WO2007072110A1

WO2007072110A1 - Enhancement of carotenoids in plants

Info

Publication number: WO2007072110A1
Application number: PCT/IB2005/003995
Authority: WO
Inventors: Villoo Morawala Dr. Patell; Henjarappa Jagadeesh Badamaranahalli; Venkatesh Murthy Vasundradevi Nandi; M. P. Babitha; Sridhar Venkataraman
Original assignee: Avestha Gengraine Technologies Pvt. Ltd.
Priority date: 2005-12-23
Filing date: 2005-12-23
Publication date: 2007-06-28
Also published as: AP2008004538A0; CA2638818A1; EP1963511A1; CN101360828A; AU2005339391A1

Abstract

The present invention relates to a method of enhancing the content of carotenoids and other isoprenoids, preferably of lycopene and or β-carotene, in a plant, plant cell, callus, tissue, fruit, root or tther part of a plant, and/or a method of increasing the height in a plant, to a plant, plant cell, callus tissue, root or fruit produced by such method, to a method of obtaining carotenoids, preferably lycopene and/or β-carotene, to a nucleic acid construct and to the use of such nucleic acid construct.

Description

Enhancement of Carotenoids in Plants.

Field of Invention:

The present invention relates to a method of enhancing the content of carotenoids and other isoprenoids, preferably of lycopene and or β-carotene, in a plant, plant cell, callus, tissue, fruit, root or other part of a plant, and/or a method of increasing the height in a plant, to a plant, plant cell, callus, tissue, root or fruit produced by such method, to a method of obtaining carotenoids, preferably lycopene and/or β-carotene, to a nucleic acid construct and to the use of such nucleic acid construct.

Background of the Invention:

Among modern diseases and ailments, both cancer and cardiovascular diseases rank close to the top and affect a significant proportion of the population. These diseases have been linked to factors such as reactive oxygen species which cause damage to membranes, DNA and other cellular functions. Consequently anti-oxidants have become very popular dietary supplements among all age-groups a number of products such as fresh fruits, juices, plant extracts and tablets are available and consumed on a daily basis towards the maintenance of health. This category of chemicals includes vitamins C and E, polyphenols, flavonols and carotenoids. As humans do not synthesize any of these, these are obtained from plant of microbial sources. One of the key groups involved in reactive oxygen quenching are poly-ols and poly-enes. It is well known that lycopene, an acyclic isomer of β-carotene, is one of the most potent anti-oxidants with twice the singlet oxygen quenching capacity of β-carotene and 10 times that of α-tocopherol. Further it is the most predominant carotenoid in human plasma (Kaliora et al, 2005).

Lycopene' s stability in serum and its superior quenching ability have made it an extensively studied compound in terms of its production and disease treatment. Its 11 conjugated and 2 non-conjugated double bonds give it its characteristic red colour (peak absorbance at 472-476 nm). Further of the possible 1056 isomers about 12 are found in nature with the linear all trans isomer being the most stable and the one found in plants. This compound is a polyunsaturated hydrocarbon, lipophylic, and sensitive to light, heat and oxidation (Faulks and Southon, 2005).

Lycopene and diet

Lycopene is abundant in several fruits and vegetables such as grapefruit, guava juice, watermelon and tomatoes. In tomatoes, the red pigmentation is largely accounted for by lycopene and high-lycopene fruits exhibit enhanced redness. In plants lycopene is found in the all trans- form and is poorly absorbed from the diet without cooking. Heating in the presence of oil has shown better extractability and certain tomato products such as juice, puree, paste and sauce have been found to have better, i.e. higher amounts of lycopene. Cooking has shown to isomerize lycopene to a czs-confϊguration that increases its bioavailability. Further in serum the preponderance of lycopene is in the cw-form. It has been estimated that 35 mg of lycopene is required on a daily basis and may not be currently part of the current intake of consumers (Faulks and Southon, 2005).

Lycopene and health

Reactive oxygen species (ROS) are generated by a number of pathways whereby energy is transferred to a ground-state triplet oxygen making it a highly reactive excited singlet oxygen. This species is capable of lipid, protein and DNA damage. ROS are thus associated with symptoms of aging, with cancer and cardiovascular diseases. By virtue of the abundance of unsaturations and the conjugation of these linkages, carotenoid molecules can quench the energy from the singlet oxygen. Concomitant with this step, the carotenoid molecule attains an excited state, which is subsequently dissipated as heat by interaction with the solvent milieu. After completing one quenching reaction, the carotenoid is regenerated for another reaction. Certain estimates reveal that carotenoids can quench around 1000 singlet oxygens before they break down (Krinsky, 1998, Bhuvaneswari and Nagini 2005, Gruszecki and Strzalka, 2005). ROS have been linked with a number of chronic diseases, due to the oxidative damage caused. In turn antioxidants have been associated with protecting lipids, membranes, low- density lipoproteins, proteins and DNA from damage. More specifically, lycopene has been demonstrated to prevent cancer and cardiovascular diseases. Several studies have found that lycopene, by binding to lipophylic moieties, protects such complexes from oxidative damage. Further it is proposed to prevent the carcinogen-induced phosphorylation of p53 and Rb anti-oncogens, and stop cell division as the GO-Gl phase. It is also an inhibitor of HMG CoA reductase, the committed step in cholesterol biosynthesis. Additionally by binding to LDL and VLDL, it prevents the formation of cholesterol oxides and hence CVD (Kaliora et al 2005, Agarwal and Rao 2000).

While several transgenic approaches have resulted in the enhancement of lycopene in tomatoes, few natural high-lycopene varieties have been found. Spontaneous mutations historically identified in tomato by the Campbell Soup company in 1917 (hp- 1), the hp-2 modified in the San Marzano variety (1975) and dg (Manapal variety 1973) have been associated with elevated lycopene levels and thus used in breeding programs (For review Bramley 2002).

