WO2007057648A1 - Inhibiteurs de bcl-6 - Google Patents

Inhibiteurs de bcl-6 Download PDF

Info

Publication number
WO2007057648A1
WO2007057648A1 PCT/GB2006/004231 GB2006004231W WO2007057648A1 WO 2007057648 A1 WO2007057648 A1 WO 2007057648A1 GB 2006004231 W GB2006004231 W GB 2006004231W WO 2007057648 A1 WO2007057648 A1 WO 2007057648A1
Authority
WO
WIPO (PCT)
Prior art keywords
bcl
apt48
cell
cells
peptide
Prior art date
Application number
PCT/GB2006/004231
Other languages
English (en)
Inventor
Anasuya Chattopadhyay
Ferrigno Paul Ko
Simon David Wagner
Original Assignee
Medical Research Council
Imperial College Innovations Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medical Research Council, Imperial College Innovations Limited filed Critical Medical Research Council
Publication of WO2007057648A1 publication Critical patent/WO2007057648A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4703—Inhibitors; Suppressors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids

Definitions

  • the invention relates to inhibitors of BCL-6.
  • the invention relates to small peptide inhibitors of BCL-6 such as aptamer 48 disclosed herein.
  • BCL-6 is a transcription factor essential for germinal centre B cell development.
  • BCL-6 is a transcriptional repressor whose N-terminal POZ-domain mediates protein protein interactions to assert its effects.
  • BCL-6 is involved in diffuse large cell lymphoma and is over expressed in other types of non Hodgkin's lymphoma and in high grade breast cancer. Furthermore, BCL-6 is expressed in other lymphoproliferative disorders such as follicular lymphoma, Burkitt's lymphoma and B-cell predominant Hodgkin's disease.
  • HDAC histone deacetylases
  • the present invention seeks to overcome problems associated with the prior art.
  • the present inventors have undertaken a large scale screen for interactors of BCL-6. They have surprisingly discovered a number of BCL-6 repressing peptides. These peptides are disclosed herein in the form of peptide aptamers, having core unique sequences of approximately 10 amino acids.
  • the peptides disclosed herein have been shown to be functionally capable of repressing BCL6 activity. Furthermore, as a result of these studies, a specific novel surface has been delineated on BCL-6 through which repressor activity can be mediated.
  • the present invention is based on these surprising findings.
  • the invention provides a polypeptide comprising at least six contiguous amino acid residues of the amino acid sequence of one or more of
  • the invention provides a a polypeptide as described above wherein said peptide comprises the full amino acid sequence of one or more of
  • the invention provides a polypeptide as described above wherein said sequence is HGPRDWCLFG (Aptamer 48).
  • the invention provides use of a polypeptide as described above in the expression of a BCL6 repressed gene.
  • the invention provides use of a polypeptide as described above in the inhibition of BCL6.
  • the invention provides a use of a polypeptide as described above in the blocking of the POZ site of BCL6.
  • the invention provides a method of inducing expression of a gene selected from the group consisting of CD69, blimp 1, and cyclin D2 in a cell by contacting said cell with a polypeptide as described above.
  • the invention provides a method as described above wherein the cell is a cell of the B cell lineage. In another aspect, the invention provides a method of inhibiting the effects of BCL6 overexpression comprising contacting a cell overexpressing BCL6 with a polypeptide as described above.
  • the invention provides a method of inducing differentiation of a proliferating B cell comprising contacting said B cell with a polypeptide as described above.
  • the invention provides a polypeptide as described above for use as a medicament.
  • the invention provides a polypeptide as described above for use in the treatment of a lymplioproliferative disorder.
  • the invention provides use of a polypeptide as described above in the manufacture of a medicament for the prevention or treatment of a lymplioproliferative disorder.
  • the invention provides a method for causing growth arrest of a cell over expressing BCL 6 comprising contacting said cell with a polypeptide as described above and at least one cytokine, hi another aspect, the invention provides a composition comprising a polypeptide as described above and at least one cytokine; preferably the polypeptide is or comprises Aptamer48.
  • the composition is for use in medicine; preferably said composition is for use in the manufacture of a medicament for the prevention or treatment of a lymplioproliferative disorder.
  • the invention provides a polypeptide comprising an amino acid sequence selected from the group consisting of Aptamer 7, Aptamer 48, Aptamer 52 and Aptamer 58.
  • the invention provides a polypeptide consisting of DILTDVVIVVSREQFRAH. In another aspect, the invention provides a polypeptide comprising DILTDVVIVVSREQFRAH for use as a medicament.
  • the invention provides a polypeptide comprising DILTDVVIVVSREQFRAH for use in the treatment of a lymphoproliferative disorder.
  • the peptide comprising DILTDVVIVVSREQFRAH consists of DILTDVVIVVSREQFRAH.
  • the invention provides use of a polypeptide comprising DILTDVVIVVSREQFRAH in the manufacture of a medicament for the prevention or treatment of a lymphoproliferative disorder.
  • the invention relates to peptide aptamers to antagonise BCL-6 function.
  • the peptides of the invention find application in disorders such as B Cell lymphoma.
  • lymphoproliferative disorders are follicular lymphoma, Burkitt's lymphoma and B-cell predominant Hodgldn's disease
  • the invention also relates to uses of the peptides in gene expression, in BCL-6 inhibition and in medicine.
  • the closest prior art may be considered to be Polo et al (2004 Nature Medicine pages 1329-1335).
  • the peptides of the present invention are dramatically different from those disclosed in Polo et al. Comparative data establishing this is presented in the examples section. Firstly, the peptide disclosed by Polo et al is divergent in sequence from the peptides disclosed herein. Secondly, there is only a weak homology between the sequences disclosed herein and those of Polo et al. Thirdly, with reference to Figure 2b, clear functional differences are shown between the prior art peptide (BBD) and an exemplary peptide of the present invention (aptamer 48).
  • BBD prior art peptide
  • aptamer 48 an exemplary peptide of the present invention
  • BCL-6 is a transcription factor essential for germinal centre B-cell development.
  • the BCL-6 gene is involved in diffuse large cell lymphoma and over-expressed in other types of non-Hodgkin's lymphoma and in high grade breast cancer.
  • BCL-6 is a transcriptional repressor whose N-terminal POZ domain mediates protein-protein interactions to exert its effects.
  • Reasoning that disruption of POZ domain-mediated interactions may be an effective route to antagonizing the effects of BCL-6 in lymphoma, we screened a library for peptide aptamers that specifically bind to BCL-6 POZ and not the POZ domains of related proteins and describe here the first set of these reagents, most preferred example of which is Apt48.
  • Apt48 binds BCL-6 POZ in a manner distinct from the transcriptional co-repressor SMRT, yet was found to prevent BCL-6 mediated repression of a luciferase reporter gene.
  • Apt48 also reproduced several previously validated effects of BCL-6 inhibition. Notably, expression of the differentiation markers CD69, Blimp- 1 and cyclin D2 was increased in B-cell lines when Apt48 was expressed.
  • expression of Apt48 restores cytokine-mediated growth arrest to BCL-6 over-expressing cells.
  • a peptide aptamer that affects a function of BCL-6 that is required to prevent differentiation of proliferating B cells.
