WO2007069368A1 - Peptides issus du virus de l’hepatite c - Google Patents

Peptides issus du virus de l’hepatite c Download PDF

Info

Publication number
WO2007069368A1
WO2007069368A1 PCT/JP2006/315874 JP2006315874W WO2007069368A1 WO 2007069368 A1 WO2007069368 A1 WO 2007069368A1 JP 2006315874 W JP2006315874 W JP 2006315874W WO 2007069368 A1 WO2007069368 A1 WO 2007069368A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
peptide
hcv2a
hcv
virus
Prior art date
Application number
PCT/JP2006/315874
Other languages
English (en)
Japanese (ja)
Inventor
Kyogo Itoh
Akira Yamada
Michio Sata
Shigeru Yutani
Original Assignee
Kurume University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kurume University filed Critical Kurume University
Publication of WO2007069368A1 publication Critical patent/WO2007069368A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/29—Hepatitis virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C12N2770/24211—Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
    • C12N2770/24222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C12N2770/24211—Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
    • C12N2770/24234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the present invention relates to a composition useful for treatment of a hepatitis C virus (HCV) -related disease and diagnosis or progression prediction of an HCV-related disease.
  • HCV hepatitis C virus
  • HCV hepatitis C virus
  • interferon interferon
  • ribavirin ribavirin
  • polyethylene glycol-modified IFN- ⁇ has been used.
  • persistent responses are seen only in about 50% of treated patients (Manns MP, et al, Lancet. 2001; 358: 958-965).
  • antiviral therapy is not available in most developing countries where the majority of infected people live. Therefore, there is a need to develop new treatments.
  • CTL virus-specific cytotoxic T lymphocytes
  • HCV genotypes are mainly la and lb
  • many studies have been conducted on these types.
  • Several HLA-restricted epitopes derived from HCVla and lb have been identified as peptide vaccine candidates (Kurokohchi K, et al., J Hepatol. 2001; 34 (6): 930-935; Uno — Furuta S, et al., Vaccine. 2001; 19: 2190-2196; Dikopoulos N, et al., Hepatology. 2004; 40 (2): 300-309; Curiel TJ, et al "J Immunol.
  • HCV2a is the dominant genotype in China, Japan and Italy, little is known about HCV2a (Zein NN, Clin Microbiol Rev. 2000; 13 (2): 22 3-235; Huy TT, Abe K., Pediatr Int. 2004; 46 (2): 223-230).
  • an object of the present invention is to provide a molecule that is the basis of specific immunotherapy for hepatitis C virus (HCV) 2a infection.
  • Patent Document 1 WO2005 / 028503
  • Non-patent literature l Kurokohchi K, et al., J Hepatol. 2001; 34 (6): 930-935
  • Non-patent literature 2 Uno- Furuta S, et al., Vaccine. 2001; 19: 2190-2196
  • An object of the present invention is to provide a therapy for HCV-related diseases that can be applied to patients infected with HCV2a.
  • HCV hepatitis C virus
  • HLA human leukocyte antigen
  • the present invention provides a peptide that is recognized by an antibody against hepatitis C virus and has the following!
  • E1 335-344 AYAMRVPEVI (SEQ ID NO: 1)
  • E2 576-584 DFNASTDLL (SEQ ID NO: 2)
  • E2 627-635 NYTIFKIRM (SEQ ID NO: 3)
  • E2 649-658 NFTRGDRCNL (SEQ ID NO: 4)
  • NS2 889-897 VFDITKWLL (SEQ ID NO: 5)
  • NS2 936-945 KYVQMALLAL (SEQ ID NO: 6)
  • E2 576-584 DFN (A / T) S (T / M) DLL (SEQ ID NO: 12)
  • E2 627-635 N (Y / F) (T / S) (I / T / V) FK (I / V) RM (SEQ ID NO: 13)
  • NS3 1085-1094 VYHGAG (N / T) (K / R) T (L / I) (SEQ ID NO: 14)
  • the peptides of the present invention have any of the following sequences:
  • E2 576-584 DFNASTDLL (SEQ ID NO: 2)
  • E2 627-635 NYTIFKIRM (SEQ ID NO: 3)
  • NS3 1085-1094 VYHGAGNKTL (SEQ ID NO: 7)
  • the peptide of the present invention is capable of inducing HLA-A24-restricted cytotoxic T cells.
  • the present invention provides a pharmaceutical composition for treating a patient having an HCV-related disease, comprising the above-described peptide of the present invention as an active ingredient.
  • the present invention also provides a composition for diagnosing HCV-related diseases or predicting the progression of HCV-related diseases, comprising the above-described peptide of the present invention.
  • the present invention provides a method for treating a patient having an HCV-related disease by administering the above-described peptide of the present invention.
  • the present invention also provides a method for diagnosing HCV-related diseases using the above-described peptides of the present invention and a method for predicting the progression of HCV-related diseases.
