WO2007066823A1 - Antibody against connective tissue growth factor or composition containing the same - Google Patents

Antibody against connective tissue growth factor or composition containing the same Download PDF

Info

Publication number
WO2007066823A1
WO2007066823A1 PCT/JP2006/324894 JP2006324894W WO2007066823A1 WO 2007066823 A1 WO2007066823 A1 WO 2007066823A1 JP 2006324894 W JP2006324894 W JP 2006324894W WO 2007066823 A1 WO2007066823 A1 WO 2007066823A1
Authority
WO
Grant status
Application
Patent type
Prior art keywords
ctgf
antibody
mouse
fragment
ferm bp
Prior art date
Application number
PCT/JP2006/324894
Other languages
French (fr)
Japanese (ja)
Inventor
Poh Sing Ng
Koki Endo
Megumi Iijima
Tomohiro Mori
Original Assignee
Nosan Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by the preceding groups
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6887Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from muscle, cartilage or connective tissue
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by the preceding groups
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/10Musculoskeletal or connective tissue disorders

Abstract

It is intended to provide an antibody, which can specifically recognize a high-order structure of the natural type of CTGF at a high affinity or its fragment, a composition comprising this antibody or its fragment which is usable in treating, preventing or diagnosing CTGF-related diseases such as fibrosis or cell proliferative diseases, and a method of producing the above antibody.

Description

Antibodies or compositions art including that for bright fine manual connective tissue growth factor

The present invention is connective tissue growth factor-derived mammal; relates to an antibody capable of recognizing with a specific and high affinity to native conformation (Connec ti ve Tissue Growth Factor CTGF).. .

The present invention also provides a method for manufacturing the antibody, and;. Pharmaceutical or diagnostic composition comprising the antibody related. . 'Background technology,

Human Bok CTGF is 322. amino acid (however, 349 amino acids when containing Jigunaru peptide) consisting of a connective tissue growth factor having 39 amino cysteine ​​residues, the amino acid and nucleotide sequence 1991 'years since knowledge They are (non-patent document 1-2). While it if this protein is a wound healing action is known, cell proliferative disorders, fibrotic disorders, § terrorist arm sclerosis, it has been known to be involved in diseases and disorders such as glaucoma (Patent Document 1 to 8, non-Patent documents 2 to 4). For the treatment or diagnosis of such diseases and disorders, use of antibodies to human CTGF has been proposed (Patent Documents 1-8, Non-patent Document 4), generally, for the production of antibody, protein, or the peptide as an antigen the method of making the immunized antibody to animals are used. Antibody production in an In vi vo, the animal to be immunized is by recognizing and its antigen as foreign, antigen presenting cells provide the representative with the antigen, the signal transduction in T cells activating this is activated T cells further stimulate B cells, performed by leading to antibody-producing cells.

However, attempts to produce a conventional antibody antibody production method that directly immunized animals human CTGF as an antigen, preparation of the antigen maintains the native conformation used for immunization is very difficult, the present inventors in La of experience, in many cases, or fail, or was very low antibody titers. This is for example the human CTGF was observed in the same manner even when immunized in two Wa birds not only in mammals. As its cause, since CTGF is a non-Japanese, strong protein of different binding properties of the original Ma Bokuri Kkusube, adhered to various surfaces, resulting a sufficient immunization has not been performed, CTGF is purified and Shasuku Oko degradation during storage, thus such is Ru is estimated as a cause that an unstable protein ¾.

Human CTGF also has for this special structure that protein has unique, ie have 39 systemic fin residues, at least the structure that there are five Jisurufui de binding ', intramolecular disulfide We have had combed characteristics if Okose the binding of the recombinant. Therefore, this protein an unnatural environment (e.g., purified Environment) - exposed to sometimes, the molecular structure chemical alteration of a non-native environment (pH, ions), it'll connexion protein native conformation change and, as a result of its it is estimated that the denaturation of the protein. occur. Moreover, CTGF sugar chain. (N - Darikan) is added it is suggested Rooster on his own column, can be expected to this difference in glycosylation also Ru very important structural. For such special structural features, arsenate, also makes it possible to obtain an antibody that specifically recognizes the native higher order structure of the bets CTGF, certain one of the future challenges. ''

Forces present patent document and publications as described above for anti 'body for human CTGF;., Large quantities methods for making antibody to a nil, also native conformation specificity of it is difficult to obtain antibodies which recognize indeed the manner, practical antibodies nevertheless are desired at present, it not yet emerged.

DNA immunization in this application (or gene immunization) a method of making an antibody by utilizing Hisage. Providing Although, for the DNA immunization, for example, Patent Document 9, is described in Non-Patent Document 5-8. DNA immunization is the in v ivo, in so that the eggplant producing antibodies against certain antigens, inserted expressible in the DNA encoding the antigen into a vector, inoculating the base Kuta over to an animal such as human to refer to a so-called genetic vaccination. Such antigens, eg viral antigens, tumor associated antigens, protozoan antigens include microbial antigen. After inoculation, DNA is expressed, the antigen is produced, the antibody is produced is incorporated into the immune system in vivo.

As an application of DNA immunization, Non-Patent Document 9 describes the production of Poriku port one monoclonal antibody using DNA immunization. The method involves immunizing built, the animals in the vector expressible manner the vector DNA encoding the fusion protein as the concatenation of the secretory leader one and antigenic tag at the N-terminal side of the antigen protein. Antigenic tag has a role, such as adjuvant door, an antibody against the tag in the in vivo is also generated.

Patent Document 1 Japan Hei 11-507332 JP

Patent Document 2 Japanese Patent Laid-Open 11-180895 JP

Patent Document 3 Japanese Patent .2004- 132974 JP '

Patent Document 4 Japanese Kohyo 2002- 529066 JP.

Patent Document 5 Japan-T-2002- 504332 JP

Patent Document 6 Japanese Kohyo 2005- 505757 JP -. 'Single Patent Document 7 Japanese Kohyo 2002-524422 JP.

Patent Document 8 U.S. Patent Application Publication 2004248206 discloses

Patent Document 9 Japan-T-2000-582427 Patent Publication No.

Non-Patent Document 1 DM Bradham et al, J. Cell Biol 114:. 1285-1294 (1991) Non-Patent Document 2 A. Igarashi et al., Mol Biol Cell 4:.. 637-645 (1993) Non-Patent Document 3 M. Minato et al., J. Biochem 135:. 347-354 (2004)

Non-Patent Document 4 T. Mori et al, J. Cellular Physiology 181: 153-159 (1999), Non-Patent Document 5 JS Boyle et al, Proc Natl Acad Sci USA 94:.... 14626 - 14631 (1997)

Patents:? Document 6 S. Gurunat an b, A Rev. Immunol.18: 927-974 (2000) Non-Patent Document 7 D. Tang, et al., Nature 356: 152-154 (1992)

Non-Patent Document 8 'H. Tighe et al., Immunol Today 19:. 89-97 (1998)'

'Non-Patent Document 9 RS Chambers and SA Johnston, Nature Biotechnology 21 (9): 1088-1092 (2003) DISCLOSURE OF THE INVENTION

Human CTGF belongs to the CCN family Lee, are known to have a wide variety of biological functions as one of the growth factors that are formed Ri by the four modules. In particular, CTGF CTGF has been noted in the previous curable molecules in fibrosis such as skin fibrosis, development of specific antibodies, including research and fibrosis investigate the relationship between the expression and pathological progression of the molecule considered to be an important key to targeted therapy methods developed for diseases associated with overproduction. However, the eye. Manner a molecule ensuring an antigenic proteins retain activity example cormorants it is difficult to produce and purify large quantities as a recombinant protein, an antibody in the conventional methods of generating antibodies against CTGF molecule or be made is very difficult ivy. Indeed, commercial-CTGF antibody is present, unusable because of its low specificity. In such circumstances, an object of the present invention is to provide an antibody capable of specifically recognizing native conformation of CTGF.

Another object of the present invention. Is to provide a pharmaceutical or diagnostic composition comprising the antibody. - - - -., -

Still another object of the present invention is to provide a method for manufacturing the antibody. Summary of the Invention.

The present inventors have initially a DNA encoding the human 0TGF expressed using insect cells infected with recombinant Vacu port viruses', to produce Afi two Tikaramu Thus recombinant tut human CTGF purified, the recombinant protein was 1-2 months immunized as an antigen to mice and two Wa birds but expected antibody was produced. For well obtain native high-order structure antibodies recognizing said protein retaining the next tried antibody production in mice by DNA immunization, Burosai densitometry results antisera analysis of mice with antibody titers it is low. it has been confirmed.

The present inventors have further in DNA immunization. Insert DNA encoding the immunopotentiating signal peptide expression base Kuta one examined the increased antibody titer by immunization. 'A Jikashi but et al., Significant CTGF antibody titer rise in the immune 6 weeks was observed. As the cause, because of CTGF antigen concentration is an expression product was very low concentrations, was expected to be not sufficient to induce the immune system. CTGF is a high protein of non-specific binding to Matrigel box might Such characteristics are affected. Therefore, thinking to remain the CTGF at a predetermined time a high concentration on the cell surface, to produce a plasmid which a localization signal was added DNA encoding just after the human CTGF, similarly were immunized, immune 6 weeks CTGF antibody titer was significantly elevated in the eye, practical as well as successfully produced CTGF antibodies, specifically recognizing antibody with high affinity as unprecedented the native conformation of human CTGF was it possible to provide. Furthermore, it was added study, for the production of anti-CTGF antibody by DNA immunization methods of the present invention, immune enhancing signal and localization signal that is divide not necessary. That is, this ^ was found that it is possible to produce the antibody of interest only with DNA co one de the CTGF precursor containing a secretory signal. In this case, about 10 weeks on more than 6 weeks after immunization, it was necessary to repeat the boost. '

Human CTGF is instability that structurally modified easily and was easily decomposed, and higher have in terms of property that non-specific adsorption of a protein having specific properties. Previously, antibodies toying marketed for CTGF, not withstand-use - a low isomerization antibodies enough. Moreover, CTGF, because of its unique properties, in order antibody had Yure characteristics that would have an extremely obtained hard, in the method disclosed in the prior patent literature and publications, etc., or not antibodies are obtained, or no practical antibody was only obtained at a very low antibody titers. In contrast, the method of the present invention makes it possible to produce reproducibly and specific human CTGF antibody. Such methods heretofore are those person skilled in the art was One or conceived Siena, be to enable the production at a practical level, and to an antibody specifically recognizing the native human CTGF can be supplied, is that a breakthrough with respect to CTGF. , Therefore, the present invention is, in summary, has the following characteristics.

This HatsuTomo, in a first aspect, a feature that can be recognized with a specific and high affinity natural 犁高 following structure connective tissue growth factor-derived mammalian (CTGF), DNA immunization providing pile or fragment thereof produced by. .

'In like, the CTGF Gahi preparative' its one implementation status is CTGF. '.

In another of its embodiments, the antibody of the present invention is a mouse antibody, human antibody or humanized antibody.

Herein, human antibodies, refers to the complete human type antibody, human antibody genes is an antibody and the same antibody produced. Furthermore, humanized antibodies are chimeric antibodies from a portion of the antibody of part of another animal human antibodies, for example, some or all of the CDR hypervariable regions of human antibodies an antibody such as substituted counterparts of non-human animal (e.g., mouse).

In another embodiment thereof, the DNA immunization is Dressings containing immunizing an expression vector into non-human animals comprising in an expressible DNA or functional fragment thereof encoding said CTGF. .

The vector, the secretion signal peptide co Solo de. DNA may further comprise a.

The vector may further comprise a DNA co one de a peptide comprising localization signal and immune-enhancing signal. '

Preferably, the vector comprises a secretion signal peptide, an immune enhancing sheet. Danaru Bae flop tides, CTGF protein., The DNA encoding each of the localization signal peptide, from the 5'-end side in this order. -. -. Secretory signal peptidase, de As used herein, the expression in a cell, the translated CTGF a base peptide with be transported to the cell 腠 Ru acts, by signal peptidase process. a peptide that is cleaved by sequencing. At this time, CTGF is secreted extracellularly. Preferred peptides are 'signal peptide CTGF. 'Localization signal peptide frolicking used herein, is any peptide having a function of anchoring expressed intracellularly the translated CTGF shifts to the cell membrane, and secreted CTGF on the cell membrane. '

, Immunopotentiating signal peptide as used herein is any peptide to enhance the immunogenic activity or antigenic activity of CTGF. .

In this ¾ light, examples of the functional fragment is a CTGF module. Here, the module refers in CTGF protein, functional, components having functions or effects. Italy j of such modules, Lee Nsu re-down-like growth factor binding element,. Fon'virubu runt C-shaped element, thrombospondin type 1 Li copy door element, C-terminus Shisutin'no Tsu door element, to the heparin-binding element, such as it is. Specifically includes as shown in FIG. 1, module one Honoré 1 of human CTGF, module one Honoré 2, the module one Honoré 3 or Mojiyunore 4. The term DNA as used herein, both cDNA and genomic DNA contains Murrell. cDNA may be synthesized by cDNA Kuroyungu from animal tissue or mRNA in the cell.

In another embodiment thereof, DNA or functional fragment thereof that co one de the full-length human CTGF is, SEQ ID NO: 2, 4, 6, by 8 or 10; is intended to include nucleotide sequences that are 1-. In another of its embodiments, the animal is a mammal. ; In another embodiment thereof, the mammal is a mouse or a rat.

