WO2007058235A1 - Proteine de fusion et utilisation de celle-ci dans des applications pharmaceutiques - Google Patents

Proteine de fusion et utilisation de celle-ci dans des applications pharmaceutiques Download PDF

Info

Publication number
WO2007058235A1
WO2007058235A1 PCT/JP2006/322818 JP2006322818W WO2007058235A1 WO 2007058235 A1 WO2007058235 A1 WO 2007058235A1 JP 2006322818 W JP2006322818 W JP 2006322818W WO 2007058235 A1 WO2007058235 A1 WO 2007058235A1
Authority
WO
WIPO (PCT)
Prior art keywords
antigen
disease
protein
presenting cell
fusion protein
Prior art date
Application number
PCT/JP2006/322818
Other languages
English (en)
Japanese (ja)
Inventor
Kohji Egawa
Katsuo Noguchi
Eri Kuwada
Original Assignee
Medinet Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medinet Co., Ltd. filed Critical Medinet Co., Ltd.
Priority to JP2007545275A priority Critical patent/JPWO2007058235A1/ja
Publication of WO2007058235A1 publication Critical patent/WO2007058235A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4615—Dendritic cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/462—Cellular immunotherapy characterized by the effect or the function of the cells
    • A61K39/4622—Antigen presenting cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464454—Enzymes
    • A61K39/464456—Tyrosinase or tyrosinase related proteinases [TRP-1 or TRP-2]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464496—Fusion proteins originating from gene translocation in cancer cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/464838—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • A61K2239/57—Skin; melanoma
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/95—Fusion polypeptide containing a motif/fusion for degradation (ubiquitin fusions, PEST sequence)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the present invention relates to a fusion protein, an expression plasmid for expressing the fusion protein, a medicine using the fusion protein, a therapeutic method using the fusion protein, and an antigen-presenting cell using the fusion protein. It relates to processing methods.
  • Immune cell therapy is a treatment method in which the patient's own immune cells, particularly white blood cells, are extracted and activated, and then returned to the patient to artificially strengthen their immunity. Since the patient's own cells are used, there is an advantage that there are significantly fewer side effects than conventional anticancer drug treatment.
  • CTL Cytotoxic T Lymphocyte
  • this rod-like cell vaccine therapy is performed by DCs that take in disease antigens, etc. and process them, and then present them as antigens, for example, cancer antigen proteins or peptides, or infectious disease antigen proteins.
  • peptides can be processed directly or intracellularly, and then a portion of the peptide can be transformed into a major histocompatibility antigen (Maior Histcompatibility A ntigen: MHC antigen, in the case of humans, human leukocyte antigen (HLA) DC is used as a vaccine, and it is administered as a vaccine to selectively attack abnormal cells in the body. It is a therapy that induces CTL and treats it (for example, Non-Patent Document 1, Non-Patent Document 2).
  • HLA human leukocyte antigen
  • DC vaccine can induce disease-specific CTLs, its therapeutic effect is particularly promising among immune cells.
  • the cancer cell extract also has the ability of a cancer antigen protein mixed in a trace amount with a large excess of normal protein.
  • the protein itself is very small and cannot be used. Therefore, the cancer antigen itself is sufficient
  • antigen cannot be taken up by DC and antigen presentation is insufficient.
  • protein uptake is due to phagocytosis, so it essentially goes to the presentation pathway to class II, and antigen presentation to CD8 positive (killer) T cells and CTL from class I. There is a problem of being unable to do enough.
  • Still another method includes a method in which an antigen peptide derived from an antigen protein is directly bound to an MHC antigen of an antigen-presenting cell (for example, Non-Patent Document 3, Non-Patent Document 4, Non-Patent Document 5). ).
  • CTL can be induced by entering a signal into the class I pathway by using a peptide containing an epitope capable of directly binding to an MHC antigen expressed on the surface of a target cell.
  • there are very few antigens whose sequences of such epitopes are known at present, and in the case of humans, for example, they bind to specific HLA such as class I A2 and A24.
  • the antigenic peptide to be identified Since only the antigenic peptide to be identified has been identified, it cannot be used for other types of HLA and is restricted to a specific HLA, so that it can be used only for a specific patient. In this case, since class II cannot be used, the CD4 positive (helper) T cell function cannot be used this time.
  • Non-Patent Document 1 Blood, 2004, 103, 383-389
  • Non-Patent Document 2 Proc. Natl. Acad. Sci. U S A. 2001, 98, 8809-8814
  • Non-Patent Document 3 Exp. Med., 1997; 185: 453-459
  • Non-Patent Document 4 Immunol., 2003; 171: 4893-4897
  • Non-Patent Document 5 J. Immunother Emphasis Tumor Immunol., 1995; 18:86 -94
  • Non-Patent Document 6 Prostate, 1995; 27: 63—69
  • Non-Patent Document 7 Prostate, 1996; 28: 65-69
  • Non-Patent Document 8 Nat. Med., 1998; 4: 328—332
  • the present invention has been made in view of the above circumstances, and presents a fusion protein for efficiently presenting an antigen and inducing CTL, a plasmid expressing the same, and use of the fusion protein It is an issue to provide.
  • the present inventors have used ubiquitin, a cytoplasmic uptake receptor ligand, and a fusion protein comprising a disease antigen protein, which have not been reported so far, for antigen presentation by antigen-presenting cells. This led to the idea of using it, and the present invention was completed. That is, the present invention relates to the following inventions (1) to (89).
  • a fusion protein comprising ubiquitin, a disease antigen protein, and a ligand for a cytoplasmic uptake receptor
  • a fusion protein expression plasmid comprising a cDNA sequence encoding ubiquitin, a cDNA sequence encoding a disease antigen protein, and a cDNA sequence encoding a ligand for a cytoplasmic uptake receptor;
  • the expression plasmid is a fusion protein in which the C-terminal side of ubiquitin binds to the N-terminal side of the disease antigen protein, and the C-terminal side of the disease antigen protein and the N-terminal side of the ligand of the cytoplasmic uptake receptor bind to each other.
  • the cDNA sequence encoding the ligand encodes an amino acid containing KDEL.
  • the expression plasmid according to any one of (17) to (21) above;
  • the fusion protein is brought into contact with the antigen-presenting cell to present any epitope of the disease antigen protein as an antigen, and the disease antigen protein-specific cytotoxic T cell is induced against the disease antigen protein to prevent or prevent the disease.
  • Antigen-presenting cells present an arbitrary epitope of the disease antigen protein by the major histocompatibility antigen class I pathway to induce disease antigen-specific CD8-positive T cells to prevent or treat disease