  • HCV-related disease refers to infection with hepatitis C virus. Means the disease caused by it, and includes, for example, acute and chronic hepatitis, cirrhosis, and hepatocellular carcinoma.
  • the progression of HCV-related disease is typically progression from chronic hepatitis to cirrhosis and further to cirrhotic liver cancer.
  • FIG. 1 shows the cytotoxic activity of HCV2a peptide-specific CTL from PBMC of HCV2a-infected patients.
  • Figure 2 shows the cytotoxic activity of HCV2a peptide-specific CTL from PBMC of healthy donors not infected with HCV.
  • FIG. 3 shows the cytotoxic activity of HCV2a peptide-specific CTL from PBMC of healthy donors not infected with HCV.
  • FIG. 4 shows the cytotoxic activity of HCV2a peptide-specific CTL from PBMC of a healthy donor non-HCV-infected.
  • FIG. 5 shows the cytotoxic activity of HCV2a peptide-specific CTL from PBMC of a healthy donor non-HCV-infected.
  • Figure 6 shows the expression of HCV2amRNA in stably transfected C1RA2402 cells.
  • FIG. 7 shows IgG reactive to HCV2a 62 7-635 peptide in HCV2a infected and non-HCV healthy donors.
  • the present invention provides an immunogenic HCV-derived peptide that can be used for the treatment of a patient infected with HCV2a.
  • the hepatitis C virus-derived peptide (HCV peptide) of the present invention includes a partial amino acid sequence of a protein derived from hepatitis C virus type 2a, and includes an HLA-binding motif compatible with the patient's HLA in the sequence. This peptide can be recognized by antibodies in the blood of people infected with hepatitis C virus.
  • the hepatitis C virus-derived peptide according to the present invention is capable of inducing CTL, and the CTL thus induced targets HCV-infected cells and attacks the cells.
  • peripheral blood mononuclear cells of HCV2a-infected persons are stimulated with an HCV2a-derived peptide having an HLA-A24 binding motif.
  • HCV2a-derived peptide having an HLA-A24 binding motif.
  • IgG immunoglobulin G
  • HCV2a 576-584 and HCV2a 627-635 from E2 protein and HCV2a 1085-1094 from NS3 protein induced CTL at a particularly high frequency.
  • HLA-A24-restricted cytotoxic activity was demonstrated by peptide-specific CD8 + T cells reactive to each peptide.
  • HCV2a 1085-1094 reactive T cells had cytotoxic activity against target cells transfected with the HCV2aNS3-5 gene.
  • significant levels of HCV2a 627-635 peptide-specific IgG were detected in the plasma of HCV2a-infected individuals.
  • 1, 2 or 3 amino acid residues may be conservatively substituted in the amino acid sequence shown in SEQ ID NOs: 1-11.
  • Conservative substitutions are those in which one amino acid is replaced with another amino acid with similar properties, so that the secondary structure and hydepathic properties of the polypeptide are not substantially altered by those skilled in the peptide chemistry arts! , Replace as expected.
  • the following groups of amino acids that are conservative substitutions for each other are generally known: (1) glycine, asparagine, gnoletamine, cystine, serine, threonine and tyrosine; (2) alanine, parin, leucine, isoleucine, (3) Glycine, Endolanin, Serine, Threonine and Methionine; (4) Leucine, Isoleucine and Parin; (5) Glutamine and Asparagine; (6) Glutamate and Aspartate; 7) Arginine, lysine and histidine; (8) Feruaranine, tryptophan and tyrosine.
  • the peptide of the present invention only needs to have the above-mentioned amino acid sequence to the extent that a desired action and effect can be obtained, and may further include an additional sequence.
  • a person skilled in the art can naturally understand how much sequence is allowed to be added to the N-terminal side and C-terminal side in order to achieve the desired effect as an antigen peptide. . Therefore, for example, an amino acid sequence useful for promoting immunization, an amino acid sequence that facilitates formulation, or a peptide as a fusion protein on the N-terminal side and / or C-terminal side of the peptide according to the present invention.
  • amino acid sequence that is convenient for the expression of amino acids or an amino acid sequence that is convenient for the production and purification of peptides may be added.
  • the peptide according to the present invention may be chemically modified as long as the specificity of binding to the antibody is not lost, or it may be added with a polymer or a sugar chain.
  • the HCV peptide according to the present invention is a gene recombination technique using a normal chemical synthesis method, an enzymatic decomposition method of a protein molecule, or a host transformed to express a base sequence encoding the target amino acid sequence. Etc. can be manufactured.
