20 in YEPD (yeast extract bactopeptone 2% glucose) media. Cells were grown for 48 hours at 30 0 C and harvested after depletion of glucose in the medium. To test for expression of the e2ns3 m ns5tr.cl21 recombinant antigen, aliquots of cells were lysed with glass beads in lysis buffer (1OmM Tris-Cl pH 7.5, ImM EDTA, 10 mM DTT). The lysates were cleared by centrifugation at high speed.
  • lysis buffer (1OmM Tris-Cl pH 7.5, ImM EDTA, 10 mM DTT
  • S.cerevisiae strain AD3* is derived originally from strain BJ2168 described in United States Patent 6,458,527 section 4.2.4.42"
  • the E2NS3 *NS4NS5tcore 121 fusion protein was expressed from a yeast plasmid using the ADH2/GAPDH promoter.
  • the E2NS345tcorel21 fusion protein comprises from the amino to carboxy terminus amino acids 384-715(E2)-1018-1026 (NS2)-1027-1972(NS3NS4)-1973-2990 (NS5t)-l-121 (Core).
  • the amino acid numbering is relative to the full length HCV polyprotein and the NS3 and core are modified as indicated above.
  • the E2NS3*NS4NS5tcorel21 protein produced as described above was used to produce HCV fusion-ISCOMs as follows.
  • the fusion-ISCOM formulations were prepared by mixing the fusion protein with a preformed ISCOMATRIX (empty ISCOMs) utilizing ionic interactions to maximize association between the fusion protein and the adjuvant.
  • ISCOMATRIX is prepared essentially as described in Coulter et al. (1998) Vaccine 16:1243. Further methods for production of HCV polyproteins plus ISCOMs
  • the fusion-ISCOM formulations are also referred to herein as "IMX/poly”.
  • mice (10 mice per group) were injected intramuscularly (im) with the indicated materials ( Figures 10 and 11 ) at week 0, 3, and 6, and the serum was collected at week 2, 5, and 8.
  • EXAMPLE 9 Cross neutralizing Abs that blocks JFHl-HCVcc (HCV-2a) infection to Huh7 cells
  • the immune sera from various prime boost regimens as described herein were analyzed for ability to neutralize infectivity of a heterologous HCV strain in an HCV tissue culture assay.
  • An HCV genomic construct encoding the type 2a HCV strain with a Luciferase reporter gene provided in a monocistronic configuration with the JHl genome was generated and called as JFHl 2a HCVcc.
  • replication of the JFHl luciferase is detected by observing the luciferase activity as Relative light units (RLU), which in turn is represented as % of control (injection with PBS) in Figure 13.
  • RLU Relative light units
  • the JFH-I Luciferase construct packaged in infectious particles was used to infect hepatocytes. Infection was allowed to occur after viral particles were treated for 1 hour at 37°C and then used to infect HuH7 cells. The infected cells were incubated for three days and then assayed for luciferase activity.
  • mice demonstrate that prime boosting with E1/E2 MF59/C ⁇ G followed by.alphavirus encoding E1E2 from HCVIa generated neutralizing antibodies that neutralized infection of a heterologous 2a HCV type, JFHl 2a HCVcc ( Figure 13).
  • Previous Examples demonstrated that this particular prime boost combination also elicits a significant T-cell response.
  • Figure 14 demonstrates that immunne sera from a chimp that was immunized with E1E2 MF59 and purified CD81 protein cause a reduction in luciferase activity under the conditions used for mice sera in this example. This control demonstrates the utility of the assay for detecting neutralization.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Mycology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Communicable Diseases (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2007/000362 2006-01-04 2007-01-04 Activation of hcv-specific t cells Ceased WO2007081848A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
ES07709585.9T ES2551113T3 (es) 2006-01-04 2007-01-04 Proteína E1E2 del VHC adyuvantada con MF59 más vector de alfavirus que codifica E1E2 del VHC para provocar linfocitos T específicos del VHC
JP2008549583A JP5405832B2 (ja) 2006-01-04 2007-01-04 Hcv特異的なt細胞の活性化
CA2636032A CA2636032C (en) 2006-01-04 2007-01-04 Activation of hcv-specific t cells
EP07709585.9A EP1981537B1 (en) 2006-01-04 2007-01-04 HCV E1E2 MF59-adjuvanted protein plus HCV E1E2 encoding alphavirus vector for eliciting HCV-specific T cells.
US12/087,330 US8178086B2 (en) 2006-01-04 2007-01-04 Activation of HCV specific T cells