Preferably, the people mouse is a human antibody-producing trans-diethyl Nick mouse. The mice human small lance capable human antibody genes in place of the mouse antibody genes on the mouse chromosome by genetic recombination technique using the artificial chromosome is introduced to produce fully human antibody Te cowpea thereto a Jie nick mouse. '

In another of its embodiments, it can be the antibodies of the invention specifically recognizes a native conformation of the CTGF molecule. . -: A

Herein, native conformation of CTGF is, CTGF frolicking formed by disulfide bond at the natural position formed between Li Tutsi systemic fin residues in the amino acid sequence is taken in vivo native a conformation (also Konfuome one Deployment referred to)., and, means a supramolecular structure consisting of sugar chain structure derived from mammals that bind to CTGF protein.

Here, the sugar chain structure derived from a mammal, especially a CTGF Gahi preparative CTGF, a force to take native conformation of the three-dimensional structure Hohi preparative CTGF protein protein; one, as the sugar chain structure is Degiru also take sugar chain structure derived from other mammals Nag just sugar chain structure derived from human Bok stuff and Juru. The sugar chain structure derived from such other mammals, for example CH0 cells, COS cells, HEK293 cells, mammalian cells such as NIH3T3 cells include sugar chain structure can be produced. Such sugar chain structure is a human CT F gene may be formed 'when expressed in said mammalian cell containing the gene. Mammals, including humans. CTGF derived, in generation and purification process of CTGF with purified or recombinant methods from natural or during even storage at 4 ° C with purified CTGF, low molecular by decomposition reduction (module 1 and 2, the module 3 and 4, or degradation of each module) easily to put the. Thus, the full-length CTGF protein, is one of extremely handling difficult protein unlike other proteins. In conventional classical immune 疫法, as an antigen, it is necessary to obtain purified CTGF, in the course of purification or immunization, compounds, may occur as described above is estimated to be very high. The antibodies of the work process of the present invention, since the native antibody is formed by INVi vo, singular antibodies recognizing easily obtaining a native conformation. Herein, the term "denatured", Chigae set of Jisurufui de coupling, low 兮 coca by decomposition, denaturation by heat or chemicals, cleavage of the sugar chain structure, and from non-mammalian Tokusari構 Concrete formation, are used with respect to either the I go-between resulting CTGF protein. Many anti-CTGF antibody prepared by classical immunization, for the above reasons, it is expected to contain a higher antibody reactive with such degeneration type CTGF.

Further, herein, to specifically recognize the native conformation of CTGF is an antibody or fragment thereof of the present invention, a continuous or discontinuous surface antigen of CTGF with native conformation the E-bi Ichipu, relative to the native CTGF purification or genetic recombination ^ intramolecular disulfide formation 'surface antigen variation † raw type CTGF as structural modification occurs by Chigae Gokumi Epito Ichipu, It means that the well-recognized than '. Here, the specific, or recognize CTGF. With native conformation does not recognize other proteins and peptides other than the above-denatured CTGF or CTGF, or the denatured 'natural high than CTGF It means the CTGF with the following structure relatively easily recognizable Furudo. The good sea urchin relatively high awareness

(Or immunological reactivity), when compared with SPR analysis in other words, binding ability of the antibody or fragment thereof of the present invention with respect to the native conformation, higher than binding to denatured forms CTGF, preferably the modified binding capacity five times or more for the type CTGF, more preferably 10 times or more, more preferably 100 times or more, to have a 1, 000-fold or more higher binding ability, Honmyo! ; During Tasho is specifically of recognizing. .

And a Is Ranaru characteristics of the antibody of the present invention is that it recognizes a discontinuous Epito Ichipu three-dimensional structure rather than a linear E peak Tope of CTGF protein (l inear epi tope) or communicating Epito one flop . It said Therefore, the antibodies of the present invention is susceptible to Konfo Ichime one Deployment change in CTGF.

Herein, DNA immunization, CTGF encoding DNA or expression downy Kuta incorporating a functional fragment expression available-^ "a non-human animal, preferably injected into the mammal, subcutaneous, intracellular for heterologous expression and secreted the protein in, antibodies against the protein in the animal is meant a series of techniques including be produced.

Antibodies of the present invention, finding that the protein or peptide antigen can be obtained by using the above DNA immunization rather than conventional methods of generating antibodies directly injected into the animal's subcutaneous aspect of the present invention it is also one, before the present applicant, is that those skilled in the art were country expected at all.

Herein, expressible manner and under the control of regulatory sequences, meaning that with DNA or functional fragment thereof encoding the CTGF is expressed, 'corresponding protein or peptide is produced in inv ivo to.

In the alternative embodiment, the antibody of the present invention, module 1 of the human C.TGF, module 2, can it to specifically recognize any one of Mojigoru 3 or module 4.

In an embodiment of the sex, the antibody of the present invention, the binding constant for CTGF (KA) 1 Χ 10 9 Μ-ι above and / or dissociation constants (1 ^) are those having a 7 X 10- below.

Prepared by conventional immunization methods. Has been the binding constant for the native human CTGF (polyclonal or monoclonal) antibodies not specifically. Reported before, antibodies such as their are human CTGF throat cross-reactive it that is known is hardly low affinity (e.g. J. Biochem, 2004, 135:. 347- 3 5 none antibodies of the present invention, more than conventional produced by immunization antibodies. binding constant for higher human CTGF, some have is characterized by having a lower dissociation constant, '.:

The present invention also provides in a second aspect, comprising an antibody or its fragment of the present invention as described above, treat CTGF-associated diseases, a pharmaceutical composition for improving or preventing. .. ..

In one embodiment thereof, the antibody of the present invention is a monoclonal antibody.

As another embodiment odor X, antibodies of the present invention is a human antibody or a humanized antibody. In another embodiment thereof, the antibody or fragment thereof of the present invention is combined with a therapeutic agent.

Konjiyugeto of such an antibody or fragment thereof with a therapeutic agent is a pharmaceutical aimed at so-called molecular target. Antibody or fragment and a therapeutic agent thereof of the present invention are transported to the disease target site by the antibody or fragment thereof, can act for the treatment or prevention of diseases CTGF is implicated.

Examples of such CTGF-associated diseases, fibrosis, sclerosis accompanied by fibrosis, arteriosclerosis, Ateromu sclerosis, cellular proliferative diseases, leukemia, angiogenesis, glaucoma, arthritis, diabetes, hypertension , there is such as transplant rejection. Specifically, sclerosis associated with the fibrosis or fibrosis include, for example, renal fibrosis, pulmonary fibrosis, hepatic fibrosis or scleroderma (or skin fibrosis). Further, the cell proliferative disorder, for example cancer.

The present invention further relates in a third aspect, comprising an antibody or fragment thereof of the present invention as described above, provides compositions for diagnosing a CTGF-associated disorder.

In one embodiment thereof, the antibody of the present invention is a monochromator 'polyclonal antibodies.

In another embodiment thereof, the compositions of the present invention, fibrosis, sclerosis accompanied by fibrosis, arteriosclerosis, Ateromu sclerosis, cellular proliferative diseases, leukemia, angiogenesis, glaucoma, arthritis, diabetes. hypertension, frolic used for the diagnosis of CTQF-related diseases such as transplant rejection. ,

The fibrosis or sclerosis accompanied by fibrosis, such as renal fibrosis, pulmonary fibrosis, hepatic fibrosis or scleroderma (or skin fibrosis). Further, the cell proliferative disorder is cancer. In another of its embodiments, the antibody of the present invention, Mouse- Mouse hybri doma CTGF-ml l (FERM BP - 10454), Mouse-Mouse hybridoma CTGF - ml2 (FERM BP - 10455) or Mous e-Mouse hybr i doma CTGF-m21 (FERM BP - 10456) Nono Ivry dormer derived from algae carbonochloridate of - Ru monoclonal antibody der '. '

'The present invention is further to the fourth aspect. Oite provides Mouse- Mous e hybr i doma CTGF-ml l (FERM BP- 10454) hybridoma derived monoclonal antibodies.

This Ming further. In a fifth aspect, Mouse- Mouse hybr i doma CTGF- ml 2 (FERM BP- 10455) High Priestess dormer to provide a monoclonal antibody derived. Ru. The present invention f Masala ί this, sixth Te aspect (Nobi Rere of providing Mouse-Mouse hybr idoma CTGF-m21 (FERM BP- 10456) hybridoma derived monoclonal antibodies.

The present invention further provides in a seventh aspect of the, Mouse-Mouse hybr i doma CTGF - providing m22 (FERM BP- 10727) monoclonal antibody from hybridoma of.

The present invention furthermore, in a eighth aspect, provides a Mouse-Mous e hybr idoma CTGF-m23 (FERM BP- 10728) hybrid one Ma-derived monoclonal antibodies.

The present invention furthermore, in a ninth aspect, there is provided a monoclonal antibody derived from a hybridoma of Mouse-Mouse hybr i doma CTGF- m24 (FERM BP- 10729).

The present invention furthermore, in a tenth aspect, there is provided a monoclonal antibody derived from a hybridoma of Mouse-Mous e hybr i doma CTGF-m26 (FERM BP- 10730). The present invention is further .., in the first one aspect,. Mouse- Mous e hybr i doma CTGF- m31 (FER.M BP-10731) monochromator from hybridoma of. Providing polyclonal antibodies.

The present invention further provides a twelfth aspect odor T, Mouse-Mouse hybr idoma CTGF-m32 (FER BP- 10732) monoclonal antibody from hybridoma of.

The present invention further 'in the thirteenth aspect of the, Mouse-Mous e hybr i doma CTGF- m41 - providing (FERM BP 10733) monoclonal antibody from hybridoma of. '

The present invention further provides a body fluid comprising the fourteenth aspect, DNA encoding or expressible expression base Kuta one containing the functional fragments of CTGF. Immunizing non-human animals, an antibody that recognizes the CTGF, or cells that produce antibodies, the extraction involves obtaining a polyclonal one null or monoclonal antibodies that recognize the CTGF, to provide a manufacturing method of the present invention the antibody. '

In that embodiment, it is the CTGF Gahi preparative CTGF.

In another embodiment thereof, it is the non-human mammal month rodent or ungulates. In another embodiment thereof, the moon rodent is mouse or rat.

In another embodiment thereof, the mice are ^ human antibody-producing tiger ^ Sujienikkuma c.

In another of its embodiments, it can further comprise said vector encoding a secretory signal peptide. Ru DNA.

In another of its embodiments, it can further comprise a DNA. The base compactors encodes a peptide ^ including localization signal and immunopotentiating signaling Le. ''

Preferably, the base Kuta scratch, secretion signal peptide, an immune enhancing signal peptidase flop tides, CTGF protein, DNA encoding each of the localization signal peptide comprises from 5 'end in this order.

In another embodiment thereof, cells producing the antibodies are spleen cells, B cells, or lymphocytes.

In another of its embodiments, the ungulate is © sheet.

In another embodiment thereof, it is the body fluid is blood, serum or milk.

In another embodiment thereof, the polyclonal or monochromator port one monoclonal antibody is binding constant (KA) for the human CTGF 1 X Ι Ο 9 ^ 1 or more and / or dissociation constant (KD) 7 X 10- 1 Q M have the following characterized by.

Further, examples of the functional fragment 'the module 1 arsenide Bok CTGF, module 2, a DNA encoding the modular Interview one Honoré 3 or module 4.

In another embodiment thereof, the method of the present invention further comprises selecting a cell or the High Priestess dormer producing the antibody at Furosai Tome birds scratch. The present invention, antigens as compared to the antibodies obtained by conventional Me antibody production method that directly immunized animals, higher significantly binding affinity for CTGF having native conformation and specific biological activity of the CTGF manner or. one antibody that highly inhibited play provided. The finding of such antibodies is very surprising that mean to those skilled in the art. When the antibodies of the present invention, produced in in v ivo in particular human antibody-producing trans Jie Nick animals, human antibody is obtained which, diseases associated CTGF is in humans, for example, fibrosis and cell proliferative diseases, for the effective treatment of a possible use without rejection. Thus, the present invention is the antibody produced by the conventional antibody-producing method in that can provide a sufficient effect of the novel properties as described above which can not be expected antibody, treatment of the disease; diagnosis it is industrially valuable and useful for. A brief description of 'drawings

Figure 1 'shows the basic structure of human CTGF.

Figure 2 is a schematic diagram of VV8 and VV6 vector. Shown. In the figure, FLAG is a tag,. IEE

-,, refers to immunogenic ten production increase bow Ereme emissions Bok '(Immunogenic i ty enhancing el ement), Shimegishiroshaku (TARGET) is a DNA In addition the gene encoding the expression product of interest, GPI-signal , representing the GPI anchor.

3, mouse pol yc lonal ant i-CTGF polyclonal antibody: shows the FCM analysis result of (antigen full length CTGF).

Figure 4 shows a schematic diagram of CTGF full length, and each module (modul e) expression product (ml, m2, m3, m4).

5, mouse pol yc lona l ant i-CTGF polyclonal antibody: shows the FCM analysis result for CTGF total length of (antigen full length CTGF), and each modul e expression product (Module 1 Module 4). A represents a control for the expression of CTGF full length, and each module, B shows the results of analysis by the anti-pan 'Shin. , 6, Mouse - shows the Mouse hybridoma CTGF- mil FCM analysis of monochrome over nano-les antibody clone 30d2 derived.

7, Mouse - Mouse hybridoma CTGF - ml2 shows the FCM analysis of monoclonal antibody clone 30E9 derived. '

Figure 8 I or, Mouse- Mouse hybridoma CTGF one mil from monochrome over nano-les antibody clone 30d2, shows the FCM analysis result of the fine ouse-Mouse hybridoma CTGF- ml2 derived the monochromator port Nanore ¾ΐί present clone 30E9. This Chino antibodies, anti module 1: indicates that an antibody. ', .. ■

9, ouse-Mouse hybridoma CTGF - shows the m21 mono Kuronanore antibody clone 1 from FCM analysis result.. '

Figure 1 0 ί or shows Mouse- Mouse hybridoma CTGF- m22 'monochrome over nano-les antibody clone 3 derived, and' FCM analysis result of Mouse one Mouse hybridoma CTGF one πι24 · 'from monochrome over nano-les antibody clone 13. These antibodies show that an anti module 2 antibody. Figure 1 1 (i, Mouse-Mouse hybridoma CTGF- m31 origin of monochrome over Chino les antibody clone 54 Alias: 22D10) shows the FCM analysis of.

. Figure 1 2 I or, Mouse- Mouse hybridoma CTGF- m32 from monochrome one Nanore antibody clone 62 (aka: 21 2) of indicating the FCM analysis result.

Figure 1 3 ί or, Mouse-Mouse hybridoma CTGF_m33 derived monochromator port Nanore antibody clo, shows the FCM analysis result of ne 2IH12. '

Figure 1 shows the 4 {1, ouse-Mouse hybridoma CTGF-m31 derived monochromator port Nanore antibody clone 54, and Mouse-Mouse hybridoma CTGF_m32 FCM analysis of monochrome over nano-les antibody clone 62-derived. These antibodies show that an anti module 3 antibody. Figure 1 5 ί or, Mouse- Mouse hybridoma CTGF-m41 from monochrome over nano-les antibody clone 42 (aka: 8E7) shows the FCM analysis of.

Figure 1 6 ί or shows Mouse- Mouse hybridoma CTGF- m41 FCM analysis from the monochromator port one Nanore antibody clone 42, and Mouse-Mouse hybridoma CTGF one m42 origin of monochrome over nano-les antibody clone 69 results. These antibodies show that an anti module 4 antibody. Figure 1 7 shows a Western plot analysis results was performed using the monochromator opening one monoclonal antibody of the present invention. Each lane of purified CTGF. Subjected, + the CTGF treated with 2-mercaptoethanol, one was subjected to CTGF not treated with 2-mercaptoethanol. Molecular weight markers one is shown at the left end of each lane.

Figure 1 8, rat fibroblasts by each monoclonal antibody of the present invention: shows the inhibitory activity of definitive to cells NRK-49F collagen synthesis. Using recombinant human CTGF was produced by the CH0 strain PBS (phosphate-buffered bus Ffa) as a control. Also. Was, as a separate controls, recombinant human Bok CTGF + TGF j3, TGF and control mAB (which are mono. Clonal antibody of .- present invention using a purified IgG of non-immune mice during treatment by the addition of TGF) 3 to the medium. .,

Figure 1 9 is. In suppressing effect test for in v ivo skin fibrosis Bal b N mice (postnatal day 7) shows a control plot was administered immunoglobulin emissions from unimmunized mice (negative control). '' 2 0, in the suppression effect test for in v ivo skin fibrosis Bal b / c mice (postnatal day 7), indicating the test group treated with m @ 2-l antibody of the present invention.

Figure 2 1 is in the suppression effect test for in v ivo skin fibrosis Ba rb / c mice (age 4 days), indicating the test group administered with antibodies to each module of the present invention. Red arrows indicate the fibrous layer produced in the fat layer. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in detail. ''.

CTGF

CTGF is human, mouse, rat, pig, mammals such as © sheet, have been identified in birds such as two Wa birds are secreted from the cells, and the interaction with its specific cell surface receptors, Yotsute thereto, which is one of growth factors having activity particularly involved in the synthesis of proliferation and extracellular Conclusions Li box connective tissue cells.

In the present invention, CTGF animals, in particular vertebrate, preferably a mammal, more CTGF derived from good Mashikuwahi bets. For example mammalian origin Amino acid and base sequence of CTGF are available from GenBank de one database (NCBI). For example CTGF sequence, accession number in humans CAA63267, X9251 1, P29279, NM001554, 围 001,901; In mice NP034347;. In © shea NP776455, N 174030;; rat In NP071602, N 022266 preparative registered as AAD00174 in pigs there.

Human CTGF is 322 Amino acid (provided that 349 Amino acid when including the signal peptide) is a glycoprotein consisting of, in addition to the sugar chain derived from human, have a 39 amino Li Tutsi systemic Inn residues and, characterized by five disulfide bond exists at least. Further, as shown in FIG. 1, this protein has four functional domains, modules 1 is ie Insurin like growth factor binding protein, module 2 is Fon'virubu Holland C Factor - Toronbosupo ^ Jin 1 - module 3, C-terminal Shisutin'no Tsu preparative like domains including the module 4 is (signal CTCK) a type repeats. : Roh

Human CTGF. Amino acid sequence, and the nucleotide sequence encoding it, SEQ ID NO: 1 and SEQ ID NO: 2 in the sequence listing described later, are shown reconstituted SEQ ID NO: 1 1. . Further, each of the nucleotide sequence encoding Amino acid sequence of modules one Le 1-4 and their, SEQ ID NO: 3 and 4 are in the Mojiyu Le 1, SEQ ID NO: 5 and 6 for module 2, SEQ ¾ No. for modular Yule 3 7 and 8 are shown distribution 刿番 No. 9 and 10 for the module 4.

In the present invention, mutants of CTGF, e.g., if the mutants occurring in the individual for mutations, such as polymorphisms Ya splice variant II is present, the present invention similarly to such mutants also CTGF It may be subject. Such mutants, CTGF or functional fragment in (e.g. module, preferably the module 1-4 arsenide Bok CTGF) § amino acid sequence or nucleotide sequence is ^ in, one or more, for example 1 or several number of amino acids or quinuclidine Reochi de substitutions may include deletions or additions. Here, 2-10 and several, for example 2 to 7 carbon atoms, 2-5 atoms, 2-3 atoms, represents two integers. Alternatively, such mutants, the amino acid sequence or nucleotide sequence having 80% or higher, 90% or more, 95%, 98%, those having 99% or more identity. Here, the percent identity may be readily determined using known programs such or introducing non BLAST program introducing Giyappu (S. Kar l in al, Proceed i ngs of the Nat i ona l Academi c Sc i ences USA 90: 5873 - 5877 (1993)).

In the following description, generically referred to as CTGF the CTGF and its mutants. The production of antibodies by DNA 'immunization

Preparation of the antibody of the present invention is achieved by the use of DNA immunization.

The DNA immunization insertion, animal tissues or cells, such as human (eg, skin fibroblasts, the inner skin cells) DNA encoding the CTGF protein from black to one Schimmelpenninck ', resulting cDNA into an animal expression vector and, to immunize the base Kuta one to the animal. At this time., Antibodies to human CTGF obtained by expression of the DNA is produced by dynamic within the object. The present invention, by the use of DNA immunization, - CTGF is Nei in INVi vo - produced in revertive state, an antibody thereto, characterized in that the produced. The Neiti blanking state, naturally occurring higher-order 'structure of CTGF (disulfide bond, sugar, etc.) means that you take. Thus, antibodies produced by the present invention is the antibody against the native CTGF. Preferred antibodies are antibodies against native human CTGP. Human CTGF is to have a five disulfide bond, its expression, denaturation during the purification, i.e. to combed if Okose conformational change, addition, since CTGF is a glycoprotein, human type - sugar statement should CTGF protein is made form to have a similar carbohydrate thereto. Many of the antibodies produced by the method of the present invention, because it is specifically recognize and high affinity to native high following structure CTGF, in which the two above problems can Masaru clothes.

Black-learning of DNA encoding CTGF may be carried out as. Order.

Database or based on CTGF the cDNA nucleotide sequence described in the literature, designed and synthesized a primer consisting of the 5 'end 及 beauty 3' end of the sequence. Primers usually have a size of about 15 to 25 bases, to provide two primers one that can be Aniringu the sense strand and antisense strand of the CTGF. Primer - Synthesis of can be performed using a commercially available automated DNA synthesizer.

Animal tissue or cells, such as human (eg, skin fibroblasts, endothelial cells) prepared in the total RNA from example click every mouth Holm / phenol / I Soa mil alcohol / Guanijiniumu / CsCl method such as a known RNA Preparation to obtain poly a (+) RNA (mRNA) by oligo dT cellulose column chromatograph I first processing, intends row cDNA synthesis. in the presence of a reverse transcriptase. c DNA synthesis and cloning kit, for example from Amersham, since commercially available from such Inv i trogen Corporation. are, it is convenient to use these kits. In this way, the synthesized cDNA into 铸型, using the produced ply, mer as described above, the polymerase chain reaction performed (PCR), to amplify the cDNA encoding CTGF.

PCR is commercially available thermal cycler one (e.g. Perkin Elmer-9600, Eppendorf- Master like cycl er grad i ent) it is preferable performed using. 'PCR. As a condition, for example 10 X PCR buffer (lOOmM Tri s (pH 8. 3), 500mM KC1, 15mM MgCl 2 , and 0. 1% (W / V) gelatin), dNTPs 2 mM, Purama one 2. during 5 mu M to 10 mu M, heat resistance DNA polymerase main hydrolases such as Taq polymerase (1-2 5 units;. rTaq (Takara ^ Kyoto, Japan), Ampl i Taq (Promega), etc.) and the reaction was added to do. PCR, may, for example 95 ° C, after one of the modified Saikunore in 2-5 minutes, 95 ° C, 0.. 2 to denaturation at 1 min, 50-65 ° C, 0.. 5 to 1 minute § twenty-one ring, and 72 ° C, the elongation at 0.5 to 2 minutes 1 cycle and. to make 15 to 40 cycles, and finally, comprises performing extension 72 ° C, 5 minutes . Roh cDNA Kuroninku ,, and PCR [tips Rere. Ί or Te, Sambrook et al., Molecular Clon ing A Laboratory Manual λ Cold Spring Harbor Laboratory (1989) ,, Ausubel et al., And urrent Protocol s in Mol ecular Bio logy (1989) , etc. can refer are described. , The sequence of a functional fragment species CTGF is already functional and Rooster, himself column may determined based on a comparison of identity between the known CTGF. Comparison can row be using the above BLAST program. Moreover, functional fragments of known CTGF is, for example, modules 1-4 of human CTGF. DNA encoding a functional fragment, may be synthesized using an automated DNA synthesizer can be '. '.'

DNA encoding obtained as described above. CTGF or functional fragment thereof (e.g., humans CTGF and its modules 1-4) is then inserted into an expression vector. Vector one includes, for example, plasmid, virus, phage and the like. Preferred vectors scratch, animal cell expression base Kuta one, for example, insect cell expression vector or mammalian cell expression vector, preferably a mammalian cell expression vector. Vectors are city sales, it can be used in the present invention. Examples of mammalian cell expression vectors, adeno © Lee Noresu base Kuta one, Huy Roh-less vector such Wakushiniaui Noresu base Kuta one, pcDNA3. 1 (Inv i trogen), and the like plasmid downy compactors such as pCI (Promega). Expression vectors, promoters, Enhansa, replication origin, ribosome binding sites, polyadenylation site, or terminator that forces include regulatory sequences one coater, etc.; be. Transfer to a promoter one Te cowpea that RNA polymerase binds is started in the host cell, is translated into protein or base peptide of interest. Examples of preferred promoters are viral promoter one coater, e.g. CMV (site cytomegalovirus) flop port motor-, RSV (respiratory syncytial virus) promoter, EBV (Epstei n-Barr ©-virus), and the like. '

In the present invention, the aforementioned vector preferably contains DNA encoding including peptides localization signals and immune-enhancing signal. - -

(Also referred to as immune enhancing elements) immunopotentiating signal, as defined above, is any peptide to enhance the immunogenic activity or antigenic activity of CTGF. Such peptides include peptides having immune adjuvant activity, such as T-cells Epitopu. T cells Epito Ichipu recognizes T cell receptor, is capable of binding thereto. Immunopotentiating signal, for example, various viral antigens, various bacterial toxins such as E Pi Bokuichipu, Kihoruri Npe' to Bok Moshianin (KLH), Oboarubu Min (OVA), © shea serum T albumin (BSA), etc. including such Epitopu of T cell dependent antigens. '

Examples of immunopotentiating signal is of the following shall not be limited to '(RS Chambers and SA Johnston, Nature Biotechnol ogy 21 (9): 1088-1092 (2003)).

GlnAl aVa lHisAlaAlaHi sAlaGluI leAsnGl u (SEQ ID NO: 12);

GlnTyrl l eLysAlaAsnSerLysPhel l eGlyl l eThrGluLeu (SEQ ID NO: 13); SEQ ID NO: 14); and

15).

In the present invention, immunopotentiation signals, you can use a combination of one or more.

Localization signal expressed intracellularly, the translated CTGF shifts to the cell membrane, and secreted CTGF is any peptide having a function of anchoring on the cell membrane. In this onset bright, localization signal is one of the key components, as high antibody titer of CTGF antibody is produced, to stay the Hatsu璜 been CTGF on the cell surface. In a certain time a high concentration there is a need for. Examples of localization signals, GPI (glycosylphosphatidylinositol phosphatidyl inositol Bokuichiru) -.... Anchors one (e.g. Kam, W. et al, Pro Natl Acad Sci USA 82 (24), 8715-8719 (1985) Una I described anchor.:;: a [a Mi acid sequence Titidieieietchipigrsvvpallpllagtlllletatap (sequence number 17) salt group, array accaccgacgccgcgcacccggggcggtccgtggtccccgcgttgcttcctctgctggccgggaccctgctg ctgctggagacggccactgctccct.ga (. SEQ ID NO: .18)], hydrophobic proteins 32 Amino acid residues termini cleaved by transaminase just after the 3-position of the Asp residue, GPI is applied behind the Asp Xango. Thus, data rodents Bok through the 3-position of the Asp residues. allowing to anchor the protein on the cell membrane sul (the EMB0 Journal Vol.19 No.1 pp.10-15, etc. 2000). 'usable in the present invention localization signal, Re limited to the above example and that there is no, the same anchor Any of shea Gunaru if any action can be used.,

Immunopotentiating signals and CTGF and localization signal from the N-terminal side:; Zare linked in order Rukoto are preferred. The linker one of between the respective signal consisting of one to several amino acid of any kind may be coupled. Further, among the sequences, optionally with intervening linker consisting or to several pieces of any amino acid, placed so connecting the CTGF or a functional fragment thereof.

Vectors It is preferable that the coupling further, the DNA which the CTGF or functional fragment thereof expressed in cells co one de secretion signal peptide for the transport to the cell membrane. Suitable examples of such signal peptides are, CTGF signal peptide, for example, the signal peptide of human Bok CTGF (1-position to 27-position of the sequence of SEQ ID NO: 1).

In the present invention, preferred vectors are downstream of the promoter, secretion signal peptide, immune enhancing signal peptide, CTGF, a localization signal peptide so that the fusion protein containing the N-terminal side in this order is expressed, the fusion protein including encoding DNA. Fusion proteins expressed in a cell, the process moves to the cell membrane, it is secreted been disconnected or the signal peptide, et al., Remains in the anchor to the cell membrane. As a result, the antibody against the CTGF is likely to generate. Base compactors further, if necessary, the tag ,, e.g. FLAG tag for detecting the expression of the DNA of interest, histidine tags (e.g., Hi s6~His l O). Nucleotide sequence encoding the like, object it can be attached to the 5 'end or 3' end of the DNA. In particular tag, such as FLAG tag is useful for the detection of expression of the target protein.

CTGF or expression base Kuta one containing DNA encoding a functional fragment thereof is injected body part of an animal, for example subcutaneously,. Implantation can be performed several times every about 1 to 2 weeks, for example, for about 1-2 months. Injection amount of the vector is, for example, 17. 5 g antigen / dose. -! ■

Animals refers vertebrate (fish, reptiles, amphibians, birds, mammals), and preferred animal is a bird and non-human mammals. More preferred animals are non-human mammals, eg Ebage' 齒類 (e.g. mouse, rat, hamster, guinea pig, etc.), ungulates (e.g. Ebaushi, © Ma, Hijji, pigs, catcher formate, etc.), 'Usagi, and the like. . 'Invention. To the purpose of production of antibodies, (excluding human) human antibody or humanized antibody capable of producing animals preferably being used' Ru. Such animals, there is human antibody-producing trans Jie Nick animal catcher, for example mouse Ya © Shea has been known for (Japanese Patent Omotetaira 4-504365, JP-Japan Hei 6-500233 JP, . U.S. Patent No. 5, 545, 806, U.S. Patent No. 5, 569, 825 No., LL Green, J. Immunol Methods 231:. 11-23 (1999), etc.),. In particular, KM mice (Kiri Nbiru Co.), etc. Xenomouse (Abgeni c Inc.) is known as a trans-diethyl nick mice producing human antibodies. These Ma, the © scan, all or part of the original mouse antibody genes are antibody genes and replacement from human, this Yotsute mice produce human antibodies or humanized antibodies be able to. That is, human Bok antibody is one that heavy and variable regions and constant regions of the light chain of the immunoglobulin down is derived from any human immunoglobulin genes. Furthermore, humanized antibodies (or chimeric antibodies), the human antibody molecule, a part of the variable and constant regions of the heavy or light chain derived from a human immunoglobulin down gene, preferably hypervariable regions CDR of some or all of the CDR, a portion of the corresponding heavy or light chain variable and constant regions derived from human animal immunoglobulins except bets gene such as a mouse, preferably hypervariable regions some or all of a Kinora immunoglobulin as substituted by. Of humanized antibodies. For the production, there is a method of producing a humanized antibody without example animal. That, humanized antibodies, for example, can be obtained using a check one Nshafuringu method, or phage display techniques. For example, a polypeptide comprising a heavy or light chain variable domain of singular specific baboons Bok antibody CTGF, is coupled with repertoire of human antibodies (light or heavy) chain variable domains. Selecting a specific High Priestess head pairing antigen of interest. Followed by human Bok chains from the selected pairings, human Bokuhotai variable domain. Coupled with the lever tree of (heavy or light), and the humanized antibody polypeptide dimers, binding specificity to an antigen It can be selected for. 'Techniques described for preparation of human Bokuka antibodies which can be used in the method of the present invention, for example, U.S. Patent No. 5, 565, 332, EP .5, 585, 089, EP 5, 694, 761 No. , toying fifth, 693, 762, etc. disclosed.

In animals immunized with DNA immunization by the present invention, transiently Hatsu瑱 been CTGF the production of antibodies against a functional fragment 'is induced. Of the antibody. Production after birth, animal body fluids, such as serum, plasma, and recovering the antibody of interest from such milk. Here resulting antibody is a polyclonal antibody. Isotype of the antibody IgG, I g M, IgA, IgD, which may be either of IgE. The antibodies of the class, IgGl, IgG2, and the like I gG3, IgG4, IgA I g A2, the light chain is κ chain, e-chain, and the like. Types of such antibodies, monoclonal antibodies are the same.

The present invention also encompasses the antibodies or fragments of the monoclonal antibody described below. Examples of such fragments include Fc, Fd, Fv, scFv, Fab, Fab ', etc. (Fa) 2. For example papain, triple. Singh, it is possible to obtain a fragment by degradation by proteases such as pepsin.

Monoclonal antibodies of the present invention can be prepared by the method for manufacturing a typical monoclonal antibody as follows.

Additional DNA immunization in immunized animals (except for human), preferably a mouse, more preferably takes the human antibody-producing trans-di We nick mouse spleen from the cells, B cells or lymphocytes (or lymph node) these cells with myeloma cells (myeloma cells Tomore, U), preferably to produce a High Priestess de Ichima fusing mouse myeloma cells, and. For cell fusion, for example, fine 胞凝 collection medium, such as polyethylene glycol is used.

From the resulting High Priestess dormer, native CTGF, preferably selected antibodies that specifically recognize naturally occurring conformation, the CTGF. The selection, Furosai Conclusions tree can be preferably used. For detection, it is possible to use a fluorescent-labeled secondary antibody that immunospecifically Guropuri down arsenide Bok or mouse specifically bind.

The method for preparing monoclonal antibodies, Kohler et al, Nature, 256: 495 (1975), Chi Ausubel, Current Protocols in Molecular Biology (1989), Kozbor Ri, Immunology Today 4:72 (1983), Cole et al., Monoclonal- Antibodies and-Cancer Therapy, 77- 96 (1985), Antibodies, a Laboratory Manual, Cold Spring Harbor Laboratory, Chapter 8, which is described, for example, .1988, be referred to for the embodiment of the present invention. it.

Establishment was High Priestess dormer injected intraperitoneally into nude mice, ascites are harvested, passed through the ascites to protein A or protein G Sepharose column, it is possible to recover high-purity desired monoclonal antibodies of the. ,

Accordingly, the present invention, CTGF the co one de DNA or expression vector comprising in an expressible a (DNA encoding modules constituting the For example CTGF) a functional fragment immunizing non-human animals, the CTGF body fluid containing antibodies that recognize, or cells producing 該杭 body, were removed, and obtaining a poly click opening one null or monoclonal antibody that recognizes the CTGF, a manufacturing method of the above antibodies is provided that.

According to an embodiment of the present invention, the non-human animal is preferably a mammal, more favorable Mashiku month rodent or ungulates. Examples of rodent mice, rats, etc. guinea pig, preferably a human antibody-producing transformer diethyl nick mice. Further, Yuhizume such are © shea, catcher formate, etc. Hijji, preferably human antibody-producing transformer diethyl nick © sheet.

In the method, body fluid, for example serum or milk.

Further, according to the embodiment of the present invention, cells producing the antibody spleen cells, B fine 胞又 is lymphocytes. These cells, as described above, fused with myeloma cells to form a High Priestess dormer, it is used to produce monoclonal antibodies of the present invention. Furthermore, according to an embodiment of the present invention, the method of the present invention further comprises selecting a cells or the hybridoma producing the antibody at Furosai densitometry. For detection, it is possible to use a fluorescent-labeled secondary antibody which specifically binds the immunoglobulin human or mouse. Et al or in the antibodies obtained by the selection method, harmful antibodies exert adverse effects to human Bok is Hai餘.

Anti module antibodies, immune absorption method from among the anti-CTGF polyclonal or monoclonal antibody group elicited in vivo by the full-length CTGF and each module gene expression by DNA immunization - or the like Furosai Tome birds one, using a selection method it can also be obtained by selection for Furudo. , Characteristics of the antibody

The present invention, 'therefore the DNA immunization as described above, (including sugar) mammalian CTGF or functional fragment thereof that retains the native conformation (e.g. module) antibodies that specifically recognize ( that is, polyclonal one monoclonal antibody or a monoclonal antibody) is obtained. In particular, human 'antibody-producing trans Jie nick animals (e.g. mouse, © sheet) when performing DNA immunization against, human CTGF or specifically recognizes human that each module holds the native conformation it is possible to obtain the antibody or humanized antibody. Ru. ,.,.

As a good UNA antibodies, for example human CTGF module 1 and module one Honoré 2, each against mono-click b Nanore antibodies, i.e. Mouse-Mouse hybridoma CTGF - mil (FERM BP-10454), Mouse-Mouse hybridoma CTGF - ml2 (FERM BP - 10455), Mouse-Mouse hybridoma CTGF - m21 (FERM BP - 10456), Mouse-Mouse hybridoma CTGF-m22 (FERM BP - 10727), Mouse-Mouse hybridoma CTGF-m23 (FERM BP - 10728) , Mouse-Mouse hybridoma CTGF - m24 (FERM BP - 10729), Mouse-Mouse hybridoma CTGF-m26 (FER BP - 10730), Mouse-Mouse hybridoma CTGF - m31 (FERM BP - 10731), Mouse-Mouse hybridoma CTGF - m32 (FERM BP - 10732), Mouse-Mouse hybridoma CTGF- m41 (FERM BP- 10733), were produced, such as Mouse-Mouse hybridoma CTGF-m42 (FERM BP-10734) - derived monoclonal antibody. However, the present invention is not intended to be limited to these specific antibody, for example, human antibodies by using the human antibody-producing trans conjugated nick animals for each human CTG.F or modules 1-4 it is also possible to get prepared and practiced, likewise the object human antibodies of the. .

Antibodies of the present invention, when measured by the surface plasmon resonance of the BIA c 0 re (TM), binding constant for the native CTGF 1.0Χ10 9 Μ- 'or more, preferably δ.ΟΧΙΟ ^ - 1 or more, and et al preferably 1,0X10 1Q M- 1 or more, particularly preferably δ.'ΟΧΙΟ 1 ^ - 1 or more, and / or, following dissociation constant ΤΧΙΟ- ^ Μ against native CTGF, or less preferably 1X10- 1Q M , more preferably 5X10- less, particularly preferably characterized by the following 1 X10 1 M. ,.

Antibodies of the present invention, CTGF mammals (having a type of sugar chains), preferably of specifically recognizing native conformation of human CTGF,. Here, the specific, as described above, recognizes the CTGF with native conformation does not recognize the denatured CTGF. And other proteins and base peptide other than CTGF force or Kanto than the denatured form CTGF means that the CTGF with natural type conformation relatively easily recognizable. Thus relatively high recognition rate (or immunological reactivity), 'in other words more than 10 times, preferably 100 times or more, further preferably' Ku high binding capacity. 1,000 or more times, herein in, specifically that recognition. Because of the high binding affinity for the native human CTGF was not achieved by conventional immunization, it is possible to significantly inhibit or suppress a practical level with the biological activity of the in vivo Dehi preparative CTGF. Here, the biological activity, growth of fibrous connective tissue, including increased cell proliferation, including angiogenesis. , The onset. Ming antibody is further characterized in that to recognize a discontinuous Epito Ichipu the three-dimensional structure rather than a linear Epitopu or continuous Pito Ichipu of CTGF protein. Such properties, antibodies of the present invention is not consistent with features of easily recognize even One protein native conformation rather than denatured CTGF protein. Pharmaceutical compositions

The present invention further provides a pharmaceutical composition comprising an effective amount of an antibody of the invention described above. Antibody used in the pharmaceutical compositions of the present invention is preferably an antibody against human CTGF or functional fragment thereof (e.g., modules 1-4), preferably human antibodies or humanized antibodies, particularly preferably it is a human antibody. Also, the antibody may be a polyclonal Ichina le antibody, or may be a monoclonal antibody, but preferably monochromatic - a monoclonal antibody.

By Furosai densitometry, without substantially adversely affect the normal 'cells or tissues, physiologically! The High Priestess dormer only produce monochromator opening one monoclonal antibody that acts effectively against ¾ always expressed CTGF can be selected. .

The compositions of the present invention, fibrosis, sclerosis accompanied by fibrosis, arteriosclerosis, Ateromu sclerosis, cell proliferative disorders (such as breast, knee 臓癌, colon cancer, liver cancer, stomach cancer, such as ovarian cancer cancer), leukemia, angiogenesis, glaucoma, arthritis, sugar disease, hypertension, transplant rejection reactions, inflammation, obesity, hyperglycemia, diabetic nephropathy, diabetic retinopathy, related CTGF such as diabetic cardiovascular disease treatment of a disease can be used to improve or prevent. The fibrosis or sclerosis associated with fibrosis, e.g. kidney, lung, liver, eye,, heart of any organ fibrosis, scleroderma, interstitial fibrosis, epidural fibrosis, and the like. There. Abnormal expression of CTGF, the general organization scarring, tumor-like 增殖 of the skin, accompanied Tsutemi be sustained scarring of blood vessels, which leads deterioration of blood carrying capacity, hypertension, obesity and the like. Moreover, Ho Other diseases that CTGF is implicated, cancer, including skin fibroma, endothelial cell abnormalities ¾ currently associated symptoms, 'breast desmoplastic tumors, vascular lipoma, vascular leiomyoma, Ateromu arteriosclerosis, systemic sclerosis, Ateromu curable plaques, inflammatory bowel disease, Crohn's disease, etc. angiogenesis, arthritis, and other disease symptoms, angiogenesis is involved in glaucoma, (such as arthritis) inflammation, tumor growth metastasis, interstitial disorders, skin disorders, arthritis (rheumatoid Li Umachi etc.), arteriosclerosis, diabetes (including diabetic neuropathy), hypertension, and other kidney disorders, 'surgery, chemotherapy, radiation treatment, allograft piece rejection, transplant rejection, such as various disease, disorder or condition.

Fibrosis Kitaichi and curing atrophy growth occurs tissue fibrous connective tissue in an organ or organ as described above, it refers to a state where the devastation and disruption of the normal organ or structure occurred. Fibrosis is may be caused by a variety of injury or disease, often caused by chronic transplant rejection relating to the transplantation of various organs. Fibrosis is generally abnormal production of cellular stroma Conclusions Li box component, contains accumulation or deposition, for example, cause overproduction and increased deposition of collagen and Fuibu Ronekuchin.

It said cell proliferative disorder is an abnormal growth of cancer. CTGF has an effect of enhancing angiogenesis, it is said to be particularly involved in angiogenesis of malignant tumor (ie, cancer) (Japan-T-2002-529066 JP). Cancers such as acute lymphoblastic leukemia, cutaneous fibroma, breast cancer, 'breast gland dysplasia, vascular lipoma, vascular leiomyoma, adhesion cancer, prostate cancer, ovarian cancer, colorectal cancer, 鸱癌, gastrointestinal system carcinoma, liver cancer, and the like cancer, including tumor growth and metastasis 俾. . '' ■

If it is possible to CTGF clinches inhibit or suppress the of transmitting the combined growth signals to the cell surface receptors, sclerosis accompanied by fibrosis or fibrosis of various diseases or disorders that CTGF is involved, such as angiogenesis It is considered a role 宾Tsu for the treatment or prevention. One of inhibitors or inhibitors for this, but antibody against human CTGF or a surface antigen Epitopu. . - the embodiment of the present invention, it is possible to couple the therapeutic agent to the antibody. Antibodies are together '' when transporting the drug to the target disease site or near the exist CTGF, CTGF. Functioning inhibition or suppression of, whereas, the agent treating the symptoms of a disease, alleviating or ameliorating. Medicaments such embodiment is the so-called targeted therapy.

Agents have been used as a therapeutic agent for the disease, or used about to expire Udo, including all drugs. Such agents, for example, synthetic or natural, low molecular weight or high molecular weight, proteinaceous or non-protein, alternatively a nucleic acid or nucleotide of the quality. For example, examples of the therapeutic agent fibrosis, prostaglandin E l, scan Teroi de agent, P AR ligand, angiotensin II type I receptor antagonists DOO, soluble TGFI I type receiving 'receptor, HGF, etc., also, anti-cancer agents examples include alkylating agents, for example Ihosufuami de, two Musuchin, Shikurohosufua Mi de, dacarbazine, etc. Ranimusuchi down, antimetabolites, for example gemcitabine and Furuorourashiru, antitumor antibiotics, for example daunorubicin, doxorubicin, bleomycin, My Tomaishi such as down C, vegetable Arukaroi de, e.g. Park Li taxol, Bink Risuchin, such as bottles Burasuchin, platinum complexes such Shisuburachin the like.

Binding of the antibody and the drug is preferably carried out via a linker scratch. The linker one includes, for example, a substituted or unsubstituted aliphatic alkylene chain, its both ends, capable of binding groups with the functional groups of the antibody or agent, for example N - hydroxycarboxylic succinimide I Mi de group, an ester group, thiol group, I Mi Dokarubone capital group, is intended to include, such as aldehyde group (anti-body engineering Introduction, cytidine Shokan, 1994).

If necessary, medicament to easily delivered into cells, it is also Rukoto be encapsulated in ribosomes. Preferred ribosome ', positive charge ribosome, positive charges cholesterol, and the like membrane permeable peptide bonds ribosomes (protected Nakanishi, Protein, Nucleic Acid and Enzyme 44: 1590-1596 (1999), Shiro Niki, chemical and biological 43: 649 -653 (2005), Cl ini ca l Cancer research 59: 4325-4333 (1999), etc.). '

Administration, parenteral administration, such as intravenous, intraperitoneal, intramuscular, subcutaneous, and the like transdermal administration.

Formulations for parenteral administration, sterile saline solution, buffered saline solution, in an aqueous solution such as an organic solvent-containing aqueous solution, solutions, suspensions, etc. emulsions. Examples of organic solvents include Etanoru, propylene glycol, polyethylene glycol, vegetable oils, and Orein fatty acid esters such as Echiru the like. Also, during ^, nutritional agents, electrolyte solution, preservatives, ^ [may contain additives such as oxidizing agents. The amount of active ingredient of the antibody 100-2 per dose, which is 500 mu g / m 1, or human adult patient 1 kg body weight per. Although the amount of 0-10 mg, is also not limited to (7 to.

The frequency of administration, for example 1 to about 2 months in a single ^ given in 2 weeks (several administrations, or 2-3 weeks at a frequency of once this. Diagnostic composition

The present invention further Tsutsumikyo a diagnostic composition comprising an upper himself antibody or fragment thereof.

The compositions of the present invention, for example fibrosis, sclerosis accompanied by fibrosis, arteriosclerosis, Atero one arm sclerosis, cell proliferative disorders (such as breast, 睇臓 cancer, colon cancer, liver cancer, stomach cancer, egg cancers such as Sugan), leukemia, angiogenesis, glaucoma, arthritis, diabetes, hypertension, transplant refusal reaction, inflammation, obesity, 髙血 sugar, diabetic nephropathy, diabetic retinopathy, diabetic cardiovascular disease, etc. are used for the diagnosis of a CTGF-associated diseases are not limited to, other diseases of the upper SL can also be used for the detection of failures. In such diseases, the expression of CTGF becomes higher than the normal or standard values, normal growth of connective tissue, atrophy and hardening of the tissue, the destruction of an organ or organ structure occurs. For this, the presence or amount of CTGF, by measurement using the antibody of the present invention, diagnose diseases such as the 'it can. Antibodies, not only antibodies against human Bok CTGF, animal except human, preferably an antibody can be used for CTGF mammals. CTGF has a high have sequence identity between mammalian, for example in the human Bok and mouse have identity 93.5% at the amino acid level. . ''

Examples of Atsusi, general Assi methods customary, for example, enzyme-linked immunosorbent § Tsu Si (ELI SA), fluorescent antibody Atsusi, radioimmuno Atsusi, radioimmunoprecipitation, dot Toburo' Tassi, inhibition or competition Assi, Sa Doi Tchiassi V Ratedzu Kusubizu aggregation Atsusi but like, not limited thereto.

Antibodies of the present invention, native CTGF (preferably human CTGF) is characterized by specifically recognizing, especially discontinuous surface antigen Epito native conformation of CTGF - flop specifically it can be recognized. '..., In order to achieve high specificity monochromator opening one monoclonal antibody is preferred. To the purpose of diagnosis or detection of diseases, the antibody need not be human antibody or humanized antibody, the murine monochrome over chill antibody if example embodiment. Examples of such antibodies, 'following things limited to such Rere mosquito s, Mouse-Mouse hybri doma CTGF_ml 1 (FERM BP- 10454), Mouse-Mouse h ybr i doma CTGF - ml 2 (FERM BP - 1 -0455), Mouse-Mouse hybri doma CTGF-m21 (FER BP - 1 P456) ,, Mous e- Mous e hybridoma CTGF-m22 (FERM BP- 10727), Mouse-Mouse hybr idoma CTGF-m23 (FERM BP- 10728 ), Mouse-Mouse hybri doma CTGF-m24 (FERM BP- 10729), Mouse-Mouse hybri doma CTGF - m26 (FERM BP- 10730), Mouse-Mouse hybr idoma CTGF-m31 (FERM BP - 10731), Mouse-Mouse . hybri doma CTGF-m32 (FERM BP - 10732), Mouse-Mouse hybridoma CTGF- m41 (FERM BP- 10733), Mouse-Mouse hybr idoma CTGF - m42 (FERM BP- 10734) monochromator opening one Naru from hybridoma of it is an antibody (see example below).

Sclerosis associated with detectable fibrosis or fibrosis in the method of the present invention, such as renal fibrosis, pulmonary fibrosis, hepatic fibrosis, or skin fibrosis (strength also referred to as scleroderma) fibrosis, such as, also, cell proliferative disorder is a example cancer, without limitation.

Samples biological sample, e.g., tissue or cell biopsy of the disease site, blood, serum, plasma, lymph, bodily fluids such as urine, and the like. These samples, homogenized if necessary., Centrifugation, or subjected to dilution in an appropriate buffer, added antibody of the present invention, a complex of human CTGF antibody is an antigen It is detected in the above Assi method. In this case, the antibody may be labeled according to the invention, or a labeled secondary antibody can also be used.

Label, an enzyme (e.g. horse Wa rust pel O Kishida over peptidase; and alkaline phosphatase Fatah Ichize), radioactive isotopes (e.g. 32 P, 35 S, 3 H , 125 1 , etc.), fluorescent substances (e.g., mouth - rhodamine, Furuoresamin , Danshiruku opening Li de, their derivatives, and the like) Ru Nadodea. . -. -. ■ '-.. One following examples present invention specifically XIANG and to be described, the scope of the present invention shall not be limited in any way. Example ' '

(1) Construction of expression vector ■ '

Full length gene of human CTGF (SEQ ID NO: 2) or each of the module 1 (SEQ ID NO 4) that constitute the, module 2 '(SEQ ID NO: 6), module 3 (SEQ ID NO: 8),' and module 4 ' each gene fragment (SEQ ID NO: 10), incorporated into the mammalian expression vector of with FLAG tag (pcDNA3.1, Invitrogen Corp.). Expression vectors also include a site cytomegalovirus (CMV) promoter, immunopotentiating signal sequence (d Wa tri OVA Epito Ichipu; RS Chambers and SA Johnston, Nature Biotechnology .21 (9): 1088-1092 (2003)) and human including Bokua alkali. Fosufata Ichize DNA encoding the peptide consisting coming GPI anchor one sequence (SEQ ID NO: 17). This was designated as VV8 vector (Fig .2).

Recognizes the conformation of human Bok CTGF and to obtain a monochromator opening one monoclonal antibody which inhibits the biological bioactive, 8 / and CTGF antigen gene for optimal immune a construct containing the human CTGF full length gene It made, but others, module 1, module 2, module 3, constructs one has been inserted in the module 4 may also be used as an immunogen gene.

Confirmation of HEK293T expression products

Gene construct was constructed (i.e., vv8 / human CTGF full length gene, vv8 / module 1, vv8 / module 2, vv8 / module 3 and vv8 / module 4) immunized for whether they are expressed on the cell surface as designed by It was verified using human kidney-derived mammalian cells (HEK293T) before implementation. That is, a genetic construct was constructed by introducing one over expression in mammalian cells. 5% C0 2 incubator the introduced mammalian cells, with 10% FCS added D-MEM medium, 24 hours, and cultured at 37 ° C, it was used on the front one rhino Tome tri one (FCM) analysis. When FCM analysis, FLAG M2 antibody against the tag, appended to the transgene

(S igma - a 1 drich Co.) was added to the culture cell suspension transgene was allowed to stand for 30 minutes. Thereafter, specifically recognizes fluorescently labeled anti-mouse Ig antibody primary antibody '

Was added (Beckr ^ ncoulter Co.) to the reaction solution, it was used after standing for 30 minutes to FCM analysis -. One '- - ■

, -. /

As a result, five gene construct was constructed by the present invention (FIG. 4) that are all expressed on cell surface. Was demonstrated (left end in FIG. 3).

Confirmation of CH0 expression products

Gene product was constructed (VV8 / Full length, modulel, module2, module3, module4) was verified by transient introduction expression experiments using CH0 cells prior to immunization for whether they are expressed on the cell membrane surface as designed. In other words,. It was plating the IxlO 6 cells per well the day before the 6-weil plate. Five/. C0 2, 37 ° C. Under conditions over晚culture it was Les. Transfection day, plasmid dilutions in polystyrene round tube

(3 μ g plasmid DNA + 500 μ L D-MEM) and 1 ipof ectamine2000 mixed well dilutions (9 mu 1 of Lipofectamine2000 + 500 ^ L (D D-MEM), after 20 min incubation bets at room temperature, the day before discarded each other culture supernatant by plating, to gently cells to not remove cells. were added. '5% C0 2, 5 hours after incubation at 37 ° C, the supernatant was removed, 5% FCS were cultured in D-MEM medium for 24 hours 5% after the addition C0 2, 37 ° C containing. the next day, cells were plate force Ra剥Ka in Dissociation buf f er (Invi trogen Inc.), used in the FCM angle? analysis have been. FCM analysis was performed as follows. That is, 1 is the primary antibody reaction, the cells in 3% FCS containing PBS 4 ° the FLAG M2 antibody (SIGMA) in C, reacted for 30 minutes. secondary antibody after washing the cells with 3% FCS containing PBS, 3% FCS-containing anti-mouse Ig antibody PE labeled in PBS

(Beckman) was reacted 4 ° C, 30 min. The cells 3 ° /. After washing with FCS containing PBS, and suspended in an appropriate amount of 3% FCS containing PBS, and used for FCM analysis.

As a result, it proved that all genetic constructs constructed are expressed on all cell surface (Fig. 5 top). (2) establishment of CTGF stable production strains

And transfection into human CTGF full length of the FIG. · 4 (full length), and each module (module) con scan tractor preparative falls the CH0 cells AA8 strain (ATCC), after 24 hours of culture, the cells Puretoka ゝ et detached with Dissociation buffer after turbid suspension in methylcellulose medium (transfectants in 20 mL of TCS medium (ClonaCell) + 2.5mL of neomycin + 5xl0 5 cells) were seeded into 10 cm 2 plates, .1 weeks under the conditions of 5% C0 2, 37 ° C and culture was performed. Pick up grown colonies were cultured for 4-5 days in 96we-ll plate in 10% FCS input Ri D-EM medium containing neomycin. The cells after culture with anti · FLAG antibody (anti-FLAG), described above, was Kaiori by FCM analysis, a strong clones of shift select. :

(3) purification and mass production of recombinant human CTGF

The above (2) 10% FCS containing the CTG.F stable expression strain prepared in! ) - having conducted a suspension culture in MEM medium. That was performed 1 week culture at lOOrpm at 5% C0 2, 37 ° C under conditions in 500mL Erlenmeyer flasks containing medium at a final concentration LxlO 5 cells / mL cell and 200 mL. After one week, cell concentrations were increased to 2xl0 6 cells / niL. Ji recover the culture supernatant by centrifugation, to was affixed to the Paris Nkara arm. Elution of CTGF from Parinkaramu to saw subjected in a gradient program of NaCl. CTGF could be recovered in 0.5~1.0M NaCl. The CTGF fraction was affixed to Anti-FLAG column (Sigma). CTGF elution from Anti-FLAG force ram was performed in 0.1M Glycine- HC1 (pH2.7) solution. The purified CTGF fraction was concentrated in ultrafiltration membrane (10, 000 cutoff), PBS - and location with buffer (). The molecular weight of the purified product by electrophoresis and subjected to purity check in accordance with a conventional method. The purified protein is distinct band in the vicinity of the molecular weight 3 7 kDa could be confirmed. In Western Blotting, the purified protein is an, ti - were detected at Flag.

(4) production of the antibody by DNA immunization

DNA immunization is the gene construct alone or in combination, a variety of gene transfer methods to the immune animals using any of (e.g. intramuscular injection, electronics Toroporeshiyo emissions, gene gun, etc.), animal (mouse or human were injected subcutaneously in Bok antibody producing trans diethyl nick mice), it was incorporated into the cells.

Specific examples include immunization with following gene gun. DNA immunization is a gene con. Scan tractor preparative shown in FIG. 4 alone or in combination, were Gyoke with gene gun the immune animals. This in order Gyotsu, main one force one fg shows, gene gun optimization kit: Bio - Rad, the DNA of 200 [mu] g was administered per gold particles 25mg accordance USA). Immunization was carried out four times to come for two weeks. During the fourth immunization, samples a small amount of antiserum were FCM analysis antisera diluted 1, 000-fold with 3% FCS containing PBS as the primary antibody. At this time, perform Furosai densitometry (FCM) analysis using the CH0 cells were transiently expressed Yun-su tractor bets CTGF full length shown in FIG. 4 (full.length), and each module (module), for each module antibody titer was confirmed to be elevated (Fig. 5 bottom). 'In addition, preparation of. Monoclonal antibodies, after the final boost (fin l boost) was performed twice, was carried out using a general cell fusion method. That is, dissected animals produce strong specific antibody recognizing the preparative CTGF full length gene transfer cells to generate monoclonal antibodies B cells isolated according to a conventional method. Specifically, it was carried out as follows. 'High Priestess dormer was produced by fusing immune cells and myeloma cells obtained from the spleen or lymph nodes of Balb / c mice immunized. Myeloma cells folds in cell lines obtained from mice, 8 -.. Azaguanin resistant mouse (derived from BALB / c) myeloma cell line P3-X63Ag8-Ul (P3-U1) [Eur J. Immunol, 6, 511 (1976)], SP2 / 0-Agl4 (SP2) [Nature, 276, 269 (1978)], P3-X63-Ag8653 (653) [J. Immunol., 123, 1548 (1979)] ', P3-X63-Ag8 (X63) [Nature, 256, 495 (1975)], etc., it may be any as long as it is capable of growing myeloma cells in 'vitro (in vitro). For cultivation and passage of these cell lines, 'known method [anti body's Ichia' Laboratory preparative Lee 'manual (Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, Cnapter 8, 1988); in accordance with, cell fusion to ensure a 2X10 7 or more of the number of cells by the time.

After washing the antibody-producing cells and myeloma cells obtained from the immunized mice, poly Echirendariko one Roux 1000 (PEG-1000) cell aggregating medium such as addition, fused cells were suspended in culture medium It was. For washing the cells, using MEM medium or PBS (phosphate Ninato Li um 1.83 g, Ichiriki phosphate Li um 0.21 g, NaCl 7.65 g, distilled water 1 liter, pH 7.2) and the like. As the medium for suspending the fused cells, so as to obtain only the fused cells of interest selectively, HAT medium [glutamine (½M), 15% fetal calf serum (FCS), hypoxanthine (1 (gamma 4 Micromax), it was used thymidine (1.5xlO- 5 M) and Aminoputerin (4xl (T 7 M) containing D-MEM medium.

After culturing, Ri preparative portion of the culture supernatant, by forced expression enzyme immunoassay by cells (CELISA) and FCM, 'in response to an antigen protein' and select the sample that do not react to a non-antigen protein. Then, cloning is carried out by limiting dilution method to select the one observed with stable and high antibody titer as monoclonal antibody-producing High Priestess 1 dormer strain. Enzyme immunoassay using the forced expression was performed as follows. Cells expressing forced the antigen protein is coated into 96 Uwerupure Bok, reacting the High Priestess dormer culture supernatant as the first antibody, after the first antibody reaction, was added a second antibody plates Te washing. Here, the second antibody is an antibody which can recognize mouse I Takeno globulin first antibody is an antibody labeled with horse Wa rust pel O Kishida Ichize (HRP). After the reaction, the fluorescent substrate corresponding second antibody labeled enzyme were added and prayer solution with fluorescence measurements play Readers. '' I was then carried out mass production of monochrome one monoclonal antibody from ascites was as follows. Pristane 0.5ml in pretreated Balb / c mice in phosphate buffered saline 0.5ml, a. 1 to 3 X10 6 Loans of hybridoma cells in pH7.4 was shines ¾ intraperitoneally. After approximately two weeks, were collected ascites was affinity purified monoclonal antibodies with protein A or protein G.

. In DNA immunization, from among a number of hybridoma cell lines established, in order to disconnect the hybridoma cell line producing recognize monochromator opening one monoclonal antibody to native conformation. Human CTGF, on, serial (1) Similarly, using FCM analysis system. '

Monochromator port one monoclonal antibody which is produced by the above method are as follows. ouse- -Mouse hybridoma CTGF-mll Nono type ^; - Ma derived from the clone 30D2 ouse- -Mouse hybridoma CTGF-ml2 Nono Iburi - Ma derived from the clone 30E9 ouse- -Mouse hybridoma CTGF-m21 Nono I blanking U door "Ichima derived from the clone 1;

kouse- -Mouse hybridoma CTGF-m22 hybrid Ichima derived from the clone 3;

ouse- -Mouse hybr i doma CTGF-m23 Nono I Dzu K Ichima 'derived clone 4;

ouse- -Mouse hybridoma CTGF-m24 Nono I Dzu K Ichima derived from clone 9;

ouse- -Mouse hybridoma CTGF-m26 hybrid Ichima derived from the clone 13;

Mouse- -Mouse hybridoma CTGF-m31 Bruno, Iburi Ichima derived clone 54; Mouse - Mouse -hybridoma .CTGF - m32 Nono ibritumomab de one Ma-derived clone 62; Mouse-Mouse hybridoma CTGF- m33 Nono Ibuji Ichima from clone 21H12;

Mouse-Mouse hybridoma CTGF ~ m41 / ヽ Ibuji dormer derived from the clone 42;

Mouse-Mouse hybridoma CTGF- m42 Nono Ibuji dormer 'derived from the clone 69 0

clone 30d2 and clone 30E9 is human CTGF module 1 specifically recognize monochrome Naru antibody (MAb), clone 1, 3, 4, 9 and specifically recognizes MAb to human CTGF module 2 'is 13, clone 54, 62, 21H12, 54 and 62 specifically recognizes MAb to human CTGF module 3, clone 42 and 69 are specifically recognizes MAb to human CTGF module ¾. ,.. ■

Chi La of the fabricated Nono Ipuji dormer, Mouse-Mouse hybridoma CTGF- mil, Moiise - Mouse hybridoma CiW - ml2 and Mouse-Mouse hybridoma CTGF - ¾ of m2'l · Roh -, the Ivry dormer, 2005 (2005 year) November 25, dated, in National Institute of Advanced industrial Science and technology, the provisions of the Budapest, Treaty on the International Patent organism Depositary (IP.0D) (Higashi, Tsukuba-shi, Ibaraki-ken, Japan central 6, 1-1-1) on the basis of the international deposit and each accession number FERM BP- 10454, FERM BP - the receipt of the 10455, FERM BP-10456 (nearest ίΐ's: Japan Noshae Samukabu Shikiunsha). To, Mouse - Mouse hybridoma CTGF- m22, Mouse - Mouse hybridoma CTGF ~ m23 Mouse-Mouse hybridoma CTGF - m24, Mouse-Mouse hybridoma CTGF- m26, Mouse-Mouse hybridoma CTGF - m31 ,. Mouse-Mouse hybridoma CTGF-m32, Mouse-Mouse hybridoma CTGF - m41, Mouse-Mouse hybridoma CTGF - m42 each Nono Eve! ; The dormer, in 2006 (2006) November 16, dated, National Institute of Industrial Technology Research Institute, is the same international depository institution as above, to an international deposit in Patent Organism Depositary Center (IP0D), entrusted each number FERM BP- 10727, FERM BP- 10728, FERM BP-10729, FERM BP-10730, FERM BP- 10731, FERM BP- 10732, received the FERM BP-10733, FERM BP-10734 (depositor: Koki Endo; address Japan Kanagawa Prefecture Kanazawa-ku, Yokohama Fukuura 1-1- 1 Yokohama Kanazawa high-tech center Te Kunokoa third floor room C (Nosan Co., Ltd. Bio Research Yokohama lab)).

module specificity of each clone described above, using a stable production line expressing fabricated Full length (VV8 / CTGF) and each module (VV8 / modulel, 2, 3, 4), 1-order the hybridoma culture supernatants It was confirmed by FCM analysis using as the antibody (FIGS. 6 to 16). Furthermore, to obtain the human antibody-producing transformer diethyl nick mice instead of normal mice, the mouse. The same manner as above except for using a scan, the pilot, native human CTGF, the module 1, modul e 2, modul e 3, and modul e 4 can specifically recognize to Rukoto was able to produce a complete human antibody.

(5) features analysis of antibody

The above Purified recombinant human CTGF, reduc ing (2_ mercaptoethanol added), or non - reduc i ng (2- mercaptoethanol no addition, and boiling for 10 minutes) treated samples 1 mu g per lane . subjecting the recombinant CTGF in SDS-PAGE, the gel after electrophoresis PVDF)] electrically transferred to trillions, membrane 0. 2% BS after transfer: A_ containing TPBS (l OniM phosphate buffer, pH 7. 5, 0. 9% NaCl, 0. 05% Tween20)., penetrated in 30 minutes. Final concentration 1. 1 hour infiltrated with 0 .. 2% BSA containing TPBS containing each other antibodies of mu g / mL. For 1 hour infiltrated with Ri TPBS - TPBS three Kaiarai Kiyoshigo, HRP-labeled anti-mouse Ig antibodies (3, 000-fold dilution Bi oRad) 0 · 2% BSA input including. After 3 washes with TPBS, coloring solution (4-chloro-1 one naphthoquinone toe Honoré 30 m g, and methanol 10m, PBS50.mL, Η 2 0 2 25 μ L) at reacted for 10 minutes, a band of about 38KDa falls CTGF It was detected. As a result, module l, monochrome for 2 - monoclonal antibody 30D2;.. 30E9, 3, 13 may, reduc ing (reduced, denatured) highly reactive with difficulty that the conditions, also monoclonal antibody 54 against module3, 4, 62 , 42 also be difficult to react with reduc ing conditions' were found (Fig. 17). For each antibody, fully denatured human CTGF (+) and partially denatured human CTGF near natural type. - density ratio of cross-reactive band at () (- / +) results measured at Denshitome Ichita the It is shown below.

Anti-FLAG antibody (control); 1 1, 30D2; 2. 1, 30E9; 7. 9, 3; 4:.. 2 ;. 13; 3. 8, 54; 2 6, 62; 1. 7, 42; 1.6, 69; 1.0.

From the above results, among the monoclonal antibodies produced and tested, other monoclonal antibodies, except the cl one 69 c lone 30D2, 30E9, 3, 13, 54, 62 and 42, naturally occurring higher order human CTGF it has been shown to specifically recognize the structure. In addition, the above result is that the monoclonal antibody of the present invention has recognized easily characteristics discontinuous Epito Ichipu of human (rather than linear Epito one-flop) of CTGF protein three-dimensional structure that shows. This is because, as Western plot analysis, if basically was analyzed under denaturing conditions of the environment, Ant i-FLAG of the controls is an antibody that recognizes a linear Epitopu, - / + with respect to the ratio of is substantially 1, the recognizing body discontinuous Epito-loop three-dimensional structure - / + ratio is because greater than 1.

Then, for a detailed analysis of the purified immunoglobulin was prepared High Priestess dormer, E Pi taupe analysis, surface plasmon resonance (SPR) analysis, Western blots analysis, collagen synthesis inhibition test according to NRK-49F cells, in vivo suppressing effect test on skin fibrosis (mouse fibrosis model; T. Mori et al, J. Cellular Physiology 18: 153 - 159 (1099)) was performed. .

Epitopu angle? Analysis is a module 1, module 2, module 3 , module 4 mammalian cells transfected with either Rere deviation of genes, as with the above (1), 5% C0 2 and .24 hours culture in Inkyubeta similarly was rows by the FCM analysis (Fig. 3, 6, & 7, 9, 11, 12, 13, 15). As apparent from FIG, 5, 000-fold or 10,000-fold even diluted specifically recognizing high-affinity monochromator port one monoclonal antibody each character Yule (IgGl) is; it 导 was.

For SPR analysis, Biacore, Inc. (Tokyo, Japan) to each of the purified immune globulin was immobilized to a CM5 chip surface of. Various immune globulin to immobilized CM5 chip flow path and flushed with purified recombinant human CTGF antigen ( 'CTGF with native conformation prepared by conventional methods from mammalian cells HEK293T). The unmodified human CTGF Tan Pug ¾ and the dissociation constant of the monoclonal antibodies prepared in this invention (K u) and coupling constants (K A) was measured by the measuring system.

Measurement; ^ conditions 〖, are as follows.

Measuring instruments: Biacore 2000 (Biacore, Inc.);

Li 'command immobilized Chiffu. : CM5 sensor-chip;

Ligand Antibodies diluted buffer: 10 mM acetate buffer (pH 5.0); (to adjust the Li ligand to a final concentration of 25 mu g / ml in this buffer.)

Running buffer: HBS-EP buffer ( 10mM HEPES, pH7.5, 0.15M NaCl, 3mM EDTA, 0.005% surfactant P20 (Tween 20), pH7.4) 0

The results are shown in Table 1. table 1

As apparent from Table 1 above, antibody. (MAb) of the present invention, the binding and dissociation constants for recombinant human CTGF produced from transformants ^ mammal fine HEK293T and antigens are respectively the 1 . 0 X 10 8 IT 1 or more, 5 becomes 6 X 1 (TM 'hereinafter, very. exhibited a high affinity. in addition, using a disk produced recombinant CTGF antigen from CH0 expression strain, the was measured conditions catcher SPR analysis similar to. That is, Biacore Inc. (Tokyo, Japan) immobilized to each of the purified immunoglobulin to a CM5 chip surface, the flow path of the CM 5 chip of the solid phase, CH0 stable was purified from strain expressing recombinant human CTGF antigen was subjected to immobilized flow path with antibodies for the measurement. the measurement system of the non-modified human CTGF end tooth ° click proteins and monoclonal antibodies prepared in the present invention dissociation constant (K D) and coupling constants (K a) was measured. measurement傺, any control To eliminate background due to nonspecific adsorption to the body, the non-immunized mice (controls) I gG flowed CTGF in immobilized CM5 chip, coupling a value obtained by subtracting the value of true It was constant and the dissociation constant.

The results are shown in Table 2.

Table 2

Table 2, the results calibration monoclonal antibodies except clone 69 are. Each binding constant and dissociation constant of recombinant human CTGF produced from transformants換哺mammal cells CH0 and antigen, '8.0 × 10 8 M- 1 or more, and less 6.8X10- 1Q M, it shows a very high affinity.

Incidentally, the binding constant and dissociation constant of the antibody for use have the present invention the recombinant human CTGF produced in a general-purpose insect (® tens © moths) cells as antigen as measured by SPR analysis method, a contact probably Insect due to the effect due to a difference in sugar chain structure of mammalian type, niodu 1 e 1, modu, coupling constant le 2, module 3 and module 4 showed a 1/10 value of the values ​​shown in Table 2, dissociation constant also becomes 10 times higher than the values ​​shown in Table 2, thus affinity compared to recombinant human CTGF made in mammalian cells showed a tendency to decrease. Indeed, MALDI-T0FMS (Bruker Ultraflex), AXIMA-QIT T0FMS (Shimadzu, Kyoto, Japan) As a result of sugar chain analysis, CTGF in Tokusaricho produced in human CTGF and insect cells produced in mammalian cells is different, CTGF produced in insect cells had only a short sugar chain with high mannose added.

(6) VV6 production of the antibody by DNA immunization using a secretory vector

As described in Example (1) (provided that includes a DNA encoding the human CTGF precursor containing a secretory signal, not including immune enhancement signal sequence and GPI anchor sequences), pcDNA3. 1 plasmid (INVi Trogen company) was derived from VV6 secretory vector (see Figure 2) and work made. DNA immunization was performed as described in Example (4), after the first immunization mice were boost every 2 weeks, repeated immunization over about 10 weeks. Use the Furosa I densitometry method was sure 卩 'the production of almost the same level of polyclonal antibody as above

(7) -NRK- 49F- inhibition of collagen synthesis in a cell one - :: Further, with the antibody of the biological activity of the present invention was investigated t. Specifically, it was tested for inhibition of rat TGF- in preparative fiber fibroblasts] 3-induced Me collagen synthesis.

NRK- 49F cells (rat Bok fibroblasts) may produce CTGF, are known to secrete. Moreover, TGF induces CTGF expression in these cells. NRK- 49F cells (ATCC No.: CRL-1570) were acquired American Type Culture Col l ect ion (ATCC) (USA) mosquitoes, et al. 10% FCS, inoculated penicillin, a scan streptomycin and non-essential minimum contain Amino acid essential medium (MEM) This cell 6 Ueru tissue culture plates (1 Ueru per 5 xl 0 5 cells) containing the. After 12 hours, the medium was removed and replaced with fresh medium containing © shea calf serum-free fresh media and and © shea serum albumin (0. lmg / ml). Further, the two after 24 hours, the medium TGF] 3 (5ng / ml) is added or buffer added (PBS only) or TGF / 3 simultaneously controls mouse I gG or each module-specific antibody (final concentration, Ι / g / mL) was added, (without © shea fetal serum, Ushichi Kiyoshi albumin (0. lmg / ml) of fresh medium but replaced with MEM) containing. Then, Culture supernatants were collected from the conditioned media after 48 hours and analyzed for concentrations of Type l collagen. The measurements were performed using a sandwich ELISA using two kinds of ant i- col lagen typel antibodies shown in below.

That, 96 - wel l was added 1 with 1% BSA containing PBS of 100 mu L per 1 wel l, 000-fold diluted mouse ant i- col lagen typel antibody (SIGMA) of the plate, 4 ° C, over 晚 Inn Kyube immobilization was carried out by Bok. The next day, washed 3 times with plates with PBS, collected culture supernatant was diluted 20-fold with PBS, and after 100 have added this was 1 hour I incubate at room temperature. After three times washing the pre Ichito with PBS, and Usagi was diluted 500-fold with 1% BSA containing PBS ant - added collagen Typel antibody (Abeam), and Bok 1 hour incubator base at room temperature. After plates 3 times washed with PBS, added pressure to the TMB coloring solution of well per 50 / L, by coloring reaction 10 minutes for absorbance measurement 450nm. The absorbance upon addition of TGFj3 was relatively calculated collagen production amount when the 100 (Figure 18). As a result, anti-module2, anti module3, any anti module4 antibody has collagen synthesis inhibitory activity, anti moduli antibody has the strongest activity, activity in this order was found and Yowamaruko. In contrast, the anti modulel antibody, conversely, have a Agonisu preparative action to induce the synthesis is shown. .: -:. ■ - Also Sho, defined in the following (8) and (9), by in vivo testing, to verify the further effect. In detail, using the 庆膚 fibrosis model, effects of suppressing 該疾 patients according to the invention antibodies were tested in in vivo.

(8) new born mouse fibrosis fibrosis I spoon inhibitory effect in model, Balb / c mice (postnatal day 7) to TGF) 33 800 ng for 3 days. After the lower injection, 4 days subcutaneously recombinant tut human CTGF 400 ng by injection to. it was induced fibrosis subcutaneous tissue. . '. ■. ■

'The antibody (anti IN2- 1 antibody) 4 mu g of the present invention were subcutaneously injected immediately miscible with CTGF. The control group was the same amount as well subcutaneous injection Mice IgG.

Non disease and control group the ratio base was administered from resulting immunoglobulins (negative control) mice, human CTGF antibody obtained in the present invention the inhibitory effect of significance for in vivo skin fibrosis was shown L in mice ( 19 and 20). That is, FIG. 19 is Ri Contact shows a control group, and vertically through the center of the figure to the side. Have enlarged portions represent fibrosis tissue layer. As shown in FIG. 20, the antibody is treated the test group of this invention, it fibrosis portion is greater was reduced to about 1/3 as compared with the control group. Therefore, antibodies of the present invention, proved to be effective for the suppression of fibrosis.

(9) new born mouse fibrosis ItoMotome 維化 inhibitory effect in the model

Postnatal day Balb / c mice to lOuL of PBS in suspended TGF β 800 μ g, or induced a transient fibrosis subcutaneous tissue by only 3 days hypodermic PBS (CHUJOet al. ( 2005) Jcell Physiol 203: 447-456). At this time, anti-CTGF and control mouse IgG to each module was administered for 3 days with TGF / 3. Antibody, was one dose a mouse individual or 1. 68ug. Day 4, the mice were sacrificed, and tissue sections fart the Mato toxin over E O Shin (HE) staining of the site of administration. .

As a result, while the completely abnormal fibrosis in sham (PBS) treated group was observed, fibrosis layer indicated by the arrow in the TGF / 3 administration group was observed. (The TGF / 3 alone abnormal fibrosis induced by administration can inferred to as a joint action of the TGF / 3 and mouse endogenous CTGF administered.) In addition, in ant i-CTGF antibody administration group, con compared with trawl IgG administration group, significant enlargement of fibrosis layer of subcutaneous observed, in particular, against the module 2 monochromator port is one monoclonal antibody anti m2- l ,. m2-3, m2 - 13 strong inhibition of the fiber layer was observed ', module 3, and a monochromator port one monoclonal antibody against 4 anti πι3 -. 54, m3 - 62, m4-42, m4-69 also fibrous layer suppression was observed (it shows the result of only a representative example in FIG. 21). The availability of on Roh industry

The present invention, in the conventional method but the difficulty and make antibodies, antibodies that specifically recognize natural type human CTGF with nonspecific adsorptive against the special structure and Matrigel box (a human antibody-free) easily It was able to be made to. Yotsute thereto, antibodies of the invention are Yu甩 for the treatment or diagnosis of fibrosis and cell proliferative diseases CTGF is implicated. Sequence Listing pretend one text

