WO2007066823A1

WO2007066823A1 - Antibody against connective tissue growth factor or composition containing the same

Info

Publication number: WO2007066823A1
Application number: PCT/JP2006/324894
Authority: WO
Inventors: Poh Sing Ng; Koki Endo; Megumi Iijima; Tomohiro Mori
Original assignee: Nosan Corporation
Priority date: 2005-12-07
Filing date: 2006-12-07
Publication date: 2007-06-14
Also published as: JP2009067678A

Abstract

It is intended to provide an antibody, which can specifically recognize a high-order structure of the natural type of CTGF at a high affinity or its fragment, a composition comprising this antibody or its fragment which is usable in treating, preventing or diagnosing CTGF-related diseases such as fibrosis or cell proliferative diseases, and a method of producing the above antibody.

Description

For children is the field of art that includes it

This book relates to a body that can uniquely recognize the structure of (onnecve T ssue oh Fac o TF).

Also includes methods for making the above bodies, as well as

Regarding composition.

HCT F is a stain-bearing connector consisting of 322 amino acids (or 349 amino acids when containing guna), and its amino acid and nucleotide sequences have been determined since 199 (~ 2). While it is known to have this use, it is also known to be associated with harms such as cell illness, radiation, atherosclerosis, and glaucoma (1-8, 24). In order to prevent this damage, it has been proposed to use the body against human F (~ 8, 4 in general, for the production of antibody, immunize animals by using tac or The method is used: at n V Vo, the immunized animal, by recognizing it as a foreign body, presented the antigen to the antigen vesicles and was gnagged and activated by the T vesicles and activated. T also stimulates the B vesicles and is done by antibodies.

However, it is extremely difficult to produce antibodies by using the conventional biotechnology that directly uses the human TF to directly immunize animals, and it is extremely difficult to produce antibodies that retain the natural high-order immunity. In many cases, they either failed or were very expensive. This was also observed when, for example, F was immunized with a bare fish. Therefore, TF originally Since it has a white binding property, it adheres to the surface of, and is not immunized to that extent, while TF is susceptible to decomposition during purification and storage, and thus is an unstable protein. It is estimated that

H TF is also prone to alter intramolecular dislocations because of the unique structure of this white, i.e., the 39-system system and the presence of at least 5 phycosystems. Has characteristics. Therefore, when this white is in the natural environment), the molecular structure of the environment is still (PH, ion), which changes its natural structure, resulting in white properties. Estimated. In addition, it is expected that TF will be attached by (gucan), which is also important in terms of construction. Due to this special structure, the heat T F

It will be a future topic to make it possible to obtain a body that uniquely recognizes the structure.

Although there are such patents and works related to the human TF body as described above, it is for producing a large amount of the body, and it is difficult to actually obtain a body that specifically recognizes the body. Therefore, the present situation is that a practical antibody has not emerged even though it is desired.

Provides a method for producing a body using N (is a gene), and N is described in, for example, 9, 5 to 8. , NV, it is a gene vaccine species that expresses N to express in the body so that it will give rise to a certain antigen, and inoculates such body with such body. Such antigens include, for example, viral origin, raw material, protozoan source, and microbial source. , DN is expressed, antigen is produced, and it is taken up by the infectious system of the body to give rise to the body.

For N, 9 describes the manufacture of a cylinder using. This antigen is secreted by the white N

It is possible to express D that connects the tags , Including immunizing animals therewith. The tag plays a role similar to that of an horse mackerel, and at "o, it also creates a body for

Patent Main Features ""

11 507332

2 special 11 18895

3 special 2 2004 132974

4 special 200 2 529 066

5 pieces 2002 504332

6 specials 2005 505 757

7 book special 2002 524422 report

8 United States 2004242482

9 bottles 2000 582427

D ・ B adha J e B o 114 1285 1294 (1991) 2 ga ash o B o e 4: 637 645 (1993) 3 na o J B oche 135 347 354 2004)

4 T o J e u a Phys o ogy 181 53 159 (1999) 5 J ・ Boy e P oc Na cad Sc U g 4626 14631 (1997)

6 una han nnu ev uno 8 27 974 (2000) 7 D ・ Tang Na ue 356 152 154 (1992) 8 HT ghe uno oday 9 89 97 (1998) 9 ・ ha be s ・ Johns on Na e B o echno ogy 21 (9) 088 1092 (2003)

Human TF is known to have a variety of biological functions as proliferators that belong to N-pha and are composed of 4 di. In particular, TF is attracting attention as an oxidative molecule in dermatosis and the like, and the specific body is involved in studies that control the pathophysiology of this child and in the initiation of molecular therapy for TF-related diseases such as. Important Think of it as a key. However, it is extremely difficult to produce the antibody in large quantities by assembling the offspring in order to secure the active protein and to produce the antibody against the TF offspring by the conventional method. It was difficult. In this case, commercially available F exists, but it is suitable because of its low specificity. In this situation, it is necessary to provide a body capable of specifically recognizing the structure of TF.

Another object of Ming is to provide a composition comprising the above body.

Yet another object of Ming is to provide a method of making the above body. Of Ming

Et al. Originally expressed a DN carrying human T F in kiwis-infected cells and purified it in an attica.

TF was prepared and used to produce ~ 2 from this white, but the expected production was not achieved. Next, in order to obtain a body that recognizes white that retains its natural structure, we next attempted to produce it with N using us, but it was confirmed that the antibody titer was low as a result of the serum analysis of us using site.

Furthermore, we inserted N, which is a signa, in DN into the expression vector, and increased the body price by immunization. However, there was no significant increase in CTF titers with immunity 6. As a result, the expression level, F, was extremely low, which was not expected to be sufficient for the immune system to occur. CF is white with a strong binding property of the cock, which may have influenced this property. Therefore, in consideration of allowing TF to remain on the cell surface for a certain period of time, a plus with a localized signal was added after the human TF, and when immunization was performed in the same manner as above, CT F body value at immunity 6 was determined. It was possible to provide a body that specifically recognizes the F structure, as well as the conventional one, while succeeding in producing a practical TF body. Furthermore, after further study, it was found that the immune gna was necessary for the production of F bodies in M of Ming. In other words, it was found that the target body could be produced only by F-containing N containing secretory signal. In this case, immunization was required for more than 6 weeks and the bus had to be repeated.

CT F is structurally susceptible to degeneration and instability when degraded,

In terms of stickiness, the unique characteristics are also white. So far, a body for TF has been commercially available, but it is a body that is so specific that it cannot be used. In addition, because F has a characteristic that it is extremely difficult to obtain an antibody due to its different nature, F cannot be obtained by the methods disclosed in the conventional literature and products at a very low body price. It only provided a practical body. On the other hand, it is possible to create a clear and reproducible F-body. This method has never been done by a person skilled in the art, and the fact that it enables production in a practical manner and provides a body that specifically recognizes human TF is epoch-making. That is. Therefore, in summary, it has the following characteristics.

, And provides a fragment thereof produced by N, which features that it can uniquely recognize an upcoming (F) structure.

As such, the above T F is T F.

In another situation, the bright body is the us body or the hehito body.

In the specification, it refers to human and complete human body, and is the same body as that in which the human body gene is produced. In addition, it is a chimera derived from human, human body part, and other animal body parts.For example, all of the human body region is an antibody in which a human (for example, a mouse) is replaced with a human body. .

In another embodiment of the present invention, it is possible to immunize a human with the above-mentioned TF-bearing vector or a vector containing the functional fragment capable of being expressed. It is.

The kuta can further include secretory secretions.

The kuta may further include an N, which includes a localized signa signa.

More preferably, the above vector is an N that carries secretory gnomes, immune gnomes, TF tanks, and localized gnomes, in this order from the 5 side.

As used herein, secretory gnomes are those that are capable of transporting TF expressed and expressed in cells to cells and are cleaved by the signature of SIGNA. Here, T F is secreted into the cell. More is the CT F CIGNA.