  • a method for processing an antigen-presenting cell which comprises contacting any of the epitopes of a disease antigen with an antigen in vitro or in vivo;
  • a method for preventing or treating a disease comprising administering the fusion protein according to any one of (1) to (14) above to a mammal including a human;
  • the fusion protein contacts antigen-presenting cells to present any epitope of the disease antigen protein as an antigen, and against the disease antigen protein, the disease antigen protein-specific cytotoxic ⁇ cells
  • Antigen-presenting cells present an arbitrary epitope of disease antigen protein by major histocompatibility antigen class I pathway to induce disease antigen protein-specific CD8-positive sputum cells to prevent or treat disease
  • (60) A method for preventing or treating the disease according to the above (58) or (59), which is an up-regulator force FN-y; (61) A disease comprising contacting the antigen-presenting cell with the fusion protein according to any one of (1) to (14) above, and then administering the antigen-presenting cell to a mammal including a human. How to prevent or treat;
  • the fusion protein is brought into contact with the antigen-presenting cell to cause any epitope of the disease anti-protein to be presented as an antigen, and the antigen-presenting cell presenting the antigen in the mammal's living body reacts against the disease antigen protein.
  • Antigen-presenting cells present an arbitrary epitope of disease antigen protein by major histocompatibility antigen class I pathway to induce disease antigen protein-specific CD8 positive T cells to prevent or treat disease
  • the upregulator that promotes the antigenic expression function of the disease antigen protein together with the fusion protein is brought into contact with the antigen-presenting cell, or the upregulator is administered together with the antigen-presenting cell. Or a method for preventing or treating the disease according to paragraph 1;
  • (70) A method for preventing or treating the disease according to the above (68) or (69), which is an up-regulator force FN—y; (71) An antigen-presenting cell that takes in the fusion protein according to any one of the above (1) to (14) and presents any epitope of a disease antigen protein as an antigen;
  • the upregulator that promotes the antigenic expression function of the disease antigen protein together with the fusion protein is incorporated into the antigen-presenting cell, and any one of ( 79) to ( 82) above is described.
  • the present invention provides an antigen-presenting cell by using a fusion protein comprising ubiquitin, a cytoplasmic uptake receptor ligand and a disease antigen protein, which has not been reported so far, for antigen presentation by an antigen-presenting cell. It is possible to effectively present antigens, and thereby induce cytotoxic T cells (CTLs) specific to disease antigen proteins, effectively preventing or treating diseases such as cancer and infectious diseases. Make it possible to do.
  • CTLs cytotoxic T cells
  • antigen-presenting cells such as rod cells (DC) can present antigens. 1) It can be applied to all major histocompatibility antigens (MHC antigens (HLA)). 2) A large amount of disease antigen protein can be presented. 3) Since the disease antigen protein is directly taken into the cytoplasm via a cytoplasmic uptake receptor such as KDEL receptor, presentation mainly from MHC antigen class I.
  • MHC antigens major histocompatibility antigens
  • the antigen presenting ability is improved and CD8 activated by antigen presentation through the MHC antigen class I pathway
  • the number of positive cells can be increased more efficiently than before.
  • the fusion protein of the present invention comprises ubiquitin, a disease antigen protein, and a ligand for a cytoplasmic uptake receptor.
  • the antigen needs to be taken into the antigen-presenting cell.
  • the cytoplasm After being taken into the cell, it is processed by the proteanome in the cell, then taken into the endoplasmic reticulum, bound to the MHC class I antigen synthesized in the endoplasmic reticulum, and the complex moves to the cell surface.
  • antigens are presented on the surface of antigen-presenting cells.
  • the disease antigen protein refers to a protein of an antigen that causes disease, a protein of an antigen marker that specifically occurs in the disease, and the like.
  • a disease antigen protein may be a whole protein, or a partial substitution, deletion, translocation, etc. of the sequence, or an epitope, and may be a partial protein of the protein as long as it retains antigenicity. I do not help. In the present invention, the whole protein is particularly suitable. In the present invention, when the total protein is used, All proteins have a variety of known and unknown epitopes! /, Therefore, by the MHC antigen class I pathway, and in addition to the MHC antigen class I pathway, the MHC antigen class II pathway It is possible to present various antigens.
  • the ligand of a receptor taken up into the cytoplasm means "a ligand of a receptor involved in the uptake of an extracellular substance into the cytoplasm by a receptor-mediated reaction".
  • the column f of this ligand includes heat shock protein HSPgp96 (j. Exp. Med., 2000; 19 1: 1965—1974) and transferrin receptor ligand (Prog. Clin. Biol. Res., 1982; 91: 495-521).
  • the structure containing the C-terminus of HSPgp96 preferably contains the amino acid sequence KDEL! /.
  • Ubiquitin is a protein with a molecular weight of 7500 that is universally found in eukaryotic cells, and has the property of being taken up by proteanomes and degraded in cells (FEBS Lett., 1993; 324: 345- 348) .
  • ubiquitin derived from any eukaryotic cell may be used as long as it has the property of being taken up and decomposed by a proteanome in a cell, and a partial substitution of the amino acid sequence of the protein is also possible. Even if there is a defect, translocation, etc., or even a partial protein of the protein, it will not work.
  • the fusion protein of the present invention is directly taken into the cytoplasm, for example, as an adhesion site with a receptor on the surface of the KDEL partial force C, and antigen presentation by the MHC antigen class I pathway
  • ubiquitin facilitates transport to the proteanome, so that antigen can be presented more efficiently than conventional protein uptake, thereby improving the efficiency of CTL induction.
  • any disease antigen protein can be used. Therefore, the disease antigen protein is not limited to a specific disease, and can be applied to various diseases. A protein of cancer antigen or infectious disease antigen is preferably used.
  • any antigen can be used regardless of the type of cancer of the cancer antigen.
  • any cancer antigen such as prostate cancer, liver cancer and pancreatic cancer can be used.
  • cancer antigens include those encoded by the MAGE gene family such as MAGE1, MAGE3, GAGE, BAGE and RAGE.
  • Other cancer antigens include, for example, ⁇ 53, K-ras, CDK4 and bcl-c-abl Examples include cancer antigens caused by mutations in gene products, cancer antigens that are overexpressed in cancer cells such as c-erb2 (neu) protein, and carcinogenic virus antigens such as E7 protein in HPV-16. .