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US75635406P 2006-01-04 2006-01-04
US60/756,354 2006-01-04
US79984006P 2006-05-11 2006-05-11
US60/799,840 2006-05-11
US84008206P 2006-08-25 2006-08-25
US60/840,082 2006-08-25

Publications (2)

Publication Number Publication Date
WO2007081848A2 true WO2007081848A2 (en) 2007-07-19
WO2007081848A3 WO2007081848A3 (en) 2007-11-15

Family

ID=38256946

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/000362 Ceased WO2007081848A2 (en) 2006-01-04 2007-01-04 Activation of hcv-specific t cells

Country Status (6)

Country Link
US (1) US8178086B2 (https=)
EP (1) EP1981537B1 (https=)
JP (1) JP5405832B2 (https=)
CA (1) CA2636032C (https=)
ES (1) ES2551113T3 (https=)
WO (1) WO2007081848A2 (https=)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8206992B2 (en) 2008-03-27 2012-06-26 President And Fellows Of Harvard College Cotton thread as a low-cost multi-assay diagnostic platform
US8377710B2 (en) 2006-10-18 2013-02-19 President And Fellows Of Harvard College Lateral flow and flow-through bioassay devices based on patterned porous media, methods of making same, and methods of using same
US8628729B2 (en) 2008-03-27 2014-01-14 President And Fellows Of Harvard College Three-dimensional microfluidic devices
WO2014067498A1 (es) * 2012-11-05 2014-05-08 Centro De Ingenieria Genetica Y Biotecnologia Antígenos vacunales quiméricos contra el virus de la hepatitis c
US9192933B2 (en) 2009-03-06 2015-11-24 President And Fellows Of Harvard College Microfluidic, electrochemical devices
WO2017006182A1 (en) 2015-07-07 2017-01-12 The Governors Of The University Of Alberta Hepatitis c virus immunogenic compositions and methods of use thereof
US9829488B2 (en) 2008-03-27 2017-11-28 President And Fellows Of Havard College Paper-based cellular arrays
WO2018055535A3 (en) * 2016-09-21 2018-05-03 The Governors Of The University Of Alberta Hepatitis c virus immunogenic compositions and methods of use thereof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2719800A1 (en) 2008-03-27 2009-10-01 President And Fellows Of Harvard College Paper-based microfluidic systems
RU2675108C2 (ru) * 2015-06-15 2018-12-17 Федеральное государственное бюджетное научное учреждение "Научно-исследовательский институт биомедицинской химии имени В.Н. Ореховича" (ИБМХ) Композиция на основе синтетических пептидов и липидов для вакцины против гепатита с
US20240358821A1 (en) * 2021-07-06 2024-10-31 The Trustees Of The University Of Pennsylvania P7 Containing Nucleoside-modified mRNA-lipid Nanoparticle Lineage Vaccine for Hepatitis C Virus

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6514731B1 (en) 1996-05-24 2003-02-04 Chiron Corporation Methods for the preparation of hepatitis C virus multiple copy epitope fusion antigens
US6054424A (en) 1998-04-15 2000-04-25 Church & Dwight Co., Inc. Process for the production of a liquid laundry detergent composition of desired viscosity containing nonionic and anionic surfactants
US20050074465A1 (en) 1999-11-24 2005-04-07 Michael Houghton HCV fusion proteins with modified NS3 domains
JP2004500366A (ja) * 1999-12-01 2004-01-08 カイロン コーポレイション C型肝炎ウイルス(hcv)について特異的な抗体を誘発すること
US20030232324A1 (en) 2001-05-31 2003-12-18 Chiron Corporation Chimeric alphavirus replicon particles
AU2002303330B2 (en) 2001-05-31 2008-07-24 Novartis Vaccines And Diagnostics, Inc. Chimeric alphavirus replicon particles
GB0226722D0 (en) * 2002-11-15 2002-12-24 Glaxo Group Ltd Vaccine
NZ551319A (en) 2004-05-17 2010-07-30 Novartis Vaccines & Diagnostic Truncated Hepatitis C virus NS5 domain and fusion proteins comprising same