  • the target peptide When the target peptide is produced by a chemical synthesis method, it can be produced by a known and commonly used technique in ordinary peptide chemistry, for example, using a peptide synthesizer. Thus, it can be synthesized by a solid phase synthesis method.
  • the crude peptide thus obtained can be purified by purification methods commonly used in protein chemistry, such as salting-out, ultrafiltration, reverse phase chromatography, ion exchange chromatography, and affinity. It can be purified by chromatographic methods.
  • a desired peptide is produced by gene recombination technology
  • a synthetic or cloned DNA fragment encoding the target amino acid sequence is incorporated into an appropriate expression vector, and this expression vector is used.
  • the desired peptide can be obtained by transforming microorganisms or animal cells using, and culturing the resulting transformant.
  • expression vectors that can be used plasmids, virus vectors, and the like known in the art can be used.
  • Host cell transformation methods using expression vectors in this peptide production technique include methods known per se, such as the calcium chloride method, calcium phosphate coprecipitation method, DEAE dextran method, lipofectin method, The positioning method can be used and should be selected as appropriate based on the host cell used.
  • the obtained peptide can be purified from the cell extract or culture supernatant collected from the cultured medium by the purification method described above.
  • the peptide of the present invention is a pharmaceutical composition for treating a patient having an HCV-related disease. That is, it is useful as a peptide vaccine.
  • a vaccine consisting of a hepatitis C virus-derived peptide is prepared by appropriately mixing the peptide produced as described above with a pharmaceutically acceptable adjuvant and sputum or carrier. Adjuvants that can enhance the immune response, such as Freund's incomplete adjuvant, aluminum hydroxide gel, can be used.
  • the carrier for example, phosphate buffered saline (
  • PBS distilled water
  • physiological saline physiological saline
  • the peptide vaccine can be administered by a transdermal route such as oral or intravenous administration or subcutaneous administration, depending on the form of use.
  • the dosage form include tablets, granules, soft capsules, hard capsules, liquids, oils, and emulsifiers.
  • the dosage of such a pharmaceutical composition may vary depending on the symptoms of the patient to whom it is administered, but in general, 0.1 to 10 mg of peptide per day is preferable for adults. The interval is preferably administered once every few days to several months.
  • a peptide vaccine may be used in combination with an antiviral agent such as interferon or ribavirin.
  • the hepatitis C virus-derived peptide to be administered is selected based on the peptide reactivity of anti-HCV antibodies present in the patient's blood or the presence of CTL. More preferably, the selection is based on the peptide reactivity of the anti-HCV antibody and the presence of CTL.
  • “peptide reactivity of anti-HCV antibody” means that any of the peptides to be administered is recognized by the anti-HCV antibody present in the blood of the patient. Higher therapeutic effects can be expected by examining the peptide reactivity of anti-HCV antibodies in each patient and administering only the appropriate peptides for each patient, so-called tailor-made administration.
  • the tailor-made administration induces secondary immunity promptly, resulting in a safer and better clinical effect (Mine et al., Clin Can. Res. 929-937, 2004).
  • HCV-related diseases can be confirmed by monitoring the blood antibody titers of subjects suffering from HCV-related diseases, that is, the blood concentration of antibodies reactive to peptides, by conventional methods such as ELISA. Can be done.
  • the amount of HCV RNA can be monitored by measuring the amount of HCV RNA using conventional methods such as RT-PCR. It can be done.
  • the peptide of the present invention is also useful as a composition for diagnosing a patient having an HCV-related disease or predicting the progression of the disease.
  • the antibody titer in the blood of a subject can be measured using an antigen-antibody reaction well known in the art.
  • the measurement can be performed as follows.
  • the antigen peptide is bound to a conventional ELISA plate such as 96well, and the plate is appropriately blocked to prevent nonspecific adsorption.