  • BCL-6 is a transcription factor which is normally expressed at high level in lymph node germinal centres (Cattoretti et al, 1995; Onizuka et al, 1995).
  • the BCL-6 gene was cloned from chromosomal translocations in diffuse large cell lymphoma (Baron et al, 1993; Ye et al, 1993), suggesting that it has a role in the causation of this disease, and is expressed in other lymphoproliferations e.g. follicular lymphoma, Burkitt's lymphoma and B-cell predominant Hodgkin's disease and a number of breast cancers (Logararjah et al, 2003).
  • BCL-6 expression promotes proliferation and inhibits differentiation and apoptosis of B-cell lines (Niu et al, 1998; Shaffer et al, 2000).
  • expression of an inducible dominant negative BCL-6 led to up-regulation of genes associated with B cell differentiation e.g. Blimp- 1, and cell death in the Burkitt's lymphoma cell line Raji (Turner et al, 1994).
  • BCL-6 may be a therapeutic target in lymphoma.
  • the carboxy-terminus of BCL-6 comprises a DNA binding domain of 6 zinc-fingers, which recognise the same consensus sequence as that of the signal transducers and activators of transcription (STAT) family of transcription factors (Dent et al, 1997). BCL-6 can bind to STAT6 (Dent et al, 1997, Harris et al, 1999) and STAT3 (Reljic et al, 2000) binding sites, suggesting that it may function in part by antagonizing STAT signalling.
  • the effector portion of BCL-6 is a POZ/BTB domain (Pox virus and zinc finger/bric-a-brac tramtrack broad complex (Bardwell and Treisman, 1994); hereafter referred to as the POZ domain) located at the amino terminus of the molecule.
  • POZ domains mediate transcriptional repression (Chang et al, 1996) and this is generally, although not exclusively (Deltour eto/, 1999), achieved by association with the co-repressor proteins N-CoR and SMRT (Huynh et al, 1998), which in turn recruit histone deacetylases (Dhordain et al, 1998).
  • POZ domains are able to homodimerise, and in some cases heterodimerise (Davies et al, 1999; Dhordain et al, 2000 and references in Table I). It has been postulated that overexpression of one POZ domain-containing protein may lead to helerodimerisation with another POZ domain-containing protein, resulting in loss of function and either physiological or pathological effects (Bardwell and Treisman, 1994). This mechanism could plausibly contribute to pathology in cells over-expressing BCL-6 as a result of chromosomal translocation.
  • peptide aptamers peptides whose amino- and carboxy-termini are anchored in the context of a scaffold protein; Colas et al, 1996) against BCL-6.
  • the role of the scaffold protein is first, to reduce the range of conformations that can be adopted by a given sequence of amino acids; second, to display these conformationally-constrained peptides on the surface of a larger molecule; and third, to stabilise the presented peptide in the cellular environment (Colas et al, 1996).
  • different peptide sequences adopt different conformations.
  • Constrained peptides therefore represent a range of structures that can be screened for biological interactions, with a view to identifying molecules with desired effects.
  • Constrained peptides are able to bind to their target proteins with specificities and affinities comparable to antibodies (Colas et al, 1996) and have been used to interfere with protein function in a number of cellular pathways (see Crawford et al, 2003 for references).
  • peptide aplamers identified in our screen may bind to any of several protein-interaction surfaces of the BCL-6 POZ and may therefore identify other ways of interfering with BCL-6 function.
  • peptide aptamers we have isolated, the most preferred example of which is termed 'Apt48'. Our data show that Apt48 binds to BCL-6 POZ in a manner distinct from that used by the SMRT peptide.
  • Apt48 is able to interfere with BCL-6 mediated repression in three distinct cellular assays, and restores on BCL-6 over-expressing cells the ability to growth arrest in response to cytokines.
  • Our results identify the POZ domain of BCL-6 is a valid drug target and that its function may be inhibited by targeting sites other than the groove where SMRT-related co-repressors bind.
  • BCL-6 As a transcriptional regulator, it is possible that changes in gene expression due to altered BCL-6 function are themselves tumorigenic, and inhibiting BCL-6 may not be able to reverse the effects of these down-stream genes.
  • BCL-6 must homodimerise through its N-terminal POZ domain and recruit co- repressor molecules and histone deacetylases to mediate its effects (Huynh and Bardwell, 1998; Dhordain et al, 1998; Ahmad et al, 2003). We reasoned that disruption of interactions mediated by the POZ domain with small molecules was feasible and likely to result in inhibition of BCL-6 function.
  • Apt48 in 6 different cell lines, that either do not express endogenous BCL-6 (U2os, BCL-I), or express pathological levels of BCL-6 (mouse A20, human Burkitt's lymphoma lines Ramos, Raji and Daudi).
  • U2os cells we show that Apt48 can interact with transfected, over-expressed BCL-6.
  • Apt48 can lead to the de-repression of three genes that are known targets of BCL-6 mediated repression.
  • Apt48 can restore clinically-relevant growth arrest to BCL-6 over-expressing lymphoma cells.
  • the BBD peptide derived from the portion of the SMRT co-repressor that binds to BCL-6 has recently been shown to be able to inhibit BCL-6 function (Polo et al, 2004). It was important to find out whether the mechanism of action of Apt48 involves inhibition of SMRT binding at the site occupied by the BBD peptide. However, when we altered the amino terminal sequences of the random portion of Apt48 to more closely resemble the SMRT sequence, we found that interaction with BCL-6 POZ was lost. Conversely, a mutation in BCL-6 POZ that inhibits the recruitment of the SMRT derived peptide does not inhibit recruitment of Apt48
  • Apt48 may represent a novel mechanism of action where it sterically competes or displaces native interactors required for proper functioning of BCL6.
  • our open-ended approach has led us to identify a new way to interfere with BCL-6 function, distinct from that used by Polo et al (2004).
  • the mechanism of action of Apt48 may advantageously be further studied using the reagents and techniques disclosed herein. It is a possibility that Apt48 may compete for binding with a region of SMRT (or another co-repressor) that makes contact at the top of the molecule. However, although such an interaction has been implied (Melnick et al, 2002), experimental proof for such an interaction is lacking (Ahmad et al, 2003). It is a formal possibility that Apt48 may inhibit DNA binding by full length BCL-6. However, POZ domains have been suggested to inhibit DNA binding by the carboxy-terminal zinc finger domain (Bardwell and Treisman, 1994), so that it
  • the invention defines a novel surface on the BCL6 protein which is a target for repression of its activity.
  • This surface is defined as the second and third strands of anti-parallel ⁇ sheet of BCL6.
  • the surface as defined in the table presented in Figure 2c.
  • the surface of interest on BCL6 is defined with reference to the sequence DILTDVVIVVSREQFRAH. This is a specific tertiary structure within the overall sequence of the POZ-domain of BCL6.
  • the invention relates to use or targetting of this part of BCL6 in the suppression or inhibition of BCL6 activity.
  • the invention relates to the screening or targeting of potential repressors to the surface.
  • the peptides of the invention are discussed with relation to their core unique sequence. In many embodiments, this will be the lOmer unique peptide sequence of the particular peptides and aptamers being discussed.
  • the aptamer is used as a free peptide.
  • peptides of the invention may be fused with a scaffold together with elements used in an interaction trap cloning scheme, such as 2 hybrid scheme.