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP1981537A4 *

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8377710B2 (en) 2006-10-18 2013-02-19 President And Fellows Of Harvard College Lateral flow and flow-through bioassay devices based on patterned porous media, methods of making same, and methods of using same
US9829488B2 (en) 2008-03-27 2017-11-28 President And Fellows Of Havard College Paper-based cellular arrays
US8628729B2 (en) 2008-03-27 2014-01-14 President And Fellows Of Harvard College Three-dimensional microfluidic devices
US8206992B2 (en) 2008-03-27 2012-06-26 President And Fellows Of Harvard College Cotton thread as a low-cost multi-assay diagnostic platform
US9192933B2 (en) 2009-03-06 2015-11-24 President And Fellows Of Harvard College Microfluidic, electrochemical devices
AU2013339846B2 (en) * 2012-11-05 2017-08-17 Centro De Ingenieria Genetica Y Biotecnologia Chimeric vaccine antigens against hepatitis C virus
WO2014067498A1 (es) * 2012-11-05 2014-05-08 Centro De Ingenieria Genetica Y Biotecnologia Antígenos vacunales quiméricos contra el virus de la hepatitis c
US11576967B2 (en) 2015-07-07 2023-02-14 The Governors Of The University Of Alberta Hepatitis C virus immunogenic compositions and methods of use thereof
WO2017006182A1 (en) 2015-07-07 2017-01-12 The Governors Of The University Of Alberta Hepatitis c virus immunogenic compositions and methods of use thereof
EP3319997A4 (en) * 2015-07-07 2019-01-23 The Governors of the University of Alberta IMMUNOGENIC COMPOSITIONS OF THE HEPATITIS C VIRUS AND METHOD OF USE THEREOF
US10300131B2 (en) 2015-07-07 2019-05-28 The Governors Of The University Of Alberta Hepatitis C virus immunogenic compositions and methods of use thereof
US10881727B2 (en) 2015-07-07 2021-01-05 The Governors Of The University Of Alberta Hepatitis C virus immunogenic compositions and methods of use thereof
US12005116B2 (en) 2015-07-07 2024-06-11 The Governors Of The University Of Alberta Hepatitis C virus immunogenic compositions and methods of use thereof
WO2018055535A3 (en) * 2016-09-21 2018-05-03 The Governors Of The University Of Alberta Hepatitis c virus immunogenic compositions and methods of use thereof
US11324818B2 (en) 2016-09-21 2022-05-10 The Governors Of The University Of Alberta Hepatitis c virus immunogenic compositions and methods of use thereof
US12296005B2 (en) 2016-09-21 2025-05-13 The Governors Of The University Of Alberta Hepatitis C virus immunogenic compositions and methods of use thereof

Also Published As

Publication number Publication date
JP2009522368A (ja) 2009-06-11
US20100034844A1 (en) 2010-02-11
EP1981537A4 (en) 2009-06-17
JP5405832B2 (ja) 2014-02-05
ES2551113T3 (es) 2015-11-16
EP1981537A2 (en) 2008-10-22
WO2007081848A3 (en) 2007-11-15
CA2636032A1 (en) 2007-07-19
EP1981537B1 (en) 2015-08-26
US8178086B2 (en) 2012-05-15
CA2636032C (en) 2016-04-12

Similar Documents

Publication Publication Date Title
US20090098153A1 (en) Activation of HCV-specific T cells
US20100291134A1 (en) Truncated hepatitis c virus ns5 domain and fusion proteins comprising same
EP1981537B1 (en) HCV E1E2 MF59-adjuvanted protein plus HCV E1E2 encoding alphavirus vector for eliciting HCV-specific T cells.
EP1539809A2 (en) Hcv fusion proteins with modified ns3 domains
US7439058B2 (en) HBV/HCV virus-like particle
EP1233783B9 (en) Hbv/hcv virus-like particle
US8216590B2 (en) HCV fusion polypeptides
US20050074465A1 (en) HCV fusion proteins with modified NS3 domains
EP1576125A2 (en) Activation of hcv-specific cells
WO2007041432A2 (en) Cross-neutralization of hcv with recombinant proteins
EP1535628B1 (en) Hbv/hcv virus-like particle

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2636032

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2008549583

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007709585

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 12087330

Country of ref document: US