Description of SEQ ID NO: 16 Artificial Sequence: localization signal

Description of SEQ ID NO: 1 7 Artificial Sequence: GPI anchor

Description of SEQ ID NO: 18 Artificial Sequence: GPI anchor

Claims

The scope of the claims
1., Characterized in that it can be recognized with a specific or One high affinity natural conformation of the connective tissue growth factor-derived mammalian (CTGF), an antibody or fragment thereof produced by DNA immunization.
2. The a CTGF Gahi preparative CTGF, an antibody or fragment thereof according to claim 1, wherein.
. 3 wherein the antibody is murine antibody, a human antibody or a humanized antibody according to claim 1 Ki载 antibody - or a fragment thereof. - -
4. Binding to the native higher order granulation is had higher than binding to denatured forms CTGF, an antibody or fragment thereof according to claim 1, wherein.
5. The DNA immunization is intended to include immunizing an expression vector into baboons Bok animals, including DNA or functional fragment thereof encoding said CTGF on the expression available-antibody or fragment thereof according to claim 1, wherein. '
6. Further comprising a DNA in which the vector encodes a secretion signal peptide, antibody or fragment thereof 請 Motomeko 5 wherein.
-.. 7 wherein the vector further comprises a co one DNA encoding a peptide comprising a localization signal and immune-enhancing signal, the antibody or fragment thereof according to claim 5, wherein.
8. The functional fragment is a DNA encoding a modular Lumpur of the CTGF, antibody or fragment thereof according to claim 5, wherein.
9. DNA or functional fragment thereof encoding said CTGF is SEQ ID NO: 2 ', 4, 6, comprising the nucleotide sequence represented by 8 or 10, an antibody or fragment thereof according to claim 5, wherein.
1 0. Wherein the animal is a mammal, an antibody or fragment thereof according to claim 5, wherein.
1 1. Wherein the mammal is a mouse or rat antibody or fragment thereof of claim 10, wherein.
1 2. The mice are human antibody-producing transformer diethyl nick mice, antibody or fragment thereof of claim 1 1, wherein.
1 3. The human module 1 of CTGF, module 2, can be recognized specifically any one of module 3 or modules 4, the antibody or fragment thereof according to claim 1, wherein.
1 4. The anti. Body is, the binding constant for CTGF (KA) 1 X10 9 M_ ' above and / or, the release constants (KD) 7 X10-' having a ° M or less, anti Segare of claim 1, wherein or the fragment.
1 5. claim 1 comprising an antibody or fragment thereof of any one of 14, treatment of diseases CTGF is associated engagement, improved or pharmaceutical composition for the prevention.
1 6. wherein the antibody is a monoclonal antibody, according to claim 15 pharmaceutical composition.
1 7. wherein the antibody is a human antibody or a humanized antibody according to claim 15 pharmaceutical composition.
1 8. The antibody or fragment thereof is conjugated to a therapeutic agent, according to claim .15 pharmaceutical composition. - - -
1 9. fibrosis, sclerosis accompanied by fibrosis, arteriosclerosis, Ateromu sclerosis, cell proliferative disorders. Leukemia, vascular if raw, glaucoma, arthritis, diabetes, hypertension, transplant rejection CTGF-associated diseases, such as treatment is for ameliorating or preventing, 15. the pharmaceutical composition according. ,
2 0. The fiber or sclerosis accompanied by fibrosis, renal fibrosis: pulmonary fibrosis, also hepatic fibrosis is scleroderma, 19. The pharmaceutical composition according. ,
2 1. The cell proliferative disease is cancer, claim 19 IS drug composition.
,
2 2. comprising an antibody or fragment thereof of any one of claims 1 to 14, a composition for diagnosing a CTGF-associated disorder.
2 3. wherein said antibody is a monoclonal antibody, according to claim 22 diagnostic composition according.
2 4. CTGF related diseases, fibrosis, sclerosis accompanied by fibrosis, arteriosclerosis, Atero arm sclerosis, cell 'proliferation ^ patients, leukemia, angiogenesis, glaucoma, arthritis;. Diabetes, Hypertension or transplant rejection is a reaction, claim 22 diagnostic composition according.
2 5. sclerosis associated with the fibrosis or fibrosis, renal fibrosis, pulmonary fibrosis, hepatic fibrosis or scleroderma, claim 24 diagnostic composition according.
2 6. The cell proliferative disease is cancer, 24. Diagnostic composition according.
. 2 7, wherein said antibody force S, Mouse-Mouse hybridoma CTGF-mll (FERM BP - 10454), Mouse-Mouse hybridoma CTGF - ml2 (FERM BP - 10455 '), Mouse-Mouse hybridoma CTGF- m21 (FERM BP- 10456) , Mouse-Mouse hybridoma CTGF-m22 (FERM BP - 10727), Mouse-Mouse hybridoma CTGF - m23 (FERM BP - 10728), Mouse-Mouse hybridoma CTGF-m24 (FERM BP - 10729), Mouse-Mouse hybridoma CTGF- m26 (FERM BP-10730), Mouse-Mouse hybridoma CTGF - m31 (FERM BP - 10731), Mouse-Mouse hybridoma CTGF- m32 (FERM BP- 10732) 及Hi 'Mouse-Mouse hybridoma CTGF- m41 (FERM BP- 10733) a monoclonal antibody derived from a High Priestess dormer selected from the group consisting of, 請 Motomeko 22 diagnostic composition according.
2 8. Mouse- Mouse hybridoma CTGF - mil (FERM BP-10454) Nono Ivry dormer derived monochromator port one Nanore antibody of. ,
2 9. Mouse-Mouse hybridoma CTGF- ml 2 (FERM BP - 10455) of Nono Ivry dormer - derived mono-click - polyclonal antibody. Scratch.
3 0. Mouse-Mouse hybridoma CTGF-m21 (FERM BP - 10456) hybridoma - derived monoclonal antibody of.
3 1. ouse-Mouse hybridoma CTGF- m22. (FERM BP - 10727) hybridoma - derived monoclonal antibody of. . '.
. 3.2 Mouse-Mouse hybridoma CTGF- m23 (FERM BP - 10728) hybridoma - derived monoclonal antibody of. '
3 3. Mouse-Mouse hybridoma CTGF_m24 (FERM BP- 10729) Nono Eve - di dormer - derived monoclonal antibody.
3 Nono Ibuji dough 4. Mouse-Mouse hybridoma CTGF- m26 (FERM BP- 10730) - ^ - derived of the monochromator Naru antibody.
3 5. Mouse-Mouse hybridoma CTGF- m31 (FERM BP- 10731) Nono Ibuji dormer - derived monoclonal antibody of. . '.
3 6. Mouse-Mouse hybridoma CTGF-m32 (FERM BP - 10732) hybridization DoichimaYukari come of monochromator opening one monoclonal antibody of.
3 7. Mouse-Mouse hybridoma CTGF- m41 (FERM BP - 10733) hybridoma - derived of the mono-click opening Naru antibody of.
3 8. CTGF immunized expressible manner the expression base Kuta one containing DNA encoding or functional fragment thereof to non-human animals, body fluid comprising an antibody that recognizes the CTGF, or cells that produce the antibody, was removed, also specifically and with high affinity natural conformation of the CTGF includes obtaining connexion recognizing polyclonal or monoclonal antibodies, antibody or fragment thereof of any one of claims 1 to 14 a method for manufacturing a.
3 9. The a CTGF Gahi preparative CTGF, The method of claim 38, wherein.
4 0: the non-human animal is a mammal The method of claim 38.
4 1. a said mammal month rodent or ungulates The method of claim 40, wherein.
4 2. is the month rodent is mouse or rat The method of claim 41, wherein.
4 3. The mouse human antibody production Toransuji - a nick mice The method of claim 42, wherein. ,
4 4. further comprising a DNA wherein base compactors is that the co-one de secretion signal peptide, the method according to claim 38. . -.. ._
4 5. The vector further comprises DNA codes a peptide comprising localization signal and immune enhancing signal, The method of claim 38. '
4 6. cells producing said antibody, spleen cells are B cells or lymphoid 'cells, The method of claim 38. ''
4 7. The ungulates are © shea, claim 41 Symbol ¾ methods.
4 8. The body fluid is blood, serum or milk, a claim 38, the method described.
4 9. further comprising that you form fused High Priestess dormer cells producing the antibody with myeloma cells, The method of claim 38. '
5 0. The Poriku port one null or monoclonal antibody has a binding constant (KA) 1 Χ10 9 Μ 'above and / or dissociation constant (KD) 7 X 10- lfl M or less for the CTGF, according to claim 38, wherein Method.
5 1. The function, sexual fragment, a DNA encoding CTGF module 39. The method of claim 38, wherein.
5 2. further comprising selecting a cell or the High Priestess de Ichima producing said antibody by Furosai Tome preparative Lee, The method of claim 38.
PCT/JP2006/324894 2005-12-07 2006-12-07 Antibody against connective tissue growth factor or composition containing the same WO2007066823A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2005-353628 2005-12-07
JP2005353628A JP2009067678A (en) 2005-12-07 2005-12-07 Antibody against connective tissue growth factor or composition containing the same

Publications (1)

Publication Number Publication Date
WO2007066823A1 true true WO2007066823A1 (en) 2007-06-14

Family

ID=38122955

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2006/324894 WO2007066823A1 (en) 2005-12-07 2006-12-07 Antibody against connective tissue growth factor or composition containing the same

Country Status (2)

Country Link
JP (1) JP2009067678A (en)
WO (1) WO2007066823A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009072588A1 (en) * 2007-12-05 2009-06-11 Nihon University Monoclonal antibody responsive to mouse polymeric immunoglobulin receptor
EP2564866A2 (en) * 2010-04-28 2013-03-06 Postech Academy-Industry Foundation Pharmaceutical composition using connective tissue growth factor
WO2013094723A1 (en) 2011-12-22 2013-06-27 アステラス製薬株式会社 Novel anti-human ctgf antibody
WO2013108869A1 (en) * 2012-01-20 2013-07-25 国立大学法人岡山大学 Therapeutic or prophylactic agent for cancer
EP2964330A4 (en) * 2013-03-08 2016-08-31 Univ Vermont Compositions and methods for cardiac tissue repair

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2435074B1 (en) * 2009-05-28 2015-11-25 Abbott Biologicals B.V. Extraneous agents testing

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000029442A1 (en) * 1998-11-16 2000-05-25 Genovac Ag Method for producing antibodies acting against a polypeptide that only recognises the coding nucleic acid

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000029442A1 (en) * 1998-11-16 2000-05-25 Genovac Ag Method for producing antibodies acting against a polypeptide that only recognises the coding nucleic acid

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BOYLE J.S. ET AL: "DNA immunization: Induction of higher avidity antibody and effect of route on T cell cytotoxicity", PROC. NATL. ACAD. SCI. USA, vol. 94, 1997, pages 14626 - 14631, XP003014106 *
HOSEI K.I. ET AL: "DNA Men'ekiho ni yoru Hito Ketsugo Soshiki Seicho Inshi (CTGF) ni Taisuru Tokui Kotai no Kaihatsu", DAI 28 KAI ANNUAL MEETING OF THE MOLECULAR BIOLOGY SOCIETY OF JAPAN KOEN YOSHISU, 25 November 2005 (2005-11-25), ABSTRACT, pages 768 - 3P-1222, XP003014104 *
MINATO M. ET AL: "Module-specific antibodies against human connective tissue growth factor: utility for structural and functional analysis of the factor as related to chondrocytes", JOURNAL OF BIOCHEMISTRY, vol. 135, no. 3, 2004, pages 347 - 354, XP003014105 *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009137859A (en) * 2007-12-05 2009-06-25 Univ Nihon Monoclonal antibody reactive with mouse polymeric immunoglobulin receptor
WO2009072588A1 (en) * 2007-12-05 2009-06-11 Nihon University Monoclonal antibody responsive to mouse polymeric immunoglobulin receptor
JP2013530934A (en) * 2010-04-28 2013-08-01 ポステック アカデミー−インダストリー ファンデーション Pharmaceutical compositions using the connective tissue growth factor
EP2564866A2 (en) * 2010-04-28 2013-03-06 Postech Academy-Industry Foundation Pharmaceutical composition using connective tissue growth factor
US8859496B2 (en) 2010-04-28 2014-10-14 Postech Academy-Industry Foundation Pharmaceutical composition using connective-tissue growth factor
EP2564866A4 (en) * 2010-04-28 2013-11-27 Postech Acad Ind Found Pharmaceutical composition using connective tissue growth factor
CN104011206A (en) * 2011-12-22 2014-08-27 安斯泰来制药株式会社 Novel anti-human ctgf antibody
WO2013094723A1 (en) 2011-12-22 2013-06-27 アステラス製薬株式会社 Novel anti-human ctgf antibody
JPWO2013094723A1 (en) * 2011-12-22 2015-04-27 アステラス製薬株式会社 New anti-human antibody ctgf
US9587015B2 (en) 2011-12-22 2017-03-07 Astellas Pharma Inc. Anti-human CTGF antibody
WO2013108869A1 (en) * 2012-01-20 2013-07-25 国立大学法人岡山大学 Therapeutic or prophylactic agent for cancer
EP2964330A4 (en) * 2013-03-08 2016-08-31 Univ Vermont Compositions and methods for cardiac tissue repair
US9707271B2 (en) 2013-03-08 2017-07-18 University Of Vermont And State Agriculture College Methods for enhancing cardiac function with the combination of CTGF and insulin or IGF-1

Also Published As

Publication number Publication date Type
JP2009067678A (en) 2009-04-02 application

Similar Documents

Publication Publication Date Title
US20080177045A1 (en) Monoclonal antibodies against ANGPTL3
WO2008047925A1 (en) Pharmaceutical composition comprising anti-hb-egf antibody as active ingredient
WO2008072723A1 (en) ANTI-Claudin-3 MONOCLONAL ANTIBODY, AND TREATMENT AND DIAGNOSIS OF CANCER USING THE SAME
WO2000035956A1 (en) Antihuman vegf monoclonal antibody
WO2006075784A1 (en) ANTI-α9 INTEGRIN ANTIBODY AND THE USE THEREOF
WO1999040118A1 (en) Antibodies against human vegf receptor kdr
WO1997002290A1 (en) ANTIFas LIGAND ANTIBODIES AND ASSAY METHOD BY USING THE SAME
WO2014206107A1 (en) Anti-pd-1 antibody and use thereof
WO2004111233A1 (en) Process for producing antibody
WO1999033878A1 (en) Monoclonal antibody against connective tissue growth factor and medicinal uses thereof
WO2006074228A1 (en) Monoclonal antibodies against angiopoietin-like protein 4 (angptl4 )
WO2009116670A1 (en) Anti-human dlk-1 antibody having anti-tumor activity in vivo
JP2008500025A (en) Monoclonal antibodies that specifically block the biological activity of tumor antigens
WO2014049087A1 (en) Monoclonal antibodies to growth and differentiation factor 15 (gdf-15)
WO2006118350A1 (en) Anti-platelet membrane glycoprotein vi monoclonal antibody
EP1167387A1 (en) Antibodies against SEMP1, methods for their production and uses thereof
WO2010137654A1 (en) Pharmaceutical composition containing antagonist of egf family ligand as component
WO2007142277A1 (en) Monoclonal antibody capable of binding to heparin-binding epidermal growth factor-like growth factor
WO2007114496A1 (en) Novel anti-cd98 antibody
WO2005028515A1 (en) Recombinant antibody against human insulin-like growth factor
WO2007023782A1 (en) Neutralizing antibody directed against killer toxin-like protein, and use thereof
Tsunoda et al. Pathogenic relevance of IgG and IgM antibodies against desmoglein 3 in blister formation in pemphigus vulgaris
WO2006117910A1 (en) Monoclonal antibody against platelet membrane glycoprotein vi
WO2008056833A1 (en) ANTI-HUMAN Dlk-1 ANTIBODY SHOWING ANTI-TUMOR ACTIVITY IN VIVO
EP1167389A1 (en) Antibodies against the protein SEMP1, methods for their production and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06834648

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase in:

Ref country code: JP