Metabolic plant engineering

The quest for plants and plant products with enhanced carotenoids and specifically lycopene towards better nutrition has taken plant biology through very novel and groundbreaking science. Understanding and mapping the pathway of carotenoid biosynthesis (Fraser et al , 1994, Hirschberg 2001, Fraser et al 2002 and Bramley 2002 for review) has yielded a wealth of information enabling the metabolic engineering of plants towards enhanced carotenoid production. Key to recent advances was the discovery that unlike other organisms, plants synthesize carotenoids via the l-deoxy-D-xylulose-5-phosphate (DOXP) pathway rather than the mevalonic acid pathway. While both pathways produce isopentenyl pyrophosphate, the mevalonate pathway channels carbon into the sterol, sesquiterpenoid and triterpenoid pathway while the DOXP leads to carotenoid, phytol, plastoquinone-9, and diterpene formation (Bramley 2002, Romer and Fraser 2005). To begin, IPP is isomerized to dimethylallyl pyrophophate (DMAPP), an activated monomer that is eventually oligomerized into geranyl geranyl pyrophosphate, the precursor to C40 carotenoids and the first compound in the pathway, phytoene. Phytoene is desaturated to phytofluene by phytoene desaturase and further to ζ-carotene. Lycopene is next produced via neurosporene by ζ-carotene desaturase. Interestingly, the bacterial crtl (from Erwinia uredovord) converts phytoene to all trans-lycopene (Ye et al 2000, Bramley 2002). While beyond the scope of this work, it is to be noted that all trans- lycopene is further converted to α- and β-carotene of which β-carotene is a pro-vitamin A.

Engineering plants and or identifying plants with enhanced lycopene in view of its health benefits has been carried out for a great number of years with some of the earliest dating back to 1917 when the Campbell soup company identified hp-1 as a highly pigmented mutant of tomato (Reynard 1956). An extension of the hp-\ phenomenon was demonstrated by Liu et al (2004), who showed that the modulation of hp-1 homologs DDBl, LeHY5 and LeCOPlLIKE affect carotenoid biosynthesis (Bramley 1997).

hp-2 and dg were also identified from natural populations and linked to enhanced carotenoid levels (for review Levin). Drawing from these results, hp2 and dg were determined to be tomato homologs of the Arabidopsis DETl (DE-ETIOLATED 1). The constitutive silencing of this gene resulted in elevated levels of β-carotene and lycopene in tomato (Davuluri et al 2004). As with hp-2, these mutants had severe development defects in that, they were stunted, bushy and dwarf. Davuluri and coworker (2005) further, reduced the level of DETl using an RNA interference strategy that significantly increased the level of carotenoids, resulting in a doubling of lycopene and a 10-fold increase in β-carotene. In a similar strategy, over-expression of the blue light photoreceptor cry2 increased lycopene contents by decreasing the expression of lycopene β cyclases (Giliberto et al, 2004).

Modulation of enzymes involved in the biosynthetic pathway of carotenoids has yielded mixed results. Fray et al. (1995) over-expressed a tomato phytoene synthase gene in tomatoes resulting in increased lycopene and a simultaneous dwarfing due to a reduction in gibberellic acid biosynthesis. Fraser et al. (2002), further demonstrated that a fruit specific over-expression of phytoene synthase (crtB from Erwinia uredovora) using a polygalacturonase promoter resulted in a 1.8 fold increase in lycopene along with phytoene, β-carotene and lutein (2.4, and 2.4 fold increases). The over-expression of bacterial phytoene desaturase {crtl form Erwinia uredovora) in tomatoes however (Romer et al. 2000) resulted in a 3-fold increase in β-carotene while the lycopene content was halved. Mehta et al. (2002) engineered polyamine accumulation in tomatoes using yeast S-adenosylmethionine decarboxylase gene driven by a ripening-induced E8 promoter. Fruit extracts revealed a yield of 120 μg/mg of lycopene (about 300 % increase). Rosati et al. (2000) used a different approach, whereby lycopene cyclase was inactivated by antisense technology resulting in an increase in lycopene.

Breeders have long toiled with breeding for high lycopene, Liu et al. (2003) reported that around 16 QTLs determine tomato colour and thus lycopene by looking at 75 introgression lines between Lycopersicon pennellii and M82 (L. esculentum). Lycopene has attracted the attention of health specialists and plant scientist alike for it beneficial properties. The 90 or so years of interest in developing new strategies to increase the carotenoid levels in tomatoes goes to show its importance and that despite the difficulties in developing such technologies, the need for the hour continually directs attention towards lycopene.

Summary of the invention

The object of this invention is to provide means to enhance carotenoid levels in plants and/or plant parts. A further object of the present invention is to provide a method for producing enhanced levels of carotenoids, in particular lycopene, in plants and/or plant parts. Yet a further object of the present invention is to provide a plant or plant part having enhanced levels of carotenoids, in particular lycopene. The objects of the present invention are solved by a method of enhancing the content of carotenoids and other isoprenoids, preferably of Iycopene and or β-carotene, in a plant, plant cell, callus, tissue, fruit, root or other part of a plant, and/or increasing the height in a plant, said method comprising:

impairment of mitochondrial function, preferably impairment of mitochondrial complex I, II, III and /or IV, more preferably mitochondrial complex I in said plant, plant cell, callus, tissue, fruit, root or other part of a plant.

In one embodiment of the method according to the present invention, said impairment occurs using a modified protein component of mitochondrial complex I of said plant cell, preferably a protein component of mitochondrial complex I that is the translation product of an unedited coding sequence.

Preferably, said impairment occurs by transforming said plant cell with a nucleic acid construct, preferably a DNA-construct, or by transforming said plant cell with a nucleic acid construct via Agrobacterium species - mediated transformation, preferably Agrobacterium tumefaciens, or by viral transfection using a suitable plant virus such as Tobacco Mosaic Virus, or by protoplast transformation.

In one embodiment of the present invention, said nucleic acid construct, preferably said DNA-construct, or said Agrobacterium comprises, preferably in a binary vector, a nucleic acid encoding said modified protein component of said mitochondrial complex I.

In a preferred embodiment of the present invention, said modified protein component of mitochondrial complex I is a dysfunctional protein from another plant species than said plant cell or a dysfunctional protein of the same plant species as said plant cell. In another embodiment of the method according to the present invention, said modified protein component of mitochondrial complex I is a dysfunctional protein selected from the group comprising NAD 1, 2, 3, 4, 4L, 5, 6, 7, 9, nuclear mitochondrial proteins 76 Kda, 55 Kda, 28.5 Kda, 22 Kda and Acyl carrier protein.

Preferably said nucleic acid encoding said modified protein component is selected from the group comprising SEQ ID NO: 1 - 3

In one embodiment of the method according to the present invention, said nucleic acid construct, preferably said DNA-construct, or said Agrobacteriiim, preferably said Agrobacterium binary vector, additionally comprises a nucleic acid encoding a mitochondrial transit peptide, operably linked to said nucleic acid encoding said modified protein component of said mitochondrial complex I.

In a preferred embodiment of the invention, wherein said nucleic acid construct, preferably said DNA-construct, or said Agrobacterium, preferably said Agrobacterium binary vector, additionally comprises a promoter and a terminator, and said promoter and terminator are operably linked to said nucleic acid encoding said modified protein component of said mitochondrial complex I.