  • melanoma antigens such as TRP-2
  • oncofetal antigens such as carcinoembryonic antigen (CEA) and ⁇ -fetoprotein (AFP)
  • CEA carcinoembryonic antigen
  • AFP ⁇ -fetoprotein
  • prostate-specific antigens such as sputum, and leukemia and lymphoma sputum cells
  • CALLA antigen Differentiation antigens
  • infectious disease of the infectious disease antigen is not particularly limited, and for example, intractable diseases among viral infectious diseases such as AIDS, hepatitis B, Epstein Barr Virus (EBV) infection, HPV infection, etc. Also mentioned. Parasite antigens such as the malaria parasite sporozoide protein can also be used.
  • the fusion protein of the present invention is not bound by a specific MHC (MHC antigen (HLA)), it can be applied to any patient.
  • MHC MHC antigen
  • any disease antigen protein can be used.
  • AARS placenta
  • ABL1 fibroblastoma
  • ACADVL placentoma
  • ACLT7B brain tumor
  • ACP2 lymphoma
  • ACVR2B brain tumor
  • ADPRT fibroblastoma
  • ADS L brain tumor
  • AF6 myeloma
  • AFP AFP
  • AGPAT2 kidney cancer
  • AIBP kidney cancer
  • AIM1 liver cancer
  • AKAP9 brain tumor
  • ALDA fibroblastoma
  • ALDOA fibroblastoma
  • ALOX12B brain tumor, etc.
  • ALPHA NAC brain tumor
  • AMHR2 breast cancer
  • ANT3 brain tumor, lung cancer, etc.
  • ANXA11 teratocarcinoma
  • ANXA2 variant cancers
  • API G2 dry cancer
  • AP1M1 dry cancer
  • AP2M AP
  • HSP60 liver cancer, uterine cancer
  • HSP90A variable
  • HSPA4 lymphoma
  • HSPCA placental tumor
  • HSPE1 uterine cancer
  • HSPH1 bone marrow
  • infectious disease antigens examples include HBV, HCV, and HIV.
  • a desired disease antigen protein may be used alone, or a plurality of the same disease antigen proteins or a plurality of different types of proteins may be combined. ! ⁇ .
  • the ubiquitin, disease antigen protein, and ligand can be composed of any binding form, but preferably the C-terminal side of ubiquitin and the N terminus of the disease antigen protein. It is desirable that the C-terminal side of the disease antigen and the N-terminal side of the ligand bind to each other.
  • ⁇ binding '' means that ubiquitin, disease antigen protein, and ligand are directly bound to each other, and one to a plurality of amino acids are inserted! It means that it may be bonded through an appropriate linker.
  • Such a binding form makes it possible to more efficiently perform uptake into cells and processing in the endoplasmic reticulum after uptake.
  • the expression vector of the present invention comprises a ubiquitin cDNA, a multicloning site into which a cDNA of a disease antigen protein is incorporated, and a cDNA of a receptor ligand that is incorporated into the cytoplasm.
  • FIG. 1 shows a block diagram of the expression vector of the present invention.
  • the composition includes the cDNA of the amino acid sequence KDEL at the end of the heat shock protein HSPgp96C.
  • a commonly available expression vector or viral vector can be used as appropriate. Examples include PQE30, 31, 32, pColdI DNA, pET3 (Escherichia coli), pRCZCMV (mammal), pAXcw (mammal, adenovirus vector), and the like.
  • the multicloning site of the expression vector of the present invention preferably contains a recognition site for Swal and Fsel.
  • Swal and Fsel are restriction enzymes that recognize 8 bases, and they appear very rarely in ordinary genes, so they are less likely to be included in the antigen gene that you want to express. The possibility that the gene is cleaved is very low, and the desired gene can be inserted easily and efficiently.
  • the expression vector of the present invention can be prepared using a conventional method for preparing a recombinant plasmid. For example, Molecular Cloning A Laboratory Manual 3rd Edition (Sambrook and Russell, Cold Spring Harbor Laboratory Press, Col. dspring Harbor, New York) and the like. For example, according to the structure of the expression vector in the examples of the present invention described later, all necessary elements (including the promoter region, His tag region, etc.) including the multicloning site into which the disease antigen protein cDNA is incorporated are included. Therefore, using such an expression vector, the expression plasmid that expresses the desired fusion protein can be more easily and reliably obtained simply by incorporating the DNA sequence that encodes the disease antigen protein that is required from time to time. Can be obtained. Of course, in addition to the above configuration, for example, a GST (Dartathione S-transferase) tag, a myc tag, an S tag, or a T7 tag can be used instead of the His tag.
  • a GST
  • the fusion protein of the present invention can be obtained using the above-described expression plasmid, and antigen uptake, processing, and antigen presentation in antigen-presenting cells, particularly DC, can be performed at a higher rate than in the past.
  • a medicine in a form in which the fusion protein is directly administered, or this fusion protein is administered simultaneously with antigen-presenting cells such as DC or is incorporated into antigen-presenting cells such as DC, and then antigen-presenting cells such as DC are administered.
  • a medicament for preparing an antigen-presenting cell vaccine such as DC When the fusion protein of the present invention is used as a medicine, it can also be used as a preventive for infectious diseases and cancer. Prevention here includes not only initial infection / onset, but also prevention of recurrence
  • the fusion protein of the present invention has a higher ability to induce CTL via antigen-presenting cells such as DC than the conventional antigen protein itself or antigen peptide. Therefore, the fusion protein of the present invention can be directly administered and incorporated into antigen-presenting cells such as DC in the body.
  • the ability to induce CTL is higher than the conventional one even when an antigen-presenting cell such as DC is incorporated into an antigen-presenting cell such as DC in vitro. As a result, it can be used as a medicine having a high therapeutic effect.
  • this vaccine can be used to induce CTL in vitro and administer it to the patient.
  • the fusion protein itself When the fusion protein itself is administered, it is appropriately selected according to the administration method and the patient's condition. Force that can be selected As a normal dose, it is preferable to administer a dose in the range of 0.0: g to 10 mg.
  • the frequency of administration can be appropriately selected according to the nature of the disease antigen protein used, the type and condition of the disease, and the patient's condition. For example, when a protein with weak antigenicity is used, for example, administration once a week can be performed continuously for 1 to several months. Once the patient's function has become active, it may be spaced for a while (weeks to months) and then started again as needed.