  • the peptides are fused only to the scaffold protein.
  • the peptides are incorporated into a context of the operator's choice.
  • peptide sequences are given with reference to the core unique sequence, hi many embodiments, these will be flanked by "GP" residues at the N and C terminal. These 2 amino acid residues are generated from the Rsr II cloning site which is used to incorporate the peptide aptamers into the particular vectors for conducting the screening and analysis presented herein.
  • the peptide aptamers comprise N and/or C terminal GP amino acid residues.
  • a lOmer peptide may preferably comprise a core unique sequence of ten amino acids flanked by a GP dimer at each terminus, totalling 14 amino acid residues in length.
  • the invention also relates to nucleic acids encoding the peptides of the invention.
  • nucleic acids are in the form of nucleic acid cassettes.
  • these cassettes comprise a coding sequence for the unique 10 amino acid sequence of the peptide, flanked at each end by an Rsr II site.
  • the nucleic acid will encode 14 amino acids, i.e. a GP followed by the unique peptide aptamer sequence followed by a second GP.
  • the scaffold protein is TrxA (thioredoxin based scaffold protein) or is STM (stefin A based scaffold protein).
  • the peptides of the invention are preferably used as free peptides.
  • the peptides of the invention are preferably used as circularised ring peptides.
  • the invention also embraces mimetics of the peptides disclosed herein, or other chemical equivalents thereof.
  • the peptides of the invention are preferably fused to supplementary peptides or proteins depending on their desired use. For example, it may be desirable to direct to the peptide to B cells or cells of the B cell lineage. In this embodiment, preferably the peptide is fused to the CD 20 ligand. This has a technical benefit of the CD 20 ligand portion of the fusion protein directing the fusion protein to the surface of B cells. In a preferred embodiment, this binding is sufficient to lead to endocytosis and internalising of the aptamer-CD20 ligand fusion protein.
  • the invention advantageously provides a one step targeting and internalisation construct by fusion of the peptide of interest to the CD20 ligand. This can be applied equally to any other suitable ligand.
  • the peptides of the invention are directed into the target cells. This may be accomplished by targeting the peptides to receptors which, upon binding, become internalised thereby accomplishing targeting and internalisation in one convenient step.
  • the peptides may be fused to transduction domains in order to achieve internalisation. Any suitable transduction domain known in the art may be employed for this purpose. Indeed, combinations or multiple transduction domains may be fused to the peptides of interest in order to achieve the desired effect if necessary.
  • the transduction domain would be selected from the classes of HIV tat, Drosophila antennapaedia, VP22 or arginine repeat.
  • the domain comprises at least 8 or 9 consecutive arginine residues.
  • the domain comprises at least 9 consecutive arginine residues.
  • the peptides of the invention are targeted to the nucleus.
  • Such targeting may be direct, for example by use of a nuclear localisation signal, or may be indirect.
  • indirect targeting may include "piggy backing" by binding with a nuclear localised protein in the cytoplasm at the stage of protein synthesis, followed by translocation into the nucleus by association with that binding partner.
  • nuclear localisation is ensured by use of appropriate targeting domain fused to the peptide of interest.
  • An example would be a standard nuclear localisation signal.
  • Preferred peptide amino acid sequences are given in the following table.
  • the capitalised sequence is the sequence of interest.
  • Aptamer 7 has been created by the internal fusion of two individual peptide cassettes. Aptamer 7 has the advantage of being very specific. Aptamer 7 has the advantage of a greater size than the lOmer aptamers disclosed herein.
  • Aptamer 52 is a preferred peptide of the invention.
  • Aptamer 52 shows a relatively non specific binding pattern.
  • aptamer 52 binds the POZ-domain of PLZF, and of BCL-6, and of BACH2. Furthermore, aptamer 52 interacts with CDK4.
  • Aptamer 52 thus has the advantage of targeting many pathways simultaneously.
  • the technical benefit of this feature is that it may offer better therapeutic effect by simultaneously intervening in multiple signalling pathways.
  • Aptamer 58 demonstrates a degree of functional activity. Although this activity is not prominent in the immuno fluorescent experiment shown in figure 3, as will be appreciated by the skilled reader it is difficult to visualise red cells in this type of assay and so the modest activity read out from this assay is not a negative indication of the activity or usefulness of aptamer 58.
  • Aptamer 58 has the advantage of intermediate specificity.
  • Aptamer 58 has the advantage of being a strong binder to BCL6. Furthermore Aptamer 58 has affinity for CDK4. Both of these proteins are clinically relevant targets. Thus, technical advantages associated with aptamer 58 include the opportunity to influence multiple pathways through a single peptide.
  • the preferred peptides of the invention are presented in terms of their amino acid sequence, the skilled reader will appreciate that variations in the amino acid sequence will be possible. By variations is meant substitution, deletion or addition of one or more residues.
  • the resulting peptide should show at least 40% sequence identity to the relevant unique core aptamer sequence disclosed herein, preferably 50%, preferably 60%, preferably 70%, preferably 80%, preferably 90% and most preferably 100% sequence identity.
  • sequence comparison may be taken to mean sequence similarity, taking into account conservative substitutions within the core aptamer sequence.
  • sequence variants of the aptamer peptides disclosed herein should retain the biological function of the reference peptide.
  • the assays for that biological function are set out herein with specific reference to the examples.
  • sequence variant peptides retaining the activity can easily vary the sequence and compare the new peptide sequence with the original peptide sequence in the assays to ensure that activity has been retained.
  • the skilled operator may use error prone PCR to randomise the peptide.
  • the randomised peptides would then be screened in yeast for retention or enhancement of the binding activity.
  • These enhanced or retained binders would be considered biologically active variants of the peptides of the invention.
  • the peptide of interest possesses a D- hydrophobic-C motif.
  • this motive is found as DWC.
  • this motive is found as DYC.
  • a “peptide aptamer” as used herein means a peptide whose amino and/or carboxytermini are anchored in the context of a scaffold protein.
  • an aptamer is a peptide whose amino and carboxytermini are anchored in the context of the scaffold protein. If the phrase "aptamer” is used herein to describe a free peptide, then it will be understood to refer to a peptide having a unique amino acid sequence which was cloned as the corresponding constrained aptamer.
  • the present invention also provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of the peptide(s) of the present invention and a pharmaceutically acceptable carrier, diluent or excipient (including combinations thereof).
  • the pharmaceutical compositions may be for human or animal usage in human and veterinary medicine and will typically comprise any one or more of a pharmaceutically acceptable diluent, carrier, or excipient. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985). The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice.
  • the pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s).