In one embodiment of the invention, wherein said nucleic acid construct, preferably said DNA-construct, or said Agrobacterium, preferably said Agrobacterium binary vector, comprises said promoter and said terminator, said nucleic acid encoding mitochondrial transit peptide and said nucleic acid encoding said modified protein component of said mitochondrial complex I, all as defined before, all of them being operably linked.

Preferably said impairment occurs by mutating said plant cell with respect to at least one of the components of said mitochondrial complex I in said plant cell. In a preferred embodiment of the present invention, said mutating occurs by mutating said plant cell at random using a chemical and/or physical mutagenic agent being applied to at least one plant cell, preferably a plurality of plant cells of the same plant, said chemical mutagenic agent preferably being selected from the group comprising ethyl methane sulfonate and said physical mutagenic agent being selected from the group comprising fast neutron bombardment, X-ray, gamma ray and other mutagenic irradiation.

In one embodiment of the method according to the present invention, the method, after mutating, further comprises the additional step of screening for a modified protein component of mitochondrial complex I or other mitochondrial functions of said plant cell in said plant cell or plurality of plant cells.

In one embodiment of the method according to the present invention, said impairment occurs by applying a chemical inhibitor of mitochondrial function, preferably a chemical inhibitor of mitochondrial complex I of said plant cell, to said plant cell, plant, callus, tissue, a part of said plant, said plant in its entirety, fruit, root and / or other plant organ.

In a preferred embodiment of the present invention, said chemical inhibitor is selected from the group comprising rotenone, antimycin A, oxyfluorfen, violaxanthin, piericidin, piericidine A, pyrazoles, pyridaben, quinazolines, acetogenins, thiangazoles and fenaza.

In a preferred embodiment of the invention, said impairment is an inhibition of said of mitochondrial complex I.

In one embodiment of the method according to the present invention, said method further comprises the step of raising said plant cell, plant part, tissue, seed or organ having undergone the method of any of the foregoing claims, to produce a plant callus, tissue, plant, root and/or fruit. The objects of the present invention are solved by a plant cell, callus, tissue, plant, root or fruit produced by the method according to the present invention.

Preferably the plant cell, callus, tissue, plant, root or fruit is/are derived from a plant origin selected from the group comprising solanaceous species, including tomato, pepper, capsicum, potato, petunia and or tobacco.

Preferably, in the plant cell, callus, tissue, plant, root or fruit, the amount of carotenoid, preferably lycopene, is enhanced to >10mg, preferably >15 mg, even more preferably >16 mg and most preferably >20 mg/lOOg fresh weight of plant cells, callus tissue, plant, root and/or fruit.

Preferably, in the plant cell, callus, tissue, plant, root or fruit, the amount of carotenoid, preferably lycopene is enhanced by at least two-fold, preferably three-fold, in relation to a plant cell/callus/tissue/plant, root or fruit not having undergone the method according to the present invention.

The objects of the present invention are solved by a method of obtaining carotenoids, preferably lycopene and /or β-carotene, comprising the steps:

Producing a plant cell, callus, tissue, plant, root or fruit according to the present invention,

Purifying carotenoids, preferably lycopene and /or β-carotene, from said plant cell, callus, tissue, plant, root or fruit, preferably by solvent extraction and purification or by supercritical carbon dioxide extraction or any other method typically employed by someone skilled in the art. The objects of the present invention are also solved by a nucleic acid construct comprising a nucleic acid sequence encoding a modified protein component of mitochondrial complex I.

Preferably, said modified protein component of mitochondrial complex I is selected from the group comprising NAD 1, 2, 3, 4, 4L, 5, 6, 7 and 9 or other proteinaceous component of said complex.

In one embodiment of the nucleic acid construct according to the present invention, said modified protein component of mitochondrial complex I is from a species selected from the group comprising tomato, potato, tobacco, rice, maize, petunia, Arabidopsis, and or Lotus, Medicago, wheat and/or Sorghum.

Preferably, said modified protein component of mitochondrial complex I has a sequence selected from the group comprising SEQ ID NO: 4, 5, and 6.

The objects of the present invention are solved by the use of a nucleic acid construct according to the present invention for enhancing the content of carotenoids and other isoprenoids, preferably of lycopene and /or β-carotene, in a plant cell, plant, callus, tissue, fruit, root or other part of said plant and/or for increasing the height in a plant.

Definitions

A "transgenic or transformed plant" refers to a plant which contains a recombinant polynucleotide introduced by transformation. Transformation means the introduction into a plant of a polynucleotide sequence in a manner so as to cause a stable integration of the nucleotide sequence or a transient expression of the sequence. This may be achieved by particle bombardment (biolistic), Agrobacterium-mediated (using a suitably developed plasmid vector), transfection with viral DNA or vectors, introduction of DNA by electroporation or lipofection. Plant transformation may be carried out on plant cells, pollen, on plant seeds, on plant protoplasts, or any other type of plant tissue, intact plant or plant part under sterile or non-sterile conditions. A transformed plant may refer to a whole plant, any plant part, plant cell, plant organ, plant tissue, seed, root, flower, fruit, root or shoot. It may also refer to the progeny thereof.

A "vector" is a polynucleic acid construct, generated recombinantly, artificially or chemically, comprising nucleic acid elements that may encode genes, proteins, promoters, terminators and transit peptides. These segments will be operably linked so as to enable the expression of the gene encoded or the complete execution of the process encoded. The promoter region may include constitutive or tissue-specific, tissue-active, developmental stage-active/specific, or inducible promoters such as but not limited to the cauliflower mosaic virus 35S promoter, the cassava vein mosaic virus promoter or the maize ubiquitin promoter.

A nucleotide sequence is "operably linked" when adjacent segments of DNA sequence are linked in such a manner so as to enable a cellular/biological function as encoded by the gene sequence.

Carotenoid

Carotenoids are a class of hydrocarbons (carotenes) and their oxygenated derivatives (xanthophylls) consisting of eight isoprenoid units joined in such a manner that the arrangement of isoprenoid units is reversed at the centre of the molecule so that the two central methyl groups are in a 1,6-positional relationship and the remaining non-terminal methyl groups are in a 1,5-positional relationship. All carotenoids may be formally derived from the acyclic C40H56 structure, having a long central chain of conjugated double bonds, by (i) hydrogenation, (ii) dehydrogenation, (iii) cyclization or (iv) oxidation or any combination of these processes. Impairment

Impairment refers to the partial or complete loss of function of the organelle, functional complex, enzyme or other functional entity. A complete loss of function as used herein is also sometimes referred to as inhibition.