  • a highly antigenic protein When a highly antigenic protein is used, it can be administered only once, for example, once a week may be administered a plurality of times. Alternatively, after a single administration, it can be administered again at intervals of several weeks to several months. It can be administered by intravenous, subcutaneous, intracutaneous injection, direct injection into regional lymph nodes, direct injection into the lesion, or systemic administration as an infusion It is. Alternatively, it can be injected from an artery near the lesion. As the preparation for administration in these administrations, a well-known dosage form can be arbitrarily adopted.
  • an aqueous carrier such as phosphate buffered saline (PBS), or an aqueous carrier such as squalene, squalene or non-toxic oil such as ⁇ -tocopherol added to the aqueous carrier is used.
  • PBS phosphate buffered saline
  • squalene squalene
  • non-toxic oil such as ⁇ -tocopherol added to the aqueous carrier
  • the number of cells to be administered is as follows: Although it is possible to select appropriately according to the state, it is usually preferable that 10 6 to 10 8 Z people are applied at one time, more preferably 10 7 Z people or more.
  • the number of doses depends on the patient's condition, but usually 4 to 6 doses are given as one course.
  • the dosing interval depends on the number of rod cells to be administered and is preferably from 1 week to once a month. Furthermore, if the number of rod cells to be administered is 5 x 10 6 cells, 1 every 2 weeks If it is 2 ⁇ 10 7 or more, it is preferable to administer once a month.
  • an aqueous carrier such as phosphate buffered saline (PBS), or an aqueous carrier such as squalane
  • PBS phosphate buffered saline
  • squalane examples include formulations using oil-in-water emulsions containing non-toxic oils such as squalene or a-tocopherol.
  • a pharmaceutical comprising a fusion protein and an up-regulator
  • the medicament is a combination of the fusion protein of the present invention and an up-regulator.
  • the “up-regulator” refers to one having an expression inducing function that increases the antigen presentation amount of antigen-presenting cells such as DC by using it.
  • Specific examples include site force ins such as interferon ⁇ (IFN- ⁇ ) and TNF-a, and bacterial preparations such as OKT432 and BCG.
  • the expression level is not constant. When the expression level is small, the antigen-presenting function is lowered accordingly, so that the expression level is high.
  • administering allows the expression of many MHC antigen class I molecules in cancer cells in the body, so that an antigen presentation function is also provided. Improve and efficiently target cancer cells to CTL.
  • DC antigen presentation is made more efficient and CD8 positive cells (CTL) can be produced.
  • CTL CD8 positive cells
  • cancer cells that have a low expression level of MHC antigen class I molecules and cannot be targeted by CTLs can be combined with IFN-y to restore the antigen-presenting function and efficiently perform immune cell therapy. Can be done.
  • a fusion protein is administered, and an up-regulator such as IFN-y is administered simultaneously or at intervals of several hours to several days.
  • Up-regulators such as IFN-y increase the expression level of MHC antigen class I to the maximum on the first to fifth days after administration, and also maturate antigen-presenting cells such as DC.
  • Antigen-presenting cells can efficiently present antigen when taken up by antigen-presenting cells Since the amount of MHC antigen class I molecules produced in the target cells has increased, the treatment can be performed efficiently.
  • the fusion protein has a dosage of 0.01 ⁇ g to 10 mg, and the up-regulator such as IFN-y has an international unit of 2 million to 3 million units, and contains antigen-presenting cells such as DC
  • the total dose is preferably in the range of 200,000 units to 3 million units.
  • the optimum administration range varies depending on the conditions of the patient to be treated.
  • the antigen-presenting cells such as DC may be administered.
  • an upregulator such as a fusion protein, IFN- ⁇ , or the like is used in an amount of 0.01 g to 10 mg, 1,000 units and 200,000 units (as an international unit), respectively.
  • an upregulator such as a fusion protein, IFN- ⁇ , or the like is used in an amount of 0.01 g to 10 mg, 1,000 units and 200,000 units (as an international unit), respectively.
  • 5 to 1 ⁇ 10 7 cells (number of cells) are used for contact, the antigen presenting ability of the rod-shaped cells can be effectively exhibited.
  • the medicament of the present invention depends on the dosage form usually employed when administered.
  • any carrier that is usually used may be used.
  • an aqueous carrier such as phosphate buffered saline (PBS), or an aqueous carrier such as squalene, squalene or non-toxic oil such as ⁇ -tocopherol may be used as an oil-in-water emulsion. ,.
  • the antigen delivery method and the antigen delivery agent of the present invention are those in which antigens are presented by both MHC antigen class I and class II routes by incorporating the fusion protein of the present invention into the cells of antigen presenting cells. .
  • the antigen delivery method and the antigen delivery agent of the present invention are suitable for causing a disease antigen protein in the form of total protein to be presented in the antigen-presenting cell by the MHC antigen class I route.
  • the conventional antigen presentation method even if it is intended to present the antigen of the MHC antigen class I pathway to induce CTL, sufficient antigen uptake cannot be performed to present the antigen, or the MHC antigen class II pathway I get on and I can not present antigen efficiently won.
  • the fusion protein of the present invention even if the fusion protein of the present invention is incorporated into cells by phagocytosis, the disease antigen protein is intracellularly absorbed by ubiquitin and the HSPgp96C terminal (KDEL). Incorporated into the endoplasmic reticulum, the disease antigen protein is appropriately degraded and the antigenic peptide is presented on the cell surface (MHC antigen class I pathway).
  • the phagocytosis leads to the path to MHC antigen class II as usual, so CTL (CD8 positive cells) and helper T cells (CD4 positive cells) are induced from both MHC antigen class I and class II pathways.
  • CTL CD8 positive cells
  • helper T cells CD4 positive cells
  • the immune function can be activated more than before. Thereby, it becomes possible to improve treatment efficiency more than before.
  • HSPgp96C terminal DNA that is, a DNA sequence encoding KDEL was inserted into the plasmid.
  • HSPgp96Ct was obtained.
  • the template is Immunology and Cell Biology, 2, 006; 84: 1—10 Using pTracer—SV4 OmUb containing the DNA sequence encoding ubiquitin shown in SEQ ID NO: 23, Immunology and Cell Biology, 2, 006 84: 1—10.
  • the sequence was amplified by PCR using a synthetic DNA oligomer having the following sequence as a primer. PCR conditions are 94 ° C, 3 minutes ⁇ (94 ° C, 30 seconds; 60 ° C, 30 seconds; 72. C, 30 seconds) X 30 cycles ⁇ 72. C, 7 minutes ⁇ 4.
  • Sequence number 3 5'-TAAGTCGACATGCAGATCTTCGTGA-
  • SEQ ID NO: 4 5 '— TCCCCAGCATGCCTGCTATTG— 3'
  • the Sail-EcoRV fragment was taken out, and pIVEX2.4a-HSPgp96Ct prepared in 1. above was treated with Sail and Smal, ligated and inserted.