  • Preservatives, stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition.
  • preservatives include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid.
  • Antioxidants and suspending agents may be also used.
  • the pharmaceutical composition of the present invention may be formulated to be administered using a mini-pump or by a mucosal route, for example, as a nasal spray or aerosol for inhalation or ingestable solution, or parenterally in which the composition is formulated by an injectable form, for delivery, by, for example, an intravenous, intramuscular or subcutaneous route.
  • the formulation may be designed to be administered by a number of routes.
  • the agent is to be administered mucosally through the gastrointestinal mucosa, it should be able to remain stable during transit though the gastrointestinal tract; for example, it should be resistant to proteolytic degradation, stable at acid pH and resistant to the detergent effects of bile.
  • compositions can be administered by inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or they can be injected parenterally, for example intravenously, intramuscularly or subcutaneously.
  • compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood.
  • compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner.
  • the agents and/or growth factors of the present invention may also be used in combination with a cyclodextrin.
  • Cyclodextrins are known to form inclusion and non-inclusion complexes with drug molecules. Formation of a drug- cyclodextrin complex may modify the solubility, dissolution rate, bioavailability and/or stability property of a drug molecule. Drug-cyclodextrin complexes are generally useful for most dosage forms and administration routes.
  • the cyclodextrin may be used as an auxiliary additive, e.g. as a carrier, diluent or solubiliser.
  • Alpha-, beta- and gamma- cyclodextrins are most commonly used and suitable examples are described in WO-A- 91/11172, WO-A-94/02518 and WO-A-98/55148.
  • nucleotide sequences encoding said peptide may be delivered by use of non-viral techniques (e.g. by use of liposomes) and/or viral techniques (e.g. by use of retroviral vectors) such that the said peptide is expressed from said nucleotide sequence.
  • the pharmaceutical of the present invention is administered topically.
  • the pharmaceutical is in a form that is suitable for topical delivery.
  • the term "administered” includes delivery by viral or non-viral techniques.
  • Viral delivery mechanisms include but are not limited to adenoviral vectors, adeno-associated viral (AAV) vectors, herpes viral vectors, retroviral vectors, lentiviral vectors, and baculoviral vectors.
  • Non-viral delivery mechanisms include lipid mediated transfection, liposomes, immunoliposomes, lipofectin, cationic facial amphiphiles (CFAs) and combinations thereof.
  • the components of the present invention may be administered alone but will generally be administered as a pharmaceutical composition - e.g. when the components are is in admixture with a suitable pharmaceutical excipient, diluent or carrier selected with regard to the intended route of administration and standard pharmaceutical practice.
  • the components can be administered (e.g. orally or topically) in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed-, modified-, sustained-, pulsed- or controlled- release applications.
  • the tablet may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably com, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose
  • HPMC hydroxypropylcellulose
  • HPC hydroxypropylcellulose
  • sucrose sucrose
  • gelatin gelatin
  • lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included.
  • Solid compositions of a similar type may also be employed as fillers in gelatin capsules.
  • Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols.
  • the agent may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.
  • the routes for administration include, but are not limited to, one or more of: oral (e.g. as a tablet, capsule, or as an ingestable solution), topical, mucosal (e.g. as a nasal spray or aerosol for inhalation), nasal, parenteral (e.g. by an injectable form), gastrointestinal, intraspinal, intraperitoneal, intramuscular, intravenous, intrauterine, intraocular, intradermal, intracranial, intratracheal, intravaginal, intracerebroventricular, intracerebral, subcutaneous, ophthalmic (including intravitreal or intracameral), transdermal, rectal, buccal, vaginal, epidural, sublingual.
  • oral e.g. as a tablet, capsule, or as an ingestable solution
  • mucosal e.g. as a nasal spray or aerosol for inhalation
  • nasal parenteral (e.g. by an injectable form)
  • gastrointestinal intraspinal, intraperitoneal
  • the pharmaceutical composition is delivered topically.
  • a component of the present invention is administered parenterally
  • examples of such administration include one or more of: intravenously, intra-arterially, intraperitoneally, intrathecally, intraventricularly, intraurethrally, intrastemally, intracranially, intramuscularly or subcutaneously administering the component; and/or by using infusion techniques.
  • the component is best used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or glucose to make the solution isotonic with blood.
  • aqueous solutions should be suitably buffered (preferably to a pH of from 3 to 9), if necessary.
  • suitable parenteral formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well-known to those skilled in the art.
  • the component(s) of the present invention can be administered intranasally or by inhalation and is conveniently delivered in the form of a dry powder inhaler or an aerosol spray presentation from a pressurised container, pump, spray or nebuliser with the use of a suitable propellant, e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, a hydrofluoroalkane such as 1,1,1,2-tetrafiuoroethane (HFA 134ATM) or 1,1,1,2,3,3,3-heptafiuoiOpropane (HFA 227EATM), carbon dioxide or other suitable gas.
  • a suitable propellant e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, a hydrofluoroalkane such as 1,1,1,2-tetrafiuoroethane (HFA
  • the dosage unit may be determined by providing a valve to deliver a melered amount.
  • the pressurised container, pump, spray or nebuliser may contain a solution or suspension of the active compound, e.g. using a mixture of ethanol and the propellant as the solvent, which may additionally contain a lubricant, e.g. sorbitan trioleate.
  • a lubricant e.g. sorbitan trioleate.
  • Capsules and cartridges (made, for example, from gelatin) for use in an inhaler or insufflator may be formulated to contain a powder mix of the agent and a suitable powder base such as lactose or starch.
  • the component(s) of the present invention can be administered in the form of a suppository or pessary, or it may be applied topically in the form of a gel, hydrogel, lotion, solution, cream, ointment or dusting powder.
  • the component(s) of the present invention may also be dermally or transdermally administered, for example, by the use of a skin patch. They may also be administered by the pulmonary or rectal routes. They may also be administered by the ocular route.
  • the compounds can be formulated as micronised suspensions in isotonic, pH adjusted, sterile saline, or, preferably, as solutions in isotonic, pH adjusted, sterile saline, optionally in combination with a preservative such as a benzylalkonium chloride.
  • a preservative such as a benzylalkonium chloride.
  • they may be formulated in an ointment such as petrolatum.
  • the component(s) of the present invention can be formulated as a suitable ointment containing the active compound suspended or dissolved in, for example, a mixture with one or more of the following: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water.