As used herein, the localized gnha is meant to translocate the expressed and expressed CT F into the cell and to secrete the secreted TF onto the cell.

The immune signal used in the specification is TF

It is intended to enhance the antigenicity.

Obviously, an example of the above-mentioned functional piece is TF. Here, the term moji refers to a component that also has a function, function, or action in T F. Examples of such modalities are: Inns, Ombilas, Boss ginpits, C cystine knots ,. Physically, it contains the moth, moth2 moth3, or di4 of human TF as shown in.

The term N as used in the specification includes the c N genome N. c is synthesized by animal cells N and c king.

In another embodiment thereof, the above-mentioned F is added or the functional fragment thereof contains the base sequence formed by Sequences 2, 4, 6, 8 or. In another of them, the above-mentioned object is the object.

In another embodiment, the above object is a mouse or rat.

Furthermore, the above-mentioned us is a history jig. In this strain, a transgene capable of producing a complete human body by introducing a human body gene in place of the us body gene on the us color body by a gene assembly technique using a human color body. It's Us.

In another of these situations, the bright body can uniquely recognize the structure of the ETF child.

In the specification, the TF, the TF formed by the fit in its annotated natural system, is the biologically active higher order (enumeration), and the TF tag. It means a child structure that is made up of a structure that combines quality.

Here, in the conventional structure, in particular when TF is F, the three-dimensional structure of the texture is the high-order structure of the TF texture, while on the other hand, the structure is the conventional structure. Not only can other sources be used. Other such structures include CH ,, H 293 and N 3T3 cells.

Includes structures that can live. As such, the HTF gene is formed when the gene containing the gene is expressed. The traditional T F, including human, is the T obtained by natural genetic engineering.

In the F-purification process, was produced by decomposition (mod 2, m 34, di) during the presence of even purified F at 4 C.

). In this way, the full length TF tacks are of a different quality and difficult to handle. Traditionally, it is necessary to obtain purified TF as an antigen, but it is highly likely that the above degradation will occur in the course of purification. In the Ming body method, the active antibody is formed by vo, so it is easy to obtain a body that specifically recognizes natural production. In the specification, the sex type is used in reference to the TF tank quality caused by the difference in the dysphytes, the decomposition, the denaturation by thermochemicals, the breakage of the structure, and the formation of the non-native structure. It is expected that the normally produced F-form will contain a higher form of this modified TF-reactivity due to the reasons mentioned above.

In the present specification, the specific recognition of the TF structure means that the fragment of the TF is a continuous discontinuous surface topography of F even in the natural structure when the molecule is incorporated into the natural TF gene. This means that the structural denaturation due to the difference in the internal morphology has occurred and that the TF is better recognized than the denatured TF. Here, the peculiarity recognizes TF even in the natural form, but does not recognize the above-mentioned sex-type TF or other qualities other than TF, and is the relative TF even in the above-mentioned sex-type TF. It means to be easy to recognize. Thus, relatively high recognition (is immunologically reactive), in other words, when compared by P-analysis, the clearness to the natural structure is higher than the binding to the denatured TF, preferably the reactivity. In the present specification, it is specifically recognized that the binding to the type TF is 5 or more, preferably 10 or more, more preferably 100 or more, and 1000 or more.

A further feature of the Ming body is that it recognizes a three-dimensional continuous top that is not a nea ep ope or a continuous top of the TF texture. It is considered to be sensitive to information.

In the specification, N that expresses N, F, or a factor into which N or a functional fragment thereof has been operably incorporated is injected under a human, preferably a substance, and the secreted protein expressed in cells is secreted. Difference, means a set of methods involving the development of a body for that protein in an animal.

The fact that it can be obtained by using the above-mentioned N, which is not the conventional method of directly entering under the tank animal, is a characteristic of Ming, and the person skilled in the art of the present application can obtain the knowledge. This is what I thought.

In the specification, “expressible” means that the above-mentioned F of the regulatory sequence or the functional fragment thereof is expressed, and the corresponding tank is produced at n vo.

In another embodiment, it is possible to specifically recognize whether the above-mentioned TF is a deviation of MJ, MJ2, MJ3, or MJ4.

In another embodiment thereof, the bright form has a bond (K) on and / or a dissociation (under X10) with respect to g.

The binding to the human TF (pokuner or knuckle) body produced by the past has not been specifically reported so far, but it is known that the antibody is TF cross-reactive. (For example, J. Boche 2004 135: 347 354). The deviance of light is also characterized by a higher number of bonds for higher F, and a lower number, than the conventionally produced bodies.

It also provides TF treatment, amelioration prevention, including two of the above-mentioned fragments, in two ways.

In that state, the Akira body is the Nokuna body.

In another of these situations, the bright body is the hot body. In another embodiment, the fragment is bound to a therapeutic agent.

Antibodies are therapeutic agents, and drugs are drugs intended for molecular purposes. The clear one is transported by its treatment to the target site and can act for the prevention of TF-related diseases.

As such, examples of TF include: ray-associated dysplasia, arteriosclerosis, atherosclerosis, cell illness, leukemia, angiogenesis, glaucoma, joints, urinary illness, hypertension, and transplant response. Physically, Inflammation includes, for example, lung, liver, or strong (or skin). Further, the above is, for example, cancer.

In addition, as in item 3, provides a T F disconnection, including the fragment described above.

In that state, the Akira body is the Rona body.

In another of these, there are, obviously, ray-related complications, arteriosclerosis, atherosclerosis, cell disease, leukemia, angiogenesis, glaucoma, joints, urine disease, hypertension, and transplant extinction. F Used for sickness determination. ,

The above-mentioned associated sclerosis is, for example, lung, liver.

(Or skin) Yes. Also, the above cancer. In another embodiment, the body of light is ouse ouse hyb oa TF (FE BP 0454) ouse ousehyb do a TF (FE BP 0455) is ouse ouse hyb do a TF 2 FE BP 0456 It's a body.

In addition, it provides a monocene from ouse ousehyb do a TF (FE BP 0454), such as 4.

In addition, it provides a monocene from ouse ousehyb do a F 2 (FE BP 10455), such as 5.

In addition, it provides an ouse ousehyb do a T 2 (FE BP 10456) idiosyncratic monomorph, such as 6.

In addition, it provides an oval ousehyb do a F 22 (FE BP 0727) idiomatic monoclone, such as 7.

In addition, it provides a native monocran of ouse ousehyb do a F 23 (FE BP 0728), such as 8.

In addition, it provides an oval ousehyb do a TF 24 (FE P 0729) idiosyncratic monomorph, such as 9.

In addition, the 10-like, monolithic ovine ousehyb do a F 26 (FP 0 30) is provided. In addition, it provides an ovine ousehyb do a F (F BP 073) ubiquitous mononuclear body, such as 11.

In addition, it provides a monoclonal body from Ouse ousehyb do a TF 32 (F BP 0732), as in 12.

In addition, it provides a monocranial model, such as ouse ous hyb do a F 4 (FE BP 073), as in 13.

In addition, as in 14, immunized humans with a factor containing N that expresses F or a fragment capable of expressing it, and a body that recognizes TF, and a cell that produces a body are removed. , A TF-recognizing knocker or knocker body is provided.

In this state, the above T F is T F.

In another aspect, the above-mentioned parasite is a hoof with a tooth. In another embodiment, the rodent is a mouse or rat.

In another embodiment, the above-mentioned us is a Hittrasujisk us.

In another embodiment thereof, the above vector may further comprise a DN carrying a secretory signal.

In another situation, the above-mentioned Kuta is

Can include N, which includes.

Furthermore, the above-mentioned K is a secretory signal, an immune signal, a C F tank, and a localized N, which are N, which are added in this order from the 5 side.

In another embodiment, the cells producing the above-mentioned body are

Is.

The other is the above.

In another embodiment, the above is serum.

In another embodiment of the present invention, the above-mentioned occupant or mono-acceptor has a bond) X 0 and / or a dissociation () It is characterized by having 0 below.