  • E. coli was transformed with this plasmid, colony selection was performed in the same manner as in 1. above, and the nucleotide sequence was confirmed with a sequencer. It was confirmed that the ubiquitin sequence and the multicloning site were also inserted into the plasmid. .
  • the plasmid PIVEX2.4a-Ubi-H SPgp96Ct was constructed by force.
  • the plasmid prepared in 2 above is ubiquitin, multicloning site (MCS), HSPgp96C terminal sequence T7 promoter region, HisTag region, and FactorXa Have a site.
  • MCS multicloning site
  • HSPgp96C terminal sequence T7 promoter region, HisTag region, and FactorXa Have a site.
  • the structure is T7-HisTag-FactorXa- Ubi- MCS- HSPg p96Ct
  • the Sail region upstream of the Ubi sequence is deleted from the restriction enzyme SacII region downstream of the FactorXa site to shorten the space between the Xa site and the ubiquitin sequence did.
  • the plasmid pIVEX2.4a (ASac II) —Ubi—HSPgp96Ct was constructed by force.
  • the multicloning site was replaced in order to obtain a multicloning site containing Swal and Fsel recognition sequences that recognize 8 bases.
  • TRP which has the structure shown in FIG. 1 and is a melanoma antigen as a disease antigen protein
  • a plasmid expressing a fusion protein containing 2 was prepared.
  • RNA was extracted from mouse melanoma cell B16, and cDNA was synthesized by reverse transcription reaction. PCR was carried out using this cDNA as a cage and synthetic DNA of the following sequence as a primer to obtain a 1.6 kbp DNA fragment. PCR conditions are 94. C, 30 seconds, (94. C, 30 seconds; 60. C, 30 seconds; 72. C, 90 seconds) X 30 cycles, 72. C, 7 minutes.
  • SEQ ID NO: 7 5,-AAAACTAGTATGGGCCTTGTGGG ATGGGG 3 '(TRP-2: F)
  • pUC19ZmTRP-2 was digested with Fsel to obtain a mTRP-2 full-length cDNA fragment. This was inserted into the Fsel site of PIVEX2.4a ( ⁇ Sacll) —Ubi—MCS—HSPgp96Ct by a ligation reaction.
  • TC was digested with Sail and Fsel, treated with T4 DNA polymerase and T4 polynucleotide kinase, and self-ligation was performed. Escherichia coli (DH5) was transformed with this reaction solution and cloning was performed. The nucleotide sequence was confirmed, and an expression plasmid PIVEX2.4aZATC was constructed that expresses the mTRP-2-HSPgp96Ct fusion protein (hereinafter referred to as TC) without ubiquitin.
  • TC mTRP-2-HSPgp96Ct fusion protein
  • PCR was performed using pIVEX2.4aZTRP-2 in a saddle shape, the synthetic DNA of the following sequence as a primer and the synthetic DNA of SEQ ID NO: 10, and the 5 'end of mTRP-2cDNA.
  • a DNA fragment in which a part of 3 and 3 and a part of the end were deleted was prepared.
  • SEQ ID NO: 11 5, -ATAAGGCCGGCCGAGAGGGCAGGGGGCAGTG-3 '(mTRP-2-2-3: F)
  • This fragment was digested with Fsel and Swal and then ligated to pIVEX2.4a (A SacII) —Ubi— MCS—HSPgp96Ct Fsel / Swal Inserted into the site. Further digested with Swal and BamHI and treated with T4 DNA polymerase. This reaction solution was electrophoresed to recover the linearized plasmid DNA.
  • UT ubiquitin-mTRP-2 fusion protein
  • KDEL HSPgp96Ct terminal sequence
  • pIVEX2 4aZU AT was digested with Sail and Fsel, then treated with T4 DNA polymerase and T4 polynucleotide kinase, and self-ligation was performed. E. coli (D ⁇ 5 ⁇ ) was transformed with this reaction solution was subjected to Kuroyungu. The nucleotide sequence was confirmed, and an expression plasmid PIVEX2.4 & ⁇ expressing mTRP-2 protein (hereinafter referred to as T), which does not contain ubiquitin and ⁇ SPgp96Ct terminal sequence (KDEL), was constructed.
  • T expression plasmid PIVEX2.4 & ⁇ expressing mTRP-2 protein
  • each reaction solution was recovered, and each fusion protein and protein having a His-tag was purified by a conventional method using an affinity column in which nickel was solidified.
  • the purity of each purified sample was confirmed by SDS-PAGE, it was almost a single band.
  • the antigen-presenting effect of the various fusion proteins or proteins produced in Example 3 on the rod-shaped cells was evaluated by measuring the number of sensitized lymphocytes, cytotoxicity tests, and measuring the cyto force-in production ability.
  • DC rod-shaped cells
  • C57BlackZ6 mice H- 2 b, 8 weeks old, male Bone marrow cells were harvested from the suspension to kanamycin and streptomycin each 50 mu g / ml inclusive AIM-V medium (GIBCO Co., 087- 01 12DK) to I let you.
  • This suspension was filtered through a cell strainer (40 ⁇ m, Falcon, REF 352340), and then centrifuged at 1200 rpm for 5 minutes to recover the cell precipitate.
  • This precipitate was suspended in 0.84% NH 4 C1 solution and allowed to stand at room temperature for 5 minutes to lyse erythrocytes.
  • a medium was added thereto, followed by centrifugation, and the precipitate was collected and washed. Furthermore, the cells were washed twice and the collected cells were suspended in the medium.
  • the number of cells was counted, transferred to a 75 cm 2 flask at 2.5 ⁇ 10 7 cells / 15 ml / flask, and allowed to stand at 37 ° C. for 2 hours in the presence of 5% CO. Then shake the flask gently to remove non-adherent cells.
  • the medium was changed every other day and cultured in a medium containing fresh GM-CSF and IL-4. On the 7th day, cells were collected and a part thereof was analyzed with a flow cytometer.
  • CDl lc positive cells were DC phenotype.
  • the cells (immature DC) whose medium was changed were seeded into a 6-well plate with 2.4 ⁇ 10 6 cells / 3 ml / well, and there, the UTC, UT, TC, and T prepared in Example 3 were transferred.
  • Each fusion protein or protein and ⁇ —2K b- restricted peptide (VYDFFVWL: mouse TRP-2 peptide) is added at 225 pmole, and as an up-regulator that promotes antigen presentation, interferon y (IFN-y, manufactured by Peprotec, 315-05) was squeezed to 20ngZml. Thereafter, the culture was further continued for 2 days to obtain mature DC.
  • Each mature DC prepared in 1. above was placed in the abdominal cavity of C57BlackZ6 mice (10 weeks old, male: same gene as C57BlackZ6 mice used to collect bone marrow cells in 1. above) 1.5 X 10 5 cells were administered in Z mice. On the 10th day after administration, each mouse force spleen cell was collected and suspended in RPMI 1640 medium (GIBCO, 11875-093) containing 50 ⁇ g Zml of kanamycin and streptomycin.
  • Each CD8 positive fraction counted the number of cells.
  • a graph of the number of cells in each fraction is shown in FIG.
  • the number of recovered cells tended to be larger when UTC and UT were added than when TC, T and mouse TRP-2 peptide were added.
  • the number of CD8 positive cells is more in UT than in UTC, which indicates the apparent number of cells.
  • Fig. 4 shows the effect of the actual antigen presenting ability.
  • each CD8 withered fraction was prepared to 2 ⁇ 10 6 cel lsZml each in complete RPMI medium containing 10% FBS, and then spread onto a 24 well plate.
  • TRP-2 specific stimulation was added to the whole well by adding 200 ng of T protein, and each culture supernatant was collected on the 1st and 3rd days.
  • each mature DC was administered to the abdominal cavity of C57BlackZ6 mice at 3 mice each with 1.5 5 10 5 cells, and one week later, each mature DC was administered again under the same conditions.
  • spleen cells were collected from each mouse and suspended in RPMI 1640 medium (GIBCO, 11875-093) containing 50 g / ml of kanamycin and streptomycin. Thereafter, the CD8 positive fraction of each mouse spleen cell force was collected as in A) above.