  • dilute the prepared blood serum of the test subject appropriately and cover each well of the plate and react for a predetermined time.
  • the plate After washing the plate to remove unbound components, add antibodies that can bind to human antibodies (eg, rabbit anti-human antibodies). If it is desired to detect IgG, ⁇ chain specific anti-HgG can be used. After reacting for a specified time, the plate is washed and detectably labeled antibody (eg anti-rabbit IgG) is added. Labeling can be performed by methods well known to those skilled in the art using enzymes, fluorescent dyes, chemiluminescent substances, piotin, radiation compounds and the like. After reacting the plate for a specified time, the label is detected by adding an appropriate substrate and measuring the decrease in substrate or increase in product, or by measuring fluorescence, luminescence, or radioactivity. In this way, the amount of antibody against a specific peptide in the serum of the subject can be measured. In addition, the progression of HCV-related disease can be predicted by monitoring the amount of antibody.
  • detectably labeled antibody eg anti-rabbit IgG
  • Labeling can be performed by methods well known to
  • xMAP technology is one of highly sensitive methods. This is a flowmetry measurement method developed by Luminex using a fluorescent microbead array system. Microbeads to which peptides are bound are brought into contact with serum, and then a fluorescently labeled secondary antibody is bound to the flow. Measure fluorescence intensity by measurement.
  • an immunochromatography method can be used.
  • a portion in which the antigen (or antibody) is linearly distributed is made on the test paper, and the complex of the antibody in the sample and the antigen labeled with the colored particles moves on the test paper.
  • Qualitative analysis is based on the presence or absence of colored lines that appear by intensive capture by antigens (or antibodies). If this method is used, a simple facility can be In between (within 20-30 minutes).
  • the subjects were 20 HLA-A24 positive chronic hepatitis patients with HCV2a infection and 15 healthy donors without HCV infection.
  • PBMCs from 10 HLA-A24 positive patients and 5 HLA-A24 positive HCV non-infected healthy donors were used.
  • HCV2a patients were seropositive for anti-HCV antibodies (Abs). Healthy donors who were not infected with HCV had symptoms of liver dysfunction and were strong.
  • PBMC peripheral blood mononuclear cells
  • 20 ml of peripheral blood was collected and PBMCs were prepared by Ficoll-Conley density gradient centrifugation.
  • HCV2a-derived peptides used in the following Examples. These peptides are eleven types of 9-mer or 10-mer synthetic peptides with HLA-A24 binding motif derived from HCV-genotype 2a protein. Negative controls include influenza virus (Flu) -derived peptide (RFYIQMCYE L (SEQ ID NO: 15)), EBV-derived peptide (TYGPVFMCL (SEQ ID NO: 16)), and human immunodeficiency virus (HIV) with HLA-A24 binding motif The peptide (RYLRQQLLGI (SEQ ID NO: 17)) was used. All peptides are BIOSYNTHESIS (Lewisville, TX) or SynPep (Dublin,
  • CIR-A2402 is a subline of CIR lymphoma that expresses HLA-A * 2402 (Dr. M. Takiguchi, Kumamoto University, Japan).
  • the cells were maintained in RPMI-1640 medium supplemented with 10% FCS (fetal bovine serum) and 500 / zg / ml hygromycin B (Gibco BRL, New York, NY, USA).
  • Plasmid pSGR—JF HI which contains the conserved sequence of NS3—NS5 of HCV2a subgenomic JFH-1, is described in Kato et al. (Gastroenterology. 2003; 125 (6): 1808-1817). The plasmid was linearized by Xbal digestion, and then Mangbean 'nuclease (New England
  • the pulse was imprinted at 300 V and 950 F.
  • the transferred cells were transferred to RPMI1640 medium containing 10% FCS and cultured in a culture flask. 18—24 hours after transfusion, G418 (0.5 mg / ml) (Nacalai
  • Media include 45% RPMI—1640, 45% AIM—V media (GibcoBRL, NY, USA), 10% FCS, lOOU / ml interleukin 2 (IL—2), and gentamicin strength of 40 / z gZml . Every 3-4 days, half of the culture was removed and replaced with fresh medium containing 20 gZml of the corresponding peptide. On the 15th day, half of the cultured cells in the well were equally divided into four wells. Two wells were further stimulated with C1R-A2402 cells pulsed with the corresponding peptide, while the other two were stimulated with C1 R-A2402 cells pulsed with the control HIV peptide.
  • IFN- ⁇ production in response to control HIV peptide was subtracted as background.