An example of the above-mentioned functional piece is a moth, a moth 2, a moth 3 or a moth 4 of Hei F.

In another of its aspects, obviously, the cells producing the above-mentioned body further include the above-mentioned selection by flocime.

The present invention provides a body with significantly higher binding to F having a natural structure and a specific high degree of inhibition of the sex of F, as compared with the body obtained by a natural method of directing an antigen to an animal. . The discovery of such an antibody is very surprising to a field supplier.

When the light body is produced at n V, especially in the human trachea, a human body is obtained, which has a TF-related disease in the human, such as a cellular disease, It can be used without rejection for effective treatment of. As described above, the body prepared by the conventional biomethod cannot be expected to have a sufficient effect, and thus it is industrially used for the above-mentioned treatment and diagnosis in that it provides a body with the above-mentioned new characteristics. A simple description of the surface

Indicates the construction of human F.

2 indicates 8 6 ct. , FL is, E is an immunogen (1 unogen c y enhanc ng e e en), the target T E is a gene that carries the target substance, and P guna is a P anchor.

Figure 3 shows the F analysis result of ouse po yc ona an T F kuna (: T F).

4 is the F length of the odu e (2 3 4).

Figure 5 shows the TF length of ouse Poyc ona an TF KU (: TF), and the F analysis results for odu e (Moji to Moji 4). A is F length, Moji shows, B is The analysis result by serum is shown.

6 shows the F result of the monocuna cone30 2 from ouse ousehyb do a T F.

Figure 7 shows the F analysis results of the monocuna cone309 from ouse ousehyb do a T F 2.

Figure 8 shows the F-analysis results of the ouse ousehyb do a T F 1 coming monoclone c one 30 2 ouse ouse hyb doma T F 2 coming monocloner c one 30 9. It is shown that these are modus.

Fig. 9 shows the mouse ouse hyb do a T F 21 conventional knocker c one F analysis result.

Shows the results of ouse ousehyb doma F 22 coming knocker c on 3 ouse ousehyb do a T F 24 coming monocuna c one 3 F. It shows that these are two bodies.

Shows the F-analysis results of ouse ou ehyb do a T F m31 coming monocuna c one54 (: 220).

2 shows the o se ousehyb do a F 32 coming knocker c one62 (: 2 2) F analysis result.

Figure 3 shows the F analysis results of the monocuna c one 2 2 from ouse ouse hyb do a T F 33.

Figure 4 shows the F-analysis results of ouse ousehyb do a T F 31 coming cone 54 ouse ousehyb do a F 32 coming monocone c one 62. It is shown that these are three bodies.

Figure 5 shows the F-analysis results of the okun ousehyb do a T F 41 from the knocker c one 42 (: 8 7).

Figure 6 shows the F analysis results for the ouse ousehyb do a F 41 conventional monocone c one42 ouse ousehyb do a F 42 conventional monocuna c one69. It is shown that these are four bodies.

7 is a Usta block that was made using the clear monolith. The analysis results are shown. Purified F was used for the test, TF treated with 2 mecaptan and TF not treated with 2 mecaptan.

A molecular key is shown at the end of the button.

No. 8 shows the harmful activity of radiogenesis in rat N49F due to the photonuclide. In addition, F produced by the (Nuffa) H strain was used. Separately, F F, T F, and control B, which is the g of Us, were used. TF days were added to the ground during clear processing.

Figure 9 shows a control in which a native guib (control) was administered in a study of Ba b c us (7) against nV vo.

Reference numeral 20 indicates a test in which 21 21 bodies were administered in a test for n "" o of Ba b c us (7).

Figure 2 shows a study of Ba b c us (4) for nV vo in which the body was administered to Ming dysmesia.

Is generated in. Good to carry out Ming

The present invention will be described in more detail below.

The TFTF is similar to humans, mice, rats, pigs, etc., and is also secreted from cells and interacts with it, thereby forming, in particular, connective cultures and cocks. The activity involved in is also proliferative.

Obviously, TF is an animal, in particular a vertebrate, preferably an animal, more preferably a native TF. For example, the conventional F anoic acids and salts are available from enBan data (). For example, F, contracted in human 6326 92511 p29279 N 001554 001901 It is registered as P 034347 Lap P 071602 022266 N 776455 174030 0 174.

HI F is a tank material consisting of 322 ano (349 ano when including CIGNA), has 39 hitches in addition to HI, and at least 5 EY. It is characterized by the existence of In addition, as shown in, the quality of this protein is 4, which is a functional domain, that is, Moji, which is an instinct, Ji 2, which is a ponvira C-child, and 3 which is a Trovosponpit. , C Stain Nod May (T), including Moji 4.

The sequence of the TF and its base sequence are shown as Sequence 2 and Sequence 11 below. Also,

Sequences of ~ 4 and their base sequences are shown in sequence 34 for di, sequence 5 6 for mod 2, sequence 78 for mod 3, and sequence 90 for di 4, respectively. It

Clearly, if there are natural variants of T F, such as mutants that occur in individuals due to differences such as splice differences, they are the subject of the present invention as well as such mutant T F. Such a variant may be represented by TF or function (eg mod, preferably mod 4 of TF), with an X in the base sequence, or a plurality of, e.g. It is possible to include replacement and deletion. Here, several represents 2 to 10, for example, 2 to 7, 2 to 5, 2 to 3, and 2 integers.

Such a mutant is one in which the above-mentioned Ano X has identity on the base sequence 80, 90, 95, 9899. Here, unisex can be easily determined by using a program such as BT program with or without (an, P oceed ngs O he a ona cade cc ences g0 5873 5877 (1993)). o

In the description below, TF and naturally mutants are collectively referred to as F. Due to

It is made by using the of the body of light.

In N, cells such as human cells (eg,), which carry the F protein, are inserted, and the obtained cDN is placed in an animal tractor to immunize the animal. At this time, a field for F obtained by the appearance of the moving object N is born.

, DN is used to produce T F in an active state at n "", which gives birth to the body. The term "active state" means that CT F (fitting, chain, etc.) is driven. Therefore, it is the body for natural TF, which is produced in Ming. Furthermore, it is a body for natural TF. Since the human TF has 5 phytos, it is likely to undergo denaturation, that is, to be dominated during purification, and since human TF is a tank, human The TF tank quality needs to be formed so as to have similarities. The body of the Ming

It is possible to overcome the above two points because it recognizes the structure uniquely.

The N kun, which drives TF, can be done as follows.

Design and synthesize a ply consisting of 5 ends and 3 columns based on the sequence of the F c N base in the pattern or literature. The ply usually has a size of about 15 25 groups, and 2 plies that can be agglutinated to the F sense strand and the atticense strand are prepared. You can use commercially available N for ply.

For example, cells such as chicks (for example,), etc. are prepared by an N production method such as the Kuhnonoisoaum s method, and () N () is obtained by ossealography, and reverse transcription is performed. Perform a simple c N composition. For example, esha, nvogen, etc. It is convenient to use these kits because they are on the market. The c thus synthesized is used as a mold, and the lysine prepared as described above is used to carry out the polymerase chain reaction (P) to amplify the cDN carrying TF.

P should be carried out using a commercial cycler (eg, Pekn e e 9600 ppen o as e cyc e g ad en). For example, 0X bu e T s pH 8 3) 500 5 g 0 1) gelatin), d TPs 2, pla 2-5 ~ 0, Taq pomerase and other thermophilic N pomerase (~ 2・ 5 Taq (aka a, Tokyo, Japan), T.

aq P o ega), etc.) to carry out the reaction. P, eg once at 95C, 25 minutes.

Denaturing Cycle, 95C, · Sex in 2 to min, 50 ～.

65C, · 5 to 5 minutes.

Gu, 72C, 15 to 40 cycles, with 1 cycle at 0,5 to 2 minutes, and finally 7.

Including 2C, 5 minutes extension.