  • it can be formulated as a suitable lotion or cream, suspended or dissolved in, for example, a mixture of one or more of the following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid paraffin, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
  • the agent of the present invention may be administered with one or more other pharmaceutically active substances.
  • the present invention covers the simultaneous, or sequential treatments with an agent according to the present invention and one or more steroids, analgesics, anlivirals or other pharmaceutically active substance(s) such as other BCL-6 repressors.
  • Dose Levels typically, a physician will determine the actual dosage which will be most suitable for an individual subject.
  • the specific dose level and frequency of dosage for any particular patient may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the individual undergoing therapy.
  • the agent may be administered at a dose of from 0.01 to 30 mg/kg body weight, such as from 0.1 to 10 mg/kg, more preferably from 0.1 to 1 mg/kg body weight.
  • the component(s) of the present invention may be formulated into a pharmaceutical composition, such as by mixing with one or more of a suitable carrier, diluent or excipient, by using techniques that are known in the art.
  • a suitable carrier such as by mixing with one or more of a suitable carrier, diluent or excipient, by using techniques that are known in the art.
  • the peptide(s) of the present invention may be administered as a pharmaceutically acceptable salt.
  • a pharmaceutically acceptable salt may be readily prepared by using a desired acid or base, as appropriate.
  • the salt may precipitate from solution and be collected by filtration or may be recovered by evaporation of the solvent.
  • treatment includes one or more of curative, palliative and prophylactic treatment.
  • treatment includes at least curative treatment and/or prophylactic treatment.
  • the treatment may be of one or more of those disorders mentioned herein, or related complaint.
  • the agents/modulators identified by the methods of the present invention may be used as therapeutic agents - i.e. in therapy applications.
  • the term “therapy” includes curative effects, alleviation effects, and prophylactic effects.
  • the therapy may be on humans or animals.
  • the therapy can include the treatment of one or more of those disorders mentioned herein, or related complaint.
  • the agents/peptides or compositions of the invention find application in lymphoma such as Burkitt's lymphoma.
  • agents/peptides or compositions of the invention find application in bladder cancer, colorectal cancer, and breast cancer or any other cancer in which Bcl-6 is de-repressed.
  • Aptamer 48 finds application in the increase of p53 expression. Without wishing to be bound by theory, it is believed that this effect is mediated by disruption of BCL-6 repression of the p53 promoter. Ap tamer 48 finds application in the increase of Blimp- 1 expression.
  • Figure 1 Yeast two hybrid interaction matrix for BCL-POZ, related POZ domains and the peptide aptamers isolated in the screen.
  • Panel A POZ domain- containing proteins have previously been shown to interact.
  • Haploid yeast strains carrying either the bait (DNA binding domain fusions to the POZ domains of BACH2, BCL-6b, BCL-6, and PLZF; shown in columns) or the prey (activation domain fusions; shown as rows) were mated by replica plating. Selection for diploid cells from the grid of mating haploid cells gives rise to the pattern of squares in the Figure.
  • the interaction between CDK4 and cyclin D (Cyc D in the Figure) is a positive control for the yeast two hybrid interaction assay.
  • Yeast strains carrying empty bait and prey fusion vectors are indicated by "-" .
  • Panel B the expression of the peptide aptamers and cyclin D prey fusion proteins is induced by galactose present in the growth medium, allowing interactions to be measured by the development of a blue colour following induction of the LacZ reporter gene.
  • Apt48 binds most strongly to the BCL-6 POZ and shows no significant cross-reactivity, while Apt52 and 58 appear to bind to CDK4 as well as to BCL-6 POZ.
  • Apt7/130 is the most specific binder, but does not bind BCL-6 POZ as strongly as Apt48.
  • Panel C BCL-6 and Apt48 can be coimmunoprecipitated from cells.
  • BCL-6 was iramuno-precipitated from whole cell lysates (WCL) with an anti-Flag tag antibody and the immuno-precipiatates (IP) probed with an anti-myc antibody.
  • Lanes 1 and 3 are from cells co-transfected with Apt48 and BCL-6, while lanes 2 and 4 are from cells co-transfected with TrxA and BCL-6. The band marked with an asterisk that appears in the IP lanes is the antibody light chain.
  • Panel D Sequences of the peptide aptamers isolated in the screen.
  • Figure 2 The mechanism of action ofApt48 may not involve displacement of the SMRT co-repressor from BCL-6 POZ.
  • Panel A Sequence alignments of the SMRT BBD sequence that is known to bind to the POZ domain of BCL-6 (top line; Polo et al, 2004), the unique sequence of Apt48 (middle line), the designed version of Apt48 intended to mimic SMRT ("Des": third line) and a sequence for BCL-6 with complementarity to Apt48.
  • pJM-1 expresses E coli thioredoxin and differs from Apt48 and BBD only in not carrying an inserted peptide.
  • Panel C Seven fragments of BCL-6 POZ corresponding to the elements of secondary structure revealed by Ahmad et al (2003) were cloned as yeast two hybrid baits and their interaction with preys consisting of Apt48, the SMRT-BBD peptide aptamer or BCL-6 POZ itself was determined. Fragment 1 interacted with POZ and with BBD, as predicted by the crystal structure, but did not recognise Apt48. Fragment 2 did bind Apt48, and also recognised POZ, but not the BBD. Fragment 3 shows weak interaction with POZ but not with Apt48 or BBD.
  • Fragment 5 was a trans-activating bait whose interaction with POZ was strong enough to be seen above the trans-activation signal, but it was not possible to determine whether there was an interaction with Apt48 or BBD (ND: not determined). Fragments 4, 6 and 7 do not interact with POZ, BBD or Apt48 in this assay.
  • FIG. 3 The expression of Apt48 in cells relieves transcriptional repression.
  • Panel A Ramos cells normally express low levels of CD69, which are undetectable in this immunofluorescent assay and are not increased by expression of thioredoxin (left hand panels). In contrast, cells expressing Apt48 show significant levels of CD69 expression (right hand panels). CD69 expression is shown in red, and thioredoxin or Apt48 protein is shown in green. Nuclear DNA is stained blue, and the three panels are merged in the bottom right hand image of each set.
  • Panel B Ramos cells transfected with thioredoxin or peptide aptamer as above were processed for immunofluorescence and the samples anonymised before being independently counted by two individuals.
  • Panel C Mouse A20 (left hand pair of each set of 4) or human Ramos (right hand pair of bars) transfected with expression constructs for either Apt48 (gray bars) or thioredoxin (black bars) upstream of an internal ribosome entry site and the ORF encoding red fluorescent protein were isolated by flow cytometry, lysed and mRNA levels measured by Real Time-PCR.
  • the mRNA levels for three known BCL-6 target genes show significant increase in cells expressing Apt48 when compared to those expressing empty scaffold (thioredoxin) alone.
  • the increases range form 7 (CD69 in mouse A20 cells) to 15 fold (Blimp- 1 in mouse cells).
  • Apt48 can antagonise BCL-6 mediated gene repression in an exogenous system.
  • the interleukin dependent expression of a firefly luciferase reporter gene in transfected BCLl cells is dependent on Stat3 binding sites, and can be repressed by BCL-6.
  • Each pair of bars shows luciferase activity in the absence (left hand bar) and presence (right hand bar) of interleukins 2 and 5.