  • PBMCs stimulated with the HCV2a peptide were cultured for about 2-3 weeks using irradiated HLA-A24-positive buffy coat cells as feeder cells to obtain a sufficient number of cells for analysis of cytotoxic activity.
  • PBMCs were seeded on culture plates with 4ml0 6 cells Zml in 10% FCS, PRMI1640 medium and incubated at 37 ° C for 60-90 minutes to allow the cells to attach to the culture plates.
  • the adherent monocyte-rich population was cultured in the following media for 7 days.
  • the medium is 45% RPMI—164 0, 45% AIM—V medium, 10% FCS, 100 U / ml interleukin 1 2 (IL—2), 10
  • DC was matured by adding lOngZml of TNF-a (Sigma, MI, USA) to the culture.
  • cells were collected and used as DC.
  • the DCs are washed with PBS, 1. Resuspended in Oml medium and incubated with 3 gZml j8 2-microglobulin (Sigma) and 10 ⁇ gZml peptide for 2 hours at 37 ° C. did. After irradiation (40 Gy), DC were further incubated with non-adherent PBMC in a 1:20 ratio. On days 7, 14, and 21, PBMC cultures were pulsed with peptide and restimulated with irradiated DC at a ratio of 1:40. On day 28, a cytotoxic activity assay was performed.
  • Plasma levels of peptide-specific IgG were measured with a fluorimeter as previously reported ( Komatsu N, et al, Scand J Clin Lab Invest. 2004; 64 (6): 535-545).
  • each manufacturer's method 100 / zg in 0.1 M MES buffer, pH 4.5
  • color-encoded beads Luminex Corp., Austin, TX
  • Dilute plasma samples (1: 100, 1: 200, and 1: 400) in 96-well filter plates (NUNC, NY, USA) with plate-conjugated color-encoded beads and plate shaking Incubated in a vessel (300 rpm) at room temperature for 2 hours.
  • HLA-A24-binding putative peptides derived from HCV2a were analyzed by BIMAS software (Bioin formatics and Molecular Analysis Section, NIH). Peptide bond scores were calculated based on the predicted half-life of HLA class I molecular force dissociation (Bioinformatics and Molecular Analysis Section, Computational Bioscience and Engine Laboratory, Division of Computer Research & Technology, NIH).
  • HCV2a-derived peptides (HCV2a 576-584, HCV2a 627-6 35, HCV2a 649-658, HCV2a 889-897, HCV2a 1085-1094, HCV2a 1447-1456, and HCV2a 2445-2453) are 1Z3 or more of patients From which peptide-specific CTLs were derived.
  • the HCV2a 627-635 peptide induced peptide-specific CTL most efficiently, and this peptide produced 7 peptide-specific CTLs out of 10 HLA-A24 positive patients.
  • these 11 peptides were able to induce peptide-specific CTLs from PBMCs of healthy donors who were not infected with HCV.
  • cytotoxic activity of peptide-induced CTL from PBMC in HVC2a infected patients was examined. Cytotoxic activity against C1R-A 2402 cells pulsed with the corresponding HCV2a peptide or HIV peptide as a negative control was examined by a standard 6 hour 51 Cr-release assay.
  • CTL induced by three peptides showed peptide-specific cytotoxic activity.
  • Representative results for patients 1, 2, 4 and 8 are shown in FIG. The value is the average of three measurements, and statistical analysis was performed by Student's t test (* P ⁇ 0. 05).
  • These peptide-specific CTLs show significantly higher levels of cytotoxic activity against C1R-A2402 cells loaded with the corresponding peptide compared to C1R-A2402 cells loaded with the control HIV peptide. It was.
  • HCV2a-derived peptides (HCV2a 576-584, HCV2a 627-635, and HCV2a 1085-1094) are cytotoxic to target cells that express the corresponding peptide and HVC2a. It shows that CTL can be induced.
  • HCV2a 627-635 peptide in particular, was able to induce peptide-specific CTL from more than half of the patients tested.
  • HCV2a 576-584 The amino acid sequence of these three peptides was conserved for 6, 5, and 7 HCV2a strains, respectively.
  • PBMCs of healthy donors not infected with HCV were stimulated with DC loaded with HCV2a peptide in vitro, and their cytotoxic activity was examined by 6 hr 51 Cr-release assay.
  • the target was C1R-A2402 cells pulsed with the corresponding HCV2a peptide or control HIV peptide.
  • In vitro stimulation of DC pulsed with HCV2a 576-584, HCV2a 627-635, or HCV2a 1085- 1094 peptide was able to induce peptide-specific CTL from PBMCs of healthy donors without HCV infection (Fig. 2).
  • the values shown are the average of three measurements, and statistical analysis was performed by Student's t test (* P ⁇ 0.05).
  • CD8 + cells of PBMC stimulated with HCV2a peptide were purified and examined for cytotoxic activity against C1R-A2402 cells pulsed with the corresponding HCV2a peptide in the presence of various mAbs.