For cDN cue, a b ook, o ecu a on n Labo a. y anua, o d p ・ ngHa bo Labo a. y (1989), usube Cu en P o co s no o ec a B o ogy (1989), etc. The function and sequence of a certain TF functional piece is already determined based on its compatibility with the public CT F. , Can be done using the BL T program above. Also, the performance of CT F, for example, T F di ~ 4. N, which is a piece of ability, can be synthesized using automation.

The T F obtained as described above or the N that carries its ability (for example, T F and its content 14) is next introduced into the expression vector.

Kuta includes, for example, plus, whistle, and fa. Matter is an animal vector, such as

Kuta, preferably vector. Kuta is on the market and can be used in the morning. Examples of vectors are widgets such as the Adviser and Waxia widgets, and plus such as pc N 3 (nv oge, p (o ega)).

Kuta is a promoter, service, origin of replication, It can include columns such as position, pore site, or field. Transcription is initiated by the binding of pomerase to the main promoter, which translates to the desired tank. Examples of Masumi pumps are whistle promoters, such as (cymegalowis) pumps, (vacuum wis) pumps, and E (Eps en Ba mice).

Obviously, it is preferred that the vector contains N, which includes the localized SIGNA SIGNA.

Guna (also referred to as “me”) is intended to enhance the antigenicity of TF, as defined above. These include T-tops, etc., which have immunogenicity. T-tops are able to recognize and bind to T-septors. Cigna is, for example,

Primitives, etc., including tops of T such as carbon (H), ovoa (, and (B)).

Examples of CIGNA include, but are not limited to, the following (ha be s 4 ・ Johns o a u e B o echno ogy 2 (9): 088 1092 (2003))

n a a H s a a s a e sn u (12)

n y eLys a sn e LysPhe e e h Leu 13) 14)

sn n g yTh uLeu g e o e a spLeu snLysP o y g s (

15)

Obviously, the immune signal can be used alone or in combination.

Guna means to transfer F expressed and expressed in cells to cells and to secrete secreted CF on cells. In this case, the localized SIGNA is an important constituent and is necessary to allow the expressed F to remain on the cell surface for a certain period of time so as to generate F-valued F-forms. An example of Cigna is the (Geosfati Inos) mosquito (e.g., aep oc Na ca c. 82 (24) 8715 8 19 (1985)). The sequence caccgacgccgcgcacccggggcgg ccg gg c cgcg gc cg ggccgggacc gc g gc ggagacggccac g ccc g (18)), which is 32 anth at the end of the sparseness of the tanky material, followed by the lass It is cleaved and P is attached around sp. This makes it possible to target the target tag on the cell via sp at position 3 (such as The E Jou na og No pp 0 5 2000). The clear and usable localized SIGNA is not limited to the examples above, but any similar GNA can be used as long as it has similar functions.

CIGNA T F Guna is preferably linked at the N side. A mosquito consisting of ~ arbitrary anoic acid may be bound between each signa. In addition, TF or functional pieces are arranged so as to be connected with each other via a mosquito of any desired anoic acid.

It is also preferred that Kuta further ligates a N expressed as a gun for transporting TF expressed in the cell or a functional fragment thereof to the cell. A suitable example of such a Cigna is a T F Guna, such as a F Guna (up to position 27).

Obviously, the preferred vector contains in the promoter stream a secretory gnome, immune signa, F, a localized gno, and a DN which is white so that white is expressed in this sequence from the N side. Expressed in cells, translocated to cells, and

It is secreted and secreted, and becomes a cell bacterium. As a result, it becomes easier for the field for F to be generated. In addition, if necessary, a base sequence for detecting the expression of the target, such as FL His tag (for example, s6 to s), is connected to the 5-3 end of the target DN. I can do this. In particular, FL and others are useful for producing the expression of the target protein.

The tractor containing the DN carrying T F or its functional fragments is injected into the body part of the animal, eg below. I can go there several times every two months, for example in February. Kuta, for example, 17 5 4 times.

, Vertebrates (animals, reptiles, amphibians, birds, mammals), and preferred animals are species and non-humans. Preferable animals are humans, for example, rodents (for example, mouse, rat, mustammotte), ungulates (for example, cormorant, cormorant, sheep, ta, goat, etc.), and rabbit.

For the purpose of producing antibodies, animals capable of producing baboons (excluding humans) are preferably used. Such animals are

There is a rustic, and it is known, for example, in the US etc. (This special 4504365 report, Japanese special 6500233 report, US 554506, US 5569 825, L ・ Leen J uno e hods 231 23 (1999) Etc. In particular, uss (millet), eno ouse bgen c), etc. are known as transgenic uss that produce human bodies. In these, a part of the native somatic gene of Us was replaced with the native somatic gene of Us, which enables Us to produce human somatic body. In other words, it is derived from the Hugu gene, which has different regions and regions in the chains and regions of human and immune globules. In addition, hi (or chimera) is a region or region of the region derived from the Higlob gene, preferably

All of the regions are replaced by corresponding regions and regions of the region derived from the Gub gene of objects outside the heat such as us, preferably all of the regions. is there. For the production of human body, for example, there is a method of producing human body without using any material. That is, it can be obtained by, for example, a cinching method or a fuzzy display method. For example, a F-specific body or domain containing a domain is bound to the F-domain. Select an idiosyncratic source. Selected chains can be linked to a hydomain (or to a chain), and the hypobodies can be selected for binding isomerism to the antigen. The disclosed techniques are disclosed, for example, in US 5,565 332, 5,585 89, 5 694 761, 5,693 762.

In animals exposed to light, body life is induced against transiently expressed TF or functional fragments thereof. After the body is born, the target body is collected from animals such as plasma and milk. It is a polygonal body obtained here. The body isotype can be g g g D E. The antibody classes are, g 2 g 3 g 4 g, 2, and so on, and chains. The same applies to antibodies such as these, and to monoclonals.

In addition, the following mononuclear bodies are included. Examples of this fragment include Fc F Fv ScFv Fab Fab (Fab) and the like. For example, fragments can be obtained by disassembling with ai, psi, psi, etc.

Ming monocran can be prepared by a general method for producing monocuna as follows.

The animals noted N (excluding humans), preferably Us, et al., Preferably Hylansicus, et al., B

Then, the bone marrow (and) is taken out, and these bone marrow (and), preferably mouse, are fused to produce an id. For example, if you have a The body is used.

From among the ibuds selected, a body that specifically recognizes natural F, preferably TF, is selected. For this, it is preferable to use the facet. In order to get out,

A body that binds specifically can be used.

For the manufacturing method of mono-body, oh e a u e 256: 495 (1975) usube u en p o oco s n o ecu a B o o y (1989) ozbo

no ogy oday 4:72 (1983) oe onoc ona n bod es and ance The ay 77 96 1985 n bod es Labo aoy anua odp ng a bo Labo aoy hape 8 1988. Can be referred to.

The standing ibd can be intraperitoneally injected into the mouse, the ascites can be collected, and the ascites can be passed through a pewter or a patio scalar to collect the target occluders.

Therefore, it is clear that TF-containing DN or a factor capable of expressing its ability (e.g., a component of TF) is immunized to humans and a body that recognizes TF is included. , Is a cell producing a body, and a method for producing the body is provided, which comprises removing a cell or a cell that recognizes TF.

According to the clear description, the above-mentioned heat, preferably a thing, and more preferably a dental hoof. Examples of teeth are Us, Ras, Mots, etc., preferably Hytransicus. In addition, ungulates, cormorants, goats, sheep, etc. are preferable, and they are preferable.

In law, for example,

According to the clear state, the cell producing the above-mentioned body is B-n. These are used to form cages and bone marrow ids described above and to make clear mononuclear bodies. In addition, in the case of Ming, the cells producing the above-mentioned Ming further include selecting said Id by phsime. Binds to a singularity of Heus or Usus for output

You can use your body. From the body thus obtained, harmful antibodies that have no effect on humans are eliminated.