  • luciferase activity is induced by interleukin treatment ("vector alone") and this is not impaired by expression of Apt48 ("vector + Apt48").
  • BCL-6 + BCL-6 interleukin mediated induction of luciferase
  • Apt48 is also expressed, in which case mterleukin-mediated induction of luciferase is restored
  • BCL-6 + Apt48 Figure 5.
  • Apt48 reverses BCL-6 mediated resistance to cytokine mediated growth arrest in BCLl cells.
  • Panels A and B The growth of BCLl cells expressing either GFP alone ( ⁇ ) or GFP and BCL-6, GFP and BCL-6 and TrxA , or GFP and BCL-6 and Apt48, was measured over three days in the absence (panel A) and presence (panel B) of interleuldn 2 and 5.
  • FIG. 7 shows electrophoretic mobility shift assay showing that the binding of proteins in cell extracts to either a highly specific BCL-6 binding site (Ie STAT6, left hand lanes) or the more generic BCL-6 binding oligonucleotide (B6BS, right hand lanes) is not affected by expression of Apt48, the empty scaffold (Trx) or the irrelevant GFP.
  • B6BS highly specific BCL-6 binding site
  • B6BS more generic BCL-6 binding oligonucleotide
  • Figure 8 shows chromatin immuno-precipitation and quantitative RT-PCR of promoters normally repressed by Bcl-6.
  • Purple bars indicate the relative levels of mRNA expressed from each of the BCL-6, cyclin D2 (Ccd2), Blimp- 1 and p53 promoters given as the ratio from cells expressing Apt48 to levels in cells expressing the empty thioredoxin scaffold.
  • a value of 1 indicates no change. Ratios indicating an increase over 1 are not deemed significant unless they exceed 2, as is the case for Blimp- 1.
  • the levels of BCL-6 (blue bars) protein present at each promoter do not change in cells expressing Apt48.
  • N-CoR (maroon bars) recruitment to the promoters is similarly unaffected, except in the case of the Blimp- 1 promoter, were its level appears to decrease by more than half in cells expressing Apt48.
  • MT A3 levels generally decrease at promoters where expression is increased (ie all promoters tested except that for the cycliii D2 gene), although neither change was statistically significant. No consistent changes in Sin3A (light blue bars) were noted.
  • Figure 9 shows co-immunoprecipitation of MT A3 with anti-BCL6 antibodies is decreased in cells expressing Apt48.
  • Nuclear extracts were prepared from Ramos cells expressing empty scaffold protein (Trx) or Apt48.
  • Figure 10 shows a yeast two hybrid interaction matrix showing that mutation of aspartic acid residue at position 33 of the BCL-6 POZ/BTB domain abolishes interaction with both Apt48 (A48) and the BPI inhibitor peptide in the context of thioredoxin, although the POZ domain still folds correctly as judged by its ability to homodimerise.
  • the pPM-l vector expresses thioredoxin alone, showing no interaction between the empty scaffold and the POZ domain of Bcl-6.
  • Figure 11 shows upregulation of cell cycle proteins following viral infection.
  • the coding sequence of peptide aptamer number 48 from the screen (Apt 48) including the full coding sequence of E. coli thioredoxin A (TrxA) was PCR- amplified from the peptide aptamer prey vector pJM-1 (Colas et al, 1996) using a 5' primer containing a EcoRI restriction site (5'- GGAATTCC ACC ATGGCT A- GCGATAAAATTATTCAC) and a 3' primer containing a Xbal site (5 1 - GCTCTAGAGCGGC-AGGTTAGCGTC) and cloned into EcoRI and Xbal digested pCDNA3.1B myc/his + (Invitrogen).
  • Apt48 and TrxA coding sequences were PCR-amplified using a 5' primer containing a EcoRI site (5' - GGAATTCCACC-ATGGCTAGCGATAAAATTATTCAC) and a 3' primer containing a SacII site (5'-TCCCCGCGG-GGACTAGGCCAGGTTAGCGTCGAG) and cloned into EcoRI and Sacll digested pIR ⁇ S-DsRed2 (Clontech).
  • Ramos, Raji and Daudi cells are BCL-6 expressing human Burkitt's lymphoma lines.
  • A20 cells are BCL-6 over- expressing mouse cells. All tissue culture media and supplements were from Gibco-BRL (Paisley, UK). 2- mercaptoethanol was from BDH (Poole, UK).
  • Ramos, Raji, Daudi and A20 cell lines were maintained in RPMI 1640 media supplemented with 10% fetal calf serum (FCS) (HyClone) and penicillin (100 U/mL) /streptomycin (100 ⁇ g/mL) (pen/strep, final concentrations).
  • FCS fetal calf serum
  • penicillin 100 U/mL
  • streptomycin 100 ⁇ g/mL
  • BCLl cells were cultured in RPMI 1640 with 15% FCS, 10 niM HEPES, 50 ⁇ M 2-mercaptoethanol and pen/strep. U2os cells were maintained in D-MEM supplemented with 10% FCS. Transient transfection and immunofluorescence.
  • Ramos cells were transfected with expression plasmids using the Nucleofector (Amaxa, Cologne, Germany) following the manufacturer's instructions. After overnight culture, transfected cells were seeded on poly-L-lysine coated cover slips and fixed using 4% paraformaldehyde for 20 min at room temperature, washed three times with phosphate-buffered saline (PBS) containing 1% bovine-serum albumin (BSA), permeabilised for 30 min with 0.2% saponin in 1% BSA-PBS, blocked for 1 hr with 10% normal goat serum, and incubated overnight at 4°C with primary antibodies.
  • PBS phosphate-buffered saline
  • BSA bovine-serum albumin
  • CD69 expression was visualized directly using allophycocyanin (APC) conjugated a-CD69 antibody (BD Biosciences, Cowley, UK) while peptide aptamer expression was visualised using a -TrxA primary antibody (Sigma, Poole, UK) with fluorescein isothiocyanate conjugated goat anti rabbit secondary (Alexa 488, Molecular Probes, Paisley UK). Nuclear DNA was visualised with DAPI (4',6' ⁇ diamidino-2-phenylindole). Coverslips were mounted using Vectashield (Vectorlabs, Peterborough, UK). The cells were examined by confocal laser-scanning microscopy (Zeiss LSM 510).
  • Cell lines were transfected with peptide aptamers or empty thioredoxin scaffold expressed from mammalian expression vectors upstream of an IRES site and RFP.
  • 5 ⁇ g of plasmid DNA was transfected by means of a Nucleofector, Kit T (Amaxa) using programmes 0-17 for BCLl and Ramos, and T-16 for A20 cells. After 24 hours, cells expressing RFP were collected by FACS for extraction of RNA and production of cDNA (Qiagen).
  • Primers used were as follows: CD69 forward 5TATAACGGAAAATAGCTCTTCACATCT; CD69 reverse 5 'TGATT AGCTTC ATTTTTC AGCCC AAT; Blimp- 1 forward 5TGGACATGGAGGACGCTGATATG; Blimp-1 reverse 5' GCGCATCC AGTTGCTTTTCTCCTC A; CyclinD2 forward 5'GCGTGGGAGCAGCCATCTGT; CycliiiD2 reverse 5'AGGTCAACATCCCGCACGTCTG.
  • Actin was used as a loading control for the mouse A20 cells and GAPDH for the human cells.
  • the mouse actin forward primer was
  • cells were cultured in complete medium without other additives and, in the case of BCLl cells, in medium containing interleukins 2 and 5 for up to 3 days.
  • Example 1 Yeast two hybrid analysis of POZ domain interactions
  • Apt58 did not show a strong activity in our first functional assay (see below).
  • Apt48 shows the highest apparent affinity in this assay, approximating the apparent strength of interaction between BCL-6 POZ monomers (compare Figure IA and IB.
  • Such a comparison is possible because we transform equal amounts of plasmid into yeast in each experiment, and always include standard controls, such as the androgen receptor and the naturally dimerizing Cyclin D and CDK4, which allows us to compare signal intensities between plates.
  • the crystal structure of the POZ domain of BCL-6 bound to a peptide derived from the SMRT co-repressor show at least two distinct BCL-6 surfaces that may be susceptible to manipulation (Ahmad et al, 2003). One of these allows the dimerisation of BCL-6 POZ, and the other allows interaction with a relatively small surface of the co- repressor. Melnick et al (2002) have suggested the existence of a third surface that forms a charged pocket whose integrity is required for BCL-6 function, but no interaction at this surface has been demonstrated unequivocally. We wished to find out whether Apt48 binds to POZ in the same manner as SMRT.