  • Purified CD8 + T cells showed peptide-specific cytotoxic activity, which was blocked by anti-HLA class I antibody, but anti-HLA class I It was not blocked by the I antibody ( Figure 3). These results indicate that peptide-specific CD8 + T cells show cytotoxic activity in an HLA class I-restricted manner.
  • C1R-A2402 cells stably transfected with HCV2aRNA were established to examine whether HCV2a peptide-specific CTL can kill C1R-A2402 cells expressing HCV2a.
  • Cytotoxic activity on C1R-A2402 cells transfected with HCV2a 1085-1094 peptide-specific CTL force HCV2a from healthy donors was measured by 6 hr 51 Cr-release assay.
  • the 51 Cr-release assay revealed that HCV2a 1085-1094 peptide-specific CTL from 3 healthy donors significantly damaged C1R-A2402 cells tranfected with HCV2a. ( Figure 4).
  • RT-PCR was performed to confirm that HCV2a mRNA was expressed in C1R-A2402 cells and their parent cells transfected with HCV2a.
  • CDNA was synthesized from 5 ⁇ g of total RNA and used as a template for PCR amplification.
  • a set of oligonucleotide primers specific to HCV2a forward primer, nucleotide position 5 050-5069: 5'-ACACATAGACGCCCACTTCC-3 '(SEQ ID NO: 18
  • reverse primer nucleotide positions 5214-5233: 5 ACGGTACAGGAGAGGTGTGG -3 '(SEQ ID NO: 19) was used in PCR amplification.
  • PCR was performed using Taq DNA polymerase (Promega, WI, USA) for 30 cycles (1 minute, 95 ° C, 1 minute 60 ° C, and 1 minute, 72 ° C). J8actin was used as a control. PCR products were analyzed on 2% agarose gels. As a result, RT-PCR analysis confirmed the presence of HCV2a subgenomic RNA in stably transfected C1R-A2402 cells (Fig. 6).
  • FIG. 7A shows anti-HCV2a 627-635 IgG lenore in 1: 100 diluted plasma of HCV2a infected and non-HCV healthy donors.
  • the patient's anti-HCV2a 627-635 IgG (242.5 ⁇ 95. OFIU) was significantly higher than the healthy donor without HCV (64.0 ⁇ 52. OFIU) (P 0.001).
  • FIU Fluorescence Intensity Unit
  • HCV2a 627-635 IgG When the samples were cultured on plates coated with HVC2a peptide, anti-HCV2a 627-635 IgG was absorbed. It was not absorbed on plates coated with irrelevant HIV peptide or HCV2a 2850-2858 peptide. This demonstrates the presence of HCV2a 627-635 peptide-specific IgG in the serum of HCV2a-infected individuals.
  • HCV2a peptide-specific CTLs derived from PBMCs of HLA-A24-positive, non-HCV-infected healthy donors using peptide pulse DC showed peptide-specific cytotoxic activity in an HLA class I-restricted manner. More importantly, HCV2a 1085-1094 peptide-specific CTLs derived from PBMCs of healthy donors not infected with HCV showed cytotoxic activity against C1R-A2402 cells transfected with HCV2a. This result suggests that the HCV 2a 1085-1094 peptide was naturally processed and presented on HCV2a-infected cells. Taken together, these results suggest that the HCV2a peptide of the present invention has immunogenicity and is therefore useful for specific immunotherapy of HLA-A24 positive HCV2a-infected persons.
  • LA class I-binding tumor antigen-derived peptides can be recognized even by IgG (Ohkouch i S, et al. Tissue Antigens. 2002; 59: 259-272; Kawamoto N, et al., Tissue Antigens. 2003; 61: 352-361), peptide vaccines are often known to induce IgG reactive to the peptide in clinical trials (Noguchi M, et al., Pro state. 2003; 57: 80-92; Tanaka S, et al "J Immunother.
  • the peptide of the present invention is a peptide against HCV2a infection. Expected to be useful as a vaccine.
  • the peptides of the present invention are useful for the treatment of HCV-related diseases and the diagnosis or prediction of progression of HCV-related diseases.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Communicable Diseases (AREA)
  • Mycology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oncology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne un peptide reconnu par un anticorps du virus de l’hépatite C (HCV). Ledit peptide possède une séquence d’acides aminés représentée par l’une quelconque des SEQ ID NOS:1 à 14. L’invention concerne également une composition médicinale pour le traitement d’un patient souffrant d’une maladie apparentée au HCV, qui contient le peptide décrit ci-dessus en tant que principe actif; ainsi qu’une composition visant à diagnostiquer une maladie apparentée au HCV ou à prédire l’évolution d’une maladie apparentée au HCV, qui contient le peptide décrit ci-dessus. Ce peptide et ces compositions telles que décrits ci-dessus sont utiles pour traiter et diagnostiquer un patient infecté par le HCV2a et pour prédire l’évolution de la maladie.
PCT/JP2006/315874 2005-12-13 2006-08-10 Peptides issus du virus de l’hepatite c WO2007069368A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2005359511A JP2009051733A (ja) 2005-12-13 2005-12-13 Ｃ型肝炎ウイルス由来ペプチド
JP2005-359511 2005-12-13