It can also be obtained by selecting from the T F cuna or monocuna group induced by nV by full-length F moji gene expression by moji and DN using a method such as immunocyme. , Antibody

As a result of the above, it is possible to obtain the privilege (i.e., pokunanokuna) of TF or its ability (for example, modi) to retain the structure (including) of the thing as described above. To be In particular, when N is carried out on a hydrous genus (for example, Us, U), a TF that retains the natural structure or a human body specifically recognizing the TF can be obtained.

An example of such an antibody is T F

Ouse ouse hyb do a TF (FE BP 0454) ouse ouse hyb do a TF (FE BP 0455) ouse ouse hyb do a TF 2 (FE BP 0456) ouse ouse hyb do a TF 22 (FE BP 10 27, ouse ouse hyb do a TF 2 (FE BP 0728) ouse o se hyb do a F 2 (FE BP 0729) ouse ouse hyb do a TF 26 (FE BP 0730) ouse ouse hyb do a F 3 (FE BP 10731, ouse ouse hyb do a F 3 F BP 0732) ouse ouse hyb do a TF 4 (F 0733) ouse ouse hyb do a F 4 (FE B 0734) ,, are not limited to these constant bodies, for example using a traditional Then, it is also possible to carry out the production of the human body for F or Moji 4 and obtain the desired human body in the same manner.

Ming, when measured by the plasmon of B co e (), the binding to the natural F is 10 X 0 above, preferably 5 · X 0 above, more preferably 1 · 0 above, and especially preferred 5 ·. Above 0X0, and are characterized by having a dissociation to native F below 7X10, preferably below X0, more preferably below 0, and most preferably below X0.

It is capable of specifically recognizing TF (having a type of sugar), preferably TF. Here, as described above, the peculiarity recognizes F even in the natural form, but does not recognize the above-mentioned sex type TF and other substances other than TF. It means relatively easy to recognize. Thus, relatively high recognition (or immunological reactivity), in other words, 10 or more, preferably 100 or more, more preferably 1,000 or more, high binding, in the present specification, specifically recognized. Due to the high binding to natural human F, which has not been formed in the past, it is possible to practically and significantly inhibit TF activity at nV vo. Here, the biological property includes a texture, a growth including vascular growth, and the like. , Ming is further characterized by recognizing a three-dimensional continuous structure that is not a linear or continuous structure of TF tank. This characteristic does not shield the body from the fact that it is easy to recognize the natural structure, which is not the modified F-structure.

In addition, the provision of a valid statement is provided. Used in T. cerevisiae, preferably T.sub.F or its body for its potency (eg Moji ~ 4), preferably

It is a human body, and a human body is particularly preferable. In addition, the antibody It may be a body or a body, but is preferably a body.

Cyme allows the selection of ipods that produce non-human clones that act only on physiologically aberrantly expressed F without substantially affecting normal tissues. .

A clear ,, ray associated, arteriosclerosis, atherosclerosis, cell disease, (for example, colon cancer, liver, gastric cancer, cancer, etc.), leukemia, angiogenesis, glaucoma, joints, urinary disease, hypertension, It can be used to treat, improve and prevent CT F illness such as transplant response, inflammation, obesity, hyperglycemia, urine disease, urinary disease, urinary disease cardiovascular disease.

Accompanying sclerosis is, for example, viscera, lungs, liver, spheres, heart, and other organs, strength, duration, and dura. The normal expression of T F is associated with general tissues, skin, and blood vessels, which leads to inflammation, hypertension, and obesity. Other F-related diseases include skin, normal expression, blood vessels, blood vessels, atherosclerosis, systemic chemosis, atherosclerosis, inflammatory diseases, vascular disease, vascular growth, etc. Joints and other diseases, vascularization related to glaucoma, inflammation (such as inflammation), interstitial disease, skin disease, joints (such as uchi), arteriosclerosis, urinary disease (such as urinary disease, hypertension, etc.) It includes various diseases and disorders such as other renal damage, surgery, chemotherapy, radiation therapy, allograft response, and allograft response.

, As described above, the state in which the organs are cultivated and the tissue is transformed and shrunk, and the normal structure is destroyed.

It is often caused by an extinction reaction related to the planting of. , In general, contains normal cellular toxins, deposits, eg

Causes sting and addition.

, Abnormal cancer. CF is angiogenic It is said that it is involved in the life of malignant tumors (ie) (this feature 2002 529066). Cancers include, for example, leukemia, skin, formation, blood vessels, blood vessels, adherence, prostate cancer, colon and intestinal cancer, gastrointestinal, liver, and other cancers including tumors and metastases.

The ability to inhibit and inhibit T F from binding to its body and transmitting proliferative signa is thought to be useful in preventing F-related disorders such as sclerosis and angiogenesis. Therefore, the inhibitor is the body against human TF or its subtype.

Depending on the nature, the therapeutic agent can be attached to the body. , The target diseased site where CT F is present carries the drug and at the same time inhibits and suppresses the function of CT F, while the drug treats and reduces the condition of the disease. This form is a molecule.

, Which are or are used as therapeutic agents for the above-mentioned patients. Such as synthetic natural,

Macromolecules and tanks are substances with nucleic acid qualities. For example, examples of therapeutic drugs include postagrange, stade, gad, anotesic type 1-body aggregate, soluble TF type aggregate, F, etc. , Musti, Sixfa, Kazin, Musti, etc. Metabolism, for example, bottles, o, etc., biomaterials, such as Dow, doxine, Ishi, Itoishi, etc., plant amides, such as Sox, Vincustine, Vibrasti Etc., including platinum bodies such as Splatch.

With body agents, preferably via an anchor. Anker includes, for example, a substituted aliphatic achi chain, and at the end thereof, a group capable of binding to an antibody agent, such as cis, ste, thiocabone, or aldehyde. Introduction to Engineering, Shishokan, 1994).

If desired, a drug can be added to facilitate delivery to the cell. Furthermore, positive poses include positively charged poses, positively charged stellos, and transient poses (, white matter

44: 1590 1596 (1999 Science 43: 649 653 (2005) n ca ance esea ch 59 4325 4333 1999), etc.).

Oral administration, for example, intraperitoneal, intramuscular, subcutaneous, administration.

Formulations for buccal administration include solutions, suspensions, emulsions, etc. in physiological saline solution, aqueous solution, organic solution and the like.

Examples of agents include Tano, pudding, potting, plants, and paste such as ointment. The formulation should also include nutrients, electrolytes, storage, and antioxidants. The amount of the active ingredient in the body is 100 2 500 1 for re-use, and the amount is 1.0 to 9 per hit k, but the amount is not limited to these.

, For example, with a frequency of between ~ 2 and several doses of 2 ~ 3 for about 2 times.

Further, the above provides a composition comprising the fragment.

Mouth, for example, ray-related complications, arteriosclerosis, atheromatosis, cells (for example, colon cancer, liver, gastric cancer, cancer, etc.), leukemia, angiogenesis, glaucoma, joints, urine disease, hypertension transplant It is used for the control of TF patients such as abstinence reaction, inflammation, obesity, hyperglycemia, urinary disease, urinary disease, urinary heart disease, cardiovascular disease, etc. It can also be used for In this case, the CF state becomes normal and high, and the connective tissue undergoes the change and shrinkage of the tissue and the destruction of the structure. For this, the F By using the clear body, you can do the above. It is possible to use not only the body for the F of the human but the body of the human for the F of the human, preferably the human. F has a high degree of sequence identity at and, for example, in Us, it has an identity of 935.

These include conventional, general assays, such as assay (EL), fluorescence assay, radioimmunoassay, radioimmunoassay, dot-blot assay, or competition assay, sandwich assay, tex-viat, and the like. Not restricted.

Clearly, it is characterized by unique recognition of natural CT F or F), especially the continuous surface of T F.

Can be uniquely recognized.