  • Each CD 8 positive fraction contains complete RPMI 1640 (25 mM HEPES in RPMI 1640) containing 5 U / ml of 10% fetal bovine serum (FBS) and interleukin 2 (IL-2) (PROLEUKI N, CHIRON). , 50 ⁇ ⁇ 2-mercaptoethanol, 20 ML-glutamine, 10 M sodium pyruvate, 1% non-essential amino acid, lOOuZml penicillin, 100 / z gZml streptomycin).
  • FBS fetal bovine serum
  • IL-2 interleukin 2
  • the cytotoxicity against cancer cells was examined by CD8 positive T cells contained in each CD8 positive fraction obtained by culturing in B) above.
  • Ru B 16 melanoma H- 2K b
  • Dulbecco's modified Eagle's medium containing 10% FBS DMEM
  • IFN-y was added at 20 ngZml as an up-regulator and cultured.
  • M5076 sarcoma H-2K b
  • M5076 sarcoma H-2K b
  • Each of these cells was collected on the 3rd day after passage, suspended in phenol red-free R PMI 1640 medium (GIBCO, 11835-030) containing 10% FBS, and force Lucein AM (DOTITE, 349 — 07201) was added at 1Z1000 volume and allowed to stand at 37 ° C for 20 minutes.
  • Force Lucein A To remove excess force Lucein AM in each cell suspension incorporating M, each cell was washed three times with RPMI 1640 medium without phenol red containing 10% FBS, and the number of cells was counted. 10 4 cells ZLOO / z 1Z wells were seeded in 96-well plates and used as target cells for cytotoxicity tests.
  • the results are shown in the graph in Fig. 4.
  • the cytotoxic activity of UTC-treated DC which is the fusion protein of the present invention, is not producing TRP 2 !, compared with the cytotoxic activity against M5076 sarcoma. It is understood that this is a specific cytotoxicity that is highly damaging to B16 melanoma (B16). It is also understood that this specific cytotoxic activity is highest in the case of UTC-treated DC which is the fusion protein of the present invention.
  • the concentrations of FN ⁇ and IL-4 were measured by ELISA.
  • 96-well ELISA plate (Falcon, 35-3912) with purified anti-mouse IFN- ⁇ (capture, BD Pharmingen, 551216) and purified anti-mouse IL-4 (BD Pharming en, 554387), respectively 100 ⁇ l of 5 ⁇ g Zml was added and left at 37 ° C. for 2 hours.
  • TBS Tris-buffered saline
  • PIE RCE SuperBlock Blocking Bufferln TBS
  • each well was washed 5 times with TBS containing 0.1% Tween20.
  • IFN—y (standard) or IL-4 (standard) prepared in 100ngZml, 10 ng / ml, lng / ml, 0.1 ng / ml, 0.
  • HORSERADISH P EROXIDASE AVIDIN D (manufactured by Vector Laboratories, A-2004) was prepared to 5 g / ml, placed in each well with 100 1Z wells, and allowed to stand at 37 ° C for 2 hours. 0. Wash each well 7 times with TBS containing l% Tween 20 and immediately add TMB peroxidase substrate (Bio-Rad, 172-1068) at 100 1Z well and measure the absorbance at 650 nm. did. Calibration curves were also prepared for the absorbance powers of the IFN- ⁇ and IL-4 standards, and the concentrations of IFN-y and IL-4 in each culture supernatant were determined. The results are shown in Figs.
  • a test was conducted to confirm the effect of the fusion protein of the present invention in a living body using TRP-2 as a disease antigen protein.
  • DC was induced in the same manner as in Example 4 1., UTC and TRP-2 peptides were added, respectively. Sometimes IFN- ⁇ as an up-regulator of 20 ng / ml was also added to the koji culture. This operation DC obtained by antigen presenting recovered in, 30 pmol antigen / 2 X 10 5 cells / mouse were subcutaneous administration (UTC ⁇ Ka ⁇ DC: DC - UTC, TRP - 2 peptide addition DC: DC- Bae 10 animals were used for the peptide or physiological saline group).
  • ⁇ ⁇ -16 melanoma treated with 20 ng / ml of IFN- ⁇ was subcutaneously administered to the abdomen in 1 ⁇ 10 5 cell ⁇ mice. Subsequent observation of the engraftment rate of ⁇ -16 melanoma tumor and tumor volume were performed.
  • Fig. 7 shows the results of the survival rate.
  • the vertical axis represents the non-engraftment rate, and the horizontal axis represents the number of days after transplantation.
  • the time to engraftment was significantly (p ⁇ 0. 05) later in the group immunized with DC presented with the antigen in UTC compared with the physiological saline group.
  • the TRP-2 peptide group showed almost the same results as the physiological saline group.
  • Tumor volume results are shown in FIG.
  • the TRP-2 peptide group was significantly different from the raw food group.
  • significant (p ⁇ 0. 01) growth inhibition was observed in the UTC group as compared to the TRP-2 peptide group.
  • the fusion protein of the present invention exhibits at least a vaccine effect equivalent to that of the TRP-2 peptide even when administered directly into the body, and the fusion protein of the present invention is restricted to the HLA type unlike the peptide. Without expectation, vaccine effect is expected for any solid come.
  • HPV16-E7 HPV16 type E7 antigen
  • HPV human papilloma virus
  • Human papilloma virus type 1 purined phagemid was purchased from the American type culture collection (ATCC), and this was used as a cage and PCR was performed using synthetic DNA of the following sequence as a primer to obtain a 300 bp DNA fragment. PCR conditions are 94. C, 60, (94. C, 30 seconds; 63. C, 30 seconds; 72. C, 60 seconds) X 30 cycles, 72. C, 7 minutes. SEQ ID NO: 17: 5, -TTGAAGCTTAATCATGCATGGAGATACACC-3 '(H PV16-E7- 1: F)
  • the approximately 300 bp DNA fragment was digested with Hindlll and Xbal, inserted into the Hindlll and Xbal sites of pRCZCMV, and cloned.
  • the nucleotide sequence was confirmed, and PRC-CMV / HPV16-E7 was inserted with the full-length HPV16-E7 cDNA.
  • PCR was performed using pRC-CM VZHPV16-E7 in a cage shape and synthetic DNA of the following sequence as a primer to obtain a DNA fragment of about 300 bp.
  • the approximately 300 bp DNA fragment was quenched with Kpnl and Pstl and inserted into the Kpnl / Pstl site of pIVEX2.4a ( ⁇ Sacll) —Ubi—MCS—HSPgp96Ct by a ligation reaction.
  • PCR conditions were 94 ° C, 60, (94 ° C, 30 seconds; 63 . C, 30 seconds; C, 60 seconds) X 30 cycles, 72. C, 7 minutes.
  • GG-3 ′ (HPV16-E7-R2: F)
  • Escherichia coli DH5 a
  • cloning was performed.
  • the nucleotide sequence of the obtained clone was confirmed, and a plasmid PIVEX2.4a / Ubi-HPV16E7-HSPgp96Ct having the same sequence as that of the inserted pRC-CMVZHPV16E7 was constructed.
  • This expression plasmid expresses a fusion protein of Ubi—HPV16E7—HSPgp96Ct (hereinafter referred to as UE C).
  • HPV16E7 Preparation of an expression plasmid expressing HSP gO 96Ct fusion protein
  • PIVEX2.4a / Ubi—HPV16E7—HSPgp96Ct was digested with Sail, the region encoding ubiquitin was deleted, and self-ligation was performed. The base sequence of the obtained clone was confirmed, and an expression plasmid pIVEX2.4a / HPV16E7-HSPgp96-Ct expressing the HPV16E7-HSPgp96Ct fusion protein (hereinafter referred to as EC) free of ubiquitin was constructed.
  • EC HPV16E7-HSPgp96Ct fusion protein
  • PCR was performed using pRC—CMVZHPV16—E7 in a cage, HPV16—E7-F (SEQ ID NO: 19) as a primer and synthetic DNA (SEQ ID NO: 21) 16—E7—R of the following sequence: A DNA fragment of about 300 bp was obtained.
  • G-3 (16- E7- R: R)
  • the above DNA fragment of about 300 bp is digested with Kpnl and Pstl, and pIVEX2.4a (A SacIl) It was inserted into the Kpnl / Pstl site of Ubi—MCS—HSPgp96Ct by a ligation reaction. Furthermore, the region encoding HSPgp96Ct was deleted by digestion with BamHI and self-ligation.
  • pIVEX2.4aZUbi—HPV16E7 was digested with BamHI and then self-ligation was performed. Escherichia coli (DH5a) was transformed with this reaction solution and cloned. The nucleotide sequence of the obtained clone was confirmed, and an expression plasmid pIVEX2.4a / HP V16E7 that expresses mHPV16E7 protein (hereinafter referred to as E) without ubiquitin and HSPgp96Ct terminal sequence was constructed.
  • E expression plasmid pIVEX2.4a / HP V16E7 that expresses mHPV16E7 protein
  • Example 6 Using an in vitro translation kit RTS Proteomaster E. coli HY (Roche), a reaction solution containing each expression plasmid prepared in Example 6 was prepared according to the manual. The reaction was performed at 30 ° C for 24 hours using the RTS ProteoMaster Rapid Translation System (Roche). After the reaction, whether the target protein was expressed was subjected to Western blotting using an anti-HPV17E7 antibody (Chemiconlnternational, MAB8680) by a conventional method, and it was confirmed that all proteins were expressed.
  • Figure 10 shows an image of Western blotting using an anti-HP V 16E7 antibody.
  • each reaction solution was collected, and each fusion protein with a His-tag was collected by a conventional method using an affinity column in which nickel was solidified. Further, gel filtration was performed with Superdex 200. And purified. Each purified sample was subjected to SDS-PAGE followed by CBB staining to confirm the degree of purification.
  • Figure 11 shows the image after purification. As shown in FIG. 11, each was a single band, and Western blotting was carried out by an ordinary method using an anti-HPV17E7 antibody (Chemicon International, MAB8680), and it was confirmed that it reacted with each purified fusion protein.
  • the endotoxin content of the UEC fusion protein used in the evaluation using human rod cells was measured and found to be 15 ng / mg protein. It was a visible amount.
  • the vaccine effect of the rod-shaped cells in which the fusion protein (UEC) of the present invention containing the HPV16 type E7 antigen protein (HPV16-E7) was presented as an antigen was verified, and the HPV16-E7 epitope It was compared with the vaccine effect of rod-shaped cells pulsed with peptide.
  • the fusion protein (UEC) of the present invention containing the HPV16 type E7 antigen protein (HPV16-E7) was presented as an antigen was verified, and the HPV16-E7 epitope It was compared with the vaccine effect of rod-shaped cells pulsed with peptide.
  • Peripheral blood was collected from healthy volunteers with HLA-A * 0201, and peripheral blood mononuclear cells (PBMC) were obtained by specific gravity centrifugation. From this PBMC, a CD14 positive fraction and a CD14 negative fraction were separated using MACS and CD 14 microbeads (Miltenyi Biotech, 130-050-20).
  • PBMC peripheral blood mononuclear cells
  • CD14-positive cells were cultured with CellGro DC Medium (CellGenix, 2001) containing GM-CSF (500 IU / ml, BERLEX, 87-895) and IL-4 (500 IU / ml, Osteogenetics GmbH). The cells were cultured for a day and separated into rod-shaped cells (DC). Some cells are cryopreserved, and cells that are not cryopreserved are cultured in GM-CSF, IL4, TNF-a (10 ng / ml, CellGenix, 1006) and prostaglandin E2 (lg / ml, Sigma The culture was continued after changing to CellGro DC Medium containing P6532).
  • UEC and HLA-A * 0201 restricted epitope peptide (YM LDLQPETT: HPV16—E7 epitope peptide) were added to DC to a final concentration of 75 pmoleZm1. The culture was further continued for one day.
  • the CD14 negative cell population (1 X 10 6 cells) prepared in 1 above and cryopreserved and each DC (2 X 10 5 cells) prepared in 1 above are treated with 10% human AB serum and human.
  • the suspension was suspended in AIM-V medium containing IL-2 (20IUZml, manufactured by Chiron, 87-890) and seeded on a 24-well plate. Three days later, the culture supernatant was replaced with fresh one, and seven days later, secondary stimulation was performed. Secondary stimulation was carried out for 3 hours on 1 ⁇ 10 4 Z-well CD14 negative cell population with 1 ⁇ 10 3 Z-well supplemented with each DC prepared as described in 1. above. Using this cell suspension, human IFN-y ELISpot (MABtech, 3420-2A) was used. [0073] 3. Human IFN—y ELISnot Atsey
  • Fig. 12 shows the results of ELISpot assay for HFN- ⁇ .
  • the number of IFN- ⁇ -producing cells was higher than the condition in which lymphocytes were sensitized with DC pulsed with HLA-A * 0201-restricted epitope peptide. It was confirmed that there were many. From these results, it was shown that the use of UEC induces stronger cellular immunity than the conventional epitope peptide pulse method, and it is expected that the efficiency of CTL induction by DC will be improved.
  • the fusion protein of the present invention can improve the antigen-presenting ability in antigen-presenting cells. As a result, it is possible to provide an excellent antigen presentation system including the expression plasmid of the fusion protein, the production of the fusion protein, the processing method of the antigen-presenting cells using the fusion protein, the treatment technique, and the like. .
  • HLA MHC antigen
  • FIG. 1 is a structural diagram illustrating an expression vector of the present invention.
  • FIG. 2 is an image showing the results of Western blotting after in vitro translation.
  • FIG. 3 is a graph showing the number of CD8-positive cells recovered after administration of each mature rod-shaped cell using UTC, UT, TC, T, and peptide.
  • FIG. 4 is a table showing the damage activity of CD8 positive cells induced by each rod-shaped cell using UTC, UT, TC, T and peptide.
  • FIG. 5 is a graph showing the results of a test comparing the IFN- ⁇ production ability of each of UTC, UT, UC, T and peptide.
  • FIG. 6 is a graph showing the results of a test comparing the IL 4 production capacities of UTC, UT, TC, T and peptides.
  • FIG. 7 is a graph showing the results of tumor survival rates when UTC and peptides were used in DC vaccines.
  • FIG. 8 is a diagram showing the difference in tumor volume when UTC and peptide are used for DC vaccine.
  • FIG. 9 A graph showing the difference in tumor volume when UTC and peptide were directly administered.
  • FIG. 10 is a Western blotting image of various fusion proteins (UEC, UE, EC, E) using anti-HPV16E7 antibody.
  • FIG.11 SDS-PAGE images of UEC, UE, EC, and E, respectively.
  • FIG. 12 is a graph showing the number of IFN- ⁇ producing cells in a lymphocyte population when UEC and peptides are used for DC vaccine.
  • SEQ ID NO: 4 Primer: SpHI: R
  • SEQ ID NO: 5 Synthetic DNA: Swal: F
  • SEQ ID NO: 7 Primer: mTRP— 2: F
  • SEQ ID NO: 8 Primer: mTRP— 2: R
  • SEQ ID NO: 9 Primer: mTRP—2-2—F
  • Sequence number 18 Synthetic DNA: HPV 16-E7-2 R
  • Sequence number 19 Synthetic DNA: HPV16—E7—F: F SEQ ID NO: 20: Synthetic DNA: HPV 16-E7-R2: R
  • SEQ ID NO: 21 Synthetic DNA: HPV16—E7—R: R
  • SEQ ID NO: 22 DNA: Human Papilloma Virus type 16 E7
  • SEQ ID NO: 23 Synthetic DNA: Ubiquitin

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Genetics & Genomics (AREA)
  • Oncology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Communicable Diseases (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

Selon l'invention, un lymphocyte T cytotoxique peut être induit avec une efficacité élevée en utilisant une cellule présentant un antigène qui a une protéine de fusion comprenant l'ubiquitine, une protéine d'antigène de cancer ou une protéine d'antigène d'infection et la terminaison C d'une protéine de choc thermique présentée sur celle-ci en tant qu'antigène.
PCT/JP2006/322818 2005-11-17 2006-11-16 Proteine de fusion et utilisation de celle-ci dans des applications pharmaceutiques WO2007058235A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2007545275A JPWO2007058235A1 (ja) 2005-11-17 2006-11-16 融合蛋白質およびその薬学的用途

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2005-362450 2005-11-17
JP2005362450 2005-11-17

Publications (1)

Publication Number Publication Date
WO2007058235A1 true WO2007058235A1 (fr) 2007-05-24

Family

ID=38048619

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2006/322818 WO2007058235A1 (fr) 2005-11-17 2006-11-16 Proteine de fusion et utilisation de celle-ci dans des applications pharmaceutiques

Country Status (2)

Country Link
JP (1) JPWO2007058235A1 (fr)
WO (1) WO2007058235A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010532486A (ja) * 2007-07-02 2010-10-07 アメリカ合衆国 異常造血の検出及び制御
WO2011032722A1 (fr) * 2009-09-17 2011-03-24 Charité - Universitätsmedizin Berlin Vecteur basé sur un module utile dans l'évaluation de fonctions de cellule t spécifiques d'antigène
JP2016534042A (ja) * 2013-10-11 2016-11-04 ユビバック エルエルシー ユビキチニル化タンパク質
EP2895864B1 (fr) * 2012-09-17 2021-03-10 AIT Austrian Institute of Technology GmbH Mathode et moyen de diagnostic du cancer du côlon
WO2023068328A1 (fr) * 2021-10-20 2023-04-27 国立大学法人東京大学 Agent inducteur de dégradation de peptide cible

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
EGAWA K.: "Gan no Men'eki Saibo Ryoho: Kasseika Jiko lympha-kyu Ryoho o Chushin to shite", KOKYU, vol. 22, no. 12, 2003, pages 1190 - 1195, XP003009077 *
GROMME M. ET AL.: "Antigen degradation or presentation by MHC class I molecules via classical and non-classical pathways", MOL. IMMUNOL., vol. 39, no. 3-4, 2002, pages 181 - 202, XP003009078 *
HISAEDA H. ET AL.: "Ubiquitin Proteasome System no Oyo ni yoru Gan Idenshi Men'eki", ANNUAL REVIEW MEN'EKI, 5 December 2004 (2004-12-05), pages 192 - 200, XP003009076 *
HUANG Q. ET AL.: "In vivo cytotoxic T lymphocyte elicitation by mycobacterial heat shock protein 70 fusion proteins maps to a discrete domain and is CD4(+) T cell independent", J. EXP. MED., vol. 191, no. 2, 2000, pages 403 - 408, XP000974127 *
SHIBAGAKI N. ET AL.: "Dendritic cells transduced with protein antigens induce cytotoxic lymphocytes and elicit antitumor immunity", J. IMMUNOL., vol. 168, no. 5, 2002, pages 2393 - 2401, XP003009075 *
SINGH-JASUJA H. ET AL.: "Cross-presentation of glycoprotein 96-associated antigens on major histocompatibility complex class I molecules requires receptor-mediated endocytosis", J. EXP. MED., vol. 191, no. 11, 2000, pages 1965 - 1974, XP002198240 *
SUZUE K. ET AL.: "Heat shock fusion proteins as vehicles for antigen delivery into the major histocompatibility complex class I presentation pathway", PROC. NATL. ACAD. SCI. USA, vol. 94, no. 24, 1997, pages 13146 - 13151, XP002070395 *
WANG L. ET AL.: "MHC class I-associated presentation of exogenous peptides is not only enhanced but also prolonged by linking with a C-terminal Lys-Asp-Glu-Leu endoplasmic reticulum retrieval signal", EUR. J. IMMUNOL., vol. 34, no. 12, 2004, pages 3582 - 3594, XP003009079 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010532486A (ja) * 2007-07-02 2010-10-07 アメリカ合衆国 異常造血の検出及び制御
WO2011032722A1 (fr) * 2009-09-17 2011-03-24 Charité - Universitätsmedizin Berlin Vecteur basé sur un module utile dans l'évaluation de fonctions de cellule t spécifiques d'antigène
EP2309272A1 (fr) * 2009-09-17 2011-04-13 Charité Universitätsmedizin Berlin Vecteur à base de module utile pour l'évaluation des fonctions des lymphocytes T spécifiques aux antigènes
EP2895864B1 (fr) * 2012-09-17 2021-03-10 AIT Austrian Institute of Technology GmbH Mathode et moyen de diagnostic du cancer du côlon
JP2016534042A (ja) * 2013-10-11 2016-11-04 ユビバック エルエルシー ユビキチニル化タンパク質
WO2023068328A1 (fr) * 2021-10-20 2023-04-27 国立大学法人東京大学 Agent inducteur de dégradation de peptide cible

Also Published As

Publication number Publication date
JPWO2007058235A1 (ja) 2009-05-07

Similar Documents

Publication Publication Date Title
Qui et al. CD134 plus CD137 dual costimulation induces Eomesodermin in CD4 T cells to program cytotoxic Th1 differentiation
ES2676630T3 (es) Control inmunogénico de tumores y células tumorales
WO2010030002A1 (fr) Cellule capable d'exprimer un ligand gitr exogène
KR20180129899A (ko) 신생항원 및 이것의 사용 방법
Peng et al. Vaccination with dendritic cells transfected with BAK and BAX siRNA enhances antigen-specific immune responses by prolonging dendritic cell life
JP2021527426A (ja) ネオ抗原およびその使用
JP2010509191A (ja) Ｈｐｖ抗原を保持する組換えアデニル酸シクラーゼによる子宮頚癌の治療
KR20150107708A (ko) 세포 관통 펩티드
JP2021527655A (ja) ネオ抗原およびそれらの使用
KR20200067862A (ko) 종양-관련된 항원 에피토프의 미생물 서열 변이체
Qian et al. CD204 suppresses large heat shock protein-facilitated priming of tumor antigen gp100-specific T cells and chaperone vaccine activity against mouse melanoma
EP2839291B1 (fr) Vaccin multivalent contre le cancer du sein
KR20080100640A (ko) Ｉｌ－１２ 및 ｉｌ－２３의 효율적인 공동발현 방법
JP2022553192A (ja) 癌ワクチン
WO2017071173A1 (fr) Agent thérapeutique antitumoral modifié par protéine de fusion il-12/cd62l, son procédé de préparation et son utilisation
WO2007058235A1 (fr) Proteine de fusion et utilisation de celle-ci dans des applications pharmaceutiques
Tang et al. Multistep process through which adenoviral vector vaccine overcomes anergy to tumor-associated antigens
Komita et al. CD8+ T-cell responses against hemoglobin-β prevent solid tumor growth
Takai et al. Distinct effects of saracatinib on memory CD8+ T cell differentiation
WO2018094569A1 (fr) Polypeptide et son application
Liu et al. Dendritic cells engineered to express the Flt3 ligand stimulate type I immune response, and induce enhanced cytoxic T and natural killer cell cytotoxicities and antitumor immunity
WO2018058489A1 (fr) Polypeptide antigène tumoral dérivé du cacna1h et son utilisation
US20070042047A1 (en) Vaccines
Gérard et al. Recombinant human papillomavirus type 16 E7 protein as a model antigen to study the vaccine potential in control and E7 transgenic mice
CN110139875B (zh) Col14a1衍生的肿瘤抗原多肽及其应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2007545275

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06832707

Country of ref document: EP

Kind code of ref document: A1