  • Fragment 3 (a2 and a3), which interacts with the opposing monomer in the structure, also provides supporting interactions for BBD binding in the structure.
  • Fragment 1 and 3 did not interact with Apt48. Consistent with this, the N21K mutation that maps in fragment 1 does not inhibit binding of A ⁇ t48 ( Figure 2B).
  • Figure 2C Fragments 4 ((34), 6 (P3 J ⁇ and a5)) and 7 (a6) did not interact with POZ, BBD or Apt48 ( Figure 2C). Contrary to expectations, we observed interactions between POZ and fragments 2 ((32 and (33) and 5 (a4).
  • Fragment 2 was also able to interact with Apt48, but not BBD. Because fragment 2 is the only one that is able to interact with Apt48 in this assay, we conclude that fragment 2 is necessary and may be sufficient for Apt48 binding to POZ. In the structure, this fragment lies at the top of the monomer and contributes to the formation of the charged pocket identified by Melnick et al (2002), whereas the SMRT peptide binds in a groove at the opposite surface (Ahmad et al, 2003).
  • Apt48 promotes the expression of diferentiation markers in BCL-6 expressing B cell lines.
  • BCL-6 expression has been suggested to inhibit the terminal differentiation of B cells (Reljic et al, 2000).
  • BCL-6 inhibition experiments suggest that BCL-6 functionally down-regulates the expression of a range of genes including CD69, CD44, BLIMP-I and cyclin-D2 (Shaffer et al, 2000).
  • CD69 is a cell-surface protein and performed FACS analysis of Ramos cells stained with APC-labelled anti-CD69 antibodies after transfection with Apt48 or control plasmids.
  • Blimp- 1 and cyclin D2 (Shaffer et al, 2000; Reljic et al, 2000) using both Ramos cells as before and A20 cells, derived from a mouse B-cell lymphoma, that express BCL-6 as well as activation induced deaminase (AID) and surface IgG and thus have many of the characteristics of germinal centre cells.
  • AID activation induced deaminase
  • surface IgG surface IgG
  • Example 4 Apt48 functionally antagonises BCL-6 activity in a cell model of transcriptional repression
  • BCL-6 in these cells is able to repress the interleukin 2/5 dependent expression of a luciferase reporter gene regulated by STAT3 binding sites (Reljic et al, 2000). Accordingly, we co-transfected cells with reporter constructs and combinations of
  • BCL-6 and Apt48 or empty vectors Figure 4
  • Cells lacking BCL-6 show a 2.5 fold up-regulation of luciferase activity when challenged with interleukins 2 and 5, regardless of whether or not they express Apt48, confirming that any effects of
  • BCL-6 BCL-6 mediated repression of reporter gene induction is reversed by co-expression of Apt48, indicating that this peptide aptamer is able to inhibit BCL-6 function in this system.
  • BCL-6 expression correlates with the proliferation of undifferentiated B cells in germinal centres, and BCL-6 expression has been suggested to inhibit terminal differentiation of B cells (Shaffer et al, 2000).
  • a key test for our peptide aptan ⁇ ers was therefore that it be able to confer on BCL-6 expressing, proliferating B cells the ability to growth arrest in response to cytokines.
  • BCL-6 is a transcriptional repressor that regulates B cell differentiation, and whose over-expression leads to abnormal proliferation and lymphoma. BCL-6 may play a role in breast cancer, as it is expressed in high grade lesions. We have identified a peptide aptamer inhibitor of BCL-6, called Apt48.
  • BCL-6 over-expressing cells de-represses BCL-6 target genes such as CD69, cyclin D2 and Blimp- 1; (ii) prevents BCL-6 mediated repression of a luciferase reporter gene controlled by cytokine-inducible operators and (iii) prevents the proliferation of a variety of tumour-derived BCL-6 over-expressing cell lines, including MYC-over- expressing Burkitt's lymphoma lines.
  • Bcl-6 de-repression by loss of a specific microRNA has been implicated in bladder cancer, as well as colorectal cancer. Because Bcl-6 has been shown to repress p53 expression and antagonise p53 function by inhibiting its target proteins, including p21 in B cells, up-regulation of Bcl-6 in any cell, including non-B cells, may be a key step on the path to tumourigenesis.
  • Apt48 is a BCL-6 inhibitor. Another, called BPI, appears to inhibit BCL-6 activity at promoters involved in the regulation of cell proliferation, whereas Apt48 appears to promote the expression of genes that promote B cell differentiation, notably in de-repressing the expression of Blimp 1.
  • BPI BCL-6 inhibitor
  • the effects of Apt48 mirror those of a dominant negative Bcl-6 mutant that lacks the DNA binding domain.
  • Apt48 destabilises Bcl-6.
  • Bcl-6 is known to be degraded via ubiquitin-mediated proteolysis, but we have found no evidence that Apt48 destabilises Bcl-6.
  • Apt48 inhibits Bcl-6 binding to DNA.
  • the Ie binding site is highly specific for STAT6 and Bcl-6, and hence only a small proportion of the oligonucleotide is shifted in the EMSA.
  • the B6BS binding site is much less specific, as shown by the large fraction that is shifted by proteins recruited from cell lysates (these proteins are likely to comprise a range of STATs as well as Bcl-6). Most importantly, in neither case did TrxA or Apt48 expression prevent the shift, indicating that Apt48 does not prevent direct binding of Bcl-6 to DNA.
  • the invention facilitates a crystal structure of an Apt48/BCL-6 POZ complex, such as via the expression of these proteins in E. coli.
  • Apt48 may be applied directly in colorectal cancer.
  • the technical advantage of this is that the lower intestine is poorly served with lymphatics, so is not under the most rigorous surveillance by the immune system.
  • a protein of bacterial origin such as thioredoxin may not be immunogenic in such an environment, or at least would not trigger an immune response, and could thus advantageously be applied directly to colorectal tumours.
  • thioredoxin is a protein from E. coli, which is part of the intestinal flora, the peptide aptamer may not be recognised by the immune system, thereby avoiding or ameliorating problems associated with immune reduction of the therapeutic.
  • Apt48 appears to completely eliminate transfected HCTl 16 colorectal cancer cells. This result is at least as compelling as the demonstrations with B cells. Thus, it is shown that Apt48 may itself be administered as a therapeutic.
  • Example 11 Further application to non-B-ceil derived cancers
  • C33A lysates of two cervical carcinoma cell lines (C33A, and Wl 2 at early- plO- and late -p33- passage) were subject to SDS-PAGE and western blotting to probe for the expression of actin (loading control), the two key cyclin-dependent protein kinases CDK2 and CDK4, and the transcriptional repressor BCL-6, hitherto believed to be important only in B cells.
  • C33A cells are not infected with virus, and express low levels of CDK2, but undetectable levels of CDK4 or BCL-6.
  • HPV infected (but non-carcinogenic) W12plO cells show induced expression of both CDK4 and BCL-6, as well as increased expression of CDK2 compared to C33A cells. All three proteins appear to be still further up-regulated by passage 33 in W12 cells, where the virus has integrated into the genome and thus caused the cells to become carcinogenic.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne un polypeptide comprenant au moins six résidus d'acide aminé contigus à la séquence d'acides aminés d'un ou plusieurs parmi (i) HGPRDWCLFG, (ii) GGDYCCLRYV, (iii) WGGVMLVTWP, (iv) VRGYGASLLLGPPISAV ou (v) une séquence d'acides aminés ayant au moins 70 % d'identité avec une séquence de (i) à (iv) sur la longueur totale de ladite séquence. L'invention concerne en outre des utilisations du peptide pour l'expression génétique, l'inhibition de BCL-6 et en médecine.
PCT/GB2006/004231 2005-11-18 2006-11-13 Inhibiteurs de bcl-6 WO2007057648A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US73795405P 2005-11-18 2005-11-18
US60/737,954 2005-11-18