Monoclonal forms are preferred to achieve specificity. The antibody need not be human, for example human, for the purpose of detecting the disease. Examples of such antibodies include, but are not limited to, ouse ouse hyb oa TF (FE BP 0454) ouse ouse hyb do a TF (FE BP 0455) o se ouse hyb do a TF 2 (FE BP 0456). ouse ouse hyb do a TF 2 (FE BP 0727) ouse ouse hyb do a TF 2 (FE BP 0728) ouse ouse hyb do a F 2 (FE BP 0729) ouse ouse hyb do a TF 2 (FE BP 0730) ouse ouse hyb do a TF 3 (FE BP 073) ouse ouse hyb do a TF 32 (FE BP 0732) ouse ouse hyb do a TF 4 (FE BP 0733) ouse ouse hyb do a TF 42 FE BP 0734) It is a clonal body.

Photosensitized complications include, but are not limited to, eg, lung, liver, or skin) and cells, eg, cancer.

The supplement is a biological supplement such as cells at a disease site, blood, serum, plasma, blood, urine, and the like. You need these sumps If necessary, qualify, centrifuge, and dilute, add light bodies in an appropriate amount, and detect TF bodies as antigens by the above-mentioned assay. In this case, the body of the present invention can be labeled or the body can be used.

, (Eg oxida, acasfatase, etc.), radioisotopes (eg 32 cc

,, 1, etc.), and fluorescent substances (eg, phosphors, phosphers, dacros, their conductors, etc.).

I will explain Ming more physically in the following, but I shall not be restricted by these.

()

The TF gene (2) or its constituent odu e (4) modu e 2 (6) odu e 3 (8), and odu e 4 (10) gene fragment are It's Kuta (pc N 3.1 nvogen). Vectors are also available in Sai Megawis () Puta, Immune Guna (Wap ・・ hambe s and S ・ Johns on Naue B o echno ogy 2 (9) 088 1092 2003) Toa Kaosfatase P Anka (17) Including the DN that consists of This was done 8 times (2

The v8 TF, which is a human TF gene construct, is the optimal immunogen in order to obtain a monoclone that recognizes the F structure and inhibits its sex. 2 odu. 3, the construct containing odu e 4 can also be used as an immunogene.

E 2g3 in kind

The constructed genetic constructs (i.e. vv8 TF gene, v8 odu e vv8 odu e 2 Vv8 odu e 3 and vv8 odu e 4) were previously expressed on the cell surface as designed, and were previously expressed. (HE 2g3T) was used for verification. That is, the constructed gene construct was transiently introduced into the cell. Insert the cell into 5 ink tanks, 10 F

It was cultivated at C in the E field for 24 hours and used for flow cytometry (F) analysis. During F analysis, FL 2 (g a a ch), which was added to the above-mentioned gene, was added and added. Then, the mouse 9 (Bec ancou e), which was recognized to be uniquely 1, was added to the above, 30 was used and then used for F analysis.

As a result, it was proved that the 5 gene constructs (4) constructed by the present invention were all expressed on the cell surface (3).

H physical

The constructed gene (8 Fueng odu e odu e2 modu e3 odu e4) was expressed on the cell surface as designed, and it was verified by a transient experiment using cells. That is, 6 e p a e the day before.

X 0 cells per we were p a ng. Overnight under conditions of 50 and 37C. Tans ec on day, plus in post loud

(P as d DN 500 L D) and o a 000

P ec a ne 2,000 50 L of E) is good, 20 inks at room temperature, p a ng on the previous day and then thrown away, without peeling the cells.

Added to cells. 5 0 at 5 0 37 C, remove top, 5 F.

The soil containing E was added and cultured at 250, 37C. On the day, the cells were detached from the pae with sso abu onogen and used for F analysis. F Implemented as follows. That is, 1, FL 2 () in cells in 3 F S.

4C, 30. 2 cells were identified with 3 F PB and 3 F PBS in mouse 19 (B.

eck an) 4C, 30. The cells were subjected to 3 F PB, an appropriate amount of 3 F PB, and used for F analysis.

As a result, it was proved that all the constructed gene constructs were all expressed on the cell surface (5). (2) Establishment of F stock

In Fig. 4, TF (u eng h) and moji (odue) are used as (T), ans ec on, 24, and ssoc a on bu e to remove the cells from the surface and suspend them in the methices (20 LOT (ona e) 25 LO i 5x1 cell ans ec an), c p, 50 37.

Under the condition of C, 1 nutrition was performed. The soil was picked up and cultivated in 0 F S E land containing neoin for 4 to 5 times at 96 e pa e. FL of the cell

(an FL) was used to perform the F analysis described above, and a sheet of cloth was selected.

(3) Mass production and purification of TF

The T F 0 F D E land prepared in (2) above was cultivated. In other words, 500 L fuller including the last x L 200 L ground.

, 1 p was fed under 50 37C. After 1 minute, cells

2x1 6

Increased to Ce s L. It was recovered by separation and put in color. Nkara et al. T F Na g ad en program. T F could be recovered with 51.0 Na. This was a T F n FL column (ga). n FL Kara et al. T F 0 · yc ne H PH2 7) This F was exchanged with the limit (at 10000 toffs, PB () shunts. According to the law, electrical appliances were approved. The manufactured tag was confirmed to have a clear band near the molecule 37 a. At es e nB o ng, this tag could be detected at an F ag.

According to (4)

DN, injected alone or in combination with the above gene constructs, under the animal (mouse or herringbone mouse) using a gene (eg, clone, gene gun, etc.) shift relative to the immunity. And then incorporated into cells.

Includes immunization with the following genes. D, 4 Gene slack was used alone or in combination to immunize. In order to do this, 200 pups were administered per 259 according to the gene (genegun Opza onk Board). 2 times 4 In the fourth, a small amount of serum was diluted with Sampling 3 F PB 1000, and one serum was subjected to F. As shown in Fig. 4, using H cells that transiently express F (u eng h) and moji (odu e) traffic, the flow rate (F) line and the price for odu e increase. I confirmed it (5). Also, the monoclonal final bus (na boos) was performed twice, and then the general method was used, that is, a strong specific body recognizing the human TF gene was produced. The animals were dissected, and B cells were isolated according to a standard method to produce a mononuclear body, which was performed physically as follows.

The id was prepared by fusing the marrow cells of the epithelial cells of the immunized Ba b c us. 8 us (B B c)

3 63 98 U (P3 U) Eu J uno (1976 P2 0 g 4 (P 2) Na ue 276 269 (1978) P3 63 9865 (653) [J uno 123 1548 (1979) P3 3 g (63) Na ue 256 49 (1975)], etc., as long as it is capable of multiplying in (n V o) .These are and, in these, the Antibodies Laboratories (n bod es, Labo a. y anua odp · ng Ha bo Lab a. yhape 8, 1988), a cell size of 2x1 or more was secured by the time of cells.

After washing the bone marrow from the mouse, cells such as Pog 0 (E 0) were added to fuse the cells and suspend them in the ground. For cells, we used E or B (Na 1, 839, K 0, 219 a 7 659, H, H 7 2). In addition, as a place to suspend the fused cells, in addition to selectively obtaining only the target cells, T-gutta (4) 5 (FS) xanthine (10), di (5x) and annotane ( 4x1) I included it.

In the upper part, a sample that reacts with the antigen white matter and does not react with the white matter was selected by the enzymatic method (L) and F for the forced expression cells. At that time, we decided to select a stable, high-priced product as a monokunib, which was closed by the limit.

The standard method using restricted expression was performed as follows. The cells that overexpressed white matter were allowed to react in 96 pt as the first body on the ibid, and the first and the first plates were washed and the second body was added. Here, the first body is the body that can recognize the first body's Usui, which is the body recognized by Western Okida (HP). , Was added according to the labeling element of the second body, and analyzed with a fluorescence printer.

Next, the production of mononuclear bodies from ascites was carried out as follows. Ba b c mus that has been treated with a pusher 0 5m, has 0.5 salt water, H 7/4 medium to 3 6

Fired an X quad. Approximately later, the ascites was collected and the knockouts were made into a pouch or a pouch.

Of the numerous N-standing ibud stocks,

We used F as well as E () to remove the IBD that produces a monolith that recognizes structure.