Mitochondrial complex

Mitochondria complexes refer to the four electron transport chain complexes of mitochondria called I, II, III and IV respectively, where complex I is NADH- dehydrogenase, Complex II is succinate dehydrogenase, Complex III is cytochrome c reductase and complex IV is cytochrome c oxidase. These are multipolypeptide complexes involved in ATP production by oxidation of NADH+H^4" and FADH2 to NAD+ and FAD respectively and water.

Mitochondrial complex I proteins

This complexes comprises about 43 polypeptide chains including the mitochondrial encoded nadl, nad2, nad3, nad4, nad4Lm, nad5, nadβ, nad7, nad9 and the nuclear encoded 76 Kda, 55 Kda, 28.5 Kda, 22 Kda and Acyl carrier protein.

"Modified protein component" refers to a protein component that differs from the native functional protein in its amino acid sequence, structure or function and may be nonfunctional. It is to be noted that in plant mitochondria, the amino acid sequence of the native (functional) protein differs from the hypothetical translation production of the native gene sequence that encodes the protein due to one or more post-translational RNA editing events.

"Unedited" refers to a gene sequence identical to the gene sequence present naturally in the mitochondrial genome. It is often different from the mRNA product that encodes the native (functional) protein due to post-transcriptional RNA editing whereby certain C ribonucleotides are modified to U ribonucleotides and rarely certain U ribonucleotides to C ribonucleotides. For example the "translation product of an unedited coding sequence" is a protein that would be expected to be produced if no editing events at a post- transcriptional level occurred.

Dysfunctional: partially or completely non-functional

Transit peptide refers to an N-terminal presequence, which directs mitochondria-bound proteins encoded by the nucleus to the mitochondrion. The transit peptide is required for the transport of such proteins across the relevant membranes from their site of synthesis in the cytoplasm.

Inhibitors of mitochondria include but are not limited to Rotenone, Antimycin A, Cyanide, malonate (succinate dehydrogenase inhibitor), 2,4-Dinitrophenol (DNP), Carbonyl cyanide p-[trifluoromethoxy]-phenyl-hydrazone (FCCP), Oligomycin, oxyfluorfen, violaxanthin, piereicidin A, pyrazoles, pyridaben, quinazolines, acetogenins, thiangazoles, fenaza, thenoxyltrifluoroacetone, carfboxin, oxycarboxin, fenfuran, DDT, chlorproham, propanil, dinoseb, ioxynil, cyclodiene, paraquat, dinoseb, diafenthiuron, methomyl, Bongkrekic acid and hydramethylηon.

Agrobacterium refers to a bacterium of Agrobacterium species which is used to transform plants with gene(s) of interest using a suitable recombinant Agrobacterium binary vector. Likewise Agrobacterium binary vector refers to a recombinant DNA construct, which with other gene(s) of interest will be transformed into Agrobacterium cells. These cells in turn will be used for the transformation of plant cells, parts, seeds, or intact entire plants.

The inventors have surprisingly found that enhanced levels of carotenoids may be achieved by impairing mitochondrial function in plants, by way of genetic engineering or other means. Using the present invention the inventors were able to produce surprisingly high levels of carotenoids in a plant, most notably lycopene, in comparison to a plant not having undergone the method according to the present invention (table 1). Similar levels of carotenoids may only be encountered in processed and artificially enriched foods such as ketchup or concentrated tomato paste (see also Table 2). For example, said objective may be achieved by assembling a polynucleotide construct encoding a maize ubiquitin promoter (SEQ ID No 7), an Arabidopsis At-mRBPla mitochondrial targeting transit peptide (SEQ ID No 8-nucleotide sequence, SED ID No 9- polypeptide sequence), an unedited nad9 gene from rice mitochondria peptide (SEQ ID No 1 -nucleotide sequence, SED ID No 2- polypeptide sequence) and a Nopaline synthase (NOS) terminator. This assembly may be carried out so as to render the construct transcriptionally and translationally competent in plants, and additionally allow the protein product to be translocated to the mitochondrion. A plant cell/plant/plant part transformed by such or similar construct can be observed to show the aforementioned high levels of carotenoids, most notably lycopene and/or β-carotene.

This invention thus relates to a method of developing high carotenoid plants, plant cell, tissues or plant parts (comprising leaves, stems, roots, fruits and flowers).

This invention also relates to a method of developing plants with enhanced levels of lycopene and or/β-carotene.

This invention furthermore relates to a method of enhancing the levels of plant compounds derived from the isoprenoid pathway including but not limited to gibberellic acid, abscisic acid, pigments, sterols.

In the following reference is made to the examples which are meant to illustrate not to limit the present invention. Reference is also made to the figures 1 - 5 wherein:

Figure 1 shows: Plasmid pBS(SK-) construct used as a basic construct for transformation. Targeting sequence indicates the coding regions of At-mRBPla cloned in between Sac I and Xba I restriction sites to get pNGl. Figure 2 shows: Plasmid pBS(SK-) construct used as a basic construct for transformation. TS and unedited nad9 indicates the coding regions of At-mRBPla and edited nad9 gene cloned in between Xba I and BamHI restriction sites to get pNG3.

Figure 3 shows: Plasmid pBS(SK-) construct used as a basic construct for transformation. The boxes named TP and unedited nad9 indicate the coding regions of At-mRBPla and unedited nad9 inserted in multiple cloning site of the pBS(SK-) vector. The chimeric genes are under the control of ubiquitin promoter and Nos terminator.

Figure 4 shows: Plasmid pLAUό.hph encoding the hygromycin resistance gene (hph) driven by a Cassava vein Mosaic Virus promoter (CVMV) with a NOS terminator.

Figure 5 shows: The Standard curve for Lycopene used for determining the lycopene content in one embodiment of the present invention.

Figure 6 shows: A typical chromatogram obtained by resolving a lycopene extract as described herein.

Furthermore reference is made to the sequences wherein:

SEQ ID NO 1 : Rice (Oryza sativd) mitochondrial nad9 gene for NADH dehydrogenase subunit 9 (GenBank Accession number D50099 [RICMTNAD9]).

SEQ ID NO 2: Potato (Solarium tuberosum) mitochondrial nad9 gene for NADH dehydrogenase subunit 9 (GenBank Accession number X79774 [STMINAD9]).

SEQ ID NO 3: Tobacco (Nicotiana tabacum) mitochondrial nad9 gene for NADH dehydrogenase subunit 9 (GenBank Accession number YP 173479 [YP 173479]).