Publications (1)

Publication Number Publication Date
WO2007069368A1 true WO2007069368A1 (fr) 2007-06-21

Family

ID=38162684

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2006/315874 WO2007069368A1 (fr) 2005-12-13 2006-08-10 Peptides issus du virus de l’hepatite c

Country Status (2)

Country Link
JP (1) JP2009051733A (fr)
WO (1) WO2007069368A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000075338A2 (fr) * 1999-06-04 2000-12-14 The Government Of The United States Of America As Represented By The Secretary, Department Of Health And Human Services Genome clone du virus de l'hepatite c de genotype 2a et son utilisation
WO2004011650A2 (fr) * 2002-07-24 2004-02-05 Intercell Ag Antigenes a phase de lecture alternante a partir de virus
WO2005080575A1 (fr) * 2004-02-20 2005-09-01 Tokyo Metropolitan Organization For Medical Research Construction d'acides nucléiques contenant le genome complet du virus humain de l'hépatite c, cellule réplicative du génome complet du virus recombiné ayant la construction d'acides nucléiques transférée dans celle-ci et procédé de construc

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000075338A2 (fr) * 1999-06-04 2000-12-14 The Government Of The United States Of America As Represented By The Secretary, Department Of Health And Human Services Genome clone du virus de l'hepatite c de genotype 2a et son utilisation
WO2004011650A2 (fr) * 2002-07-24 2004-02-05 Intercell Ag Antigenes a phase de lecture alternante a partir de virus
WO2005080575A1 (fr) * 2004-02-20 2005-09-01 Tokyo Metropolitan Organization For Medical Research Construction d'acides nucléiques contenant le genome complet du virus humain de l'hépatite c, cellule réplicative du génome complet du virus recombiné ayant la construction d'acides nucléiques transférée dans celle-ci et procédé de construc