The knockers manufactured by the above method are as follows. ouse ouse hyb do a F cue 30D2

o se ouse hyb do a T F 2

o se ouse hyb do a T F 21

ouse ouse hyb do a F 22

ouse ouse hyb do a F 23

o se ouse hyb do a F 24

o se ouse hyb do a F 26

ouse ouse hyb do a TF 31 y next one 54 ouse ouse hyb do a F 32 eve coming c one 62 ouse ouse hyb do a F 33 eve coming c one 2 H 2 ouse ouse hyb do a F 41 eve coming next c one 42

ouse ouse hyb do a T F 42

c one 30D2 c one 30 g is a monocuna that uniquely recognizes TF odu e (b) C one, 3, 4, and 9 3 are uniquely recognizes TF odu e 2 b C one 54 62 2 H 2 54 62 is B C one 42 69 is a b that uniquely recognizes TF od e 4. ,

The produced ibu, ouse ouse hyb do a F o se ouse hyb do a TF 2 ouse ouse hyb doma TF 21 id, is attached to the Institute of Industrial Technology The host center (PD) (16, Higashi, Higashi, Japan, Japan) received FE BP 0454 FE BP 0455 FE BP 0456, respectively, based on the agreement of Dapes (agricultural production company). Ouse o sehyb do a TF 22 ouse ousehyb do a TF 23 ouse ousehyb do a TF 24 o se ousehyb do a TF 26 ouse o se hyb do a F 31 ouse ousehyb do a TF 32 ouse o sehyb do a TF 41 ouse ouse The name of hyb do a F 42 has been added to the international standard to the same function as the above, which is the National Institute of Advanced Industrial Science and Technology, Patent Research Center P).

FE BP 0727 FE BP 0728 FE BP 0729 FE BP 0730 FE BP 073 FE BP 0732 FE BP 0733 FE BP 0734 (

Kanazawa Ward, Yokohama City, Kanagawa Prefecture 1 1

IT Center / Technoa 3C Office, Agricultural Products Company, Io Laboratory Lab)) o

The odu e isomer of c one described above was used as a single body on the ibud by F analysis using the prepared stable strain expressing Fu eng h (8 TF) odu e (8 mod e 2 34). Confirmed (6-16) Furthermore, instead of the normal us, a Hittrasujisuusu By the same method as above except using a mouse, a perfect human body capable of uniquely recognizing natural human F, its odu e odu e 2 odu e 3 odu e 4 was produced. I was able to do it.

(5) physical

The above-mentioned TF is subjected to educ n (2 mecaptano) or non educ n (2 mecaptotano addition, between 10) substituting supplementation TF for E, and after that, P DF Electrically transfer to the film and transfer the transferred film to 0. 2 B TPB (

Puffer, p 7, 5, 0, g Na, 0, 05 T een 20) 30 transparent. 1 was permeabilized with 0.2BS PBS containing g L body. 3 in TPB

, HP, and a transparent glass with 0.2 BS TPB containing 1 (3000 Bad). A band of 38 Da corresponding to 3 was detected with TPBS, 10 was detected with color development (4 cfu 30, methanol 0 pBS50 L, H025 u), and CT F was detected. As a result, the knocker 30D2 30Eg 3 3 for odu e 2 is very difficult to react in the educ ng element, and the monocuncer 54 62 42 for odu e 3 4 is also in the educ ng case. The reaction was found to be difficult (17). In the body, the results of cross-section () of the fully denatured human T F (and the partially denatured human T F (), which are close to the partially denatured human T F (), are shown below.

f FL (n) 30 2 2 30 Eg 7 9 3 4 2 3 3 8, 54 2 6 62 7 42 6 69 0.

From the above, the other monocnars except the one69 that was produced and tested. . ne 30D2 30 9, 3 13 54 62 42 was shown to specifically recognize the structure of human TF. In addition to the above, the above-mentioned monolithic body has the characteristic that it is easy to recognize the continuous group of TF tank quality (not top) dimension. This is because in the case of analysis, basically, when the analysis is performed under the condition of denaturation, the n FL as a line is the body that recognizes the linear group, and the ratio is almost 1. On the other hand, three-dimensional continuous This is because the body ratio to be recognized is much larger.

Next, for the analysis of the produced igubun, the plaque, the surface plasmon (), the urea, the radioactivity test with the N49F cell, and the nV vo were examined.

(ouse b os ode o J e u a phys o ogy 8 153 159 (1999)).

Odu e odu e 2 odu e 3 odu. (4) The cells introduced with the displacement of the gene were (1) similarly cultivated in 5 and 24, and similarly F (3, 6, 7, 9, 13 13 15). As is apparent from the figure, a monoclone (g) that specifically recognizes di was obtained even at a dilution of 5,000 000.

For P analysis, each glove was formed on the surface of 5 chips of Baco e (Kyoto, Japan). Purified TF (also naturally-produced TF produced by the method of 2g3T, etc.) was flowed into 5 chips with gubbed. As a result, it is possible to obtain the

() Was measured.

The following is the cage.

Stationary equipment: Baco e 2000 (Baco e)

Gand tip 5 sensor tip

Gand () bu e 1 (p 5) (The final adjustment to the final 25)

unn ngbu e HB EP bu e (EPE PH7 5, 0 5 a 3 E T 0 005 Su ac an p20 (T een 20) pH7 4

Show the results. Dik () d ()

30 2 3 22x 3 x 09

30E9 5 33x1 88x109

2 1, 81x1 5 5 x 09

3 21H12

22 10

4 8E7 3 48x1 8 2 87x10 As is clear from 1 of the note, (b) of Ming is a trait.

The number of bonds originating from TF prepared from HEK2g3T and their respective numbers are 1.0 × 10 8 g

5 ・ Lower and very high affinity. Furthermore, using the one prepared from F strain, P was performed under the same conditions as above. That is, each glove was formed on an aco e (Kyoto, Japan) C 5 chip surface, and fixed with a 5 chip T F measuring body made of H. Using this, we measured () and () of the monotonic body produced in the human TTF tank. In order to eliminate the cloud caused by the random attachment, the TF was flowed with 5 chips with the fixed ((n)) of the us, and the value obtained by subtracting this value was the true number and number. .

The results are shown in Table 2.

2

Module () ()

30 2 2 93x1 9 3 42x 0

30E9 2 g2x1 9 3 42x 0

2 3 8 52x1 9 7

3 8 39x1 9 1 gx ``

3 54 2 g x 9 3 44x1

62 6 3x1 9 5gx

4 42 48x1 9 6 74x1

69 4 x 2 48x10 2 and so on. . except for ne69,

The number of bonds based on F prepared from H and the values were 8.0 × 18 higher and 6.0 lower, respectively, indicating extremely high affinity.

It should be noted that when the number and number of clear bodies were measured using P as the source of the (Uga) -made TF, odu e odu e 2, odu due to the effects of the mammary type structure. The number of e 3 odu e 4 shows the 0 value of the value shown in Table 2, and the number of the desorption also becomes 10 value of the value shown in Table 2, so that the F ratio produced is likely to decrease. Indicated. In this case, as a result of the analysis by LD TF (Buke a ex, TTF (Tsu Works, Kyoto, Japan), the prepared F was different from the manufactured TF, and the manufactured TF was not a non-short type. It was

(6) For a field in N using 6 vectors

The items listed in () (except TF containing secretory signal 6 vectors (2) containing pc3 · 1 plus (nv ogen) were prepared. Repeated as described in N Implementation (4), first in the us, every other bus, and repeated for 10 or more times. Using the timed method, we confirmed that almost all of the above-mentioned plants were living. () NK 49F

Moreover, the physical properties of Ming's body were adjusted. Physically, we tested the effects on T F labeling in rat cells.

N49F (rat) is known to produce and secrete T F. T F also induces T F expression in these cells. N49F (T o: L 1570) was obtained from e canTypeCuu e o ec on T)).

The cells were inoculated with 6 uppers (up to 5x15) containing a minimum (E) containing F, pen, spine and anoic acid. After 12 hours, the land was removed and replaced with new land containing and (a) (0 g), and 24 hours later, the land was added with TF (5 ng) or Tufa (PB only), or TF At the same time a mouse or odu

(1 / g L) was added and replaced with fresh (without Ab, containing 0 g). Then, after 48 hours, they were collected from the ground and analyzed for the type label. For this purpose, we used a suditch L, which uses the two types of anco agenype shown below.

That is, 100 per We of 96 e p a e is. B B is 1,000.

Usu an co agen ype () was added and the mixture was incubated at 4C overnight. On the day, 3 putts were collected with PB, 20 were collected with PB, and this was diluted with 100 P and 1 ink at room temperature. PB is 3 and B PB is 500 Rabbit ancoage yPe (ba) was added, and 1 ink was added at room temperature. Washing the plate 3 times with B, adding eT 50 of T, and letting it develop for 10 hours, measurement was carried out every 450n. The amount of lage production when TF was added to 100 was calculated relatively (18). As a result, the anti-odu e2, odu e3, and odu e4 were all misaligned.

It was found that odu e2 had the strongest activity and weakened in this order. On the other hand, in the case of the od e body, on the contrary, it was shown that it was used for inducing growth.

Moreover, the effect was further verified by the n V vo test described in (8) and (9). Physically, a skin device was used and tested at n V vo on the consequences of physical damage.

() ne bo n ouse b os s ode inhibition

Ba b c Uss (7) 3 shots of T 93 800n9,

By injecting TF400n9 four times, was induced in the subcutaneous tissue.

I fired the (2 1) 4 of Ming immediately after T F. Was shot with us g in the same manner.

In comparison with the control to which the buns (control) obtained from the above-mentioned mice were administered, the F-us obtained from the mice showed a significant effect on nV vo (192). In other words, 19 indicates the control, and the part of the figure that is cut horizontally is. As shown in 20, in the test treated with light body, the ablated area was greatly reduced to 3 compared to the control. From this, it has been proved that it is effective for the control of.

(9) Inhibition by ne bo nouse b os s ode

Injecting T 80049 suspended in uL's PB into the Ba bc mouse of the day or 3 shots of only PB induced transient in the lower tissue (UJ a (2005) Jce phys o 203: 447 456). . In this case, an TF mouse g for each di was administered together with TF for 3 times. , 1.68u9 was thrown per us. On the fourth eye, the mouse was divided, and the piece at the dose position was colored with Kin (E).

As a result, all the sha () abnormal lines were not observed, while the mark indicated by the mark was observed in T F 0. (It can be inferred that this is due to the T F-usogenic T F synergy of the extraordinary radiation administered by this T F.)

By comparison, the following is noticeably observed, especially the monopracticing 2 1 2 3 2 3 against di 2 is observed, and the nockona against 3 and 4 is observed. 54 3 62 4 42 4 69 was also recognized (the effect is shown in Figure 21). Availability

As is clear from the above, it was possible to easily produce a specific structure (including human body) that specifically recognizes human T TF, which has a special structure and adhesion to the tok, which has been difficult to produce in the past. This is useful for clearing T F related cell diseases. Text

16th row: CIGNA

1st row: Aka

18 rows of: P anchors

Claims

The one produced by DN is characterized by being able to uniquely recognize the structure of (F).

2 · F T F is F, that is what is in the claim.

3. The body is a us body or a hit body, and that in the claim is that body.

4. Bonds to structures, higher than bonds to modified TF, that is what is claimed.

5. It includes immunizing a human with a factor that expresses the F or expresses the functional fragment thereof.

6 · That of claim 5 that further includes the DN where the Kuta carries the secretory signal.

7 · Claim 5 does not, where the vector further includes a DN that includes the signal.

8 The functional piece is N, which modifies the T F, wherein that in claim 5 is.

9 · The claim N5, in which N or a functional fragment thereof which comprises TF comprises a base sequence constituted by the sequences 24, 6, 8 or 0.

0 ・ The thing is a thing, that in claim 5 is that.

The thing in claim 10 is that the object is a mouse or rat.

2 · Us is a hit transus, that in claim 11.

3. It is possible to uniquely recognize the difference between hit F, moji 2, moji 3, or moji 4, which is in the claim. 4 • The body has a bond () above and / or a dissociation (D) below 7 X with respect to said F.

5 to 4 deviations are included, including TF related treatments, for improvement and prevention.

6 · The body is a mono-body, as claimed in claim 15. 7. · The body is a hot body, claim 15. 8 · is in claim 15 in which the pieces are combined with a therapeutic agent.

9.Claims, atherosis, atherosclerosis, cell disease, leukemia, angiogenesis, glaucoma, joints, urine disease, hypertension, transplantation TF, etc. Listed

.

2 ・ Complicated with, lung, liver

It is in claim 19.

2 · Cancer, claim 19 listed.

22.4, including the fragment, T F

To refuse.

23. The diagnostic composition according to claim 22B, in which the body is a monobody. 24 T F, is associated with radiation, arteriosclerosis, atherosclerosis, cell disease, leukemia, angiogenesis, glaucoma, joint, urinary disease, hypertensive transplant reaction, and the composition of claim 22.

25 ・ Associated diseases are: lung, liver

The composition of claim 24.

26. The composition of claim 24, which is cancer.

2 7 bodies ouse ouse hyb do a F (FE BP 0 54) ouse ouse hyb do a F FE B 0455) ouse ouse hyb do a F 2 (FE BP 0456) ouse ouse hyb do a TF 2 (FB 0727) ouse ouse hyb do a TF 2 (FP 0728) ouse ouse hyb do a F 24 FE BP 0729) ouse ouse hyb do a CF 2 (FE BP 0730) ouse ouse hyb do a F n (F 073) ouse ouse hyb do a F 3 (FP 0732) ouse ouse hyb do a TF 4 (FE BP 0733) There is a composition on request 22.

28 ouse ouse hyb do a F (F BP 0454) A monocuna from Eve.

2 9 ouse o se hyb do a T F (FE BP 0455) D A monocuna coming from Eve.

30 ouse ouse hyb do a T F 2 (FE BP 0456) from the side of Monokuwana.

3 use ouse hyb do a T F m2 (FE BP 0727) A monocuna coming from Eve.

3 2 ouse o se hyb do a T F 2 (FE BP 0728) D A monocuna from the Eve.

3 3 ouse o se hyb do a T F 2 (FE BP 0729) A knocker from India.

34 ouse ouse hyb do a T F 2 (FE BP 0730) 0 Original monocana.

3 5 ouse o se hyb do a T F 3 (FE BP 073).

36 ouse ouse hyb do a T F 3 (FE BP 10732) Evade Monocuna.

3 7 ouse o se hyb do a T F 4 (FE BP 10733) D A monocuna from the Eve.

38 Immunize a human with a bacterium that contains TF or expresses a functional fragment thereof, including a body that recognizes F, is a cell that produces the body, and specifically produces TF. The method of manufacturing the pieces of claim 1 to claim 4 including obtaining a crane or a monocloner to be recognized. 39. F is TF, claim 38.

4 ・ The item is in the claim 38, which is the item.

4 ・ The object is a dental hoof, according to claim 40. 4 2 · The rodent is a mouse or rat, according to claim 41.

4 3 · Us is a Hillansickus, claim 42.

44. Claim 38 further including a UN where the Kuta carries secretory guns.

45. The claim 38 claim, wherein the actor further comprises a DN including a signature.

46. The cell producing a body is, B, according to claim 38.

The claim number is 4 7 ·.

48. The method according to claim 38, which is serum.

49. The claim of claim 38, further comprising lysing the cells that produce the body to form an ibid.

5 · Claim 38, wherein the pokna or the knockout has a bond () 110 above and / or a dissociation () 7X 0 below g.

5 The piece is a mod F, claim 38.

52. A body according to claim 38, wherein the cell producing the body further comprises selecting the ylide by flow cytometry.