Publications (1)

Publication Number Publication Date
WO2007057648A1 true WO2007057648A1 (fr) 2007-05-24

Family

ID=37663252

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2006/004231 WO2007057648A1 (fr) 2005-11-18 2006-11-13 Inhibiteurs de bcl-6

Country Status (1)

Country Link
WO (1) WO2007057648A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015143228A1 (fr) * 2014-03-19 2015-09-24 The University Of North Carolina At Chapel Hill Expression du bcl6 dans l'endomètre eutopique comme marqueur pour l'endométriose et la sous-fertilité
US11474105B2 (en) 2016-03-31 2022-10-18 The University Of North Carolina At Chapel Hill Methods and compositions for SIRT1 expression as a marker for endometriosis and subfertility

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001029057A1 (fr) * 1999-10-15 2001-04-26 Isis Pharmaceuticals, Inc. Modulation antisens de l'expression de bcl-6
US6699703B1 (en) * 1997-07-02 2004-03-02 Genome Therapeutics Corporation Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
US20040214272A1 (en) * 1999-05-06 2004-10-28 La Rosa Thomas J Nucleic acid molecules and other molecules associated with plants
WO2005052139A2 (fr) * 2003-11-19 2005-06-09 The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Methode permettant d'induire le developpement et la differenciation terminale des lymphocytes b memoire
WO2005092030A2 (fr) * 2004-03-22 2005-10-06 The Trustees Of The University Of Pennsylvania Procedes d'utilisation de nucleotides derives de bcl-6 visant a induire l'apoptose

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6699703B1 (en) * 1997-07-02 2004-03-02 Genome Therapeutics Corporation Nucleic acid and amino acid sequences relating to Streptococcus pneumoniae for diagnostics and therapeutics
US20040214272A1 (en) * 1999-05-06 2004-10-28 La Rosa Thomas J Nucleic acid molecules and other molecules associated with plants
WO2001029057A1 (fr) * 1999-10-15 2001-04-26 Isis Pharmaceuticals, Inc. Modulation antisens de l'expression de bcl-6
WO2005052139A2 (fr) * 2003-11-19 2005-06-09 The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Methode permettant d'induire le developpement et la differenciation terminale des lymphocytes b memoire
WO2005092030A2 (fr) * 2004-03-22 2005-10-06 The Trustees Of The University Of Pennsylvania Procedes d'utilisation de nucleotides derives de bcl-6 visant a induire l'apoptose

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
CERCHIETTI LCA ET AL.: "BCL6, p53 and molecular targeted therapy in B-cell lymphomas", BLOOD, vol. 106, no. 11-Part1, 16 November 2005 (2005-11-16), pages 427A - 428A, XP002416612, ISSN: 0006-4971 *
CHATTOPADHYAY A ET AL.: "A peptide aptamer to antagonize BCL-6 function", ONCOGENE, vol. 25, 5 December 2005 (2005-12-05), pages 2223 - 2233, XP002416614 *
DATABASE NCBI [online] 1 November 1997 (1997-11-01), XP002416620, retrieved from SWISSPROT accession no. P80576 Database accession no. P80576 *
DATABASE USPTO United States Patent and Trademark Office; "US20040214272", XP002416619 *
DATABASE USPTO United States Patent and Trademark Office; "US6699703", XP002416621 *
GALAGAN JE ET AL.: "The genome sequence of the filamentous fungus Neurospora crassa", NATURE, vol. 422, 2003, pages 859 - 868, XP002504380, DOI: doi:10.1038/nature01554 *
POLO JM ET AL.: "Specific peptide interference reveals BCL6 transcriptional and oncogenic mechanisms in B-cell lymphoma cells", NATURE MEDICINE, vol. 10, no. 12, 7 November 2004 (2004-11-07), pages 1329 - 1335, XP002416611 *
SICHTING M ET AL.: "Pex7p and Pex20p of Neurospora crassa Function Together in PTS2-dependent Protein Import into Peroxisomes", MOLECULAR BIOLOGY OF THE CELL, vol. 14, February 2003 (2003-02-01), pages 810 - 821, XP002416613 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015143228A1 (fr) * 2014-03-19 2015-09-24 The University Of North Carolina At Chapel Hill Expression du bcl6 dans l'endomètre eutopique comme marqueur pour l'endométriose et la sous-fertilité
US10234465B2 (en) 2014-03-19 2019-03-19 The University Of North Carolina At Chapel Hill BCL6 expression in eutopic endometrium as a marker for endometriosis and subfertility
US11474105B2 (en) 2016-03-31 2022-10-18 The University Of North Carolina At Chapel Hill Methods and compositions for SIRT1 expression as a marker for endometriosis and subfertility

Similar Documents

Publication Publication Date Title
Huynh et al. The BCL-6 POZ domain and other POZ domains interact with the co-repressors N-CoR and SMRT
Bex et al. Differential transcriptional activation by human T-cell leukemia virus type 1 Tax mutants is mediated by distinct interactions with CREB binding protein and p300
KR101749204B1 (ko) 올리고펩타이드 화합물 및 이의 용도
Jiao et al. Growth suppression and radiosensitivity increase by HMGB1 in breast cancer 1
RU2693487C2 (ru) Пептиды, способные реактивировать мутанты р53
US8658611B2 (en) Apoptosis-inducing agent for prostate cancer cells
Sung et al. Role of the SUMO-interacting motif in HIPK2 targeting to the PML nuclear bodies and regulation of p53
Chattopadhyay et al. A peptide aptamer to antagonize BCL-6 function
JP2022031646A (ja) Ａｔｆ５ペプチド多様体及びそれらの使用
KR100565819B1 (ko) 신호 전달 단백질과 ｇｌｇｆ（ｐｄｚ／ｄｈｒ）도메인간의 상호작용을 저해하는 조성물과 상기 조성물의 용도
Zhao et al. The lim domain protein fhl1c interacts with tight junction protein zo-1 contributing to the epithelial–mesenchymal transition (emt) of a breast adenocarcinoma cell line
Mattock et al. Inhibition of cell proliferation by the PCNA-binding region of p21 expressed as a GFP miniprotein
US8822420B2 (en) Peptides and aptamers thereof as specific modulators of mutant p53 function
US9683025B2 (en) Methods and compositions for treating cancer and inflammatory diseases
Wilson et al. Binding of HTLV-1 tax oncoprotein to the precursor of interleukin-16, a T cell PDZ domain-containing protein
Ou et al. The critical protein interactions and structures that elicit growth deregulation in cancer and viral replication
WO2007057648A1 (fr) Inhibiteurs de bcl-6
Lu et al. Transduction of recombinant M3-p53-R12 protein enhances human leukemia cell apoptosis
Shah et al. Adenovirus RIDα regulates endosome maturation by mimicking GTP-Rab7
AU736210B2 (en) Brca1 compositions and methods for the diagnosis and treatment of breast cancer
Hovemann et al. The protein Hrb57A of Drosophila melanogaster closely related to hnRNP K from vertebrates is present at sites active in transcription and coprecipitates with four RNA-binding proteins
JP2023520864A (ja) Ｖｇｌｌ１ペプチドを含む癌治療用組成物
Sahu et al. Epstein–Barr virus nuclear antigen 3C interact with p73: Interplay between a viral oncoprotein and cellular tumor suppressor
US20030148954A1 (en) Agents and methods for modulating activator protein-1-mediated cellular processes
US8362205B2 (en) Delocalization molecules and use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06808523

Country of ref document: EP

Kind code of ref document: A1