SEQ ID NO 4: Rice (Oryza sativd) mitochondrial nad9 protein for NADH dehydrogenase subunit 9 (translation of SEQ ID NO 1). 0.1 % BSA

4.0 mM 2-Mercaptoethanol

2 mM DTT

Wash Buffer (extraction Buffer without BSA & DTT

2 X Gradient buffer

0.5 M Sucrose

100 mM Tris HCL pH 7.5

6.O mM EDTA

Percoll gradient prepared in 2 X gradient buffer

Rice mitochondria (Approximately 75 ug) was resuspended in resuspension buffer and lysed with ¹A volumes of lysis buffer. After gentle mixing by inversion, phenol was added, followed by chloroform. Phenol chloroform extraction was carried out 3 times followed by chloroform extraction. DNA was precipitated from the aqueous phase with 2.5 volumes of ethanol and 1/1 Oth volumes of 3 M sodium acetate, by centrifugation at 13, 000 rpm for 20 minutes after a 30 minute incubation at —20 C. The DNA pellet was washed with 70 % ethanol, dried and dissolved in water.

The mitochondrial targeting sequence (At-mRBPla, see SEQ ID No 8 for DNA and SEQ

ID NO 9 for peptide) was cloned by polymerase chain reaction (PCR) from Arabidopsis thaliana cDNA, using the following set of primers:

Forward Primer: 5^Λ AAGAGCTCCCATGGTCTTCTGTAACAAACTCG 3"

Reverse Primer: 5^Λ AATCTAGACTTGGTAGACATCAACCGG 3"

The forward and the reverse primers have the Sad site and the Xbal site incorporated within them respectively and this facilitated the cloning of the PCR product into pBS

(SK-) and the resulting vector was named pNGl (Figure 1). Lysis of mitochondria

Rice mitochondria (Approximately 75 μg) was resuspended in resuspension buffer and lysed with ¹A volumes of lysis buffer. After gentle mixing by inversion, phenol was added, followed by chloroform. Phenol chloroform extraction was carried out 3 times followed by chloroform extraction. DNA was precipitated from the aqueous phase with 2.5 volumes of ethanol and 1/10 th volumes of 3 M sodium acetate, by centrifugation at 13, 000 rpm for 20 minutes after a 30 minute incubation at -20 C. The DNA pellet was washed with 70 % ethanol, dried and dissolved in water.

pNG3: Mitochonria-directed Unedited NAD9

Unedited nad9 (SEQ ID NO 1 for DNA and 4 for peptide) is obtained by PCR from rice mitochondrial DNA. The following primer combination was used for the amplification:

Forward primer: 5 AATCTAGAATGGATAACCAATCCATTTTCCAA 3

Reverse primer: 5^Λ AAGGATCCGGGATTATCCGTCGCTACG y

The forward primer has the Xba I site and the reverse primer has the BamHI site with which the unedited nad9 gene was cloned adjacent to the mitochondrial targeting sequence and the vector was named as pNG3 (fig 2).

pNGll:

The unedited nad9 gene was excised out of pNG3 with Sad and BamHI and was ligated with the ubiquitin promoter upstream (SEQ ID NO 7) and the Nos terminator downstream. The resulting construct was called pNGl 1 (fig 3).

Basic transformation work done and tissue culture procedure at laboratory level has been standardized for tomato {Lycopersicon esculentum) and transformation protocols are as follows:

Protocol for transformation of tomato:

Seeds:

Tomato {Lycopersicon esculentum Mill, variety S-22 (Arka Vikas) seeds were obtained from Indian Institute of Horticultural Research (IIHR), Hesarghatta, Bangalore. " The seeds were washed twice with double distilled autoclaved water. ^■ The seeds were rinsed in 70% Ethanol for 2 minutes.

^■ The seeds are immersed in a 70% solution of commercial bleach for 30 minutes, in a shaker.

■ They are washed till all the traces of bleach are removed.

^■ The seeds are dried on autoclaved tissue papers.

^■ Steps 'd' and 'e' are carried out in the laminar hood to avoid contamination.

Preparation of explant for bombardment:

The seeds are germinated in-vitro on half strength MS media. The 10-day old seedlings are uprooted the cotyledonary leaves are cut out and the center portion of the leaves are used for bombardments. About 40 such explants are placed at the center of a Petri plate containing osmoticum medium. After 4hrs incubation on this medium the calli were immediately subjected to microprojectile bombardment using the particle accelerator, PDS-1000/He.

Preparation of Gold Suspension:

The size of gold particles used was between 1.5-3.0μ, 6mg of gold particles was weighed in a 0.5 ml eppendorf tube. lOOμl of autoclave double distilled water was added to the gold particles and vortexed for 30 seconds in a microfuge. It is centrifuged for 30 seconds. lOOμl of 100% ethanol was added and vortexed for a minute. This was centrifuged for 30seconds in a microfuge at 10000 rpm. The supernatant was pipetted out. The ethanol wash is repeated again. 100 μl of sterile distilled water was added to the pellet. It is vortexed and 50 μl of the suspension is transferred into another 0.5 ml tube. Each of these tubes contains 50 μl of gold suspension and was stored at room temperature or at 4⁰C until DNA coating was done.

Particle Coating Protocol:

To 50μl of the gold suspension the two plasmids that is plasmid-containing gene of interest (plasmid containing the unedited nad9 gene or edited nad9 or unedited nad9 in antisense version) & pLAU6hph (the selectable marker hygromycin containing Plasmid, see Figure 4) were added in the ratio of 3:1 so as to give a total concentration of 10 μg of DNA. To this, 20 μl of 0.1M spermidine (Sigma, Aldrich) was added and mixed at low speed on the vortex. 50 μl of 2.5M CaCl₂ was then added and mixed well. The mix was left at room temperature for 10 minutes. It was later centrifuged for 30 seconds in a microfuge. The supernatant is removed in the laminar hood.

Preparation Microcarriers, Rupture Discs and Screens for Biolistic Transformation: Macrocarriers

Pre-assemble and pre-sterilize the macrocarrier set in a macrocarrier holder prior to performing sample cell/tissue bombardments. The macrocarrier was first immersed in 100% ethanol and then dried on autoclaved tissue paper. Then macrocarrier was left under UV light for surface sterilization for 10 minutes in the laminar hood.

Rupture disks

Transfer selected rupture disks to individual Petri dishes for easier handling. Sterilize rupture disks by briefly dipping them in 70% isopropanol just prior to insertion in the Retaining Cap. Do not soak for more than a few seconds. Extensive soaking may delaminate the disks, resulting in premature rupture. All disks, with the exception of those rated at 450, 650 and 1,100 psi are laminated. Autoclaving is not recommended because of potential delamination.

Stopping screens

Transfer selected stopping screens to individual Petri dishes for easier handling. Sterilization by autoclaving is recommended. Alternatively, these parts can be sterilized by soaking in 70% ethanol, followed by drying in a sterile environment. The stopping screens can be double autoclaved and reused.

Coating of Microcarrier onto Macrocarrier: The supernatant is removed from the DNA coated gold particles. Based on the number of plates to be bombarded, absolute ethanol is added to the DNA coated gold pellet - 10.0 μl is added for every macrocarrier to be coated, i.e. for every plate to be bombarded. The mixture is vortexed until a homogenous suspension is obtained and 10.0 μl is pipetted out and coated onto the center of the macrocarrier disc. The ethanol is allowed to dry away leaving the gold particles on the macrocarrier disc.

Performing a Bombardment:

Before the Bombardment

1. The bombardment parameters for gap distance between rupture disk retaining cap and microcarrier assembly are selected and adjusted. The bombardment was carried out at 900-psi rupture pressure and at a distance of 9cm. The stopping screen is supported in proper position inside fixed nest of microcarrier launch assembly.

2. The helium supply is adjusted to 200 psi in excess of the desired rupture pressure.

3. The rupture disk retaining cap, microcarrier launch assembly, and the entire apparatus is wiped clean with 70% ethanol.

4. The macrocarriers coated with DNA and load onto sterile macrocarrier holder the day of the experiment

Firing the Device

1. Plug in power cord form main unit to electrical outlet.

2. Power ON.

3. Sterilize chamber walls with 70% ethanol.

4. Load sterile rupture disk into sterile retaining cap.

5. Secure retaining cap to end of gas acceleration tube (inside, top of bombardment chamber) and tighten with torque wrench.

6. Load macrocarrier and stopping screen into microcarrier launch assembly.

7. Place microcarrier launch assembly and target cell in chamber and close door.

8. Evacuate chamber, hold vacuum at desired level (minimum 5 inches of mercury). 9. Bombard sample: Fire button continuously depressed until rupture disk bursts and helium pressure drops to zero lO.Release Fire button.

After the Bombardment

1. Release vacuum from chamber.

2. Target cells removed from chamber.

3. Unload macrocarrier and stopping screen from macrocarrier launch assembly.

4. Unload spent rupture disk.

5. Remove helium pressure from the system (after all experiments completed for the day).

Growth & Selection of Bombarded Cells:

After 16 hrs the calli were transferred to tomato regeneration medium containing BAP (4.5 mg/L) and IBA (0.2 mg/L - selection media containing 10mg/L hygromycin) medium for selection & incubated at 250C in light for 15 days. The resistant calli are subculture every 15 days onto fresh media. After regeneration the shoots are cut out and place on MS media containing BAP (4.5 mg/L), IBA (0.2 mg/L) and GA (1.0 mg/L), for elongation if only if the shoots have not elongated in the regeneration medium. The elongated shoots are shifted to MS media containing IAA (0.1 m/L) for rooting. The rooted plantlets are shifted to autoclaved distilled water for hardening for a couple of days and then into vermiculite. The plantlets are then shifted to red soil. Plant Growth

Plantlets on soil are transferred to the greenhouse. Plants are raised under standard conditions for the variety and fruits harvested. Cross-fertilization may be carried out for experimental or breeding purposes. Genetic studies may also be carried out on plants in the greenhouse.

Quantitative analysis of Lycopene content in the tomato samples by HPLC method Chromatographic system:

1. Waters 2695 XE Separations Module equipped with auto sampler, degasser, PDA detector and Millennium32 software

2. HPLC grade solvents -Methanol, Dichloromethane (filtered through 0.22micron membrane filter)

3. HPLC sample Vials

For Sample preparation:

Rotor Evaporator, Weighing Balance, Centrifuge, Tubes, Test Tube Stand and Filters.

Extraction Solvent: Hexane : Acetone : Methanol (2:1:1) with 2.5% BHT

Sample Solvent: Dichloromethane : Methanol (45:55)

Extraction of Lycopene from Tomato samples:

One gram of fresh tomato (harvested from the greenhouse) sample was weighed and ground in 10ml of extraction solvent using motor and pestle. Transferred to centrifuge tubes, sonicated for 6 minutes and centrifuged at 7500 rpm for 5 minutes. The clear organic layer is collected carefully and dried in the rotor evaporator, stored at -2O⁰C until use. All the operations are done under dim light. Avoid direct light and high temperature.

Sample Preparation:

The dried samples are redissolved in 1 ml of Sample solvent and 1:10 dilution was made from this stock. This diluted sample was passed through 0.22-micron filter before subjecting to HPLC analysis. Sample preparation should be carried out quickly to avoid loss of solvent.

Chromatographic conditions:

Mobile Phase: Methanol : Dichloromethane (95:5)

Methanol (HPLC Grade solvents were used for HPLC analysis) Pump Mode: Isocratic (MeOH:DCM ::95:5) Column: Bondapak™ C 18, 4.6 x 150mm, 5 μm

Detector: Waters 2996 PDA detector

Flow rate: 1.5ml/min

Injection volume: 20 μl

No. of Injections: 2

Run time: 15 min

Detection wavelength : 476 nm

A binary solvent system of methanol : methylene chloride (95:5) was used to resolve the Lycopene from the samples over 15 minutes. The run time was reduced to 15 minutes with a flow rate of 1.5ml/min to accommodate more samples. The detection wavelength for lycopene is 476nm, which was quantitated using standard curve.

Standard Curve: Standard Lycopene (Sigma) in the range of 10 to 80 μg/ml was prepared in HPLC grade Sample solvent with 0.1% BHT and subjected to analysis. A calibration curve was plotted - 'Lycopene 17JunO5' Calibration ID 1729, Date: 17/06/2005, R=0.9948 and R2 = 0.9897. (See figure 5 for standard curve and figure 6 for a typical chromatographic profile).

Table 1. Levels of lycopene obtained from transgenic and commercial varieties of tomato: Expressed in mg of lycopene per 100 g tomato fruit.

Table 1: Levels of lycopene analysed including transgenic lines and commercial varieties.

As can be seen the levels of carotenoids, most notably lycopene, achieved by the present invention may be as high as 6.5 (26.9:4.1), and range from 2.1 (14.3:6.7) to 6.5, and include ratios such as 4.2 (17.4:4.1), 3.0 (16.7:5.5), and 5.7 (23.5:4.1).

In absolute terms such high levels are elsewhere only achieved in processed foods such as concentrated tomato sauces, as can be seen from Table 2 below.

Table 2: Levels of lycopene in food and food products (ref Nguyen, M.L., Schwartz, SJ. 1999. Lycopene: Chemical and biological properties. Food Technol. 53:38-45.) References:

1. Agarwal S, Rao AV (2000) tomato lycopene and its role in human health and chronic diseases. Can Med Assoc Journ 163: 739-744

2. Bertram JS, Vine AL (2005) Cancer prevention by retinoids and carotenoids: independent action on a common target. Biochim Biophys Acta 1740: 170-178

3. Bhuvaneswari V, Nagini S (2005) Lycopene: a review of its potential as an anticancer agent. Curr Med Chem Anti-Cane Agents 5: 627-635

4. Bramley PM (1997) The regulation and genetic manipulation of carotenoid biosynthesis in tomato fruit. Pure & Appl Chem 69: 2159-2162

5. Bramley PM (2002) Regulation of carotenoid formation during tomato fruit ripening and development J Exp Bot 53: 2107-2113

6. Davuluri GR, van Tuinen A et al (2004) Manipulation of DETl expression in tomato results in photomorphogenic phetotypes caused by post-transcriptional gene silencing. Plant Journal 40: 344-354

7. Davuluri GR, van Tuinen A, et al (2005) Fruit-specific RNAi-mediated suppression of DETl enhances carotenoid and flavonoid content in tomatoes. Nat Biotech 23: 890-895

8. Faulks RM, Southon S (2005) Challenges to understanding and measuring carotenoid bioavailability, Biochim Biophys Acta 1740: 95-100

9. Fraser PD, Bramley P et al (2001) Effect of the Cnr mutation on carotenoid formation during tomato fruit ripening. Phytochem 58: 75-79

10. Fraser PD, Truesdale MR et al (1994) Carotenoid biosynthesis during tomato fruit development. Plant Physiol 105: 405-413

11. Fraser PD, Romer S et al (2002) Evaluation of transgenic tomato plants expressing an additional phytoene synthase in a fruit-specific manner. Proc Nat Acad Sci USA 99: 1092-1097

12. Fray RG, Wallace A et al (1995) Constitutive expressioni of a fruit phytoene synthase gene in transgenic tomatoes causes dwarfism by redirecting metabolites from the gibberellin pathway. Plant Journal 8: 693-701

13. Giege P, Sweetlove LJ et al (2003) Identification of mitochondrial proteini complexes in Arabidopsis using two-dimensional blue-native polyacrylamide gel electrophoresis. Plant MoI Biol Rep 21: 133-144 14. Giliberto L, Perrotta G et al (2004) Manipulation of the blue light photoreceptor cryptochrome 2 in tomato affects vegetative development, flowering time, and fruit antioxidant content. Plant Physiol 137: 199-208

15. Giovannoni JJ, DellaPenna D et al (1989) Expression of a chimeric polygalacaturonase gene in transgenic rin (Ripening inhibitor) tomato fruit results in polyuronide degradation but not fruit softening. Plant Cell 1: 53-63

16. Giuliano G, Aquilani R et al (2000) Metabolic engineering of plant carotenoids. Trends in Plant Sci 5: 405-407

17. Gruszecki WI, Strzalka K (2005) Carotenoids as modulators of lipid membrane physical proerties. Biochim Biophys Acta 1740: 108-115

18. Hirschberg J (2001) Carotenoid biosynthesis in flowering plants. Curr Op Plan Biol 4: 210-218

19. Kaliora AC, Dedoussis GVZ et al (2005) Dietary antioxidants in preventing atherogenesis. Atherosclerosis 11: 1-17

20. Levin I, Frankel P et al (2003) the tomato dark green mutation is a novel allel of the tomato homolog of the DEETIOLATEDl gene. Theor Appl Genet 106: 454- 460

21. Liu Y-S, Gur A et al (2003) There is more to tomato fruit colour than candidate carotenoid genes. Plant Biotechnology Journal (2003) 1: 195-207

22. Liu Y, Roof S et al (2004) Manipulation of light signal transduction as a means of modifying fruit nutritional quality in tomato. Proc Nat Acad Sci USA 101: 9897- 9902

23. Lummen P (1998) Complex I inhibitos as insecticides and acaricides. Biochim Biophys Acta 1364: 287-296

24. Mackenzie S, Mclntosh L (1999) Higher plant mitochondria. Plant Cell 11: 571- 585

25. Mehta RA, Cassol T et al (2002) Engineered polyamine accumulation in tomato enhances phytonutrent content, juice quality, and vine life. Nature Biotech 20: 613-ppppppppp

26. Muir SR, Collins GJ (2001) Overexpression of petunia chalcone isomerase in tomato results in fruit containing increased levels of flavonols. Nature Biotech 19: 470-474 27. Nguyen ML, Schwartz SJ (1999) Lycopene: Chemical and biological properties. Food technol 53: 38-45.

28. Reynard GB (1956) Origin of Webb Special (Black Queen) in tomato. Rep Tomato Genet Coop 40: 44-64

29. Romer S, Fraser PD et al (2000) Elevation of the provitamin A content of transgenic tomato plants. Nature Biotech 18: 666-669

30. Romer S, Fraser PD (2005) recent advances in carotenoid biosynthesis, regulation and manipulation. Planta 221: 305-308

31. Rosati C, Aquilani R et al. (2000) Metabolic engineering of beta-carotene and lycopene content in tomato fruit. Plant Journal 24: 413-419

32. Washam C (2005) An ounce of prevention from a ton of tomatoes. Environmental Health Perspectives 113: A178-A181

33. Ye X, Al-Babili S et al (2000) Engineering the provitamin A (B-carotene) biosynthetic pathway into (carotenoid-free) rice endosperm. Science 287: 303- 305

34. Geifman et al (2005) Clear tomato concentrate as a taste enhancer US Patent 6,890,574

35. Zelkha et al (2004) Carotenoid Extraction Process US Patent 6,797,

Claims

1. A method of enhancing the content of carotenoids and other isoprenoids, preferably of lycopene and or β-carotene, in a plant, plant cell, callus, tissue, fruit, root or other part of a plant, and/or increasing the height in a plant, said method comprising:

a. impairment of mitochondrial function, preferably impairment of mitochondrial complex I, II, III and /or IV, more preferably mitochondrial complex I in a plant, plant cell, callus, tissue, fruit, root or other part of a plant.

2. The method according to claim 1, wherein said impairment occurs using a modified protein component of mitochondrial complex I of said plant cell, preferably a protein component of mitochondrial complex I that is the translation product of an unedited coding sequence.

3. The method according to any of claims 1 - 2, wherein said impairment occurs by transforming said plant cell with a nucleic acid construct, preferably a DNA- construct, or by transforming said plant cell with a nucleic acid construct via Agrobacterium species-mediated transformation, preferably Agrobacterium tumefaciens, or by viral transfection using a suitable plant virus such as Tobacco Mosaic Virus, or by protoplast transformation.

4. The method according to any of claims 2 - 3, wherein said nucleic acid construct, preferably said DNA-construct, or said Agrobacterium comprises, preferably in a binary vector, a nucleic acid encoding said modified protein component of said mitochondrial complex I.

5. The method according to any of claims 2 - 4, wherein said modified protein component of mitochondrial complex I is a dysfunctional protein from another plant species than said plant cell or a dysfunctional protein of the same plant species as said plant cell.

6. The method according to claim 5, wherein said modified protein component of mitochondrial complex I is a dysfunctional protein selected from the group comprising NAD 1, 2, 3, 4, 4L, 5, 6, 7, 9, nuclear mitochondrial proteins 76 Kda, 55 Kda, 28.5 Kda, 22 Kda and Acyl carrier protein.

7. The method according to claim 4, wherein said nucleic acid encoding said modified protein component is selected from the group comprising SEQ ID NO: Z., 3 J .

8. The method according to any of claims 4 — 7, wherein said nucleic acid construct, preferably said DNA-construct, or said Agrobacterium, preferably said Agrobacterium binary vector, additionally comprises a nucleic acid encoding a mitochondrial transit peptide, operably linked to said nucleic acid encoding said modified protein component of said mitochondrial complex I.

9. The method according to any of claims 4 - 8, wherein said nucleic acid construct, preferably said DNA-construct, or said Agrobacterium, preferably said Agrobacterium binary vector, additionally comprises a promoter and a terminator, and said promoter and terminator are operably linked to said nucleic acid encoding said modified protein component of said mitochondrial complex I.

10. The method according to claim 9, wherein said nucleic acid construct, preferably said DNA-construct, or said Agrobacterium, preferably said Agrobacterium binary vector, comprises said promoter and said terminator according to claim 9, said nucleic acid encoding said mitochondrial transit peptide according to claim 8 and said nucleic acid encoding said modified protein component of said mitochondrial complex I according to claim 4, all of them being operably linked .

11. The method according to any of claims 1 - 2, wherein said impairment occurs by mutating said plant cell with respect to at least one of the components of said mitochondrial complex I in said plant cell.

12. The method according to claim 11, wherein said mutation occurs by mutating said plant cell at random using a chemical and/or physical mutagenic agent being applied to at least one plant cell, preferably a plurality of plant cells of the same plant, said chemical mutagenic agent preferably being selected from the group comprising ethyl methane sulfonate and said physical mutagenic agent being selected from the group comprising fast neutron, X-ray, gamma rays, and other mutagenic rays.

13. The method according to any of claims 11 — 12, said method, after mutating, further comprises the additional step of screening for a modified protein component of mitochondrial complex I other impaired mitochondrial functions of said plant cell in said plant cell or plurality of plant cells.

14. The method according to any of claims 1 — 2, wherein said impairment occurs by applying a chemical inhibitor of mitochondrial function, preferably a chemical inhibitor of mitochondrial complex I of said plant cell, to said plant cell, plant, callus, tissue, a part_of said plant, said plant in its entirety, fruit, root and / or other plant organ.

15. The method according to claim 14, wherein said chemical inhibitor is selected from the group comprising rotenone, antimycin A, oxyfluorfen, violaxanthin, piericidin,_piericidine A, pyrazoles, pyridaben, quinazolines, acetogenins, thiangazoles and fenaza.

16. The method according to any of the foregoing claims wherein said impairment is an inhibition of said of mitochondrial complex I.

17. The method according to any of the foregoing claims, said method further comprising the step of raising said plant cell, plant part, organ or seed having undergone the method of any of the foregoing claims, to produce a plant callus, tissue, plant, root and/or fruit.

18. A plant cell, callus, tissue, plant, root or fruit produced by the method according to any of the foregoing claims.

19. The plant cell, callus, tissue, plant, root or fruit according to claim 18, derived from a plant origin selected from the group comprising solanaceous species, including tomato, pepper, capsicum, potato, petunia and/or tobacco.

20. The plant cell, callus, tissue, plant, root or fruit according to any of claims 18 - 19 wherein the amount of carotenoid, preferably lycopene, is enhanced to >10mg, preferably >15 mg, even more preferably >16 mg and most preferably >20 mg/100g fresh weight of plant cells, callus tissue, plant, root and/or fruit.

21. The plant cell, callus, tissue, plant or fruit according to any of claims 18 - 20, wherein the amount of carotenoid, preferably lycopene is enhanced by at least two-fold,_preferably three-fold, in relation to a plant cell/callus/tissue/plant/root or fruit not having undergone the method according to any of claims 1 - 17.

22. A method of obtaining carotenoids, preferably lycopene and /or β-carotene, comprising the steps:

a. Producing a plant cell, callus, tissue, plant, root or fruit according to any of claims 18 -21, b. Purifying carotenoids, preferably lycopene and /or β-carotene, from said plant cell, callus, tissue, plant, root or fruit, preferably by solvent extraction and purification or by supercritical carbon dioxide extraction.

23. A nucleic acid construct comprising a nucleic acid encoding a modified protein component of mitochondrial complex I.

24. The nucleic acid construct according to claim 23, wherein said modified protein component of mitochondrial complex I is selected from the group comprising NAD 1, 2, 3, 4, 4L, 5, 6, 7 and 9, or other proteinaceous component of said complex.

25. The nucleic acid construct according to any of claims 23 — 24, wherein said modified protein component of mitochondrial complex I is from a species selected from the group comprising tomato, potato, tobacco, rice, maize, petunia, Arabidopsis, Lotus, Medicago, wheat and/ or Sorghum.

26. The nucleic acid construct according to any of claims 23 - 25, wherein said modified protein component of mitochondrial complex I has a sequence selected from the group comprising SEQ ID NO: 4, 5 and 6.

27. Use of a nucleic acid construct according to any of claims 23 - 26 for enhancing the content of carotenoids and other isoprenoids, preferably of lycopene and /or β- carotene, in a plant cell, plant, callus, tissue, fruit, root or other part of said plant, and/or for increasing the height in a plant.