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KURIHARA C. ET AL.: "Molecular characterization of hepatitis C virus genotype 2a from the entire sequences of four isolates", J. MED. VIROL., vol. 64, no. 4, 2001, pages 466 - 475, XP002320581 *
YANAGI M. ET AL.: "Hepatitis C virus: an infectious molecular clone of a second major genotype (2a) and lack of viability of intertypic 1a and 2a chimeras", VIROLOGY, vol. 262, no. 1, 1999, pages 250 - 263, XP000911930 *

Also Published As

Publication number Publication date
JP2009051733A (ja) 2009-03-12

Similar Documents

Publication Publication Date Title
Battegay et al. Patients with chronic hepatitis C have circulating cytotoxic T cells which recognize hepatitis C virus-encoded peptides binding to HLA-A2. 1 molecules
Hiroishi et al. Cytotoxic T lymphocyte response and viral load in hepatitis C virus infection
Kita et al. HLA B44-restricted cytotoxic T lymphocytes recognizing an epitope on hepatitis C virus nucleocapsid protein
Koziel et al. Intrahepatic cytotoxic T lymphocytes specific for hepatitis C virus in persons with chronic hepatitis.
JP4342597B2 (ja) Ｃ型肝炎ウイルス由来ペプチド
US20100099613A1 (en) Peptides for inducing a ctl and/or htl response to hepatitis c virus
Irshad et al. Hepatitis C virus core protein: an update on its molecular biology, cellular functions and clinical implications
JP5568309B2 (ja) Ｃｔｌ誘導剤組成物
Brinster et al. Different hepatitis C virus nonstructural protein 3 (Ns3)-DNA [ndash] expressing vaccines induce in HLA-A2. 1 transgenic mice stable cytotoxic T lymphocytes that target one major epitope
CA2696437A1 (fr) Production et utilisation de particules du virus de l'hepatite c marquees par un epitope
Cerny et al. Immunological aspects of HCV infection
CA2794359A1 (fr) Variant de vhc avec productivite elevee de virus de l'hepatite c infectieux, et utilisation de celui-ci
EP0754193A1 (fr) Peptide de noyau du virus de l'hepatite c pour la stimulation des lymphocytes t cytotoxiques et le diagnostic de l'exposition au vhc
JP5133706B2 (ja) Ｃ型肝炎ウイルス由来ペプチド
Torresi et al. Neutralising antibody, CTL and dendritic cell responses to hepatitis C virus: a preventative vaccine strategy
WO2007049394A1 (fr) Peptides provenant du virus de l’hepatite c
WO2007083806A1 (fr) Peptide antigène à restriction hla-a2 dérivés du virus de l'hépatite c 2a
WO2007069368A1 (fr) Peptides issus du virus de l’hepatite c
Frasca et al. Antibody–Selected Mimics of Hepatitis C Virus Hypervariable Region 1 Activate Both Primary and Memory Th Lymphocytes
Wang et al. Identification of hepatitis C virus (HCV) 2a-derived epitope peptides having the capacity to induce cytotoxic T lymphocytes in human leukocyte antigen-A24+ and HCV2a-infected patients
WO2010050181A1 (fr) Vaccin destiné à prévenir l’apparition et la récurrence du cancer du foie induit par le virus de l’hépatite c
Zabaleta et al. Induction of potent and long-lasting CD4 and CD8 T-cell responses against hepatitis C virus by immunization with viral antigens plus poly (I: C) and anti-CD40
Liao et al. Hepatitis B virus precore protein augments genetic immunizations of the truncated hepatitis C virus core in BALB/c mice
Wang et al. New epitope peptides derived from hepatitis C virus (HCV) 2a which have the capacity to induce cytotoxic t lymphocytes in HLA‐A2+ HCV‐infected patients
Tamura et al. Identification of hepatitis C virus 1b-derived peptides recognized by both cellular and humoral immune systems in HCV1b+ HLA-A24+ patients

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06782660

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP