WO2013108869A1

WO2013108869A1 - Therapeutic or prophylactic agent for cancer

Info

Publication number: WO2013108869A1
Application number: PCT/JP2013/050907
Authority: WO
Inventors: 正春滝川; 高子服部; 吉皆川; 泰裕瀬戸; 美香綱; 義孝原田; 学高久; 秀世安田
Original assignee: 国立大学法人岡山大学
Priority date: 2012-01-20
Filing date: 2013-01-18
Publication date: 2013-07-25
Also published as: JP2013166751A; JP6187960B2

Abstract

Disclosed are: a novel means useful for the treatment and prevention of cancer; and a novel therapeutic/prophylactic means effective even for cancer that is resistant to anti-cancer agents. As a result of extensive studies, the inventors of the present application have identified ErbB2 as a cell membrane receptor for CCN2. A first therapeutic or prophylactic agent for cancer according to the present invention comprises a substance capable of inhibiting the interaction between CCN2 and ErbB2 (i.e., a CCN2-ErbB2 interaction inhibitor) as an active ingredient. A second therapeutic or prophylactic agent for cancer according to the present invention comprises a CCN2-ErbB2 interaction inhibitor as an active ingredient and is used in combination with an anti-cancer agent capable of inducing apoptosis.

Description

Cancer treatment or prevention agent

The present invention relates to a cancer treatment or prevention agent, a cancer detection reagent, a screening method for a cancer treatment or prevention agent, and a cancer treatment or prevention agent used in combination with an apoptosis-inducing agent.

ErbB2 (also referred to as HER2) is a surface protein that penetrates the cell membrane of the epidermal growth factor receptor (EGFR) family member and is known to be highly expressed in approximately one fifth of the human breast cancer patient population. Yes. ErbB2 has been studied as a target for cancer treatment, and anti-ErbB2 antibodies as cancer therapeutic agents and various peptide sequences that bind to the extracellular region of ErbB2 are known (Patent Documents 1 to 5, etc.) . For example, Herceptin (trade name, generic name: trastuzumab), which has been put to practical use as a therapeutic agent for primary and metastatic breast cancers in which overexpression of ErbB2 has been confirmed, is an epitope in the extracellular region of ErbB2 molecule (No. 529- It is an anti-ErbB2 humanized monoclonal antibody drug that specifically binds to the 625th amino acid region (Non-patent Document 1).

Although ErbB2 is being studied in this way, ErbB2 is an orphan receptor (also referred to as an orphan receptor) among the four members of the EGFR family, and its specific ligand has not yet been reported. Patent Document 6 describes the use of a specific ligand that binds to a receptor tyrosine kinase for the treatment of cancer, but there is no disclosure regarding a specific ligand for ErbB2.

CCN2 is a protein also known as connective tissue growth factor (CTGF) and is a secreted growth promoting factor belonging to the CCN family. Biological functions of the CCN family include stimulation of cell proliferation / differentiation / migration / adhesion and extracellular matrix formation, and involvement in angiogenesis and tumor formation (Non-patent Documents 2, IV 4, 18). CCN2 can bind to cell surface aggrecan (Non-patent document 5), fibronectin (Non-patent document 6), integrin (Non-patent documents 6 to 10), and in cooperation with matrix metalloprotease (Non-patent document 13, 14) It is known that it promotes the expression of extracellular matrix proteins (Non-Patent Document 11), regulates cell adhesion activity, and also acts as an angiogenic factor (Non-Patent Document 12). CCN2 is considered to be an enhancer of endochondral ossification because strong expression of CCN2 is observed in the cartilage tissue during the process of tissue formation in ontogeny (Non-patent Document 15). Furthermore, increased expression of CCN2 has been confirmed in breast cancer, pancreatic cancer, melanoma, chondrosarcoma, and many fibrosis (Non-patent Document 16). CCN2 shows various roles in various cancers, but it is considered that overexpression of CCN2 is related to an increase in tumor size and metastasis in breast cancer cells (Non-patent Document 16). It has also been shown that CCN2 is deeply involved in the formation of osteolytic bone metastases in breast cancer (Non-patent Document 17).

CCN2 consists of four domains: IGFBP (insulin-like growth factor binding protein-like) domain, VWC (von Willebrand factor type C) domain, TSP1 (thrombospondin type 1) repeat, and CT (C-terminal) domain (non-patented) Reference 2). Each of these domains has a different binding partner. The CT domain of CCN2 binds to integrin α5β1 and promotes pancreatic stellate cell adhesion and migration (Non-patent Document 9). The domain also directly interacts with fibronectin and promotes chondrocyte adhesion via integrin α5β1 (Non-patent Document 19). Furthermore, the domain induces hepatocyte adhesion by direct binding to integrin receptor αvβ3 and direct binding to heparan sulfate proteoglycan via the C-terminal heparin binding domain (Non-patent Document 20).

However, the relationship between ErbB2 and CCN2 has never been reported.

Taxol (trade name, generic name: paclitaxel), on the other hand, is an anticancer agent classified as a taxane, which prevents cell division by stabilizing tubulin polymerization and inhibiting microtubule formation. Suppresses proliferation of cancer cells (Non-patent Document 21). Taxol is used for the treatment and prevention of various cancers including breast cancer and ovarian cancer. At that time, the appearance of taxol-resistant cancer cells has become a problem. There is also a need for new means effective for the treatment of drug-resistant cancer.

WO 01/01748 WO 2004/005320 WO 03/061559 WO 2009/080810 JP 2010-006705 A JP 2011-084580 A

An object of the present invention is to provide a novel means useful for the treatment and prevention of cancer. It is another object of the present invention to provide a novel cancer treatment / prevention means that is effective against cancer that has become resistant to anticancer agents.

The present inventors have developed a human chondrocyte that highly expresses CCN2 for the purpose of clarifying a cell membrane receptor that regulates the action of CCN2 on target cells and an intracellular signal transduction mechanism via the cell membrane receptor. As a result of earnest screening by the yeast two-hybrid method using a cDNA library derived from the strain HCS-2 / 8, ErbB2 was identified as a cell membrane receptor for CCN2. As a result of further intensive research, we found that CCN2 interacts with the extracellular REC domain of ErbB2 via its VWC domain, and that it can suppress the growth of cancer cells by inhibiting the interaction between CCN2 and ErbB2. It was. Furthermore, by using paclitaxel together with a substance that inhibits the interaction between CCN2 and ErbB2, it is possible to suppress the growth of cancer cells even at concentrations that cannot suppress the growth of cancer cells by themselves, As a result, it has been found that the cancer can be effectively treated and prevented by synergistically acting on the cancer resistant to the anticancer agent. Furthermore, it has been found that screening of novel anticancer agents is possible using inhibition of the interaction between CCN2 and ErbB2 as an indicator, and the present invention has been completed.

That is, the present invention provides a therapeutic or preventive agent for cancer comprising as an active ingredient a substance that inhibits the interaction between CCN2 and ErbB2. The present invention also provides a method for screening for a therapeutic or prophylactic agent for cancer, which comprises selecting a compound using inhibition of the interaction between CCN2 and ErbB2 as an index. Furthermore, the present invention provides a therapeutic or prophylactic agent for cancer obtained by the screening method of the present invention. Furthermore, the present invention provides a cancer cell detection reagent comprising any of the following polypeptides (a) to (c).
(a) A polypeptide comprising the amino acid sequence shown in SEQ ID NO: 4.
(b) a polypeptide consisting of a partial region in the amino acid sequence shown in SEQ ID NO: 4, comprising 7 or more consecutive residues in the region of amino acids 103 to 166 and directly to the ErbB2 extracellular region Or a polypeptide that binds indirectly.
(c) A polypeptide comprising an amino acid sequence having 90% or more identity with (a) or (b) and directly or indirectly binding to the ErbB2 extracellular region.
(d) A polypeptide comprising the amino acid sequence of the polypeptide of any one of (a) to (c) and binding directly or indirectly to the ErbB2 extracellular region.

Furthermore, the present invention provides a cancer therapeutic or preventive agent comprising a substance that inhibits the interaction between CCN2 and ErbB2 as an active ingredient and used in combination with an anticancer agent that induces apoptosis. Furthermore, the present invention provides an anti-cancer activity enhancer of an anti-cancer agent that induces apoptosis, comprising as an active ingredient a substance that inhibits the interaction between CCN2 and ErbB2. Furthermore, the present invention provides a method for treating or preventing cancer, comprising administering to a subject in need thereof an effective amount of a substance that inhibits the interaction between CCN2 and ErbB2. Furthermore, this invention provides the detection method of a cancer cell including the process of making the detection reagent of the said invention contact the object cell, and the process of detecting presence of the cell which the said polypeptide couple | bonded. Furthermore, the present invention provides administration of a combination of an effective amount of a substance that inhibits the interaction between CCN2 and ErbB2 and an effective amount of an anticancer agent that induces apoptosis to a subject in need thereof. A method for treating or preventing cancer is provided. Furthermore, the present invention relates to the enhancement of anticancer activity of the anticancer agent, comprising administering to a subject in need thereof an effective amount of a substance that inhibits the interaction between CCN2 and ErbB2. Provide a method.

The present invention provides a novel cancer treatment or prevention agent, a novel screening method for cancer treatment or prevention agent, and a novel reagent for detecting cancer cells. Although ErbB2 was an orphan receptor, the inventors of the present application have revealed for the first time that the ligand of ErbB2 is CCN2, and that the inhibition of the interaction between CCN2 and ErbB2 is effective in the treatment and prevention of cancer. It was. Furthermore, the combined use of a substance that inhibits the interaction between CCN2-ErbB2 and an anti-cancer agent that induces apoptosis such as paclitaxel acts synergistically to treat and prevent cancer resistant to the anti-cancer agent. It became clear that it was effective. The present invention is an invention that contributes widely to the treatment and prevention of cancer.

(A) ErbB2 protein structure (amino acids 1-1255) and ErbB2 cDNA fragments (# 1, # 2, # 3, # 4, # 4 # rev, # 26) cloned into the pGADT7 vector are shown. # 26 is a clone obtained by screening the HCS-2 / 8 human chondrosarcoma cDNA library by the yeast two-hybrid method. TM is a transmembrane region. (B) The left figure shows the structure of CCN2 protein. The signal peptide in the N-terminal region is a thick black line. IB is the IGFBP domain, VWC is the VWC domain, TSP is the TSP1 domain, and CT is the CT domain. The possible glycosylation sites of IB and TSP are also shown. The right figure shows the result of examining the binding between each ErbB2 fragment shown in (A) and CCN2 by the yeast two-hybrid method. The structure of ErbB2 protein (amino acids 1-1255) and the extracellular domain of ErbB2 (# 3, amino acids 23-650) are shown. CCN2 (A) and CCN2 fragments (B, C, D, E, F, G, H, I) that bind to the extracellular domain of ErbB2 were examined. The structure of CCN2 and eight types of CCN2 fragments used for the identification of the binding domain and the results of examining binding in yeast cells are shown. In the upper row, recombinant human CCN2 with Flag tag and His tag is added to ErbB2 overexpressed in HeLa cell # 5 strain, and then anti-Flag antibody and anti-ErbB2 antibody are added to immunostain each binding. It is the image observed with the confocal microscope. merge is an image obtained by superimposing these two stained images. The lower row is a similar stained image in which the same protein and antibody are added in order of HeLa cells. Phase-contrast is an image observed with a phase-contrast microscope. The left of each row shows the results of examining the binding of ¹²⁵ I-labeled CCN2 to the cell surface, and the right of each row shows the results of competition of unlabeled CCN2 with ¹²⁵ I-CCN2. (A) ErbB2-overexpressing HeLa cell # 5 and control HeLa cell results, (B) breast cancer-derived cell line MCF7 expressing ErbB2 and human fibrocystic mammary gland patient cell line MCF10A in which ErbB2 is not detected As a result, (C) shows the results for the cartilage-derived HCS-2 / 8 cell line. Each point represents the average of duplicate experiments. In HeLa cell # 5 strain, ErbB2 autophosphorylation by addition of CCN2 was examined. Cells were collected after a predetermined time shown in the figure from the addition of CCN2. Residue-specific anti-phosphotyrosine antibody was used to detect phosphorylated ErbB2. Total ErbB2 is detection by anti-ErbB2 antibody. (A) The results of examining ErbB2 autophosphorylation by addition of CCN2 in a breast cancer-derived cell line SKBr3 that highly expresses ErbB2. (B) It is the result of examining the effect of aggrecan on the autophosphorylation of ErbB2 induced by CCN2 in SKBr3 cells. Total ErbB2 is detection by anti-ErbB2 antibody. Actin is detected by an anti-actin antibody. It is the result of detecting the binding between CCN2 and ErbB2 using the crosslinking agent DSP. (A) A complex of ErbB2 and recombinant human His-CCN2 protein present on the surface of HeLa cell # 5 strain was crosslinked and detected with an anti-His antibody. (B) The amount of CCN2 bound to ErbB2 on the surface of HeLa cell # 5 was increased by the addition of aggrecan. In addition, the recombinant human CCN2 and the recombinant His-CCN2 were allowed to compete, bind and crosslink, and were detected with an anti-His antibody. As a result, competition was confirmed. (C) Results of liquid phase cross-linking assay using capsular fraction and recombinant human CCN2. After crosslinking, ErbB2 binding protein was pulled down with an ErbB2 specific antibody, and CCN2 was detected by Western blot using an anti-His antibody. It is the result of the gene expression analysis in MCF7 cell (A) and MCF10A cell (B). The vertical axis represents the ratio of each gene transcript to the gapdh gene transcript. A partial peptide of CCN2 VWC domain (upper figure) and a partial peptide of ErbB2 REC domain (lower figure) synthesized for cell growth inhibition assay are shown. It is a graph which shows the growth promotion effect | action of a breast cancer origin cell by CCN2, and the inhibitory effect of the growth promotion by an anti- CCN2 * VWC domain antibody (11H3, 101C10). (A) shows the results for SkBr3 cells, and (B) shows the results for MCF7 cells. It is a graph which shows that the recombinant human VWC fragment (final concentration 0.18 μg / ml or 1.85 μg / ml) consisting of the full length of the VWC domain suppresses cell growth induced by CCN2 in MCF7 cells. It is a graph which shows that VWC peptide # 4 (final concentration 1 μg / ml), which is a partial fragment of the VWC domain, suppresses the growth of MDA-MB-231 cells. It is a graph which shows that a recombinant human VWC fragment (final concentration 0.928 microgram / ml) suppresses the proliferation of MCF7 cell. It is a graph which shows that a recombinant human VWC fragment (final concentration 0.928 microgram / ml) suppresses the proliferation of SkBr3 cell. It is a graph which shows that a recombinant human VWC fragment (final concentration 1.35 microgram / ml) suppresses the proliferation of Capan-1 cell. It is a graph which shows the result of having examined the cell growth inhibitory effect of various partial fragment peptides of a VWC domain using MCF7 cell. (A) As a result of VWC peptide V-1, V-2, V-4 and B-7 (each final concentration 1 μg / ml), (B) As a result of VWC peptide B-6 (final concentration 1 μg / ml), ( C) Results for VWC peptide V-3 (final concentration 20 μg / ml). It is the result of investigating the binding between the immobilized ErbB2 extracellular region and biotinylated CCN2. (A) A graph showing that ErbB2 extracellular region and CCN2 bind to CCN2 in a concentration-dependent manner. (B) A graph showing that the ErbB2 extracellular region added to the liquid phase inhibits binding between the immobilized ErbB2 extracellular region and CCN2. (C) The result of monitoring the binding of the ErbB2 extracellular region and CCN2 with an SPR sensor. (D) ErbB2 membrane proximal side REC domain was fragmented, and inhibition of binding between solid-phased ErbB2 extracellular region and CCN2 was examined. It is a graph which shows that ErbB2 peptide 4 and ErbB2 peptide 5 (final concentration of 1 μg / ml), which are partial fragments of the REC domain on the membrane proximal side of ErbB2, suppress the growth of MDA-MB-231 cells. It is a figure which shows the effect of combined use of a taxol and a recombinant VWC fragment with respect to MCF7 cell. This data indicates that CCN2 and CCN3 are combined. (A) CCN3 domain binding to CCN2 by the yeast two-hybrid method. (B) The results of examining the binding between CCN3 immobilized on solid phase and biotinylated CCN2. In mock, CCN2 is not expressed.

The sequences shown in SEQ ID NOs: 1 and 2 are the nucleotide sequence (nt) and amino acid sequence (aa) of the ErbB2 cDNA registered in GenBank as accession No. NM_004448. aa1-22 (239-304nt) is the signal peptide, aa23-652 (305-2194nt) is the extracellular region, of which aa52-173 (392-757nt) and aa366-486 (1334-1696nt) are the REC domain It is. SEQ ID NO: 9 shows the amino acid sequence of the REC domain on the membrane proximal side of ErbB2.

The sequences shown in SEQ ID NOs: 3 and 4 are the base sequence and amino acid sequence of the CCN2 cDNA registered in GenBank as accession No. NM_001901. aa1-26 (207-284nt) is a signal peptide, and aa103-166 (513-704nt) is a VWC domain. SEQ ID NO: 5 shows the amino acid sequence of the VWC domain.

The active ingredient of the agent for treating or preventing cancer according to the present invention is a substance that inhibits the interaction between CCN2 and ErbB2. As demonstrated in the examples below, CCN2 interacts with the extracellular region of ErbB2 through the VWC domain, induces ErbB2 autophosphorylation, transmits a signal, and stimulates the growth of cancer cells To do. And the production amount of CCN2 increases downstream of this signal transduction, and this is expected to further promote the growth of cancer cells. In vivo, it is presumed that tumor growth is promoted by such a cycle of signal transduction. Therefore, by inhibiting the interaction between CCN2 which is a ligand and ErbB2 which is a receptor, the above cycle can be interrupted and the proliferation of cancer cells can be desirably suppressed.

In the present invention, the term “interaction” includes both direct binding between CCN2 and ErbB2 and indirect binding via other factors. Since the binding between CCN2 and ErbB2 increases in the presence of aggrecan, in vivo, in addition to direct binding between CCN2 and ErbB2, indirect binding via other factors such as aggrecan is also assumed. . As described above, the interaction between CCN2 and ErbB2 is as follows: CCN2 VWC domain (regions 103 to 166 of SEQ ID NO: 4) and ErbB2 extracellular region (SEQ ID NO: 2 to 23) From the data described in the following Examples, the region of amino acids 121 to 145 is assumed as the interaction region on the CCN2 side, and the REC domain on the ErbB2 side, Is assumed to be the interaction region of the REC domain on the proximal side of the membrane, particularly the region of amino acids 436 to 465 of ErbB2.

The following two types of substances can be cited as the types of substances that inhibit the interaction between CCN2 and ErbB2.
(1) Substances that inhibit the interaction between CCN2 and ErbB2 by binding to the extracellular region of ErbB2
(2) A substance that inhibits the interaction between CCN2 and ErbB2 by binding to or near the VWC domain of CCN2.

The substance (1) above binds to at least one of the REC domains of ErbB2 (the region of amino acids 52 to 173 and the region of amino acids 366 to 486 in SEQ ID NO: 2). For example, a substance that binds to the REC domain on the proximal side of the membrane (region of amino acids 366 to 486 of SEQ ID NO: 2) is included. The substance that binds to the REC domain on the proximal side of ErbB2 can be, for example, a substance that binds to the region of amino acids 436 to 465 (SEQ ID NO: 14) of ErbB2. The region from amino acids 436 to 465 has been confirmed to be an important region for the interaction between CCN2 and ErbB2 extracellular region (see Examples below).

Specific examples of the substance included in (1) above include an ErbB2 antagonist, an antibody against the REC domain of ErbB2 (anti-ErbB2-REC domain antibody), and an antigen-binding fragment thereof.

ErbB2 antagonists are involved in the interaction between ErbB2 and CCN2 and do not substantially activate the ErbB2 downstream signaling pathway that competes with CCN2 and stimulates cancer cell growth, in other words, ErbB2 autophosphorylation. Any substance that does not irritate may be used. An ErbB2 antagonist can be produced, for example, by modifying the CCN2 protein. CCN2 protein variants include CCN2 variants that have been modified so that ErbB2 downstream signaling pathways are not activated by introducing mutations (substitutions or insertions) into part of the CCN2 protein amino acid sequence, or ErbB2 downstream signaling pathways. CCN2 protein partial fragments lacking a region important for activation (for example, a CCN2 partial fragment containing the full length of VWC domain or a part thereof) and the like are included.

Examples of preferred CCN2 protein variants include polypeptides comprising 7 or more consecutive residues, for example, 10 or more, 15 or more, or 18 or more residues in the amino acid sequence of CCN2 VWC domain shown in SEQ ID NO: 5. Can be mentioned. The polypeptide consists of 7 or more consecutive residues in the amino acid sequence shown in SEQ ID NO: 8 (VWC peptide # 4 synthesized in the example), for example, 10 residues or more, 15 residues or more, or 18 residues or more. It can be a polypeptide. The polypeptide consisting of the partial region of SEQ ID NO: 8 preferably contains 7 or more consecutive residues in the region of amino acids 11 to 20 of SEQ ID NO: 8, preferably the entire length of the region. The amino acid sequence of the 11th to 20th amino acid region of SEQ ID NO: 8 is shown in SEQ ID NO: 38. Specific examples of preferred CCN2 protein variants include a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 (full length of VWC domain), a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 8 (partial fragment of VWC domain), and SEQ ID NO: A polypeptide comprising the amino acid sequence shown in 38 can be exemplified, but the present invention is not limited thereto, and any CCN2 partial fragment can be used as an active ingredient for cancer treatment or prevention as long as it has an action of suppressing the growth of cancer cells. Can be preferably used.

Since the CCN2 partial fragment only needs to be a fragment that does not activate the signal transduction pathway of cancer growth downstream of ErbB2, it may consist of the same amino acid sequence as the corresponding partial region of the original CCN2 protein, Moreover, as long as the effect | action as an antagonist is not impaired and the effect | action which suppresses the proliferation of a cancer cell is maintained, there may be some differences from the corresponding partial region of SEQ ID NO: 4. For example, it may be a polypeptide comprising an amino acid sequence partially different from the VWC domain sequence shown in SEQ ID NO: 5. If the sequence identity with the original corresponding partial region is sufficiently high, it is highly likely that the activity as an antagonist is maintained, and thus it can be said that the cancer cell proliferation inhibitory action can be exhibited. It is useful as an ErbB2 antagonist in the same manner as the fragment of the wild-type CCN2 protein shown in FIG. 2, and is included in the scope of the present invention. The identity with the original corresponding region is, for example, 90% or more, preferably 95% or more, more preferably 98% or more. Alternatively, it may be a polypeptide consisting of an amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added in the sequence of the original corresponding region.

Here, the amino acid sequence identity means that both amino acid sequences are aligned so that the amino acid residues of the two amino acid sequences to be compared match as much as possible, and the number of matched amino acid residues is divided by the total number of amino acid residues. Is expressed as a percentage. In the above alignment, a gap is appropriately inserted in one or both of the two sequences to be compared as necessary. Such sequence alignment can be performed using a known program such as BLAST, FASTA, CLUSTAL W, and the like. When gaps are inserted, the total number of amino acid residues is the number of residues obtained by counting one gap as one amino acid residue. When the total number of amino acid residues counted in this way is different between the two sequences to be compared, the identity (%) is the total number of amino acid residues in the longer sequence, and the number of amino acid residues matched. Is calculated by dividing.

The 20 types of amino acids that make up natural proteins are neutral amino acids with low polarity side chains (Gly, Ile, Val, Leu, Ala, Met, Pro), neutral amino acids with hydrophilic side chains (Asn, Gln) , Thr, Ser, Cys), acidic amino acids (Asp, Glu), basic amino acids (Arg, Lys, His), and aromatic amino acids (Phe, Tyr, Trp). It is known that the properties of the polypeptide often do not change if the substitution is within each of these groups. Therefore, when a polypeptide having an amino acid sequence different from that of the wild-type CCN2 protein fragment is used as an ErbB2 antagonist, the action of ErbB2 as an antagonist can be maintained if an amino acid is substituted in each of these amino acid groups. Increases nature.

A person skilled in the art can easily examine whether a CCN2 variant consisting of an arbitrary amino acid sequence has activity as an ErbB2 antagonist and can suppress the growth of cancer cells. For example, a cancer cell line may be brought into contact with a CCN2 variant to examine whether cancer cell growth is suppressed. If growth inhibition can be confirmed, it can be determined that the CCN2 variant has an ErbB2 antagonistic activity, thereby exhibiting an action of suppressing cancer cell growth. In the following examples, the VWC region (recombinant human VWC fragment), which is an example of a CCN2 variant, suppresses the growth of cancer cells induced by CCN2 added to the medium, and CCN2 is not added to the medium However, it has been specifically shown to suppress the growth of cancer cells.

Alternatively, it may be examined whether it has activity as an antagonist, that is, whether it competes with wild-type CCN2 and does not activate the signal pathway downstream of ErbB2.

For competition with CCN2, the extracellular region of ErbB2 is immobilized on the solid phase, CCN2 and CCN2 variant are brought into contact with ErbB2-immobilized solid phase, and the amount of binding between ErbB2 and CCN2 is measured. Whether the body inhibits the binding of CCN2 and ErbB2 can be examined. Measurement of the amount of CCN2 bound to ErbB2 on the solid phase is, for example, biotinylated CCN2 in advance, reacted with ErbB2 on the solid phase and washed, and then added with streptavidin labeled with an enzyme or a fluorescent substance, Furthermore, the amount of CCN2 binding can be easily measured by detecting the signal from the label after washing. Alternatively, the surface plasmon resonance (SPR) may be used to measure the amount of CCN2 bound to the ErbB2 extracellular region immobilized on the chip in the presence of a CCN2 variant using an SPR sensor. In addition, there are various known methods for measuring binding inhibition between two factors, such as an electrochemical measurement method using a microchannel chip and a method using the yeast two-hybrid method. Also good. As described above, the binding mode between CCN2 and ErbB2 is assumed to be both direct binding and indirect binding via other factors such as aggrecan, but whether to compete with wild-type CCN2 or not For, it is only necessary to examine whether direct binding is inhibited.

Whether or not the signal pathway downstream of ErbB2 is to be activated is determined by, for example, contacting cultured cells that overexpress ErbB2 (such as the breast cancer-derived cell line SKBr3 that highly expresses ErbB2) with CCN2 variants, and then making proteins from the cells. Can be examined by performing Western blotting using an anti-phosphotyrosine antibody (commercially available) and confirming whether ErbB2 autophosphorylation has occurred.

The CCN2 protein variant is introduced by introducing a mutation into a wild-type CCN2 cDNA by a conventional method using a mismatch primer or the like by a well-known genetic engineering technique, incorporating it into an appropriate expression vector, and introducing it into a host cell. CCN2 mutants can be expressed in host cells and recovered. Wild-type CCN2 cDNA can be obtained by performing RT-PCR using RNA extracted from cells expressing CCN2 such as chondrocytes as a template. In the case of a partial fragment of CCN2, a desired region of CCN2 cDNA may be incorporated into an expression vector and expressed in a host cell. A primer capable of amplifying a desired region can be appropriately designed with reference to the base sequence shown in SEQ ID NO: 3. As described above, positions 513 to 704 in the nucleotide sequence shown in SEQ ID NO: 3 are regions encoding the VWC domain. Alternatively, a CCN2 protein variant consisting of the desired amino acid sequence can be prepared by conventional chemical synthesis.

Since the anti-ErbB2-REC domain antibody can interfere with the interaction between CCN2 and ErbB2, it is useful for the treatment and prevention of cancer in the same manner as the ErbB2 antagonist. The antibody may be an antibody that binds to the REC domain on the membrane proximal side, for example, an antibody having an epitope in the region of amino acids 436 to 465 of ErbB2.

The antibody may be a polyclonal antibody or a monoclonal antibody. The anti-ErbB2-REC domain human antibody can be easily prepared by a conventional hybridoma method or the like. Briefly, an ErbB2 protein or an ErbB2 fragment containing the REC domain of ErbB2 is prepared by a well-known genetic engineering technique, and this is used as an immunogen together with an adjuvant as appropriate to immunize animals (except humans). Induces antibodies in the body. Antibody producing cells such as spleen cells and lymphocytes are collected from the animal and fused with immortalized cells such as myeloma cells to produce hybridomas. From the hybridoma, one that produces an antibody that specifically binds to the REC domain of ErbB2 can be selected and expanded to obtain an anti-ErbB2-REC domain monoclonal antibody from the culture supernatant.

In addition to antibodies derived from non-humans such as rodents, monoclonal antibodies include chimeric antibodies, humanized antibodies (non-human-derived antibody CDR regions transplanted to regions corresponding to human antibodies), human antibodies (non-human Also included are the same antibodies produced in the human body that are produced using animal or human cell lines. Methods for producing chimeric antibodies, humanized antibodies, and human antibodies have been established as methods well known in the art. For example, an anti-ErbB2-REC domain human antibody can be prepared by immunizing a REC domain of ErbB2 to a non-human animal such as a mouse genetically modified so that a human antibody can be produced.

It is also possible to prepare an antigen-binding fragment from an anti-ErbB2-REC domain antibody. “Antigen-binding fragment” means an antibody fragment that maintains the binding property (antigen-antibody reactivity) of the antibody to the corresponding antigen, such as an Fab fragment or F (ab ′) ₂ fragment of an immunoglobulin, for example. To do. Antibody fragments that maintain the binding of ErbB2 to the REC domain can be used for the treatment and prevention of cancer in the same manner as complete antibodies. Fab fragments and F (ab ′) ₂ fragments can be obtained by treating monoclonal antibodies with proteolytic enzymes such as papain and pepsin, as is well known. The antigen-binding fragment is not limited to the Fab fragment or the F (ab ′) ₂ fragment, and may be any fragment that maintains the binding property with the corresponding antigen. It may be prepared. In addition, for example, an antibody in which a single chain fragment of variable region (scFv) is expressed in Escherichia coli by genetic engineering techniques can be used. The method for producing scFv is also well known. The hybridoma mRNA produced as described above is extracted, single-stranded cDNA is prepared, and PCR is performed using primers specific to immunoglobulin H chain and L chain. Globulin H chain gene and L chain gene are amplified, ligated with a linker, inserted with an appropriate restriction enzyme site and inserted into a plasmid vector, the vector is introduced into E. coli and transformed, and scFv is transformed from E. coli. By collecting, scFv can be prepared. Such scFv is also included in the scope of the present invention as an “antigen-binding fragment”.

The substance (2) above is, for example, a substance that binds to the CCW2 VWC domain (regions 103 to 166 in SEQ ID NO: 4). Since CCN2 interacts with the extracellular region of ErbB2 via its VWC domain, using a substance that binds to the VWC domain inhibits the interaction between CCN2 and ErbB2 on the cell surface, and downstream of ErbB2 Signal transduction can be inhibited.

Specific examples of substances included in (2) above include antibodies against the CCN2 VWC domain (anti-CCN2-VWC domain antibody) and antigen-binding fragments thereof, ErbB2 extracellular region (SEQ ID NO: 9) and partial fragments thereof, etc. Can be mentioned.

The anti-CCN2-VWC domain antibody is an antibody that specifically binds to any region in the VWC domain (SEQ ID NO: 5). Examples of preferred anti-CCN2-VWC domain antibodies or antigen-binding fragments thereof include epitopes within the region of amino acids 19 to 64 in SEQ ID NO: 5 (amino acids 121 to 166 in SEQ ID NO: 4). Or an antigen-binding fragment thereof, for example, in the region of amino acids 19 to 43 in SEQ ID NO: 5 (amino acids 121 to 145 in SEQ ID NO: 4) or the sequence Although it may be an antibody having an epitope in the region of No. 44 to No. 64 (No. 146 to No. 166 in SEQ ID No. 4) in No. 5, or an antigen-binding fragment thereof, it is not limited thereto. As used herein, the expression “having an epitope within a predetermined region” means that the full length or partial region of the region is an epitope. Similarly to the anti-ErbB2-REC domain antibody, the anti-CCN2-VWC domain antibody may be a polyclonal antibody or a monoclonal antibody, and the monoclonal antibody includes a chimeric antibody, a humanized antibody, and a human antibody. The anti-CCN2-VWC domain antibody can be prepared by a conventional method using a mature CCN2 protein excluding the signal peptide or a CCN2 fragment containing the VWC domain as an immunogen.

The ErbB2 extracellular region and partial fragments thereof compete with ErbB2 on the cancer cell surface to capture CCN2, thereby inhibiting the interaction between ErbB2 and CCN2 present on the cell surface. The partial fragment of ErbB2 extracellular region is 7 or more consecutive amino acids in the amino acid sequence of ErbB2 extracellular region shown in SEQ ID NO: 9, for example, 10 residues or more, 15 residues or more, 18 residues or more, 25 residues or more. Or 30 residues or more and less than the full length of SEQ ID NO: 9. Preferable specific examples of the partial fragment include 7 or more consecutive residues in the amino acid sequence shown in SEQ ID NO: 14, for example, 10 residues or more, 15 residues or more, 18 residues or more, 25 residues or more, or SEQ ID NO: A polypeptide consisting of 14 full lengths can be mentioned, but is not limited thereto.

In addition, a polypeptide having a certain level of identity with any of the ErbB2 extracellular region and any of its partial fragments can also inhibit cancer cell growth by inhibiting signal transduction due to the interaction between CCN2 and ErbB2. Therefore, it can be used as the substance of (2) above. Such a polypeptide has 90% or more, preferably 95% or more identity with the original ErbB2 extracellular region or a partial fragment thereof, or one or several in the ErbB2 extracellular region or a partial fragment thereof. It may be a polypeptide consisting of an amino acid sequence in which one amino acid is substituted, deleted, inserted or added. Whether any polypeptide with high identity with the ErbB2 extracellular region or a partial fragment thereof can inhibit the signal transduction due to the interaction between CCN2 and ErbB2 can suppress the growth of cancer cells, for example, This can be confirmed by contacting a cancer cell line with the polypeptide and examining whether the growth of cancer cells is suppressed.

ErbB2 extracellular region and partial fragments thereof can be prepared by well-known genetic engineering techniques or by chemical synthesis, as described above for CCN2 protein variants. When prepared by a genetic engineering technique, a cDNA encoding the ErbB2 extracellular region can be obtained by, for example, amplifying RT-PCR from mRNA extracted from a cancer cell that expresses ErbB2. As described above, in the nucleotide sequence shown in SEQ ID NO: 1, positions 305 to 2194 are regions encoding extracellular regions, of which positions 392 to 757 and 1334 to 1696 are REC. Since it is a region encoding a domain, a desired region may be amplified by appropriately setting primers.

In addition, as the substance (2), a known protein known to bind to the VCN domain of CCN2 or the vicinity thereof can be used. As such a known protein, for example, CCN3 (VWC domain, CT domain binds to CCN2; 4th Japan CCN Family Study Group Program / Abstract Collection, published on August 26, 2011, p.32; And DECORIN (the core protein LRR10-12 binds to CCN2; The Journal of Biological Chemistry, 2011, 286, p. 24242-24252.), BMP (bone morphogenetic protein) (Nat Cell Biol. 2002 August; 4 (8): 599-604), and the like, but is not limited thereto. Such known proteins may use only the region that binds to the CCN2 VWC domain. Proteins and fragments thereof with known amino acid sequences and cDNA base sequences can be prepared by well-known genetic engineering techniques or by chemical synthesis.

A polypeptide such as a protein fragment used in the present invention is a technique used for improving stability in a living body in peptide medicine, for example, glycosylation, PEG addition, or the amino acid constituting the polypeptide. A technique such as at least a part of which is a D-form amino acid may be applied. Such techniques include, for example, J Am Chem Soc. 2004 Nov 3; 126 (43): 14013-22, Angew Chem Int Ed Engl. 2004 Mar 12; 43 (12): 1516-20 (glycosylation), Clin Nephrol. 2006 Mar; 65 (3): 180-90. And Proc Natl Acad Sci USA. 2005 Sep 6; 102 (36): 12962-7. (PEG addition), J Pharmacol Exp Ther. 2004 Jun; 309 (3): 1190-7 and J Pharmacol Exp Ther. 2004 Jun; 309 (3): 1183-9 (utilization of D-form amino acids) and the like, and are already utilized in the field of peptide medicine.

Alternatively, when a recombinant polypeptide is produced by genetic engineering techniques, various post-translational modifications (elimination of N-terminal methionine, N-terminal acetylation, glycosylation, limited degradation by intracellular protease, myristoyl Such post-translationally modified form of the polypeptide can be used as an active ingredient of the therapeutic or prophylactic agent of the present invention as long as it can suppress the growth of cancer cells. And within the scope of the present invention.

In addition, for the convenience of polypeptide production, etc., any amino acid sequence added, such as a polypeptide with a Flag tag, His tag, or GST added, or a polypeptide fused with other proteins or fragments thereof. Since the peptide also exhibits anticancer activity in the region of the polypeptide corresponding to the interaction inhibitor (1) or (2) described above, the present invention is used, and thus such fusion is performed. Proteins are also encompassed within the scope of the present invention. In the case of an amino acid sequence fused with another protein or the like, the amino acid sequence identity is calculated by extracting only the region corresponding to the polypeptide used in the present invention. For example, in the case of a polypeptide to which a His tag is added, the identity is calculated between regions excluding the His tag.

The cancer to be treated / prevented in the present invention is not particularly limited, and any cancer can be treated and prevented as long as it has ErbB2 expression. ErbB2 testing may be performed in breast cancer, etc., but the therapeutic or preventive agent of the present invention is not limited to ErbB2 overexpressing cancers that are judged to be ErbB2 positive by conventional methods, and ErbB2 expression can be detected. Cancers that are expressed at the level are also targeted. Examples of cancers in which ErbB2 expression has been confirmed include, but are not limited to, breast cancer, gastric cancer, pancreatic cancer, lung cancer, colon cancer, and bladder cancer. Although the expression level of ErbB2 in cancer cells may vary from patient to patient, whether or not ErbB2 expression is detected in the target patient's cancer can be determined using real-time PCR, Northern PCR using a cancer tissue sample collected from the patient. It can be easily examined by performing conventional methods such as blotting, immunostaining, and Western blotting. For example, if a cancer tissue sample is immunostained using a fluorescently labeled antibody and the expression of ErbB2 in a cancer cell is detected, it may be determined that the cancer has ErbB2 expression.

The administration target of the therapeutic or prophylactic agent for cancer of the present invention is not particularly limited, but is preferably a mammal, such as a human, dog, cat, rabbit, hamster, mouse, monkey, horse, pig, cow, sheep, etc. Can be mentioned.

The therapeutic or prophylactic agent of the present invention may contain only one type of substance selected from (1) and (2) above, or may contain two or more types. The agent of the present invention may be used alone or in combination with other anticancer agents.

The administration route to the living body of the therapeutic or prophylactic agent of the present invention may be oral administration or parenteral administration, but parenteral administration such as intramuscular administration, subcutaneous administration, intravenous administration and intraarterial administration is preferred. When used for the purpose of cancer treatment, in order to enhance the anticancer effect, it can be administered to the vicinity of the tumor to be treated or to a regional lymph node near the tumor. The dose may be an amount effective for treatment or prevention of the target cancer. The effective amount is appropriately selected according to the size and symptoms of the tumor, but is usually 0.001 mg to 1000 mg per kg body weight as the effective amount per day for the target living body, for example, 0.01 mg to 100 mg. Divided into several times, preferably divided into several times and administered every several days to several months. Since the onset and recurrence of cancer can be prevented by using the agent of the present invention before cancer onset or after cancer treatment, the present invention can also be used for cancer prevention.

The present invention also provides a substance that inhibits the interaction between CCN2 and ErbB2 (hereinafter sometimes referred to as “CCN2-ErbB2 interaction inhibitor”) and an anti-apoptosis type anti-antibody. Provided is a cancer treatment or prevention agent in combination with an cancer drug (apoptosis inducer). “In combination” means that a CCN2-ErbB2 interaction inhibitor and an apoptosis-inducing agent are administered to a patient simultaneously, sequentially or separately. Hereinafter, the cancer treatment or prevention agent described above may be referred to as “first cancer treatment or prevention agent”, and the cancer treatment or prevention agent in combination with apoptosis may be referred to as “combination agent”.

The substance that inhibits the interaction between CCN2 and ErbB2 is a substance as defined above, and the types thereof include the following two substances as already described. Preferred conditions for each substance are also as described above.
(1) Substances that inhibit the interaction between CCN2 and ErbB2 by binding to the extracellular region of ErbB2
(2) A substance that inhibits the interaction between CCN2 and ErbB2 by binding to or near the VWC domain of CCN2.

The apoptosis inducer includes various known anticancer agents known to induce apoptosis in cancer cells. Specific examples include taxane anticancer agents, vinca alkaloids, colchicine, and the like that suppress the growth of cancer cells by inhibiting mitosis, and taxane anticancer agents are particularly preferably used in combination. Specific examples of taxane anticancer agents include, but are not limited to, paclitaxel and various derivatives thereof such as paclitaxel and docetaxel.

The cancer targeted by the combination of the present invention is a cancer with ErbB2 expression, preferably an anti-cancer of the type that induces apoptosis by inhibiting mitosis or the like to suppress the growth of cancer cells Cancer resistant to drugs, particularly taxane anticancer agents. “A cancer resistant to an anticancer agent” includes both those that become resistant during treatment with the anticancer agent and those that are less effective from the beginning of treatment. The expression level of ErbB2 is not limited to overexpressed cancers, and cancers expressing ErbB2 at a detectable level are also targeted. For example, ErbB2 testing may be performed for breast cancer and the like, but it is not limited to ErbB2 overexpressing cancer that is judged to be ErbB2 positive by conventional methods. Specific examples of cancers in which the expression of ErbB2 has been confirmed, and how to check whether the expression of ErbB2 is detected in the cancer of the target patient have already been described in the explanation of the first treatment or prevention agent for cancer. As stated.

The target living body is the same as the first cancer treatment or prevention agent.

When a CCN2-ErbB2 interaction inhibitor and an apoptosis inducer are used in combination, the growth of cancer cells can be suppressed even at a concentration that cannot suppress the growth of cancer cells alone. Therefore, the combination agent of the present invention can desirably exhibit an anticancer action even against cancer resistant to an anticancer agent of a type that induces apoptosis. In addition, for cancers that are sensitive to anticancer agents, the dose can be kept low, and side effects of anticancer agents can be reduced. Therefore, it can be interpreted that CCN2-ErbB2 interaction inhibitors enhance the anticancer activity of anticancer agents that induce apoptosis.

The mechanism by which the anticancer drug resistance is released by the combination of the present invention can be inferred as follows.

TAZ (transcriptional co-activator with PDZ-binding motif) is a protein that functions as a coactivator of many transcription factors important for the development of various tissues, and has recently played an important role in the control of cell proliferation and apoptosis. TAZ is also added as a component to the Hippo-LATS tumor suppressor pathway (Genes Dev 2007; 21: 886-97, Cancer Cell 2008; 13: 188-92, Biochem Cell Biol 2009; 87: 77-91) It was shown that LATS tumor suppressor phosphorylates TAZ and inhibits its function through the pathway (Mol Cell Biol282008; 28: 2426-36). In other words, TAZ is widely involved in the control of cell division and apoptosis. CCN2 has been known to confer resistance to epithelial cells against apoptosis induced by taxol and hypoxia (Cancer Res 2000; 60: 5603-7, Cancer Res 2001; 61: 8917-23, Endocrinology 2001; 142: 2540-8, Oncogene 2002; 21: 964-73, Oncogene 2002; 21: 8178-85, J Biol Chem 2004; 279: 24015-23, Endocr Relat Cancer 2004; 11: 781-91, Oncogene 2005; 24 : 761-79, Clin Cancer Res 2005; 11: 5809-20, Int J Oncol 2008; 33: 59-67, J Cell Sci 2007; 120: 2053-65), CCN2 is located just downstream of TAZ, It has also been reported that taxol resistance is completely blocked by knockdown of TAZ and knockdown of both Cyr61 and CCN2 (Cancer Res 2011; 71: 2728-2738). And now, the present inventors have proved that the increase in the expression of TAZ is downstream of signal transduction resulting from the CCN2-ErbB2 interaction (see Examples below). That is, by inhibiting the interaction of CCN2-ErbB2, the increase in the expression of TAZ is suppressed, and the expression of CCN2 is also suppressed. Then, the resistance to apoptosis induced by CCN2 increased in expression by TAZ can be released by inhibiting the interaction of CCN2-ErbB2. From the mechanism of action presumed in this way, the combination agent of the present invention is considered to be widely effective for cancers resistant to anticancer agents of the type that induce apoptosis. Among apoptosis inducers, mitotic inhibitors, especially taxane anticancer agents, act by a mechanism very similar to that of paclitaxel, so the combined effect on resistant cancer can be desirable as with paclitaxel. It can be said that.

The route of administration of the CCN2-ErbB2 interaction inhibitor to the living body may be oral administration or parenteral administration, but parenteral administration such as intramuscular administration, subcutaneous administration, intravenous administration and intraarterial administration is preferred. When used for the purpose of cancer treatment, in order to enhance the anticancer effect, it can be administered to the vicinity of the tumor to be treated or to a regional lymph node near the tumor. The administration route of the apoptosis-inducing agent may be the same as the administration route in which the apoptosis-inducing agent is usually used as an anticancer agent.

The dose of the CCN2-ErbB2 interaction inhibitor and the apoptosis inducer may be any amount that is effective for treating or preventing the target cancer. The effective amount is appropriately selected according to the position, size, symptom, tumor marker, strength of drug resistance (in the case of resistant cancer), and the like. Usually, the dose of the CCN2-ErbB2 interaction inhibitor is 0.001 mg to 1000 mg, for example, 0.01 mg to 100 mg per kg body weight, as the effective daily dose for the target organism. It may be comparable to the amount used for cancer treatment or prevention. Since the effect of the combination is synergistic, the apoptosis-inducing agent can be used in a smaller amount than the dose usually used alone. Both can be administered in one or several divided doses, simultaneously, sequentially or separately. Preferably, it is divided into several times and administered every few days, every few weeks to every several months. When administered sequentially or separately, any of the apoptosis-inducing agent and CCN2-ErbB2 interaction inhibitor may be administered first. When administered separately, the number of administrations may be the same, or the number of administrations may be different, for example, once per day apoptosis inducer and twice CCN2-ErbB2 interaction inhibitor. Also good. Since the onset and recurrence of cancer can be prevented if the combination of the present invention is used before the onset of cancer or after cancer treatment, the combination of the present invention can also be used for cancer prevention. .

The CCN2-ErbB2 interaction inhibitor used in combination with the apoptosis inducer may contain only one type of substance selected from the above (1) and (2) (CCN2-ErbB2 interaction inhibitor) In addition, it may contain two or more. The CCN2-ErbB2 interaction inhibitor can also be formulated by appropriately mixing pharmacologically acceptable additives, such as pharmacologically acceptable carriers, diluents, excipients, etc., suitable for each dosage form. When the CCN2-ErbB2 interaction inhibitor and the apoptosis-inducing agent are administered simultaneously, both can take the form of a combination drug contained in the same composition. Formulation methods and usable additives are well known in the field of pharmaceutical formulations, and any method and additive can be used.

The present invention also provides a novel screening method for a therapeutic or prophylactic agent for cancer based on the novel finding that CCN2 is a ligand for ErbB2. In the screening method of the present invention, a compound is selected using inhibition of the interaction between CCN2 and ErbB2 as an index. The compound may be any compound such as a low molecular compound, a high molecular compound, a polypeptide (including proteins and oligopeptides), a nucleic acid, and a sugar chain.

The screening method of the present invention can be preferably carried out using inhibition of direct binding between CCN2 and ErbB2 as an index. Various techniques for examining whether a compound inhibits the binding between two factors are known and can be easily carried out by those skilled in the art. For example, the extracellular region of ErbB2 is immobilized on a solid phase, the test compound is brought into contact with ErbB2 immobilized solid phase together with CCN2, and the amount of binding between ErbB2 and CCN2 is measured, so that the test compound is CCN2 and ErbB2 It is possible to examine whether or not the binding is inhibited. In the following example, the ErbB2 extracellular region was immobilized in the well of the plate, and a test compound (partial fragment of the ErbB2 ligand binding region) was added together with biotinylated CCN2, and after washing, enzyme-labeled streptavidin was added. In addition, after washing, an enzyme substrate was added, and the amount of CCN2 bound on the solid phase was measured based on the color development amount. Thus, by directly or indirectly labeling CCN2 with an enzyme, a fluorescent substance or the like, the binding amount of ErbB2 and CCN2 can be easily measured. Further, by using surface plasmon resonance (SPR), the binding between the ErbB2 extracellular region immobilized on the chip and CCN2 can be measured by an SPR sensor. In addition, there are various known methods for measuring binding inhibition between two factors, such as an electrochemical measurement method using a microchannel chip and a method using the yeast two-hybrid method. Also good.

The compound found by the screening method that inhibits the binding between CCN2 and ErbB2 may be useful for the treatment and prevention of cancers with ErbB2 expression, similar to the therapeutic or prophylactic agent of the present invention. . Candidate compounds obtained by the screening method of the present invention can be established as cancer treatment or prevention agents through growth inhibition experiments using cancer cell lines.

Cancer cells can be detected by using direct or indirect binding of CCN2 protein to ErbB2. That is, the present invention provides a cancer cell detection reagent comprising any of the following polypeptides.
(a) A polypeptide comprising the amino acid sequence shown in SEQ ID NO: 4.
(b) a polypeptide consisting of a partial region in the amino acid sequence shown in SEQ ID NO: 4, comprising 7 or more consecutive residues in the region of amino acids 103 to 166 and directly to the ErbB2 extracellular region Or a polypeptide that binds indirectly.
(c) A polypeptide comprising an amino acid sequence having 90% or more identity with (a) or (b) and directly or indirectly binding to the ErbB2 extracellular region.
(d) A polypeptide comprising the amino acid sequence of the polypeptide of any one of (a) to (c) and binding directly or indirectly to the ErbB2 extracellular region.

(A) The polypeptide is, for example, a recombinant CCN2 protein. The following examples specifically show that ErbB2 present on the cell surface of HeLa cells overexpressed ErbB2 can be detected using recombinant CCN2 protein. Proteins such as aggrecan are also contained in fixed cell samples and tissue samples. Therefore, the binding mode between recombinant CCN2 protein and cell surface ErbB2 in the sample is between CCN2 and ErbB2. Both direct binding and indirect binding via factors such as aggrecan are envisioned.

The polypeptide of (b) is 7 residues or more in the VWC domain of CCN2, for example, 10 residues or more, 15 residues or more, 18 residues or more, 25 residues or more, 30 residues or more, 46 residues or more, Alternatively, it is a CCN2 protein fragment containing a region of 64 residues or more (full length of VWC domain). CCN2 binds to the ErbB2 extracellular region at the VWC domain (amino acids 103 to 166), and an important part for this binding exists in the VWC domain. Therefore, even a polypeptide consisting of a partial region within the VWC domain can be used for detection of cancer cells as long as it can bind directly to the ErbB2 extracellular region or indirectly through factors such as aggrecan. . The method for examining binding is the same as the method for examining competition among antagonist activities (described above). Specific examples of the polypeptide (b) include a CCN2 partial fragment containing the full length of the VWC domain, a polypeptide consisting of the VWC domain, and a polypeptide consisting of a partial region within the VWC domain (for example, any one of SEQ ID NOs: 6 to 8). A polypeptide consisting of the amino acid sequence shown in the following, or a fragment thereof consisting of 7 residues or more), but is not limited thereto.

The polypeptide of (c) is composed of an amino acid sequence in which a small number of amino acids are substituted, deleted, inserted or added in the polypeptide of (a) or (b), and is directly or aggrecan with the ErbB2 extracellular region. A polypeptide that binds indirectly via factors such as. The sequence identity with the original polypeptide (a) or (b) is 90% or more, preferably 95% or more. Alternatively, the polypeptide (c) is a polypeptide comprising an amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added in the original polypeptide (a) or (b). Is also preferable.

The identity of the amino acid sequence here is the same as the definition described above in the description of the therapeutic or preventive agent for cancer. However, when used in a form in which any other amino acid sequence is added to the polypeptide (for example, when used in the form of a fusion protein with another protein, when used in a form added with a peptide tag such as Flag peptide) The identity is calculated by comparing the sequences only in the region corresponding to the polypeptides (a) to (c) excluding the arbitrary amino acid sequence, not the full length of the amino acid sequence.

The polypeptide of (d) contains the amino acid sequence of any of the polypeptides (a) to (c) as a partial sequence (that is, other amino acids at one or both ends of the polypeptide of (a) to (c)) Or a polypeptide to which a polypeptide is added) and binds directly to the ErbB2 extracellular region directly or via a factor such as aggrecan. Polypeptides (a) to (c) to which any amino acid or polypeptide has been added can also be used for detection of ErbB2 on the surface of cancer cells as long as the binding to the ErbB2 extracellular region is not impaired.

The polypeptides (a) to (d) can be easily produced by well-known genetic engineering techniques or by conventional chemical synthesis.

The polypeptide contained in the detection reagent may be in a form labeled with a labeling substance such as biotin, fluorescent dye, fluorescent protein, enzyme, FLAG tag, metal (manganese, iron, etc.). Further, if desired, it can be used in a form to which a compound other than a label is added, or in the form of a fusion protein with another protein. These various forms of polypeptides are also included in the scope of the detection reagent of the present invention.

The detection reagent may be composed only of the above-mentioned polypeptide, or may be in a form in which the polypeptide is dissolved in a buffer or the like. The reagent can be used in the same manner as the antibody in immunoassay. It is also possible to examine the expression level of ErbB2 in the cancer cells of the patient by contacting a cancer tissue sample collected from the patient with the detection reagent of the present invention and performing a detection reaction. The reagent can also be used for pathological diagnosis of ErbB2-expressing cancer such as breast cancer.

The method for detecting cancer using the detection reagent will be specifically described below.

First, the target cell is brought into contact with the detection reagent. The detection reagent is usually used in a form in which the polypeptide is labeled with a labeling substance. Specific examples of the labeling substance are as described above. The subject is preferably a mammal, and specific examples include humans, dogs, cats, rabbits, hamsters, mice, monkeys, horses, pigs, cows, sheep and the like. The target cell may be a sample containing the target cell separated from the target living body (in vitro diagnostic agent). When the sample is a tissue specimen, the detection reagent and the cells may be brought into contact so that the tissue specimen is immersed in a solution containing the detection reagent of the present invention at an appropriate concentration. When the sample is a cultured cell, the detection reagent can be used in a form in which the polypeptide is immobilized on a support such as a plate, but the cultured cell is immobilized on a support such as a slide glass, It is preferable that the detection reagent and the cell are brought into contact so that the cultured cells are immersed in the detection reagent solution. Alternatively, the subject cell may be a cell in the subject's body (in-vivo diagnostic). In this case, by administering the detection reagent to the target, the target cell and the detection reagent can be brought into contact with each other in the body of the target.

If cancer cells expressing ErbB2 are present in the target cells brought into contact with the detection reagent, the polypeptide contained in the detection reagent binds to the ErbB2 extracellular region on the surface of the cancer cell. Therefore, the presence of cancer cells can be detected by detecting the presence of cells to which the polypeptide is bound. In the case of an in-vivo diagnostic, the mode of binding between the ErbB2 extracellular region on the surface of cancer cells and the polypeptide in the detection reagent is either direct or indirect via factors such as aggrecan Can be a bond.

When the detection reagent is an in-vitro diagnostic agent, after contacting the sample and the detection reagent, incubating for an appropriate time to fully bind the ErbB2 extracellular region on the cell surface to the polypeptide, and then perform a washing step What is necessary is just to detect the signal from the labeling substance couple | bonded with polypeptide after removing unbound polypeptide. When an enzyme is used as the labeling substance, an appropriate substrate substance is added to the reaction system, and signals such as color development or luminescence generated by the enzyme reaction may be detected. When a tag such as biotin or a FLAG tag is used as the labeling substance, an antibody against the tag and a labeling substance that emits its own signal such as a fluorescent substance or an antibody labeled with an enzyme may be used. By adding such a labeled antibody to the reaction system and detecting a signal from the labeled antibody (in the case of an enzyme-labeled antibody, a substrate substance is added and a signal generated by the enzyme reaction) is detected. The presence of cells bound by can be detected.

When the detection reagent is an in-vivo diagnostic agent, the detection reagent may be administered to the subject, and a signal from the polypeptide remaining in the body may be detected after an appropriate time has elapsed. When the detection reagent of the present invention is administered into the body of a subject, more of the polypeptide is accumulated at a site where ErbB2 is more expressed. If a polypeptide labeled with a labeling substance that emits a signal that can be detected from outside the body can be detected from outside the body, the presence of cancer cells in the body that express ErbB2 can be detected. it can. Specific examples of such a labeling substance include metals such as manganese and iron. The metal label can be detected from outside the body by MRI or the like.

Hereinafter, the present invention will be described more specifically based on examples. However, the present invention is not limited to the following examples. In addition, ErbB2 expression of the cell lines used in the following examples is as follows.
HeLa: Human cervical cancer-derived strain. ErbB2 expression is not detected.
SkBr3: ErbB2 overexpression strain derived from human breast cancer.
MCF7: ErbB2 non-overexpressing strain derived from human breast cancer. ErbB2 expression is detected.
MDA-MB-231: ErbB2 non-overexpressing strain derived from human breast cancer. ErbB2 expression is detected.
MCF10A: Human fibrocystic mammary gland patient strain. ErbB2 expression is not detected.
Capan-1: ErbB2 overexpression strain derived from human pancreatic cancer.

I. Search for CCN2 cell membrane receptor and analysis of CCN2 signal transduction mechanism through the receptor
1. Materials and methods
(1) Reagents, etc. Baculovirus expression system Bac-to-Bac (Invitrogen) was used to prepare His-tagged recombinant human CCN2 (His-CCN2) and recombinant GST-fused human CCN2 (GST-CCN2). . FITC-labeled anti-ErbB2 antibody (Becton Dickinson), unlabeled anti-ErbB2 antibody (AbD Serotec), anti-PY877 ErbB2 antibody (Applied Biological Materials), anti-PY1248 ErbB2 antibody (Dakocytomation), anti-PY1221 / 1222 ErbB2 An antibody (Abcam) and an anti-Actin antibody (Sigma) were used. The crosslinking agent used was a thiol-cleavable crosslinking agent DSP (dithiobis [succinimidylpropionate]) (Pierce).

(2) Cell line Yeast cell line AH109 was purchased from Clontech. Human cell lines HeLa, MCF7, MCF10A, SkBr3 were purchased from the American Type Culture Collection (ATCC) and maintained under the conditions recommended by ATCC. Human chondrosarcoma-derived cell line HCS-2 / 8 (Cancer research. 1989, 49, 3996-4002) was maintained in DMEM containing 10% fetal calf serum (FCS). According to a conventional method, stable transformants of ErbB2 were prepared by transfecting HeLa cells with pSV2 erb B2 (RIKEN BioResource Center) (Nature. 1984, 309, 418-425) and pcDNA3.1 (Invitrogen). Two lines that stably express ErbB2 were obtained by selection (HeLa # 3 strain, HeLa # 5 strain). HeLa cells were transfected with only pcDNA3.1 and selected with G418 to obtain control mock transformants.

(3) Screening of cDNA library by yeast two-hybrid method Screening of yeast two-hybrid method has been reported (The Biochemical journal. (2009) 420, 413-420; FEBS letters. (2006) 580, 1376-1382; Nucleic (2008) 36, 3011-3024; The Journal of biological chemistry. (2006) 281, 14417-14428). Using cDNA synthesized from RNA derived from HCS-2 / 8 cells as a template, full-length CCN2 cDNA (NCBI Reference Sequence: NM_001901.2: SEQ ID NO: 4) excluding the signal peptide region was prepared by PCR (primer was atccgaattccagaactgcagcgggccgtgccggtgcccg (SEQ ID NO: 16 ) And atacggatccctcatgccatgtctccgtacatcttcctgt (SEQ ID NO: 17)), restriction enzyme EcoRI (NEB) and BamHI (NEB) -treated fragments were used as baits and inserted into the EcoRI and BamHI sites of the pGBKT7 vector (Clontech). With this construct, full-length CCN2 excluding the signal peptide region was expressed as a fusion protein with the GAL4 DNA binding domain (BD).

Two-hybrid screening was performed in yeast AH109 cells using full-length CCN2 in a selective medium lacking leucine, tryptophan, histidine and adenine. After incubation for 3 to 5 days, a plurality of positive clones were picked up, plasmid DNA was extracted, reintroduced into E. coli DH5α strain, plasmid DNA was purified from this E. coli, and DNA sequencing was performed.

To identify the CCN2-binding domain of ErbB2, a pGADT7 vector containing either a truncated ErbB2 or a cDNA picked up from a library, together with a pGBKT7 vector that expresses either full-length or truncated CCN2 in yeast strain AH109. Reintroduced. CCN2 fragment was inserted into pGBKT7 vector using EcoRI, BamHI (NEB). In addition, the ErbB2 fragment, which had been end-treated with SalI and XhoI (NEB), was inserted into the pGADT7 vector at the XhoI site. The DNA encoding the CCN2 fragment used was a cDNA synthesized from HCS-2 / 8 cell-derived RNA as a template and amplified by PCR using the primers shown in Table 1. The DNA encoding the ErbB2 fragment was pSV2perb して B2 (RIKEN BioResource Center) as a template and was amplified by PCR using the primers shown in Table 2.

(4) Binding of CCN2 to monolayer cultured cells Recombinant human CCN2 (rhCCN2) was iodinated with ¹²⁵ I using Iodo-Gen (Pierce) according to the manufacturer's instructions. For binding analysis, cells were seeded in 24-well plates at a density of 1 × 10 ⁵ cells / well 24 hours prior to binding experiments. Cells were washed twice at 4 ° C. with binding buffer (DMEM containing 0.2% bovine serum albumin and 0.2% sodium azide). Monolayer cells were incubated for 4 hours at 4 ° C. with gentle shaking in binding buffer containing various concentrations of ¹²⁵ I-rhCCN2. To examine nonspecific binding, duplicate wells were incubated with at least 100-fold excess of unlabeled rhCCN2. Cells were washed twice with phosphate buffered saline (PBS) and lysed with 0.3 M NaOH. Lysed fractions were counted with a Beckman Gamma 5500B counter.

(5) Preparation of crude membrane fraction A membrane fraction was prepared from HeLa cell # 5 strain overexpressing ErbB2 by transformation and mock transformant. Cells were cultured in a 150 mm diameter dish until confluent, and after collection, washed with Ca ion-free and Mg ion-free PBS. Subsequently, the cells were suspended in a suspension buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 0.25 M sucrose, 0.1 mM PMSF), and sonicated at high output for 1 minute × 3 times. Centrifugation was performed at 800 × g for 10 minutes to precipitate nuclei, the supernatant was collected, and further centrifuged at 12,000 × g for 20 minutes in order to remove residues at the time of cell disruption. The supernatant was further centrifuged at 105,000xg for 60 minutes to precipitate the cell membrane fraction, and the pellet was resuspended in 10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 0.1 mM PMSF, and the membrane fraction was recovered. It was. The protein concentration of this suspension was measured using BCA reagent (Pierce).

(6) Affinity labeling and cross-linking of monolayer cultured cells and membrane fractions Cells to be affinity labeled are washed twice with PBS, incubated with PBS containing 3 mM EDTA at 37 ° C for 10 minutes, and then washed twice with DMEM. And counted. Recombination of 1 x 10 ⁶ / tube cells in a binding buffer containing 20 mM MOPS, pH 7.5, 2 mM MgCl ₂ , 140 mM NaCl, 0.2% gelatin in the presence or absence of recombinant human CCN2 Incubated with human His-CCN2 (Biochemical and biophysical research communications. (1998) 251, 748-752) for 30 minutes at room temperature. In some experiments, aggrecan (Sigma) was added to the binding buffer at a final concentration of 20 ng / ml and incubated. DSP (dithiobis-succinimidyl propionate), a thiol-cleavable cross-linking agent, was added at a final concentration of 2.5 mM, incubated at 4 ° C. for 30 minutes, and then cooled glycine was added at a final concentration of 20 mM. Stopped. The cells were collected by centrifugation at 1,000 × g for 5 minutes, washed 3 times with chilled PBS, collected, and dissolved in SDS buffer containing 2-mercaptoethanol.

For affinity binding experiments using membrane fractions, assembled in buffer (20 mM Tris-HCl, pH8.0, 25 mM NaCl, 10% glycerol, 2 ng / ml aggrecan, 66μg / ml BSA, 1 mM PMSF) Membrane fraction was mixed with either recombinant human His-CCN2 or recombinant human GST-CCN2 and incubated at 4 ° C. for 30 minutes. After the DSP addition, the mixture was further incubated at 4 ° C. for 10 minutes. The complex containing CCN2 was precipitated using either Ni-agarose® (Qiagen) ® or glutathione® sepharose® 4B® (GE® Healthcare) ®, and Western blot analysis was performed on the precipitated protein.

(7) Immunofluorescent staining of extracellular protein The cells were fixed using 4% formaldehyde. The immunofluorescent staining of cells was performed in accordance with a previous report (J Cell Physiol. (2005) 202, 191-204; J Cell Physiol. (2003) 197, 94-102). The FITC-labeled anti-ErbB2 antibody recognizes the extracellular region of ErbB2. (Beckman) and anti-Flag antibody (Sigma) were used, followed by incubation with Alexa Fluor 488 goat anti-mouse IgG Ab (Molecular Probes). After mounting, protein localization was observed using a confocal laser scanning microscope (Bio-Rad).

2. Results
(1) Isolation of CCN2 cell membrane receptor and identification of binding domain Yeast two-hybrid method was performed for the purpose of searching for CCN2 cell membrane receptor. Co-expression of CCN2 protein full-length vector and cDNA library derived from human chondrosarcoma-derived cell line HCS-2 / 8 cells in yeast, allowing clones that interact with CCN2 protein to grow in selective media Sorted by As a result, clone # 26 encoding ErbB2, one of the EGF receptor families, was isolated. ErbB2 consists of two extracellular regions believed to be ligand binding domains, a transmembrane domain, and a C-terminal intracellular domain with tyrosine kinase activity and a putative phosphorylation site. Clone # 26 contained only one of the ligand binding domains, the transmembrane domain and the intracellular kinase domain (FIG. 1 (A)).

In order to identify the CCN2 binding region in ErbB2, a vector that expresses five types of ErbB2 fragments (Fig. 1 (A), # 1 to # 4, # 4rev) was separately prepared, and the ErbB2 fragment-GAL4 AD fusion protein and CCN2-GAL4 BD fusion protein was coexpressed in yeast AH109 cells, and the binding property between CCN2 and ErbB2 fragment was confirmed in yeast. As a result, the strongest binding was confirmed in ErbB2 fragment # 3 containing two ligand binding domains and ErbB2 fragment # 2 containing one ligand binding site (FIG. 1 (B)). Some binding to CCN2 was also confirmed in ErbB2 fragment # 1. No binding between the intracellular region of ErbB2 and CCN2 was observed.

To examine which domain of CCN2 binds to ErbB2, the full length of CCN2 and fragments A to I (Figure 2) were co-expressed in yeast cells together with ErbB2 fragment # 3 containing the extracellular ligand binding domain of ErbB2. It was. As a result, it was revealed that a fragment containing the VWC domain of CCN2 was strongly bound to ErbB2 fragment # 3 containing two ligand binding sites (FIG. 2). The C-terminal CT domain of CCN2 was also weak but had binding activity, but neither IGFBP domain nor TSP domain showed binding activity to ErbB2 (FIG. 2).

(2) Binding analysis between CCN2 and ErbB2-expressing cells A gene construct that expresses ErbB2 was introduced into HeLa cells in which ErbB2 expression was not detected, and two lines that highly express ErbB2 protein were obtained (HeLa # 3 strain and HeLa # 3 strain) # 5 shares).

Recombinant human CCN2 (Flag-CCN2-His) with a Flag tag and His tag added to a sample in which HeLa cell # 5 strain is fixed at a concentration of 100 ng / ml and incubated at 37 ° C. for 20 minutes, then anti-Flag Immunostaining was performed with antibody and anti-ErbB2 antibody. As a result, as shown in FIG. 3, Flag-CCN2-His was detected at the ErbB2 localization site, suggesting that CCN2 binds to ErbB2 localized in the cell membrane.

In order to investigate in more detail the binding between ErbB2 expressed on the cell surface and CCN2, a cell line (HeLa # 5) in which ErbB2 is ectopically expressed in HeLa cells is known to express ErbB2. The binding of ¹²⁵ I-labeled CCN2 was confirmed using an existing breast cancer cell line (MCF7) (Oncogene. (2010) 29, 6343-6356) and a cartilage-like cell line (HCS-2 / 8). In addition, binding affinity was examined by competitive binding assay using unlabeled CCN2. Although binding to the control HeLa cells was not detected, the binding of CCN2 to HeLa # 5 increased greatly in a concentration-dependent manner, and the Kd value determined by the competitive assay was 0.8 x 10 ^-9 M, indicating an affinity. It was confirmed to be high (FIG. 4A). Similarly, in the breast cancer cell MCF7 expressing ErbB2, strong binding of CCN2 to the cell surface was confirmed in contrast to the cell line MCF10A derived from a fibrocystic mammary gland patient not expressing ErbB2 (FIG. 4B). , Kd = 2.19 x 10 ^-9 M). CCN2 binding to the cell surface was also confirmed in the chondrocyte cell line HCS-2 / 8 (FIG. 4C, Kd = 0.19 × 10 ⁻⁹ M).

(3) Induction of ErbB2 autophosphorylation by CCN2 and promotion of autophosphorylation in the presence of aggrecan In order to confirm that CCN2 functions as a specific ligand for ErbB2, CCN2 was used using an anti-phosphotyrosine antibody. The ability to induce ErbB2 autophosphorylation after addition was examined. First, when examined in the HeLa cell # 5 strain, strong phosphorylation was confirmed in the 1248th Y (Y1248) of ErbB2, and phosphorylation was also confirmed in Y1221 / 1222 and Y877 (FIG. 5). The ability to induce ErbB2 autophosphorylation was also investigated in the breast cancer cell line SKBr3 (Oncogene. (2010) 29, 6343-6356) that highly expresses ErbB2. 10 minutes later, this effect was confirmed until 160 minutes after the observed addition of CCN2 (FIG. 6A). Furthermore, it was revealed that the ability of CCN2 to promote ErbB2 autophosphorylation is further enhanced by adding aggrecan, which is known to promote CCN2 expression in chondrocytes, to the culture medium before CCN2. (FIG. 6B), suggesting that the presence of aggrecan can increase the effective cell surface concentration of CCN2. These data suggest that CCN2 activates an ErbB2-mediated signaling pathway in tumor cells.

(4) Detection of CCN2-ErbB2 complex by cross-linking method and affinity co-immunoprecipitation Since the binding of CCN2 and ErbB2 was expected to be transient, a cross-linking agent was used to detect the complex of CCN2 and ErbB2. . Incubate cell suspension of ErbB2-expressing HeLa cell # 5 and ErbB2 non-expressing HeLa cell with recombinant human His-CCN2, and add thiol-cleavable cross-linker DSP to this to combine complexed CCN2-ErbB2 Were crosslinked. The cells were collected by centrifugation and lysed, and then the protein of the lysate was separated by SDS-polyacrylamide electrophoresis (SDS-PAGE), and the bound CCN2 was detected with an anti-His antibody. As a result, although not detected in mock cells, CCN2 was detected in HeLa cell # 5 strain overexpressing ErbB2 (FIG. 7A, arrowhead). The amount of CCN2 bound to HeLa cells was increased by aggrecan in a concentration-dependent manner (FIG. 7B). Competitive cross-linking with untagged recombinant human CCN2 confirmed competition with recombinant human His-CCN2 (FIG. 7B). In addition, the HeLa cell # 5 strain that overexpresses ErbB2 and the HeLa cell that does not express ErbB2 are homogenized and centrifuged to prepare a crude membrane fraction, which is then incubated with recombinant human His-CCN2 for affinity crosslinking assay. Was done. After the cross-linking reaction, the protein was pulled down with an ErbB2-specific antibody, and Western blotting was performed using an antibody against His. As a result, His-CCN2 pulled down together with ErbB2 was detected (FIG. 7C). These results indicate that CCN2 binds to ErbB2 on the cell surface and triggers ErbB2 signaling by tyrosine phosphorylation of the ErbB2 receptor.

(5) Changes in gene expression in breast cancer cells by addition of CCN2 MCF7 cells expressing ErbB2 and MCF10A cells in which ErbB2 expression is not detected were incubated with recombinant human CCN2 (rhCCN2, 50 ng / ml) at 37 ° C. for 72 hours, The expression levels of CCN2 gene, taz (transcriptional coactivator with PDZ-binding motif) gene, and tead4 (TAE domain family member 4) gene were examined by real-time PCR. Using the expression level of the gapdh (glyceraldehyde-3-phosphate dehydrogenase) gene as an internal standard, the expression level was relatively evaluated. The results are shown in FIG. In MCF7 cells, increased expression of CCN2 gene and taz gene was confirmed by addition of CCN2 to the medium. When rhCCN2 was added to the medium together with ER2B phosphorylation inhibitor GW2974 (Sigma), the increased expression of CCN2 gene and taz gene by rhCCN2 disappeared. tead4 encodes a transcription factor that interacts with the taz protein and is involved in the Hippo-LATS signal pathway, but no change in the expression level due to CCN2 treatment was confirmed. In MCF10A cells in which ErbB2 was not detected, no change was observed in the expression levels of the three genes even after CCN2 treatment (FIG. 8B).

II. Suppression of cancer cell growth
1. Material
(1) Cancer cell line Human breast cancer-derived cell lines SkBr3, MCF7 and MDA-MB-231, and human pancreatic cancer-derived cell line Capan-1 were purchased from ATCC (American Type Culture Collection). Maintained under ATCC recommended conditions.

(2) A gene encoding recombinant human protein full-length human CCN2 (aa 1-349; Swiss-Prot P29279; SEQ ID NO: 4) is inserted into pCEP vector (Invitrogen), and the constructed expression vector is inserted into HEK293 cells. It was introduced using lipofectamine ™ (Invitrogen), and stable expression strains were selected by adding Hygromycin B (Invitrogen) to the medium. CCN2 protein was obtained by culturing cells in serum-free DMEM medium and combining three purification methods from the culture supernatant. First, heparin-binding protein was purified by heparin sepharose, and then purified by BMP2 affinity chromatography and S200 molecular sieve chromatography to obtain recombinant human CCN2 protein. (Reference: FEBS Letters 468 (2000) 215-219, Nat Cell Biol. 2002 August; 4 (8): 599-604. Molecular Vision 2011; 17: 53-62)

As the His-tagged ErbB2 extracellular region, the region of amino acids 23 to 650 of ErbB2 (SEQ ID NO: 2) was used. A recombinant baculovirus for expression of the extracellular region was prepared using a Bac-to-Bac baculovirus expression system (Invitrogen). First, an extracellular ErbB2 domain amplified using pSV2 erbpB2 (RIKEN BioResource Center) as a template and the primers shown in Table 3 below was incorporated into the XbaI and XhoI sites of the pFASTBAC HTB vector to construct an expression vector. Recombinant baculovirus particles were prepared by preparing recombinant Bacmid in E. coli DH10Bac and transfecting sf9 insect cells. Sf9 cultured cells were infected with this recombinant baculovirus to express recombinant ErbB2 protein, and purified using Ni-agarose (GE Healthcare).

The recombinant human VWC fragment was prepared by a well-known genetic engineering technique. Amplification of human CCN2 VWC domain cDNA (positions 513 to 704 of SEQ ID NO: 3) by PCR using the primers synthesized in Table 4 below, using cDNA synthesized from RNA derived from HCS-2 / 8 cells as a template After treatment with BamHI (Takara Bio) and XhoI (Takara Bio), the fragment was inserted into the BamHI and XhoI sites of pGEX-6P-1 vector (GE （Healthcare). This construct is introduced into E. coli BL21 (DE3) pLysS (Novagen), expressed in E. coli as a GST fusion protein, bound to Glutathione Sepharose 4B (GE Healthcare), LPS (lipopolysaccharide) removal treatment, PreScission Protease The GST part was cut and removed using (GE Healthcare).

Biotinylated CCN2 was prepared according to the reagent manual using biotinylated reagent EZ-Link® NHS-PEG4-Biotin (Thermo Fisher Scientific).

(3) Synthetic peptides In order to search for VWC peptides that inhibit the binding of ErbB2 and CCN2, peptides synthesized by fragmenting the VWC domain of CCN2 were chemically synthesized (Fig. 9 and Table 5, VWC peptides # 2-4). .

Similarly, in order to search for ErbB2 peptides that inhibit the binding between ErbB2 and CCN2, a peptide that was further fragmented in the ligand binding predicted site in the extracellular region of ErbB2 that was confirmed to bind CCN2 more strongly was chemically (Figure 9 and Table 5, ErbB2 peptides 1-6).

Table 5 shows the composition of the solvent for each peptide.

2. Methods and results
(1) Cancer cell growth promoting action of CCN2 and cancer cell growth inhibitory action by anti-CCN2-VWC domain antibody [Method]
In order to search for an antibody that suppresses CCN2 activity, a monoclonal antibody of CCN2 was prepared. Using a recombinant human CCN2 protein excluding the signal peptide as an immunogen, mice are immunized, and a hybridoma that produces monoclonal antibodies is prepared by a conventional hybridoma method.An antibody that specifically binds CCN2 based on its binding properties to CCN2 Producing clones were selected. As a result, two clones (11H3 and 101C10) that recognize the VWC domain were obtained. As a result of epitope analysis using the VWC peptide shown in Table 5, it was confirmed that 11H3 binds to VWC peptide # 2, and 101C10 binds to VWC peptide # 4, and each antibody has an epitope in each of these peptide regions. confirmed.

SkBr3 cells were seeded on a 96-well plate at 5 × 10 ⁵ cells / well and cultured for 3 hours to allow the cells to settle. Thereafter, the serum-free medium was replaced with 200 μl, and recombinant human CCN2 was added to a final concentration of 12.5, 25, 50 ng / ml. The anti-CCN2-VWC domain antibody (11H3, 1 mg / ml) prepared above was added at 2 μl / well, and after 48 hours, Tetra Color One (Seikagaku Biobusiness Co., Ltd.) was added, and the absorbance of the formed formazan salt was measured. The number of viable cells was evaluated by measuring by a conventional method.

In addition, MCF7 cells were seeded at 1 × 10 ⁴ cells / well in a 96 well plate and cultured for 24 hours to allow the cells to settle. Thereafter, recombinant human CCN2 was added to a final concentration of 6.25, 12.5, 25, 50, 100 ng / ml. The anti-CCN2-VWC domain antibody prepared above (11H3 or 101C10, 1 mg / ml) was added at 2 μl / well, and after 46 hours, BrdU was added and further cultured for 2 hours. Thereafter, BrdU incorporated into the cells was evaluated by absorbance at 655 nm using a BrdU cell proliferation assay kit (Roche). Specifically, BrdU incorporated into cell DNA was reacted with a peroxidase-labeled anti-BrdU antibody, followed by color development using a peroxidase substrate (TMB: tetramethylbenzidine), and the absorbance (wavelength 655 nm) was measured with an ELISA reader.

[result]
The results in SkBr3 cells are shown in FIG. 10A, and the results in MCF7 cells are shown in FIG. 10B. By adding recombinant CCN2 to the culture medium of SkBr3 cells and MCF7 cells expressing ErbB2, cell growth was promoted in a concentration-dependent manner. Furthermore, cell proliferation was suppressed by adding an anti-CCN2-VWC domain antibody having a VWC domain as an epitope.

(2) Cancer cell growth inhibitory effect (antagonist) of recombinant human VWC fragment and synthetic VWC peptide
[Method]
Cell Proliferation Assay As cancer cells, human breast cancer-derived cell lines MCF7, MDA-MB-231 and SkBr3, and human pancreatic cancer-derived cell line Capan-1 were used. The cells were suspended in 100 μl of medium (with 10% fetal bovine serum) at 1 × 10 ⁴ cells / well and seeded in a 96 well plate. After 3 hours, confirm cell bottoming, and add 100 μl serum-free medium to growth factor (recombinant human CCN2) solution or growth inhibitory factor (recombinant human VWC fragment, synthetic VWC peptide) twice the final concentration. The solution was added. According to the manual of BrdU cell proliferation assay kit (Roche), the cells were cultured at 37 ° C. for 24 hours. BrdU was incorporated into the cells 2 hours before the end of the culture, and the incorporated BrdU was measured by absorbance at 655 nm.

[result]
Recombinant human CCN2 promoted proliferation of MCF7 cells (FIG. 11A). Furthermore, the addition of recombinant human VWC fragment (final concentration 1.85 μg / ml) to the culture solution strongly suppressed the growth promoting effect of recombinant human CCN2 (FIG. 11A). This suggests that the recombinant human VWC fragment acts as an ErbB2 antagonist that antagonizes CCN2 for interaction with ErbB2.

In order to measure the effect of synthetic VWC peptide on the proliferation of breast cancer cells, the effect of synthetic

VWC peptide #

2, 3, 4 on cell proliferation was examined in MDA-MB-231 cells. A synthetic peptide was added to MDA-MB-231 cells under the condition that CCN2 was not added to the medium, and cell proliferation was examined by BrdU incorporation as described above. As a result, the synthetic VWC peptide # 4 suppressed the growth of MDA-MB-231 cells compared to the control in which the solvent was added instead of the peptide (FIG. 11B). It was suggested that the synthetic VWC peptide # 4 acts as an ErbB2 antagonist that antagonizes CCN2 for interaction with ErbB2.

In order to measure the effect of recombinant human VWC fragment on the proliferation of breast cancer cells, experiments were performed using MCF7 cells and SkBr3 cells. Recombinant human VWC fragment was added to the cells under conditions where CCN2 was not added to the medium, and cell proliferation was examined by BrdU incorporation as described above. As a result, the recombinant human VWC fragment suppressed the growth of MCF7 cells and SkBr3 cells as compared to the control solvent (FIG. 11C, D). It was suggested that the recombinant human VWC fragment acts as an antagonist of ErbB2 that antagonizes CCN2 for interaction with ErbB2.

In order to measure the influence of the recombinant human VWC fragment on the growth of cancer cells other than breast cancer, experiments were performed using Capan-1 cells derived from pancreatic cancer. Recombinant human VWC fragment was added to the cells under conditions where CCN2 was not added to the medium, and cell proliferation was examined by BrdU incorporation as described above. As a result, suppression of cell proliferation by the recombinant human VWC fragment was also confirmed in pancreatic cancer cell Capan-1 (FIG. 11E).

In order to further narrow down the region of the CCN2 VWC region that is important for cancer cell growth inhibition, a 10-residue peptide was prepared from the synthetic VWC peptide # 4 region as shown in Table 6 below, and MCF7 cells were used. The experiment was conducted. Each peptide was added to MCF7 cells under the condition that CCN2 was not added to the medium, and cell proliferation was examined by BrdU incorporation as described above. For comparison, a peptide B-6 consisting of the aa121-141 region and a peptide B-7 consisting of the aa142-166 region were also prepared and the experiment was performed in the same manner.

The results are shown in FIGS. It was confirmed that peptide V-3 has a growth inhibitory effect.

(3) Specific binding between ErbB2 extracellular region and CCN2 [Method]
In order to examine whether the peptide fragment corresponding to the ligand binding site in ErbB2 extracellular region (ErbB2 peptide 1-6, FIG. 9) inhibits the binding between recombinant human CCN2 and His-tagged ErbB2 extracellular region, 96 100 μl / well of His-tagged ErbB2 extracellular region (0.1 μg / ml) prepared in 0.05 M sodium carbonate buffer (pH 9.6) was added to a well plate and coated at 4 ° C. for 16 hours. After removing the coating solution, the wells were blocked in 200 μl / well of binding buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 2% BSA, 0.05% Tween20) at 37 ° C. for 3 hours. After washing once with binding buffer, biotinylated CCN2 and each ErbB2 peptide (1-6, FIG. 9) prepared to 100 μl per well were added at respective concentrations and incubated at 37 ° C. for 6 hours. Thereafter, the wells were washed three times with 300 μl / well of binding buffer, and then 100 μl / well of streptavidin-HRP (R & D System) diluted 200-fold with binding buffer was added and incubated at room temperature for 20 minutes. The wells were washed 3 times with 300 μl / well of binding buffer, then 100 μl / well of a color reagent of TMB Peroxidase Substrate kit (Bio-Rad) was added, incubated at 37 ° C., and the absorbance at 655 nm was measured.

Also, the binding between recombinant human CCN2 and recombinant ErbB2 extracellular region was monitored using a surface plasmon resonance (SPR) BiacoreX system (GE Healthcare). 1.8 μg of the recombinant ErbB2 protein was immobilized on the sensor chip C1 by amino coupling as a ligand so that the resonance unit (RU) was 5000-7000, and each concentration of CCN2 solution was added as an analyte. In the binding experiment, 0.15 M NaCl, 0.01 M HEPES, 0.005% Surfactant P20 (GE Healthcare) was used as a solvent, and the chip was regenerated with 0.01 M HCl. Kd value was calculated using BIA evaluation software version 3.0.

[result]
Biotinylated CCN2 bound to the His-tagged ErbB2 extracellular region coated on the plate in a concentration-dependent manner with biotinylated CCN2 (FIG. 13A). Furthermore, when the concentration of biotinylated CCN2 was kept constant and the His-tagged ErbB2 extracellular region was added, binding of biotinylated CCN2 was inhibited in a concentration-dependent manner in the His-tagged ErbB2 extracellular region (FIG. 13B). It was revealed that the binding between them was specific. FIG. 13C shows the result of monitoring the binding between ErbB2 extracellular region and CCN2 using a BIACORE SPR sensor.

Each peptide was added at a different concentration in order to examine whether or not the peptide fragments 1 to 6 corresponding to the ligand binding predicted region of ErbB2 inhibit the binding between ErbB2 and CCN2. As a result, the binding inhibitory action was particularly strong in ErbB2 peptide 5, and a strong binding inhibitory action comparable to that of the His-tagged ErbB2 extracellular region was confirmed (FIG. 13D). From this, the region of ErbB2 peptide 5 is important for the binding of ErbB2 and CCN2, and the use of this peptide was expected to inhibit the binding of CCN2 and ErbB2 and suppress the growth of cancer cells. .

(4) Growth inhibition of MDA-MB-231 cells by inhibiting binding of ErbB2 extracellular domain and CCN2 by ErbB2 ligand binding domain peptide [Method]
In order to examine whether the synthesized ErbB2 peptides 1 to 6 (FIG. 9) inhibit the growth of cancer cells, a cell proliferation assay similar to that of II 2 (2) was performed using MDA-MB-231 cells. . ErbB2 peptide was added to cells cultured in a 96-well plate, and cell proliferation was measured using a BrdU cell proliferation assay kit (Roche).

[result]
It was revealed that

ErbB2 peptides

4 and 5 inhibit cell growth compared to the solvent control group (FIG. 14). This indicates that

ErbB2 peptides

4 and 5 inhibit the growth of cancer cells.

(5) Cell death induction effect of MCF7 cells by simultaneous addition of recombinant human VWC fragment and taxol

[Method]
Trypan blue dye exclusion test (Dye-exclusion test)
MCF7 cells are seeded in a 24-well plate suspended in 400 μl medium at 1 × 10 ⁵ cells / well, and 16 hours later, recombinant human VWC fragment (final concentration 0.18 μg / ml, 26 nM) and anti-cancer Taxol (CellSignaling) (final concentration: 85 pg / ml, 0.1 nM), an agent, was diluted in 600 μl medium and added. Taxol was added to the medium after dissolving 1 mg in 1.15 ml DMSO and adding 1 mM according to CellSignaling protocol. After culturing for 48 hours, the cells floating from the culture supernatant were collected and the adhered cells were collected after trypsin treatment, and the number of live and dead cells was measured by trypan blue staining for each collected cell.
[result]
The effects of combined addition of recombinant human VWC fragment and taxol on the induction of breast cancer cell death were investigated. As a result, by adding the recombinant human VWC fragment (26 nM) in combination with the addition of low-concentration taxol (0.1 nM), a higher induction effect of cell death was observed compared with the addition of taxol alone (FIG. 15). As shown in FIG. 11A, the recombinant human VWC fragment does not show the effect of suppressing cell proliferation induced by CCN2 alone at a treatment concentration of 26 nM. Therefore, the combined effect of taxol and recombinant human VWC fragment is synergistic.

Reference data: Search for binding domain of full-length CCN2 and CCN3 by yeast two-hybrid method Vector encoding CCN2 expressed as a fusion with GAL4 DNA binding domain (BD) in yeast AH109 strain and GAL4 DNA activation domain A vector encoding each domain of CCN3 expressed as a fusion with (AD) was co-introduced, and the presence or absence of binding of both factors was examined from auxotrophy. As a result, it became clear that CCN2 and CCN3 show binding activity in the VWC and CT domains (FIG. 16A).

The binding between biotinylated CCN2 and GST-CCN3 was examined. 50 μg of GST-CCN3 or GST was immobilized on a 96-well plate, and biotinylated CCN2 was added at a concentration of 0 to 3 μg / mL. After washing, biotin-CCN2 bound to the plate was labeled with avidin-HRP and developed with TMB. As a result, as shown in FIG. 16B, CCN2 bound to CCN3 in a concentration-dependent manner.

Claims

An agent for treating or preventing cancer comprising a substance that inhibits the interaction between CCN2 and ErbB2 as an active ingredient.
The therapeutic or prophylactic agent according to claim 1, wherein the interaction is an interaction between the VWC domain of CCN2 and the REC domain of ErbB2.
The therapeutic or prophylactic agent according to claim 2, wherein the interaction is an interaction between the VWC domain of CCN2 and the REC domain on the membrane proximal side of ErbB2.
The therapeutic or prophylactic agent according to claim 3, wherein the interaction is an interaction between the region of amino acids 121 to 145 of CCN2 and the region of amino acids 436 to 465 of ErbB2.
The substance is
(1) a substance that inhibits the interaction between CCN2 and ErbB2 by binding to the extracellular region of ErbB2, and
(2) The substance according to any one of claims 1 to 4, which is at least one selected from substances that inhibit the interaction between CCN2 and ErbB2 by binding to or near the VWC domain of CCN2. Treatment or prevention agent.
The substance (1) is a substance that binds to at least one of the ErbB2 REC domain (regions 52 to 173 amino acids and regions 366 to 486 amino acids in SEQ ID NO: 2). The therapeutic or prophylactic agent according to claim 5.
The therapeutic or prophylactic agent according to claim 6, wherein the substance (1) is a substance that binds to the REC domain on the membrane proximal side of ErbB2 (region of amino acids 366 to 486 of SEQ ID NO: 2).
The therapeutic or prophylactic agent according to claim 6, wherein the substance (1) is at least one selected from an ErbB2 antagonist, an anti-ErbB2-REC domain antibody and an antigen-binding fragment thereof.
The therapeutic or prophylactic agent according to claim 8, wherein the ErbB2 antagonist is a variant of CCN2 protein.
A CCN2 protein variant is a polypeptide comprising 7 or more consecutive residues in the amino acid sequence of CCN2 VWC domain shown in SEQ ID NO: 5, or a polypeptide comprising an amino acid sequence having 90% or more identity to the polypeptide The therapeutic or prophylactic agent according to claim 9, which is a polypeptide having an action of suppressing the growth of cancer cells.
The therapeutic or prophylactic agent according to claim 10, wherein the variant of CCN2 protein is a polypeptide consisting of 7 or more consecutive residues in the amino acid sequence of CCN2 VWC domain shown in SEQ ID NO: 5.
The therapeutic or prophylactic agent according to claim 11, wherein the modified CCN2 protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5.
The therapeutic or prophylactic agent according to claim 11, wherein the variant of CCN2 protein is a polypeptide consisting of 7 or more consecutive residues in the amino acid sequence shown in SEQ ID NO: 8.
The therapeutic or prophylactic agent according to claim 13, wherein the polypeptide comprises 7 or more consecutive residues in the region of amino acids 11 to 20 in the amino acid sequence shown in SEQ ID NO: 8.
The therapeutic or prophylactic agent according to claim 13, wherein the variant of CCN2 protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 8.
The therapeutic or prophylactic agent according to claim 13, wherein the variant of CCN2 protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 38.
The therapeutic or prophylactic agent according to claim 5, wherein the substance (2) is a substance that binds to the VWC domain of CCN2.
The substance (2) is an anti-CCN2-VWC domain antibody and an antigen-binding fragment thereof; ErbB2 extracellular region (SEQ ID NO: 9), a partial fragment comprising 7 residues or more, and any of these and 90% or more A polypeptide having identity and inhibiting cancer cell growth; and selected from the group consisting of CCN3, DECORIN, BMP (bone morphogenetic protein), and these fragments capable of binding to the CCW2 VWC domain 6. The therapeutic or prophylactic agent according to claim 5, which is at least one kind.
The therapeutic or prophylactic agent according to claim 18, wherein the partial fragment of the ErbB2 extracellular region is a polypeptide consisting of 7 or more consecutive residues in the amino acid sequence shown in SEQ ID NO: 14.
The therapeutic or prophylactic agent according to claim 19, wherein the partial fragment of the ErbB2 extracellular region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14.
19. The anti-CCN2-VWC domain antibody and an antigen-binding fragment thereof are an antibody having an epitope in the region of amino acids 121 to 166 of CCN2 (SEQ ID NO: 4) or an antigen-binding fragment thereof. Treatment or prevention agent.
An antibody in which an anti-CCN2-VWC domain antibody and an antigen-binding fragment thereof have an epitope in the region of amino acids 121 to 145 of CCN2 (SEQ ID NO: 4) or in the region of amino acids 146 to 166 Or the therapeutic or prophylactic agent of Claim 21 which is an antigen binding fragment.
The therapeutic or prophylactic agent according to any one of claims 1 to 22, which is a therapeutic or prophylactic agent for cancer that expresses ErbB2.
The therapeutic or prophylactic agent according to claim 23, wherein the cancer is breast cancer, stomach cancer, pancreatic cancer, lung cancer, colon cancer, or bladder cancer.
The therapeutic or prophylactic agent according to claim 24, wherein the cancer is breast cancer or pancreatic cancer.
A screening method for a therapeutic or prophylactic agent for cancer, comprising selecting a compound using inhibition of interaction between CCN2 and ErbB2 as an index.
The method according to claim 26, wherein inhibition of direct binding between CCN2 and ErbB2 is used as an index.
28. The method according to claim 26 or 27, wherein the cancer expresses ErbB2.
The method according to claim 28, wherein the cancer is breast cancer, stomach cancer, pancreatic cancer, lung cancer, colon cancer, or bladder cancer.
30. The method of claim 29, wherein the cancer is breast cancer or pancreatic cancer.
A cancer therapeutic or prophylactic agent obtained by the screening method according to any one of claims 26 to 30.
A cancer cell detection reagent comprising any of the following polypeptides:
(a) A polypeptide comprising the amino acid sequence shown in SEQ ID NO: 4.
(b) a polypeptide consisting of a partial region in the amino acid sequence shown in SEQ ID NO: 4, comprising 7 or more consecutive residues in the region of amino acids 103 to 166 and directly to the ErbB2 extracellular region Or a polypeptide that binds indirectly.
(c) A polypeptide comprising an amino acid sequence having 90% or more identity with (a) or (b) and directly or indirectly binding to the ErbB2 extracellular region.
(d) A polypeptide comprising the amino acid sequence of the polypeptides (a) to (c).
The reagent according to claim 32, wherein the polypeptide (c) comprises an amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added in the polypeptide (a) or (b).
A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 4, or a polypeptide consisting of a partial region in the amino acid sequence shown in SEQ ID NO: 4, wherein 7 or more consecutive residues in the region of amino acids 103 to 166 33. The reagent of claim 32, comprising a polypeptide comprising
A polypeptide comprising the amino acid sequence shown in SEQ ID NO: 4, or a polypeptide consisting of a partial region in the amino acid sequence shown in SEQ ID NO: 4, comprising a polypeptide comprising the region of the 103rd to 166th amino acids Item 34. The reagent according to Item 34.
36. The reagent according to any one of claims 32 to 35, wherein the polypeptide is in a labeled form.
37. The reagent according to any one of claims 32 to 36, which is a detection reagent for ErbB2-expressing cancer cells.
An agent for treating or preventing cancer, comprising as an active ingredient a substance that inhibits the interaction between CCN2 and ErbB2, and used in combination with an anticancer agent that induces apoptosis.
The therapeutic or prophylactic agent according to claim 38, wherein the anticancer agent that induces apoptosis is an anticancer agent that inhibits mitosis.
40. The therapeutic or prophylactic agent according to claim 39, wherein the anticancer agent that inhibits mitosis is a taxane anticancer agent.
The therapeutic or prophylactic agent according to claim 40, wherein the taxane anticancer agent is at least one selected from the group consisting of paclitaxel and docetaxel.
The therapeutic or prophylactic agent according to claim 41, wherein the taxane anticancer agent is paclitaxel.
43. The therapeutic or prophylactic agent according to any one of claims 38 to 42, wherein the anticancer agent is administered simultaneously, sequentially or separately with the therapeutic or prophylactic agent.
44. The therapeutic or prophylactic agent according to any one of claims 38 to 43, which is a therapeutic or prophylactic agent for cancer resistant to the anticancer agent.
Enhancer of anticancer activity of an anticancer agent that induces apoptosis, comprising as an active ingredient a substance that inhibits the interaction between CCN2 and ErbB2.
A method for treating or preventing cancer, comprising administering to a subject in need thereof an effective amount of a substance that inhibits the interaction between CCN2 and ErbB2.
A method for detecting cancer cells, comprising a step of bringing the detection reagent according to any one of claims 32 to 37 into contact with a target cell, and a step of detecting the presence of a cell to which the polypeptide is bound.
48. The detection method according to claim 47, wherein the target cell is a sample containing cells separated from the target.
Treatment of cancer comprising administering to a subject in need thereof an effective amount of a substance that inhibits the interaction between CCN2 and ErbB2 and an effective amount of an anticancer agent that induces apoptosis Or prevention method.
A method for enhancing the anticancer activity of the anticancer agent, comprising administering an effective amount of a substance that inhibits the interaction between CCN2 and ErbB2 to a subject in need thereof.